- Email: [email protected]
PDGFR in Tumor Vasculature
[47]
597
sorafenib
Qiu, R. G., Chen, J., Kirn, D., McCormick, F., and Symons, M. (1995a). An essential role for Rac in Ras transformation. Nature 374, 457–459. Qiu, R. G., Chen, J., McCormick, F., and Symons, M. (1995b). A role for Rho in Ras transformation. Proc. Natl. Acad. Sci. USA 92, 11781–11785. Rotblat, B., Niv, H., Andre, S., Kaltner, H., Gabius, H. J., and Kloog, Y. (2004). Galectin‐1 (L11A) predicted from a computed galectin‐1 farnesyl‐binding pocket selectively inhibits Ras‐GTP. Cancer Res. 64, 3112–3118. Sebti, S. M., and Der, C. J. (2003). Opinion: Searching for the elusive targets of farnesyltransferase inhibitors. Nat. Rev. Cancer 3, 945–951. Sebti, S. M., and Hamilton, A. D. (2000). Farnesyltransferase and geranylgeranyltransferase I inhibitors and cancer therapy: Lessons from mechanism and bench‐to‐bedside translational studies. Oncogene 19, 6584–6593. Tao, W., Pennica, D., Xu, L., Kalejta, R. F., and Levine, A. J. (2001). Wrch‐1, a novel member of the Rho gene family that is regulated by Wnt‐1. Genes Dev. 15, 1796–1807. Whyte, D. B., Kirschmeier, P., Hockenberry, T. N., Nunez‐Oliva, I., James, L., Catino, J. J., Bishop, W. R., and Pai, J. K. (1997). K‐ and N‐Ras are geranylgeranylated in cells treated with farnesyl protein transferase inhibitors. J. Biol. Chem. 272, 14459–14464.
[47] Sorafenib (BAY 43‐9006, Nexavarw), a Dual‐Action Inhibitor That Targets RAF/MEK/ERK Pathway in Tumor Cells and Tyrosine Kinases VEGFR/PDGFR in Tumor Vasculature By LILA ADNANE, PAMELA A. TRAIL, IAN TAYLOR , and SCOTT M. WILHELM Abstract
Activating mutations in Ras and B‐RAF were identified in several human cancers. In addition, several receptor tyrosine kinases, acting upstream of Ras, were found either mutated or overexpressed in human tumors. Because oncogenic activation of the Ras/RAF pathway may lead to a sustained proliferative signal resulting in tumor growth and progression, inhibition of this pathway represents an attractive approach for cancer drug discovery. A novel class of biaryl urea that inhibits C‐RAF kinase was discovered using a combination of medicinal and combinatorial chemistry approaches. This effort culminated in the identification of the clinical candidate BAY 43‐9006 (Sorafenib, Nexavarw), which has recently been approved by the FDA for advanced renal cell carcinoma in phase III clinical trials. Sorafenib inhibited the kinase activity of both C‐RAF and B‐RAF (wild type and V600E mutant). It inhibited MEK and ERK METHODS IN ENZYMOLOGY, VOL. 407 Copyright 2006, Elsevier Inc. All rights reserved.
0076-6879/06 $35.00 DOI: 10.1016/S0076-6879(05)07047-3
598
regulators and effectors of small GTPases: Ras family
[47]
phosphorylation in various cancer cell lines and tumor xenografts and exhibited potent oral antitumor activity in a broad spectrum of human tumor xenograft models. Further characterization of sorafenib revealed that this molecule was a multikinase inhibitor that targeted the vascular endothelial growth factor receptor family (VEGFR‐2 and VEGFR‐3) and platelet‐derived growth factor receptor family (PDGFR‐ and Kit), which play key roles in tumor progression and angiogenesis. Thus, sorafenib may inhibit tumor growth by a dual mechanism, acting either directly on the tumor (through inhibition of Raf and Kit signaling) and/or on tumor angiogenesis (through inhibition of VEGFR and PDGFR signaling). In phase I and phase II clinical trials, sorafenib showed limited side effects and, more importantly, disease stabilization. This agent is currently being evaluated in phase III clinical trials in renal cell and hepatocellular carcinomas. Introduction
Several growth factors, cytokines, and proto‐oncogenes transduce their signals through the Ras/RAF/MEK/ERK signaling pathway (Marais and Marshall, 1996; Repasky et al., 2004). This pathway is an important mediator of tumor cell proliferation, survival, and differentiation and is also central to tumor angiogenesis. Alteration of the Ras/RAF pathway was shown to contribute to the pathogenesis and progression of human cancers, making the components of this signaling cascade attractive as therapeutic targets. Overexpression or mutation of cell‐surface tyrosine kinase receptors and mutation of downstream effectors, such as Ras and B‐RAF, results in constitutive activation of the RAF pathway. Ras‐activating mutations were found in approximately 50% of colon carcinomas, 30% of lung carcinomas, 80% of pancreatic carcinomas, and 20% of various hematopoietic malignancies (Minamoto et al., 2000). Moreover, the Ras pathway is often constitutively activated by many receptor tyrosine kinases, such as those for the epidermal, platelet‐derived, or vascular‐endothelial growth factors. Thus, most human tumors, not just those with Ras mutations, exploit the Ras signal transduction pathway as a means to achieve continuous cellular proliferation and survival. Moreover, a downstream effector of Ras, B‐RAF, was shown to be mutated in 30% of low‐grade ovarian cancers (Singer et al., 2003), 35–70% of papillary thyroid cancers (Cohen et al., 2003; Kimura et al., 2003; Nikiforova et al., 2003), 10–15% of colorectal cancers (Davies et al., 2002; Rajagopalan et al., 2002; Yuen et al., 2002), and 70% of malignant melanomas (Brose et al., 2002; Davies et al., 2002; Pollock et al., 2003; Yazdi et al., 2003). Approximately 90% of these mutations occur in the activation region of the kinase domain as a single‐ base substitution that converts a valine to glutamic acid at codon 600
[47]
sorafenib
599
(V600EB‐RAF) (Davies et al., 2002). This mutation causes activation of B‐RAF kinase and, thus, constitutive stimulation of MEK/ERK pathway independent of any upstream activating signal. A number of studies have suggested that inhibitors of the RAF pathway could have significant clinical benefit in the treatment of human cancers (Kolch, 2002). For instance, dominant‐negative mutants of RAF, MEK, or ERK significantly reduced the transforming ability of mutant Ras in rodent fibroblasts (Arboleda et al., 2001). Moreover, human tumor cell lines expressing a dominant negative MEK were deficient in their ability to grow under both anchorage‐dependent and anchorage‐independent conditions (Arboleda et al., 2001). These mutants inhibited both the primary and metastatic growth of human tumor xenografts (Arboleda et al., 2001). Additional evidence supporting the relevance of therapeutically targeting RAF comes from work with ISIS 5132, a RAF antisense oligonucleotide (Monia et al., 1996). ISIS 5132, a C‐RAF phosphorothioate antisense oligonucleotide (TCCCGCCTGTGACATGCATT) designed to target the 3‐prime UTR of the C‐RAF message, was found to inhibit the growth of human lung, breast, bladder, and colon tumor xenografts. Finally, reduction of V600EB‐RAF activity by SiRNA in melanoma xenograft tumors prevented vascular development because of decreased VEGF secretion and, subsequently, increasing apoptosis in tumors (Sharma et al., 2005). Small molecules that inhibit RAF or MEK kinases have been identified and are being evaluated in the clinic (Sebolt‐Leopold and Herrera, 2004; Strumberg and Seeber, 2005). Investigators at Pfizer discovered CI‐1040, a small molecule, non‐ATP competitive, allosteric MEK inhibitor. CI‐1040 was shown to inhibit ERK phosphorylation in a panel of cancer cell lines and tumor growth in xenograft models (Allen et al., 2003). Optimization efforts led to the discovery of a second‐generation compound, PD‐0325901, which recently entered phase I clinical trials. Sorafenib, which is a proprietary compound of Bayer Pharmaceuticals Corporation and is being jointly developed by Bayer and Onyx Pharmaceuticals, is an orally active multikinase inhibitor that inhibits the serine/threonine kinases, C‐RAF and B‐RAF (wild type and V600E mutant), and tyrosine kinases of the vascular‐endothelial growth factor receptor (VEGFR‐2 and VEGFR‐3) and platelet‐derived growth factor receptor (PDGFR‐ and c‐Kit) families (Wilhelm et al., 2004). Sorafenib may inhibit tumor growth by combining two anticancer activities: inhibition of tumor cell proliferation and survival (through C‐RAF and B‐RAF) and tumor angiogenesis (through VEGFR and PDGFR). Sorafenib was discovered after an extensive structure– activity relationship optimization effort that started with a weak micromolar hit from high‐throughput screen (HTS) (Lowinger et al., 2002; Lyons et al., 2001). HTS hits were confirmed in a biochemical assay and active
600
regulators and effectors of small GTPases: Ras family
[47]
compounds (IC50 < 100 nM) were tested in both a mechanistic cellular assay, which measured the level of the phosphorylated form of MEK, and a functional assay, which measured tumor cell proliferation. Sorafenib is currently being evaluated in clinical trials, including phase III trials in renal cell (RCC) and hepatocellular (HCC) carcinomas. Materials and Methods
Preparation of Sorafenib The chemical name of Sorafenib is (N‐(3‐trifluoromethyl‐4‐chlorophenyl)‐N‐(4‐(2‐methylcarbamoyl pyridin‐4‐yl)oxyphenyl)urea), and the structural formula is shown in Table I. Sorafenib is dissolved in DMSO for in vitro experiments. Cell Lines, Reagents, and Western Blot Analysis The MDA‐MB‐231 human mammary adenocarcinoma cell line was obtained from the National Cancer Institute. All the other cell lines were purchased from the American Type Culture Collection (ATCC). Cell lines were maintained in DMEM (GIBCO), supplemented with 1% L‐glutamine (GIBCO), 1% HEPES buffer (GIBCO), and 10% heat‐inactivated fetal bovine serum (FBS). Cells were plated at 200,000 cells per well in 12‐well tissue culture plates in growth media and incubated overnight. Media was removed and replaced with DMEM supplemented with 0.1% BSA (Sigma) containing either various concentrations of sorafenib, U0126 (Cell Signaling Technology), or vehicle (DMSO) for 2 h. Cells were washed with cold PBS containing 0.1 mM vanadate and lysed in a 1% Triton X‐100 solution containing protease inhibitors. Lysates were clarified by centrifugation, subjected to SDS‐PAGE, transferred to nitrocellulose membranes, and blocked for 1 h in TBS containing 5% non‐fat dry milk and 1% BSA. Membranes were probed for 1 h with antibodies to pMEK1/2 (ser217/ ser221), MEK1/2, pERK1/2 (thr202/tyr204), ERK1/2, pPKB (ser473), and PKB. The antibodies were purchased from Cell Signaling Technology and were used at a dilution of 1:000. Blots were developed with horseradish peroxidase (HRP)–conjugated secondary antibodies and Amersham ECL reagent on Amersham Hyperfilm. Phospho‐ERK Bio‐Plex Immunoassay A 96‐well immunoassay (BioPlex), using the laser flow cytometry platform of Bio‐Rad, was used to measure the level of pERK1/2 (thr202/ tyr204) in cells. Exponentially growing MDA‐MB231 breast carcinoma and
[47]
601
sorafenib
SORAFENIB INHIBITS RAF
TABLE I RECEPTOR TYROSINE KINASES INVOLVED IN TUMOR ANGIOGENESIS AND
IC50 (nM) SD (n)b Biochemical assaya RAF‐1c B‐RAF wild‐typed V600E B‐RAF mutante VEGFR‐2 mVEGFR‐2 (flk‐1) mVEGR‐3 mPDGFR‐ Flt‐3 c‐KIT FGFR‐1 ERK‐1, MEK‐1, EGFR, HER‐2, IGFR‐1, c‐met, PKB, PKA, cdk1/cyclinB, PKC, PKC, pim‐1 Cellular mechanism f MDA MB 231 MEK phosphorylation (human breast) MDA MB 231 ERK ½ phosphorylation (human breast) BxPC‐3 ERK 1/2 phosphorylation (human pancreatic) LOX ERK 1/2 phosphorylation (human melanoma) VEGFR‐2 phosphorylation (human, 3T3 cells) VEGF‐ERK 1/2 phosphorylation (HUVEC)h mVEGFR3 phosphorylation (mouse, 293 cells) PDGFR‐ phosphorylation (human AoSMC)i Cellular proliferation MDA MB 231 (10% fetal calf serum) VEGF‐HuVECh (2% fetal calf serum) PDGFR‐ß human AoSMCi(0.1% BSA)j a
6 3 (7) 25 6 (7) 38 9 (4) 90 15 (4) 15 6 (4) 20 6 (3) 57 20 (5) 58 20 (3) 68 21 (3) 580 100 (3) >10,000
40 20 (2) 90g 26 (7) 1200g 165 (2) 880g 90 (2) 30 21 (3) 60g 20 (2) 100 80 (2) 80 40 (3) 2600 810 (3) 12 10 (2) 280 140 (5)
Kinase assays were carried out as previously described (Wilhelm et al., 2004) at ATP concentrations at or below Km (1–10 M). b IC50 mean ± standard deviation; (n ¼ number of trials). c Lck activated N‐terminal truncated RAF‐1. d N‐terminal truncated B‐RAF (wild type). e N‐terminal V600E truncated B‐RAF (mutant). f Cellular assays (autophosphorylation and RAF/MEK/ERK pathway) were performed in 0.1% bovine serum albumin using phospho‐specific antibodies or 4G10 for VEGFR‐3 as previously described (Wilhelm et al., 2004). g Activated phospho‐ERK 1/2 was quantitated with phospho‐ERK 1/2 immunoassay (Bio‐ Plex. Bio‐Rad, Inc.). h HUVECs‐human umbilical vein endothelial cells. i Human AoSMCs‐ human aortic smooth muscle cells. j BSA, bovine serum albumin.
602
regulators and effectors of small GTPases: Ras family
[47]
LOX human melanoma cells were seeded at 50,000 cells per well. The next day, the media was changed to serum‐free media containing 0.1% BSA and various concentrations of compounds (serial dilution from 3 M–12 nM). Cells were incubated with the compounds for 2 h. The rest of the assay was performed per manufacturer recommendation for the pERK1/2 Bio‐ Plex assay (cat#171–304004, Bio‐Rad, Hercules, CA). Cells were washed with 100 l of wash buffer A before addition of 80 l of cell lysis buffer. The plate was agitated on a plate shaker at 300 rpm for 30 min at 4 . Cellular debris was pelleted by centrifugation at 4500g for 15 min at 4 ; 45 l of supernatant was diluted with an equal volume of Bio‐Plex phosphoprotein assay buffer B. The diluted lysate was incubated with 2000 of 5 Bio‐Plex beads conjugated with an anti‐ERK1/2 antibody. The beads and lysate mixture was incubated at room temperature (RT) for 15–18 h. The plate was vacuum‐filtered, washed three times, and 25 l of biotinylated pERK1/2 antibody solution was added to each well. The plate was incubated for 30 min at RT. The plate was vacuum‐filtered, washed three times, and 50 l of streptavidin‐PE solution was added. After 10 min incubation at RT, 125 l of resuspension buffer was added, and the relative fluorescence units of pERK1/2 were detected by counting 25 beads with Bio‐Plex flow cell (probe) at high sensitivity (Luminex 100 instrument, Bio‐Rad). Immunohistochemistry Immunohistochemical staining of pERK was performed with a rabbit polyclonal antibody anti‐phospho p44/42MAPK (Thr202/Tyr204) from Cell Signaling Technology that detects the phosphorylated p44 and p42 MAP kinases (pErk1 and pErk2). The antibodies were diluted 1:100 with Dako antibody diluent for use. Slides were deparaffinized and placed in heated citrate buffer for 35 min. They remained in the heated buffer, acclimated to RT for approximately 30 min, and washed in distilled water. Slides were blocked in a 1.5 % hydrogen peroxide solution for 10 min and washed in distilled water. They were washed in PBS and incubated with primary antibody for approximately 30 min. They were rinsed in PBS and incubated for 30 min with a rabbit HRP labeled polymer (DAKO Envision þ Kit). Slides were rinsed in PBS and the DAB substrate chromogen was applied for 5 min. They were washed in water and counterstained with filtered hematoxylin for approximately 20 sec and then washed with warm water. Slides were dehydrated and coverslipped with Permount.
[47]
sorafenib
603
Experimental Results and Discussion
Sorafenib Inhibits MEK and ERK Phosphorylation in Cancer Cells, Independent of K‐Ras and B‐RAF Mutational Status Extracellular stimuli and activating mutations activate Ras, which tether RAF to the plasma membrane, resulting in the stimulation of RAF kinase activity. Activated RAF phosphorylates MEK at two key serine residues (Ser218, Ser222), leading to a strong activation of MEK kinase. Activated MEK1/2 recognize and phosphorylate ERK1/2 on key threonine and tyrosine residues. Phosphorylation at both the threonine (Thr183) and tyrosine (Tyr185) sites on ERK is necessary to induce complete enzyme activation (Kolch et al., 2005). The effect of sorafenib on MEK and ERK activity was determined by incubating cells with various concentrations of sorafenib for 2 h. Cell lysates were analyzed by immunoblotting with antibodies specific for phosphorylated MEK (pMEK), phosphorylated ERK (pERK), and, as control, phosphorylated PKB (pPKB) (Fig. 1). To control for equal protein loading,
FIG. 1. Inhibition of MEK and ERK phosphorylation by sorafenib in MDA‐MB‐231 breast cancer cell line. Cells were incubated with various concentrations of sorafenib, 10 M U0126 (MEK inhibitor) or DMSO (vehicle) for 2 h. Cell lysates were subjected to Western blot analysis for phosphorylated (p) and total MEK (top panel), ERK (middle panel), and PKB (bottom panel).
604
regulators and effectors of small GTPases: Ras family
[47]
the same membranes were reprobed with antibodies to total MEK, ERK, and PKB. U0126, an inhibitor of MEK kinase, was used as positive control (lane 1). A weak RAF inhibitor compound (IC50 > 10 M) of the same chemical class as sorafenib was used as negative control (lanes 8–11). Sorafenib inhibited MEK and ERK phosphorylation in a dose‐dependent manner (lanes 2–7), whereas RAF‐inactive control had no effect (lanes 8– 10). Sorafenib‐mediated inhibition of phosphorylation was specific to MEK and ERK, because it had no effect on PKB. Several human tumor cell lines exhibit high levels of basal pMEK and pERK, either because of K‐Ras or B‐RAF mutation or constitutive activation of growth factor receptors. Sorafenib was effective in inhibiting ERK phosphorylation in most cell lines tested, including those with K‐Ras and B‐RAF mutations (Fig. 2). However, the potency at which sorafenib inhibited ERK phosphorylation varied among cell lines, with EC50 ranging from 90–1200 nM (Fig. 2 and Table I). This result was particularly encouraging, because it holds promise for the potential use of sorafenib in patients with cancer who have B‐RAF and K‐Ras mutations. The concentration of sorafenib necessary to reduce ERK phosphorylation by 50% (pERK EC50) was determined using the phospho‐ERK BioPlex immunoassay (Fig. 3). The pERK EC50 was determined in both the MDA‐ MB‐231 cell line, which expresses B‐RAF (G463V) and K‐Ras (G13D) mutants, and the LOX cell line, which expresses the most predominant
FIG. 2. Sorafenib inhibits ERK phosphorylation in several cancer cell lines, independent of K‐Ras and B‐RAF mutational status. Cells were incubated with various concentrations of sorafenib, 10 M U0126 or DMSO for 2 h. Cell lysates were subjected to Western blot analysis for phosphorylated (p) and total (T) ERK 1/2.
[47]
sorafenib
605
FIG. 3. Determination of pERK EC50 in MDA‐MB‐231 and LOX cells using BioPlex immunoassay. MDA‐MB‐231 breast carcinoma (B) and LOX melanoma (A) cells were incubated with various concentrations of sorafenib or inactive compound control for 2 h. Cell lysates were analyzed using a high‐throughput phospho–ERK BioPlex immunoassay (BioRad), as described in ‘‘Materials and Methods.’’
B‐RAF mutant (V600E). Sorafenib inhibited ERK phosphorylation in both cell lines but, was 10‐fold more potent in the MDA‐MB‐231 cells (EC50 ¼ 90 nM) compared with LOX cells (EC50 ¼ 880 nM). The ability of sorafenib to inhibit V600EB‐RAF mutant was analyzed in additional cancer lines that express this mutant, including melanoma (SKMEL‐28, A2058) and colon (Colo‐205, HT‐29). The results showed a significant inhibition of ERK phosphorylation in V600EB‐RAF mutant lines, demonstrating the ability of this agent to inhibit constitutively activated B‐RAF (Fig. 2 and data not shown). Similar results with sorafenib were recently reported by Sharma et al. (2005), who showed inhibition of MAPK‐signaling cascade and tumor development using V600EB‐RAF–expressing melanoma lines. Furthermore,
606
regulators and effectors of small GTPases: Ras family
[47]
decrease of V600EB‐RAF activity, by either SiRNA or treatment with sorafenib, prevented vascular development because of decreased VEGF secretion and, subsequently, increased apoptosis in melanoma tumors (Sharma et al., 2005). Recently, Karasarides et al. (2004) reported results with sorafenib that showed the inhibition of ERK activity in V600EB‐RAF–expressing melanoma cell lines, A375, Colo829, and WM‐266–4, which resulted in inhibition of DNA synthesis and induction of cell death in all three lines. The in vitro and cellular profile of sorafenib is summarized in Table I. Sorafenib inhibited the activity of C‐RAF, B‐RAF (wild type and V600EB‐ RAF), as well as tyrosine kinases of the VEGFR and PDGFR families, which are key regulators of angiogenesis (Table I). Thus, sorafenib may mediate its antitumor effect by acting on the tumor directly (through inhibition of RAF signaling) and/or tumor angiogenesis (through inhibition of VEGF and PDGF signaling). In vitro, sorafenib had no effect on MEK, ERK, or a limited panel of serine/threonine and tyrosine kinases including the ERBB, IGF1R, and CDK families (Table I). Sorafenib inhibited proliferation of MDA‐MB‐231 tumors cells (EC50 ¼ 2800 nM), as well as PDGF‐ stimulated proliferation of human aortic smooth muscle cells (EC50 ¼ 280 nM) and VEGF‐stimulated proliferation of human endothelial cells (HUVEC) (EC50 ¼ 12 nM) (Table I and Wilhelm et al. [2004]). To our knowledge, sorafenib possesses a unique profile compared with compounds either on the market or in clinical development, targeting both RAF/MEK/ ERK and VEGF/PDGF signaling pathways. The antitumor efficacy of sorafenib, administered as a single agent against established human tumor xenografts in athymic mice, was evaluated in several tumor models (Wilhelm and Chien, 2002; Wilhelm et al., 2004). In each model, sorafenib produced dose‐dependent tumor growth inhibition, and during treatment with a 30‐ to 60‐mg/kg dose, complete tumor stasis in the human ovarian (SK‐OV‐3), the human colon tumor models (HT‐29, Colo‐205, and DLD‐1), and the NSCLC model (A549) was observed (Wilhelm et al., 2004). No correlation was found between sensitivity to sorafenib and K‐Ras or B‐RAF mutational status. Indeed, sorafenib inhibited progression of tumors with wild‐type K‐Ras and B‐RAF, such as SK‐OV‐3, as well as tumors with K‐Ras or B‐RAF mutation, such as DLD‐1, H460, A549, MDA‐MB‐231, Colo‐205, and HT‐29 (Wilhelm et al., 2004). These results show that cells with a constitutively active RAF/MEK/ERK pathway are not necessarily more sensitive or resistant to sorafenib. Antitumor activity in V600EB‐RAF–expressing melanoma xenograft models has been reported by other investigators (Karasarides et al., 2004; Sharma et al., 2005). Sorafenib‐mediated inhibition of V600EB‐RAF activity decreased VEGF secretion and led to inhibition of vascular development and increased apoptosis (Sharma et al., 2005).
[47]
sorafenib
607
In another study, sorafenib‐mediated inhibition of DNA synthesis and induction of cell death correlated with a substantial growth delay in melanoma tumor xenografts (Karasarides et al., 2004). Inhibition of ERK Phosphorylation by Sorafenib in MDA‐MB‐231 Tumors The phosphorylation status of MEK and ERK has provided a useful pharmacodynamic marker for assessing RAF inhibition (Sebolt‐Leopold et al., 2003). Mechanism‐of‐action studies have been carried out in the MDA‐MB‐231 xenograft model after 5 days of daily treatment with sorafenib at 30 mg/kg. The tumors were excised 3 h after the last dose and immunostained for active ERK using an antibody that only binds to phosphorylated, active ERK1 and ERK2, as described in ‘‘Materials and Methods.’’ A substantial reduction in ERK activity was found in tumors from the sorafenib‐treated mice compared with the vehicle‐treated and untreated controls (Fig. 4). Very low pERK staining was localized at the rim of the tumor, but no staining was observed in the central region, which was mainly necrotic (Fig. 4). In the clinic, the phosphorylation status of ERK in tumors from patients has been evaluated in some cases. A sample of a tumor biopsy from a patient with melanoma before and after treatment with sorafenib is shown in Fig. 5. The tumor biopsy showed moderate to strong pERK staining (76–100% of nuclei stained) before sorafenib treatment (Fig. 5A and B). This patient was treated with sorafenib daily for 1 week, after which the treatment was discontinued for 1 week and again resumed for a second week (7 days on/7days off dosing schedule). After a total of 14 days therapy with sorafenib, only weak to moderate pERK staining was
FIG. 4. ERK activity is significantly inhibited by sorafenib in MDA‐MB‐231 tumor xenografts. Mice with tumors ranging from 100–200 mg were treated for 5 days with either sorafenib at 30 mg/kg or vehicle. Immunohistochemical staining was performed on paraffin‐ embedded tumor sections with a rabbit polyclonal antibody (anti‐phospho p44/42 MAPK [Thr202/Tyr204]) that detects phosphorylated p44 and p42 MAP kinases (pErk1 and pErk2). The level of pERK was significantly reduced in tumors obtained from sorafenib‐treated mice compared with tumors in control groups (untreated and vehicle).
608
regulators and effectors of small GTPases: Ras family
[47]
FIG. 5. pERK immunostaining in a tumor biopsy of phase I melanoma patient before and after treatment with sorafenib. Immunohistochemical staining was performed on paraffin‐ embedded tumor sections with a rabbit polyclonal antibody that detects phosphorylated p44 and p42 MAP kinases (ERK1 and ERK2). Before sorafenib therapy, the patient’s tumor biopsy showed a strong‐to‐moderate pERK staining intensity (76–100% of nuclei staining) (A and B). After a total of 14 days therapy with sorafenib (two cycles of 7 days each), only weak‐ to‐moderate pERK staining was observed (25–50% of nuclei stained) (C and D).
observed (25–50% of nuclei stained). This result showed the ability of sorafenib to distribute well and inhibit the RAF/MEK/ERK pathway in human tumor tissue. Clinical testing of sorafenib in patients with cancer began in July 2000. Sorafenib exhibited safety and pharmacokinetic profiles that permitted continuous daily administration (Ahmad and Eisen, 2004; Hotte and Hirte,
[47]
sorafenib
609
2002; Mross et al., 2003; Richly et al., 2003, 2004; Strumberg et al., 2002, 2005). Sorafenib was well tolerated, and side effects were manageable. Phase II results in patients with RCC were very encouraging. A total of 73 patients (36%) achieved tumor shrinkage (25% compared with baseline), 69 patients (34%) had tumor measurements that remained within 25% of baseline levels, and 51 patients (25%) showed either tumor growth (25% compared with baseline) or other radiological evidence of progression. In some cases, disease stabilization was maintained for periods in excess of a year (Ahmad and Eisen, 2004). A phase III randomized controlled trial of single‐agent sorafenib versus placebo is ongoing and is planned to accrue more than 800 patients with RCC who have progressed after a systemic therapy. Moreover, on the basis of encouraging results of phase II trials, a phase III study in patients with advanced HCC was initiated. In addition to its use as a single agent, there are ongoing phase II trials to evaluate combining sorafenib with other drugs to maximize therapeutic potential. Conclusion
Sorafenib is a clinical candidate with a dual mechanism of action (i.e., tumor cell proliferation and tumor angiogenesis). It is a novel orally active multikinase inhibitor that is highly potent against C‐RAF and B‐RAF, as well as tyrosine kinases of the VEGF and PDGF receptor families. Sorafenib has a unique kinase profile compared with several kinase inhibitors either on the market or in clinical development. With the central role of RAF and VEGF signaling pathways in promoting cancer growth and tumor angiogenesis, inhibitors of these pathways have the potential of a broad spectrum of antitumor activity. In the clinic, sorafenib has been well tolerated with safety and pharmacokinetic profiles that permit continuous daily dosing. It is currently being evaluated as both a single agent and in combination in phase II and phase III clinical trials. Acknowledgment We thank Hong Rong, Tim Housley, Joanna DeBear, Gloria Hofilena, Dean Wilkie, Angela McNabola, Yichen Cao, and Donna Miller for their excellent technical assistance.
References Ahmad, T., and Eisen, T. (2004). Kinase inhibition with BAY 43‐9006 in renal cell carcinoma. Clin. Cancer Res. 10, 6388S–6392S. Allen, L. F., Sebolt‐Leopold, J., and Meyer, M. B. (2003). CI‐1040 (PD184352), a targeted signal transduction inhibitor of MEK (MAPKK). Semin. Oncol. 30, 105–116.
610
regulators and effectors of small GTPases: Ras family
[47]
Arboleda, M. J., Eberwein, D., Hibner, B., and Lyons, J. F. (2001). Dominant negative mutants of mitogen‐activated protein kinase pathway. Methods Enzymol. 332, 353–367. Brose, M. S., Volpe, P., Feldman, M., Kumar, M., Rishi, I., Gerrero, R., Einhorn, E., Herlyn, M., Minna, J., Nicholson, A., Roth, J. A., Albelda, S. M., Davies, H., Cox, C., Brignell, G., Stephens, P., Futreal, P. A., Wooster, R., Stratton, M. R., and Weber, B. L. (2002). BRAF and RAS mutations in human lung cancer and melanoma. Cancer Res. 62, 6997–7000. Cohen, Y., Goldenberg‐Cohen, N., Parrella, P., Chowers, I., Merbs, S. L., Pe’er, J., and Sidransky, D. (2003). Lack of BRAF mutation in primary uveal melanoma. Invest. Ophthalmol. Vis. Sci. 44, 2876–2878. Davies, H., Bignell, G. R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M. J., Bottomley, W., Davis, N., Dicks, E., Ewing, R., Floyd, Y., Gray, K., Hall, S., Hawes, R., Hughes, J., Kosmidou, V., Menzies, A., Mould, C., Parker, A., Stevens, C., Watt, S., Hooper, S., Wilson, R., Jayatilake, H., Gusterson, B. A., Cooper, C., Shipley, J., Hargrave, D., Pritchard‐Jones, K., Maitland, N., Chenevix‐Trench, G., Riggins, G. J., Bigner, D. D., Palmieri, G., Cossu, A., Flanagan, A., Nicholson, A., Ho, J. W., Leung, S. Y., Yuen, S. T., Weber, B. L., Seigler, H. F., Darrow, T. L., Paterson, H., Marais, R., Marshall, C. J., Wooster, R., Stratton, M. R., and Futreal, P. A. (2002). Mutations of the BRAF gene in human cancer. Nature 417, 949–954. Hotte, S. J., and Hirte, H. W. (2002). BAY 43–9006: Early clinical data in patients with advanced solid malignancies. Curr. Pharm. Des. 8, 2249–2253. Karasarides, M., Chiloeches, A., Hayward, R., Niculescu‐Duvaz, D., Scanlon, I., Friedlos, F., Ogilvie, L., Hedley, D., Martin, J., Marshall, C. J., Springer, C. J., and Marais, R. (2004). B‐aRAF is a therapeutic target in melanoma. Oncogene 23, 6292–6298. Kimura, E. T., Nikiforova, M. N., Zhu, Z., Knauf, J. A., Nikiforov, Y. E., and Fagin, J. A. (2003). High prevalence of BRAF mutations in thyroid cancer: Genetic evidence for constitutive activation of the RET/PTC‐RAS‐BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 63, 1454–1457. Kolch, W. (2002). Ras/Raf signalling and emerging pharmacotherapeutic targets. Expert Opin. Pharmacother. 3, 709–718. Kolch, W., Calder, M., and Gilbert, D. (2005). When kinases meet mathematics: The systems biology of MAPK signalling. FEBS Lett. 579, 1891–1895. Lowinger, T. B., Riedl, B., Dumas, J., and Smith, R. A. (2002). Design and discovery of small molecules targeting raf‐1 kinase. Curr. Pharm. Des. 8, 2269–2278. Lyons, J. F., Wilhelm, S., Hibner, B., and Bollag, G. (2001). Discovery of a novel Raf kinase inhibitor. Endocr. Relat. Cancer 8, 219–225. Marais, R., and Marshall, C. J. (1996). Control of the ERK MAP kinase cascade by Ras and Raf. Cancer Surv. 27, 101–125. Minamoto, T., Mai, M., and Ronai, Z. (2000). K‐ras mutation: Early detection in molecular diagnosis and risk assessment of colorectal, pancreas, and lung cancers–a review. Cancer Detect. Prev. 24, 1–12. Monia, B. P., Sasmor, H., Johnston, J. F., Freier, S. M., Lesnik, E. A., Muller, M., Geiger, T., Altmann, K. H., Moser, H., and Fabbro, D. (1996). Sequence‐specific antitumor activity of a phosphorothioate oligodeoxyribonucleotide targeted to human C‐raf kinase supports an antisense mechanism of action in vivo. Proc. Natl. Acad. Sci. USA 93, 15481–15484. Mross, K., Steinbild, S., Baas, F., Reil, M., Buss, P., Mersmann, S., Voliotis, D., Schwartz, B., and Brendel, E. (2003). Drug‐drug interaction pharmacokinetic study with the Raf kinase inhibitor (RKI) BAY 43–9006 administered in combination with irinotecan (CPT‐11) in patients with solid tumors. Int. J. Clin. Pharmacol. Ther. 41, 618–619. Nikiforova, M. N., Kimura, E. T., Gandhi, M., Biddinger, P. W., Knauf, J. A., Basolo, F., Zhu, Z., Giannini, R., Salvatore, G., Fusco, A., Santoro, M., Fagin, J. A., and Nikiforov, Y. E.
[47]
sorafenib
611
(2003). BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J. Clin. Endocrinol. Metab. 88, 5399–5404. Pollock, P. M., Harper, U. L., Hansen, K. S., Yudt, L. M., Stark, M., Robbins, C. M., Moses, T. Y., Hostetter, G., Wagner, U., Kakareka, J., Salem, G., Pohida, T., Heenan, P., Duray, P., Kallioniemi, O., Hayward, N. K., Trent, J. M., and Meltzer, P. S. (2003). High frequency of BRAF mutations in nevi. Nat. Genet. 33, 19–20. Rajagopalan, H., Bardelli, A., Lengauer, C., Kinzler, K. W., Vogelstein, B., and Velculescu, V. E. (2002). Tumorigenesis: RAF/RAS oncogenes and mismatch‐repair status. Nature 418, 934. Repasky, G. A., Chenette, E. J., and Der, C. J. (2004). Renewing the conspiracy theory debate: Does Raf function alone to mediate Ras oncogenesis? Trends Cell Biol. 14, 639–647. Richly, H., Kupsch, P., Passage, K., Grubert, M., Hilger, R. A., Kredtke, S., Voliotis, D., Scheulen, M. E., Seeber, S., and Strumberg, D. (2003). A phase I clinical and pharmacokinetic study of the Raf kinase inhibitor (RKI) BAY 43‐9006 administered in combination with doxorubicin in patients with solid tumors. Int. J. Clin. Pharmacol. Ther. 41, 620–621. Richly, H., Kupsch, P., Passage, K., Grubert, M., Hilger, R. A., Voigtmann, R., Schwartz, B., Brendel, E., Christensen, O., Haase, C. G., and Strumberg, D. (2004). Results of a phase I trial of BAY 43‐9006 in combination with doxorubicin in patients with primary hepatic cancer. Int. J. Clin. Pharmacol. Ther. 42, 650–651. Sebolt‐Leopold, J. S., and Herrera, R. (2004). Targeting the mitogen‐activated protein kinase cascade to treat cancer. Nat. Rev. Cancer 4, 937–947. Sebolt‐Leopold, J. S., Van Becelaere, K., Hook, K., and Herrera, R. (2003). Biomarker assays for phosphorylated MAP kinase. Their utility for measurement of MEK inhibition. Methods Mol. Med. 85, 31–38. Sharma, A., Trivedi, N. R., Zimmerman, M. A., Tuveson, D. A., Smith, C. D., and Robertson, G. P. (2005). Mutant V599EB‐Raf regulates growth and vascular development of malignant melanoma tumors. Cancer Res. 65, 2412–2421. Singer, G., Oldt, R., 3rd, Cohen, Y., Wang, B. G., Sidransky, D., Kurman, R. J., and Shih, I. M. (2003). Mutations in BRAF and KRAS characterize the development of low‐grade ovarian serous carcinoma. J. Natl. Cancer Inst. 95, 484–486. Strumberg, D., Richly, H., Hilger, R. A., Schleucher, N., Korfee, S., Tewes, M., Faghih, M., Brendel, E., Voliotis, D., Haase, C. G., Schwartz, B., Awada, A., Voigtmann, R., Scheulen, M. E., and Seeber, S. (2005). Phase I clinical and pharmacokinetic study of the Novel Raf kinase and vascular endothelial growth factor receptor inhibitor BAY 43‐9006 in patients with advanced refractory solid tumors. J. Clin. Oncol. 23, 965–972. Strumberg, D., and Seeber, S. (2005). Raf kinase inhibitors in oncology. Onkologie 28, 101–107. Strumberg, D., Voliotis, D., Moeller, J. G., Hilger, R. A., Richly, H., Kredtke, S., Beling, C., Scheulen, M. E., and Seeber, S. (2002). Results of phase I pharmacokinetic and pharmacodynamic studies of the Raf kinase inhibitor BAY 43‐9006 in patients with solid tumors. Int. J. Clin. Pharmacol. Ther. 40, 580–581. Wilhelm, S., and Chien, D. S. (2002). BAY 43–9006: Preclinical data. Curr. Pharm. Des. 8, 2255–2257. Wilhelm, S. M., Carter, C., Tang, L., Wilkie, D., McNabola, A., Rong, H., Chen, C., Zhang, X., Vincent, P., McHugh, M., Cao, Y., Shujath, J., Gawlak, S., Eveleigh, D., Rowley, B., Liu, L., Adnane, L., Lynch, M., Auclair, D., Taylor, I., Gedrich, R., Voznesensky, A., Riedl, B., Post, L. E., Bollag, G., and Trail, P. A. (2004). BAY 43‐9006 exhibits broad
612
regulators and effectors of small GTPases: Ras family
[48]
spectrum oral antitumor activity and targets the RAF/MEK/ERK pathway and receptor tyrosine kinases involved in tumor progression and angiogenesis. Cancer Res. 64, 7099–7109. Yazdi, A. S., Palmedo, G., Flaig, M. J., Puchta, U., Reckwerth, A., Rutten, A., Mentzel, T., Hugel, H., Hantschke, M., Schmid‐Wendtner, M. H., Kutzner, H., and Sander, C. A. (2003). Mutations of the BRAF gene in benign and malignant melanocytic lesions. J. Invest. Dermatol. 121, 1160–1162. Yuen, S. T., Davies, H., Chan, T. L., Ho, J. W., Bignell, G. R., Cox, C., Stephens, P., Edkins, S., Tsui, W. W., Chan, A. S., Futreal, P. A., Stratton, M. R., Wooster, R., and Leung, S. Y. (2002). Similarity of the phenotypic patterns associated with BRAF and KRAS mutations in colorectal neoplasia. Cancer Res. 62, 6451–6455.
[48] Yeast Screens for Inhibitors of Ras–Raf Interaction and Characterization of MCP Inhibitors of Ras–Raf Interaction By VLADIMIR KHAZAK, JURAN KATO‐STANKIEWICZ, FUYU TAMANOI , and ERICA A. GOLEMIS Abstract
Because of the central role of Ras in cancer cell signaling, there has been considerable interest in developing small molecule inhibitors of the Ras signaling pathways as potential chemotherapeutic agents. This chapter describes the use of a two‐hybrid approach to identify the MCP compounds, small molecules that disrupt the interaction between Ras and its effector Raf. We first outline the reagent development and selection/ counter selection methods required to successfully apply a two‐hybrid approach to isolation of MCP compounds. Separately, we describe the collateral benefits of this screening approach in yielding novel antifungal compounds. We then discuss secondary physiological validation approaches to confirm the MCP compounds specifically target Ras–Raf signaling. Finally, we develop a decision tree for subsequent preclinical characterization and optimization of this class of pathway‐targeted reagent.
Introduction
Cell signaling processes depend on the regulated, transient interactions of proteins and protein complexes in response to an initiating stimulus. As a consequence of these interactions, ‘‘information’’ is exchanged, with proteins proximal to an activating signal often causing physical modification (e.g., phosphorylation) of other proteins distal to the signal, so as to alter METHODS IN ENZYMOLOGY, VOL. 407 Copyright 2006, Elsevier Inc. All rights reserved.
0076-6879/06 $35.00 DOI: 10.1016/S0076-6879(05)07048-5
597
sorafenib
Qiu, R. G., Chen, J., Kirn, D., McCormick, F., and Symons, M. (1995a). An essential role for Rac in Ras transformation. Nature 374, 457–459. Qiu, R. G., Chen, J., McCormick, F., and Symons, M. (1995b). A role for Rho in Ras transformation. Proc. Natl. Acad. Sci. USA 92, 11781–11785. Rotblat, B., Niv, H., Andre, S., Kaltner, H., Gabius, H. J., and Kloog, Y. (2004). Galectin‐1 (L11A) predicted from a computed galectin‐1 farnesyl‐binding pocket selectively inhibits Ras‐GTP. Cancer Res. 64, 3112–3118. Sebti, S. M., and Der, C. J. (2003). Opinion: Searching for the elusive targets of farnesyltransferase inhibitors. Nat. Rev. Cancer 3, 945–951. Sebti, S. M., and Hamilton, A. D. (2000). Farnesyltransferase and geranylgeranyltransferase I inhibitors and cancer therapy: Lessons from mechanism and bench‐to‐bedside translational studies. Oncogene 19, 6584–6593. Tao, W., Pennica, D., Xu, L., Kalejta, R. F., and Levine, A. J. (2001). Wrch‐1, a novel member of the Rho gene family that is regulated by Wnt‐1. Genes Dev. 15, 1796–1807. Whyte, D. B., Kirschmeier, P., Hockenberry, T. N., Nunez‐Oliva, I., James, L., Catino, J. J., Bishop, W. R., and Pai, J. K. (1997). K‐ and N‐Ras are geranylgeranylated in cells treated with farnesyl protein transferase inhibitors. J. Biol. Chem. 272, 14459–14464.
[47] Sorafenib (BAY 43‐9006, Nexavarw), a Dual‐Action Inhibitor That Targets RAF/MEK/ERK Pathway in Tumor Cells and Tyrosine Kinases VEGFR/PDGFR in Tumor Vasculature By LILA ADNANE, PAMELA A. TRAIL, IAN TAYLOR , and SCOTT M. WILHELM Abstract
Activating mutations in Ras and B‐RAF were identified in several human cancers. In addition, several receptor tyrosine kinases, acting upstream of Ras, were found either mutated or overexpressed in human tumors. Because oncogenic activation of the Ras/RAF pathway may lead to a sustained proliferative signal resulting in tumor growth and progression, inhibition of this pathway represents an attractive approach for cancer drug discovery. A novel class of biaryl urea that inhibits C‐RAF kinase was discovered using a combination of medicinal and combinatorial chemistry approaches. This effort culminated in the identification of the clinical candidate BAY 43‐9006 (Sorafenib, Nexavarw), which has recently been approved by the FDA for advanced renal cell carcinoma in phase III clinical trials. Sorafenib inhibited the kinase activity of both C‐RAF and B‐RAF (wild type and V600E mutant). It inhibited MEK and ERK METHODS IN ENZYMOLOGY, VOL. 407 Copyright 2006, Elsevier Inc. All rights reserved.
0076-6879/06 $35.00 DOI: 10.1016/S0076-6879(05)07047-3
598
regulators and effectors of small GTPases: Ras family
[47]
phosphorylation in various cancer cell lines and tumor xenografts and exhibited potent oral antitumor activity in a broad spectrum of human tumor xenograft models. Further characterization of sorafenib revealed that this molecule was a multikinase inhibitor that targeted the vascular endothelial growth factor receptor family (VEGFR‐2 and VEGFR‐3) and platelet‐derived growth factor receptor family (PDGFR‐ and Kit), which play key roles in tumor progression and angiogenesis. Thus, sorafenib may inhibit tumor growth by a dual mechanism, acting either directly on the tumor (through inhibition of Raf and Kit signaling) and/or on tumor angiogenesis (through inhibition of VEGFR and PDGFR signaling). In phase I and phase II clinical trials, sorafenib showed limited side effects and, more importantly, disease stabilization. This agent is currently being evaluated in phase III clinical trials in renal cell and hepatocellular carcinomas. Introduction
Several growth factors, cytokines, and proto‐oncogenes transduce their signals through the Ras/RAF/MEK/ERK signaling pathway (Marais and Marshall, 1996; Repasky et al., 2004). This pathway is an important mediator of tumor cell proliferation, survival, and differentiation and is also central to tumor angiogenesis. Alteration of the Ras/RAF pathway was shown to contribute to the pathogenesis and progression of human cancers, making the components of this signaling cascade attractive as therapeutic targets. Overexpression or mutation of cell‐surface tyrosine kinase receptors and mutation of downstream effectors, such as Ras and B‐RAF, results in constitutive activation of the RAF pathway. Ras‐activating mutations were found in approximately 50% of colon carcinomas, 30% of lung carcinomas, 80% of pancreatic carcinomas, and 20% of various hematopoietic malignancies (Minamoto et al., 2000). Moreover, the Ras pathway is often constitutively activated by many receptor tyrosine kinases, such as those for the epidermal, platelet‐derived, or vascular‐endothelial growth factors. Thus, most human tumors, not just those with Ras mutations, exploit the Ras signal transduction pathway as a means to achieve continuous cellular proliferation and survival. Moreover, a downstream effector of Ras, B‐RAF, was shown to be mutated in 30% of low‐grade ovarian cancers (Singer et al., 2003), 35–70% of papillary thyroid cancers (Cohen et al., 2003; Kimura et al., 2003; Nikiforova et al., 2003), 10–15% of colorectal cancers (Davies et al., 2002; Rajagopalan et al., 2002; Yuen et al., 2002), and 70% of malignant melanomas (Brose et al., 2002; Davies et al., 2002; Pollock et al., 2003; Yazdi et al., 2003). Approximately 90% of these mutations occur in the activation region of the kinase domain as a single‐ base substitution that converts a valine to glutamic acid at codon 600
[47]
sorafenib
599
(V600EB‐RAF) (Davies et al., 2002). This mutation causes activation of B‐RAF kinase and, thus, constitutive stimulation of MEK/ERK pathway independent of any upstream activating signal. A number of studies have suggested that inhibitors of the RAF pathway could have significant clinical benefit in the treatment of human cancers (Kolch, 2002). For instance, dominant‐negative mutants of RAF, MEK, or ERK significantly reduced the transforming ability of mutant Ras in rodent fibroblasts (Arboleda et al., 2001). Moreover, human tumor cell lines expressing a dominant negative MEK were deficient in their ability to grow under both anchorage‐dependent and anchorage‐independent conditions (Arboleda et al., 2001). These mutants inhibited both the primary and metastatic growth of human tumor xenografts (Arboleda et al., 2001). Additional evidence supporting the relevance of therapeutically targeting RAF comes from work with ISIS 5132, a RAF antisense oligonucleotide (Monia et al., 1996). ISIS 5132, a C‐RAF phosphorothioate antisense oligonucleotide (TCCCGCCTGTGACATGCATT) designed to target the 3‐prime UTR of the C‐RAF message, was found to inhibit the growth of human lung, breast, bladder, and colon tumor xenografts. Finally, reduction of V600EB‐RAF activity by SiRNA in melanoma xenograft tumors prevented vascular development because of decreased VEGF secretion and, subsequently, increasing apoptosis in tumors (Sharma et al., 2005). Small molecules that inhibit RAF or MEK kinases have been identified and are being evaluated in the clinic (Sebolt‐Leopold and Herrera, 2004; Strumberg and Seeber, 2005). Investigators at Pfizer discovered CI‐1040, a small molecule, non‐ATP competitive, allosteric MEK inhibitor. CI‐1040 was shown to inhibit ERK phosphorylation in a panel of cancer cell lines and tumor growth in xenograft models (Allen et al., 2003). Optimization efforts led to the discovery of a second‐generation compound, PD‐0325901, which recently entered phase I clinical trials. Sorafenib, which is a proprietary compound of Bayer Pharmaceuticals Corporation and is being jointly developed by Bayer and Onyx Pharmaceuticals, is an orally active multikinase inhibitor that inhibits the serine/threonine kinases, C‐RAF and B‐RAF (wild type and V600E mutant), and tyrosine kinases of the vascular‐endothelial growth factor receptor (VEGFR‐2 and VEGFR‐3) and platelet‐derived growth factor receptor (PDGFR‐ and c‐Kit) families (Wilhelm et al., 2004). Sorafenib may inhibit tumor growth by combining two anticancer activities: inhibition of tumor cell proliferation and survival (through C‐RAF and B‐RAF) and tumor angiogenesis (through VEGFR and PDGFR). Sorafenib was discovered after an extensive structure– activity relationship optimization effort that started with a weak micromolar hit from high‐throughput screen (HTS) (Lowinger et al., 2002; Lyons et al., 2001). HTS hits were confirmed in a biochemical assay and active
600
regulators and effectors of small GTPases: Ras family
[47]
compounds (IC50 < 100 nM) were tested in both a mechanistic cellular assay, which measured the level of the phosphorylated form of MEK, and a functional assay, which measured tumor cell proliferation. Sorafenib is currently being evaluated in clinical trials, including phase III trials in renal cell (RCC) and hepatocellular (HCC) carcinomas. Materials and Methods
Preparation of Sorafenib The chemical name of Sorafenib is (N‐(3‐trifluoromethyl‐4‐chlorophenyl)‐N‐(4‐(2‐methylcarbamoyl pyridin‐4‐yl)oxyphenyl)urea), and the structural formula is shown in Table I. Sorafenib is dissolved in DMSO for in vitro experiments. Cell Lines, Reagents, and Western Blot Analysis The MDA‐MB‐231 human mammary adenocarcinoma cell line was obtained from the National Cancer Institute. All the other cell lines were purchased from the American Type Culture Collection (ATCC). Cell lines were maintained in DMEM (GIBCO), supplemented with 1% L‐glutamine (GIBCO), 1% HEPES buffer (GIBCO), and 10% heat‐inactivated fetal bovine serum (FBS). Cells were plated at 200,000 cells per well in 12‐well tissue culture plates in growth media and incubated overnight. Media was removed and replaced with DMEM supplemented with 0.1% BSA (Sigma) containing either various concentrations of sorafenib, U0126 (Cell Signaling Technology), or vehicle (DMSO) for 2 h. Cells were washed with cold PBS containing 0.1 mM vanadate and lysed in a 1% Triton X‐100 solution containing protease inhibitors. Lysates were clarified by centrifugation, subjected to SDS‐PAGE, transferred to nitrocellulose membranes, and blocked for 1 h in TBS containing 5% non‐fat dry milk and 1% BSA. Membranes were probed for 1 h with antibodies to pMEK1/2 (ser217/ ser221), MEK1/2, pERK1/2 (thr202/tyr204), ERK1/2, pPKB (ser473), and PKB. The antibodies were purchased from Cell Signaling Technology and were used at a dilution of 1:000. Blots were developed with horseradish peroxidase (HRP)–conjugated secondary antibodies and Amersham ECL reagent on Amersham Hyperfilm. Phospho‐ERK Bio‐Plex Immunoassay A 96‐well immunoassay (BioPlex), using the laser flow cytometry platform of Bio‐Rad, was used to measure the level of pERK1/2 (thr202/ tyr204) in cells. Exponentially growing MDA‐MB231 breast carcinoma and
[47]
601
sorafenib
SORAFENIB INHIBITS RAF
TABLE I RECEPTOR TYROSINE KINASES INVOLVED IN TUMOR ANGIOGENESIS AND
IC50 (nM) SD (n)b Biochemical assaya RAF‐1c B‐RAF wild‐typed V600E B‐RAF mutante VEGFR‐2 mVEGFR‐2 (flk‐1) mVEGR‐3 mPDGFR‐ Flt‐3 c‐KIT FGFR‐1 ERK‐1, MEK‐1, EGFR, HER‐2, IGFR‐1, c‐met, PKB, PKA, cdk1/cyclinB, PKC, PKC, pim‐1 Cellular mechanism f MDA MB 231 MEK phosphorylation (human breast) MDA MB 231 ERK ½ phosphorylation (human breast) BxPC‐3 ERK 1/2 phosphorylation (human pancreatic) LOX ERK 1/2 phosphorylation (human melanoma) VEGFR‐2 phosphorylation (human, 3T3 cells) VEGF‐ERK 1/2 phosphorylation (HUVEC)h mVEGFR3 phosphorylation (mouse, 293 cells) PDGFR‐ phosphorylation (human AoSMC)i Cellular proliferation MDA MB 231 (10% fetal calf serum) VEGF‐HuVECh (2% fetal calf serum) PDGFR‐ß human AoSMCi(0.1% BSA)j a
6 3 (7) 25 6 (7) 38 9 (4) 90 15 (4) 15 6 (4) 20 6 (3) 57 20 (5) 58 20 (3) 68 21 (3) 580 100 (3) >10,000
40 20 (2) 90g 26 (7) 1200g 165 (2) 880g 90 (2) 30 21 (3) 60g 20 (2) 100 80 (2) 80 40 (3) 2600 810 (3) 12 10 (2) 280 140 (5)
Kinase assays were carried out as previously described (Wilhelm et al., 2004) at ATP concentrations at or below Km (1–10 M). b IC50 mean ± standard deviation; (n ¼ number of trials). c Lck activated N‐terminal truncated RAF‐1. d N‐terminal truncated B‐RAF (wild type). e N‐terminal V600E truncated B‐RAF (mutant). f Cellular assays (autophosphorylation and RAF/MEK/ERK pathway) were performed in 0.1% bovine serum albumin using phospho‐specific antibodies or 4G10 for VEGFR‐3 as previously described (Wilhelm et al., 2004). g Activated phospho‐ERK 1/2 was quantitated with phospho‐ERK 1/2 immunoassay (Bio‐ Plex. Bio‐Rad, Inc.). h HUVECs‐human umbilical vein endothelial cells. i Human AoSMCs‐ human aortic smooth muscle cells. j BSA, bovine serum albumin.
602
regulators and effectors of small GTPases: Ras family
[47]
LOX human melanoma cells were seeded at 50,000 cells per well. The next day, the media was changed to serum‐free media containing 0.1% BSA and various concentrations of compounds (serial dilution from 3 M–12 nM). Cells were incubated with the compounds for 2 h. The rest of the assay was performed per manufacturer recommendation for the pERK1/2 Bio‐ Plex assay (cat#171–304004, Bio‐Rad, Hercules, CA). Cells were washed with 100 l of wash buffer A before addition of 80 l of cell lysis buffer. The plate was agitated on a plate shaker at 300 rpm for 30 min at 4 . Cellular debris was pelleted by centrifugation at 4500g for 15 min at 4 ; 45 l of supernatant was diluted with an equal volume of Bio‐Plex phosphoprotein assay buffer B. The diluted lysate was incubated with 2000 of 5 Bio‐Plex beads conjugated with an anti‐ERK1/2 antibody. The beads and lysate mixture was incubated at room temperature (RT) for 15–18 h. The plate was vacuum‐filtered, washed three times, and 25 l of biotinylated pERK1/2 antibody solution was added to each well. The plate was incubated for 30 min at RT. The plate was vacuum‐filtered, washed three times, and 50 l of streptavidin‐PE solution was added. After 10 min incubation at RT, 125 l of resuspension buffer was added, and the relative fluorescence units of pERK1/2 were detected by counting 25 beads with Bio‐Plex flow cell (probe) at high sensitivity (Luminex 100 instrument, Bio‐Rad). Immunohistochemistry Immunohistochemical staining of pERK was performed with a rabbit polyclonal antibody anti‐phospho p44/42MAPK (Thr202/Tyr204) from Cell Signaling Technology that detects the phosphorylated p44 and p42 MAP kinases (pErk1 and pErk2). The antibodies were diluted 1:100 with Dako antibody diluent for use. Slides were deparaffinized and placed in heated citrate buffer for 35 min. They remained in the heated buffer, acclimated to RT for approximately 30 min, and washed in distilled water. Slides were blocked in a 1.5 % hydrogen peroxide solution for 10 min and washed in distilled water. They were washed in PBS and incubated with primary antibody for approximately 30 min. They were rinsed in PBS and incubated for 30 min with a rabbit HRP labeled polymer (DAKO Envision þ Kit). Slides were rinsed in PBS and the DAB substrate chromogen was applied for 5 min. They were washed in water and counterstained with filtered hematoxylin for approximately 20 sec and then washed with warm water. Slides were dehydrated and coverslipped with Permount.
[47]
sorafenib
603
Experimental Results and Discussion
Sorafenib Inhibits MEK and ERK Phosphorylation in Cancer Cells, Independent of K‐Ras and B‐RAF Mutational Status Extracellular stimuli and activating mutations activate Ras, which tether RAF to the plasma membrane, resulting in the stimulation of RAF kinase activity. Activated RAF phosphorylates MEK at two key serine residues (Ser218, Ser222), leading to a strong activation of MEK kinase. Activated MEK1/2 recognize and phosphorylate ERK1/2 on key threonine and tyrosine residues. Phosphorylation at both the threonine (Thr183) and tyrosine (Tyr185) sites on ERK is necessary to induce complete enzyme activation (Kolch et al., 2005). The effect of sorafenib on MEK and ERK activity was determined by incubating cells with various concentrations of sorafenib for 2 h. Cell lysates were analyzed by immunoblotting with antibodies specific for phosphorylated MEK (pMEK), phosphorylated ERK (pERK), and, as control, phosphorylated PKB (pPKB) (Fig. 1). To control for equal protein loading,
FIG. 1. Inhibition of MEK and ERK phosphorylation by sorafenib in MDA‐MB‐231 breast cancer cell line. Cells were incubated with various concentrations of sorafenib, 10 M U0126 (MEK inhibitor) or DMSO (vehicle) for 2 h. Cell lysates were subjected to Western blot analysis for phosphorylated (p) and total MEK (top panel), ERK (middle panel), and PKB (bottom panel).
604
regulators and effectors of small GTPases: Ras family
[47]
the same membranes were reprobed with antibodies to total MEK, ERK, and PKB. U0126, an inhibitor of MEK kinase, was used as positive control (lane 1). A weak RAF inhibitor compound (IC50 > 10 M) of the same chemical class as sorafenib was used as negative control (lanes 8–11). Sorafenib inhibited MEK and ERK phosphorylation in a dose‐dependent manner (lanes 2–7), whereas RAF‐inactive control had no effect (lanes 8– 10). Sorafenib‐mediated inhibition of phosphorylation was specific to MEK and ERK, because it had no effect on PKB. Several human tumor cell lines exhibit high levels of basal pMEK and pERK, either because of K‐Ras or B‐RAF mutation or constitutive activation of growth factor receptors. Sorafenib was effective in inhibiting ERK phosphorylation in most cell lines tested, including those with K‐Ras and B‐RAF mutations (Fig. 2). However, the potency at which sorafenib inhibited ERK phosphorylation varied among cell lines, with EC50 ranging from 90–1200 nM (Fig. 2 and Table I). This result was particularly encouraging, because it holds promise for the potential use of sorafenib in patients with cancer who have B‐RAF and K‐Ras mutations. The concentration of sorafenib necessary to reduce ERK phosphorylation by 50% (pERK EC50) was determined using the phospho‐ERK BioPlex immunoassay (Fig. 3). The pERK EC50 was determined in both the MDA‐ MB‐231 cell line, which expresses B‐RAF (G463V) and K‐Ras (G13D) mutants, and the LOX cell line, which expresses the most predominant
FIG. 2. Sorafenib inhibits ERK phosphorylation in several cancer cell lines, independent of K‐Ras and B‐RAF mutational status. Cells were incubated with various concentrations of sorafenib, 10 M U0126 or DMSO for 2 h. Cell lysates were subjected to Western blot analysis for phosphorylated (p) and total (T) ERK 1/2.
[47]
sorafenib
605
FIG. 3. Determination of pERK EC50 in MDA‐MB‐231 and LOX cells using BioPlex immunoassay. MDA‐MB‐231 breast carcinoma (B) and LOX melanoma (A) cells were incubated with various concentrations of sorafenib or inactive compound control for 2 h. Cell lysates were analyzed using a high‐throughput phospho–ERK BioPlex immunoassay (BioRad), as described in ‘‘Materials and Methods.’’
B‐RAF mutant (V600E). Sorafenib inhibited ERK phosphorylation in both cell lines but, was 10‐fold more potent in the MDA‐MB‐231 cells (EC50 ¼ 90 nM) compared with LOX cells (EC50 ¼ 880 nM). The ability of sorafenib to inhibit V600EB‐RAF mutant was analyzed in additional cancer lines that express this mutant, including melanoma (SKMEL‐28, A2058) and colon (Colo‐205, HT‐29). The results showed a significant inhibition of ERK phosphorylation in V600EB‐RAF mutant lines, demonstrating the ability of this agent to inhibit constitutively activated B‐RAF (Fig. 2 and data not shown). Similar results with sorafenib were recently reported by Sharma et al. (2005), who showed inhibition of MAPK‐signaling cascade and tumor development using V600EB‐RAF–expressing melanoma lines. Furthermore,
606
regulators and effectors of small GTPases: Ras family
[47]
decrease of V600EB‐RAF activity, by either SiRNA or treatment with sorafenib, prevented vascular development because of decreased VEGF secretion and, subsequently, increased apoptosis in melanoma tumors (Sharma et al., 2005). Recently, Karasarides et al. (2004) reported results with sorafenib that showed the inhibition of ERK activity in V600EB‐RAF–expressing melanoma cell lines, A375, Colo829, and WM‐266–4, which resulted in inhibition of DNA synthesis and induction of cell death in all three lines. The in vitro and cellular profile of sorafenib is summarized in Table I. Sorafenib inhibited the activity of C‐RAF, B‐RAF (wild type and V600EB‐ RAF), as well as tyrosine kinases of the VEGFR and PDGFR families, which are key regulators of angiogenesis (Table I). Thus, sorafenib may mediate its antitumor effect by acting on the tumor directly (through inhibition of RAF signaling) and/or tumor angiogenesis (through inhibition of VEGF and PDGF signaling). In vitro, sorafenib had no effect on MEK, ERK, or a limited panel of serine/threonine and tyrosine kinases including the ERBB, IGF1R, and CDK families (Table I). Sorafenib inhibited proliferation of MDA‐MB‐231 tumors cells (EC50 ¼ 2800 nM), as well as PDGF‐ stimulated proliferation of human aortic smooth muscle cells (EC50 ¼ 280 nM) and VEGF‐stimulated proliferation of human endothelial cells (HUVEC) (EC50 ¼ 12 nM) (Table I and Wilhelm et al. [2004]). To our knowledge, sorafenib possesses a unique profile compared with compounds either on the market or in clinical development, targeting both RAF/MEK/ ERK and VEGF/PDGF signaling pathways. The antitumor efficacy of sorafenib, administered as a single agent against established human tumor xenografts in athymic mice, was evaluated in several tumor models (Wilhelm and Chien, 2002; Wilhelm et al., 2004). In each model, sorafenib produced dose‐dependent tumor growth inhibition, and during treatment with a 30‐ to 60‐mg/kg dose, complete tumor stasis in the human ovarian (SK‐OV‐3), the human colon tumor models (HT‐29, Colo‐205, and DLD‐1), and the NSCLC model (A549) was observed (Wilhelm et al., 2004). No correlation was found between sensitivity to sorafenib and K‐Ras or B‐RAF mutational status. Indeed, sorafenib inhibited progression of tumors with wild‐type K‐Ras and B‐RAF, such as SK‐OV‐3, as well as tumors with K‐Ras or B‐RAF mutation, such as DLD‐1, H460, A549, MDA‐MB‐231, Colo‐205, and HT‐29 (Wilhelm et al., 2004). These results show that cells with a constitutively active RAF/MEK/ERK pathway are not necessarily more sensitive or resistant to sorafenib. Antitumor activity in V600EB‐RAF–expressing melanoma xenograft models has been reported by other investigators (Karasarides et al., 2004; Sharma et al., 2005). Sorafenib‐mediated inhibition of V600EB‐RAF activity decreased VEGF secretion and led to inhibition of vascular development and increased apoptosis (Sharma et al., 2005).
[47]
sorafenib
607
In another study, sorafenib‐mediated inhibition of DNA synthesis and induction of cell death correlated with a substantial growth delay in melanoma tumor xenografts (Karasarides et al., 2004). Inhibition of ERK Phosphorylation by Sorafenib in MDA‐MB‐231 Tumors The phosphorylation status of MEK and ERK has provided a useful pharmacodynamic marker for assessing RAF inhibition (Sebolt‐Leopold et al., 2003). Mechanism‐of‐action studies have been carried out in the MDA‐MB‐231 xenograft model after 5 days of daily treatment with sorafenib at 30 mg/kg. The tumors were excised 3 h after the last dose and immunostained for active ERK using an antibody that only binds to phosphorylated, active ERK1 and ERK2, as described in ‘‘Materials and Methods.’’ A substantial reduction in ERK activity was found in tumors from the sorafenib‐treated mice compared with the vehicle‐treated and untreated controls (Fig. 4). Very low pERK staining was localized at the rim of the tumor, but no staining was observed in the central region, which was mainly necrotic (Fig. 4). In the clinic, the phosphorylation status of ERK in tumors from patients has been evaluated in some cases. A sample of a tumor biopsy from a patient with melanoma before and after treatment with sorafenib is shown in Fig. 5. The tumor biopsy showed moderate to strong pERK staining (76–100% of nuclei stained) before sorafenib treatment (Fig. 5A and B). This patient was treated with sorafenib daily for 1 week, after which the treatment was discontinued for 1 week and again resumed for a second week (7 days on/7days off dosing schedule). After a total of 14 days therapy with sorafenib, only weak to moderate pERK staining was
FIG. 4. ERK activity is significantly inhibited by sorafenib in MDA‐MB‐231 tumor xenografts. Mice with tumors ranging from 100–200 mg were treated for 5 days with either sorafenib at 30 mg/kg or vehicle. Immunohistochemical staining was performed on paraffin‐ embedded tumor sections with a rabbit polyclonal antibody (anti‐phospho p44/42 MAPK [Thr202/Tyr204]) that detects phosphorylated p44 and p42 MAP kinases (pErk1 and pErk2). The level of pERK was significantly reduced in tumors obtained from sorafenib‐treated mice compared with tumors in control groups (untreated and vehicle).
608
regulators and effectors of small GTPases: Ras family
[47]
FIG. 5. pERK immunostaining in a tumor biopsy of phase I melanoma patient before and after treatment with sorafenib. Immunohistochemical staining was performed on paraffin‐ embedded tumor sections with a rabbit polyclonal antibody that detects phosphorylated p44 and p42 MAP kinases (ERK1 and ERK2). Before sorafenib therapy, the patient’s tumor biopsy showed a strong‐to‐moderate pERK staining intensity (76–100% of nuclei staining) (A and B). After a total of 14 days therapy with sorafenib (two cycles of 7 days each), only weak‐ to‐moderate pERK staining was observed (25–50% of nuclei stained) (C and D).
observed (25–50% of nuclei stained). This result showed the ability of sorafenib to distribute well and inhibit the RAF/MEK/ERK pathway in human tumor tissue. Clinical testing of sorafenib in patients with cancer began in July 2000. Sorafenib exhibited safety and pharmacokinetic profiles that permitted continuous daily administration (Ahmad and Eisen, 2004; Hotte and Hirte,
[47]
sorafenib
609
2002; Mross et al., 2003; Richly et al., 2003, 2004; Strumberg et al., 2002, 2005). Sorafenib was well tolerated, and side effects were manageable. Phase II results in patients with RCC were very encouraging. A total of 73 patients (36%) achieved tumor shrinkage (25% compared with baseline), 69 patients (34%) had tumor measurements that remained within 25% of baseline levels, and 51 patients (25%) showed either tumor growth (25% compared with baseline) or other radiological evidence of progression. In some cases, disease stabilization was maintained for periods in excess of a year (Ahmad and Eisen, 2004). A phase III randomized controlled trial of single‐agent sorafenib versus placebo is ongoing and is planned to accrue more than 800 patients with RCC who have progressed after a systemic therapy. Moreover, on the basis of encouraging results of phase II trials, a phase III study in patients with advanced HCC was initiated. In addition to its use as a single agent, there are ongoing phase II trials to evaluate combining sorafenib with other drugs to maximize therapeutic potential. Conclusion
Sorafenib is a clinical candidate with a dual mechanism of action (i.e., tumor cell proliferation and tumor angiogenesis). It is a novel orally active multikinase inhibitor that is highly potent against C‐RAF and B‐RAF, as well as tyrosine kinases of the VEGF and PDGF receptor families. Sorafenib has a unique kinase profile compared with several kinase inhibitors either on the market or in clinical development. With the central role of RAF and VEGF signaling pathways in promoting cancer growth and tumor angiogenesis, inhibitors of these pathways have the potential of a broad spectrum of antitumor activity. In the clinic, sorafenib has been well tolerated with safety and pharmacokinetic profiles that permit continuous daily dosing. It is currently being evaluated as both a single agent and in combination in phase II and phase III clinical trials. Acknowledgment We thank Hong Rong, Tim Housley, Joanna DeBear, Gloria Hofilena, Dean Wilkie, Angela McNabola, Yichen Cao, and Donna Miller for their excellent technical assistance.
References Ahmad, T., and Eisen, T. (2004). Kinase inhibition with BAY 43‐9006 in renal cell carcinoma. Clin. Cancer Res. 10, 6388S–6392S. Allen, L. F., Sebolt‐Leopold, J., and Meyer, M. B. (2003). CI‐1040 (PD184352), a targeted signal transduction inhibitor of MEK (MAPKK). Semin. Oncol. 30, 105–116.
610
regulators and effectors of small GTPases: Ras family
[47]
Arboleda, M. J., Eberwein, D., Hibner, B., and Lyons, J. F. (2001). Dominant negative mutants of mitogen‐activated protein kinase pathway. Methods Enzymol. 332, 353–367. Brose, M. S., Volpe, P., Feldman, M., Kumar, M., Rishi, I., Gerrero, R., Einhorn, E., Herlyn, M., Minna, J., Nicholson, A., Roth, J. A., Albelda, S. M., Davies, H., Cox, C., Brignell, G., Stephens, P., Futreal, P. A., Wooster, R., Stratton, M. R., and Weber, B. L. (2002). BRAF and RAS mutations in human lung cancer and melanoma. Cancer Res. 62, 6997–7000. Cohen, Y., Goldenberg‐Cohen, N., Parrella, P., Chowers, I., Merbs, S. L., Pe’er, J., and Sidransky, D. (2003). Lack of BRAF mutation in primary uveal melanoma. Invest. Ophthalmol. Vis. Sci. 44, 2876–2878. Davies, H., Bignell, G. R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M. J., Bottomley, W., Davis, N., Dicks, E., Ewing, R., Floyd, Y., Gray, K., Hall, S., Hawes, R., Hughes, J., Kosmidou, V., Menzies, A., Mould, C., Parker, A., Stevens, C., Watt, S., Hooper, S., Wilson, R., Jayatilake, H., Gusterson, B. A., Cooper, C., Shipley, J., Hargrave, D., Pritchard‐Jones, K., Maitland, N., Chenevix‐Trench, G., Riggins, G. J., Bigner, D. D., Palmieri, G., Cossu, A., Flanagan, A., Nicholson, A., Ho, J. W., Leung, S. Y., Yuen, S. T., Weber, B. L., Seigler, H. F., Darrow, T. L., Paterson, H., Marais, R., Marshall, C. J., Wooster, R., Stratton, M. R., and Futreal, P. A. (2002). Mutations of the BRAF gene in human cancer. Nature 417, 949–954. Hotte, S. J., and Hirte, H. W. (2002). BAY 43–9006: Early clinical data in patients with advanced solid malignancies. Curr. Pharm. Des. 8, 2249–2253. Karasarides, M., Chiloeches, A., Hayward, R., Niculescu‐Duvaz, D., Scanlon, I., Friedlos, F., Ogilvie, L., Hedley, D., Martin, J., Marshall, C. J., Springer, C. J., and Marais, R. (2004). B‐aRAF is a therapeutic target in melanoma. Oncogene 23, 6292–6298. Kimura, E. T., Nikiforova, M. N., Zhu, Z., Knauf, J. A., Nikiforov, Y. E., and Fagin, J. A. (2003). High prevalence of BRAF mutations in thyroid cancer: Genetic evidence for constitutive activation of the RET/PTC‐RAS‐BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 63, 1454–1457. Kolch, W. (2002). Ras/Raf signalling and emerging pharmacotherapeutic targets. Expert Opin. Pharmacother. 3, 709–718. Kolch, W., Calder, M., and Gilbert, D. (2005). When kinases meet mathematics: The systems biology of MAPK signalling. FEBS Lett. 579, 1891–1895. Lowinger, T. B., Riedl, B., Dumas, J., and Smith, R. A. (2002). Design and discovery of small molecules targeting raf‐1 kinase. Curr. Pharm. Des. 8, 2269–2278. Lyons, J. F., Wilhelm, S., Hibner, B., and Bollag, G. (2001). Discovery of a novel Raf kinase inhibitor. Endocr. Relat. Cancer 8, 219–225. Marais, R., and Marshall, C. J. (1996). Control of the ERK MAP kinase cascade by Ras and Raf. Cancer Surv. 27, 101–125. Minamoto, T., Mai, M., and Ronai, Z. (2000). K‐ras mutation: Early detection in molecular diagnosis and risk assessment of colorectal, pancreas, and lung cancers–a review. Cancer Detect. Prev. 24, 1–12. Monia, B. P., Sasmor, H., Johnston, J. F., Freier, S. M., Lesnik, E. A., Muller, M., Geiger, T., Altmann, K. H., Moser, H., and Fabbro, D. (1996). Sequence‐specific antitumor activity of a phosphorothioate oligodeoxyribonucleotide targeted to human C‐raf kinase supports an antisense mechanism of action in vivo. Proc. Natl. Acad. Sci. USA 93, 15481–15484. Mross, K., Steinbild, S., Baas, F., Reil, M., Buss, P., Mersmann, S., Voliotis, D., Schwartz, B., and Brendel, E. (2003). Drug‐drug interaction pharmacokinetic study with the Raf kinase inhibitor (RKI) BAY 43–9006 administered in combination with irinotecan (CPT‐11) in patients with solid tumors. Int. J. Clin. Pharmacol. Ther. 41, 618–619. Nikiforova, M. N., Kimura, E. T., Gandhi, M., Biddinger, P. W., Knauf, J. A., Basolo, F., Zhu, Z., Giannini, R., Salvatore, G., Fusco, A., Santoro, M., Fagin, J. A., and Nikiforov, Y. E.
[47]
sorafenib
611
(2003). BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J. Clin. Endocrinol. Metab. 88, 5399–5404. Pollock, P. M., Harper, U. L., Hansen, K. S., Yudt, L. M., Stark, M., Robbins, C. M., Moses, T. Y., Hostetter, G., Wagner, U., Kakareka, J., Salem, G., Pohida, T., Heenan, P., Duray, P., Kallioniemi, O., Hayward, N. K., Trent, J. M., and Meltzer, P. S. (2003). High frequency of BRAF mutations in nevi. Nat. Genet. 33, 19–20. Rajagopalan, H., Bardelli, A., Lengauer, C., Kinzler, K. W., Vogelstein, B., and Velculescu, V. E. (2002). Tumorigenesis: RAF/RAS oncogenes and mismatch‐repair status. Nature 418, 934. Repasky, G. A., Chenette, E. J., and Der, C. J. (2004). Renewing the conspiracy theory debate: Does Raf function alone to mediate Ras oncogenesis? Trends Cell Biol. 14, 639–647. Richly, H., Kupsch, P., Passage, K., Grubert, M., Hilger, R. A., Kredtke, S., Voliotis, D., Scheulen, M. E., Seeber, S., and Strumberg, D. (2003). A phase I clinical and pharmacokinetic study of the Raf kinase inhibitor (RKI) BAY 43‐9006 administered in combination with doxorubicin in patients with solid tumors. Int. J. Clin. Pharmacol. Ther. 41, 620–621. Richly, H., Kupsch, P., Passage, K., Grubert, M., Hilger, R. A., Voigtmann, R., Schwartz, B., Brendel, E., Christensen, O., Haase, C. G., and Strumberg, D. (2004). Results of a phase I trial of BAY 43‐9006 in combination with doxorubicin in patients with primary hepatic cancer. Int. J. Clin. Pharmacol. Ther. 42, 650–651. Sebolt‐Leopold, J. S., and Herrera, R. (2004). Targeting the mitogen‐activated protein kinase cascade to treat cancer. Nat. Rev. Cancer 4, 937–947. Sebolt‐Leopold, J. S., Van Becelaere, K., Hook, K., and Herrera, R. (2003). Biomarker assays for phosphorylated MAP kinase. Their utility for measurement of MEK inhibition. Methods Mol. Med. 85, 31–38. Sharma, A., Trivedi, N. R., Zimmerman, M. A., Tuveson, D. A., Smith, C. D., and Robertson, G. P. (2005). Mutant V599EB‐Raf regulates growth and vascular development of malignant melanoma tumors. Cancer Res. 65, 2412–2421. Singer, G., Oldt, R., 3rd, Cohen, Y., Wang, B. G., Sidransky, D., Kurman, R. J., and Shih, I. M. (2003). Mutations in BRAF and KRAS characterize the development of low‐grade ovarian serous carcinoma. J. Natl. Cancer Inst. 95, 484–486. Strumberg, D., Richly, H., Hilger, R. A., Schleucher, N., Korfee, S., Tewes, M., Faghih, M., Brendel, E., Voliotis, D., Haase, C. G., Schwartz, B., Awada, A., Voigtmann, R., Scheulen, M. E., and Seeber, S. (2005). Phase I clinical and pharmacokinetic study of the Novel Raf kinase and vascular endothelial growth factor receptor inhibitor BAY 43‐9006 in patients with advanced refractory solid tumors. J. Clin. Oncol. 23, 965–972. Strumberg, D., and Seeber, S. (2005). Raf kinase inhibitors in oncology. Onkologie 28, 101–107. Strumberg, D., Voliotis, D., Moeller, J. G., Hilger, R. A., Richly, H., Kredtke, S., Beling, C., Scheulen, M. E., and Seeber, S. (2002). Results of phase I pharmacokinetic and pharmacodynamic studies of the Raf kinase inhibitor BAY 43‐9006 in patients with solid tumors. Int. J. Clin. Pharmacol. Ther. 40, 580–581. Wilhelm, S., and Chien, D. S. (2002). BAY 43–9006: Preclinical data. Curr. Pharm. Des. 8, 2255–2257. Wilhelm, S. M., Carter, C., Tang, L., Wilkie, D., McNabola, A., Rong, H., Chen, C., Zhang, X., Vincent, P., McHugh, M., Cao, Y., Shujath, J., Gawlak, S., Eveleigh, D., Rowley, B., Liu, L., Adnane, L., Lynch, M., Auclair, D., Taylor, I., Gedrich, R., Voznesensky, A., Riedl, B., Post, L. E., Bollag, G., and Trail, P. A. (2004). BAY 43‐9006 exhibits broad
612
regulators and effectors of small GTPases: Ras family
[48]
spectrum oral antitumor activity and targets the RAF/MEK/ERK pathway and receptor tyrosine kinases involved in tumor progression and angiogenesis. Cancer Res. 64, 7099–7109. Yazdi, A. S., Palmedo, G., Flaig, M. J., Puchta, U., Reckwerth, A., Rutten, A., Mentzel, T., Hugel, H., Hantschke, M., Schmid‐Wendtner, M. H., Kutzner, H., and Sander, C. A. (2003). Mutations of the BRAF gene in benign and malignant melanocytic lesions. J. Invest. Dermatol. 121, 1160–1162. Yuen, S. T., Davies, H., Chan, T. L., Ho, J. W., Bignell, G. R., Cox, C., Stephens, P., Edkins, S., Tsui, W. W., Chan, A. S., Futreal, P. A., Stratton, M. R., Wooster, R., and Leung, S. Y. (2002). Similarity of the phenotypic patterns associated with BRAF and KRAS mutations in colorectal neoplasia. Cancer Res. 62, 6451–6455.
[48] Yeast Screens for Inhibitors of Ras–Raf Interaction and Characterization of MCP Inhibitors of Ras–Raf Interaction By VLADIMIR KHAZAK, JURAN KATO‐STANKIEWICZ, FUYU TAMANOI , and ERICA A. GOLEMIS Abstract
Because of the central role of Ras in cancer cell signaling, there has been considerable interest in developing small molecule inhibitors of the Ras signaling pathways as potential chemotherapeutic agents. This chapter describes the use of a two‐hybrid approach to identify the MCP compounds, small molecules that disrupt the interaction between Ras and its effector Raf. We first outline the reagent development and selection/ counter selection methods required to successfully apply a two‐hybrid approach to isolation of MCP compounds. Separately, we describe the collateral benefits of this screening approach in yielding novel antifungal compounds. We then discuss secondary physiological validation approaches to confirm the MCP compounds specifically target Ras–Raf signaling. Finally, we develop a decision tree for subsequent preclinical characterization and optimization of this class of pathway‐targeted reagent.
Introduction
Cell signaling processes depend on the regulated, transient interactions of proteins and protein complexes in response to an initiating stimulus. As a consequence of these interactions, ‘‘information’’ is exchanged, with proteins proximal to an activating signal often causing physical modification (e.g., phosphorylation) of other proteins distal to the signal, so as to alter METHODS IN ENZYMOLOGY, VOL. 407 Copyright 2006, Elsevier Inc. All rights reserved.
0076-6879/06 $35.00 DOI: 10.1016/S0076-6879(05)07048-5