Source of angiopoietin-2 in the sera of women during pregnancy

Microvascular Research 84 (2012) 367–374

Contents lists available at SciVerse ScienceDirect

Microvascular Research journal homepage: www.elsevier.com/locate/ymvre

Regular Article

Source of angiopoietin-2 in the sera of women during pregnancy C. Woolnough a, Y. Wang a, C.Y. Kan a, J.M. Morris a, V. Tasevski a, b, c,⁎, 1, A.W. Ashton a, 1 a b c

Division of Perinatal Research, Kolling Institute of Medical Research, Royal North Shore Hospital, University of Sydney, St Leonards, New South Wales, Australia Pacific Laboratory Medicine Services, St Leonards, New South Wales, Australia Department of Cell and Molecular Biology, University of Technology Sydney, New South Wales, Australia

a r t i c l e

i n f o

Article history: Accepted 16 August 2012 Available online 17 September 2012

a b s t r a c t Placental development requires coordinated angiogenesis regulated by multiple factors including angiopoietins. Previously we demonstrated that the concentration of angiopoietin-2 (Ang-2) in the sera of women rises markedly in pregnancy in early gestation. This increase is reduced in pregnancies subsequently complicated by intrauterine growth restriction (IUGR). We now show that the concentration of Ang-2, but not Ang-1, in maternal serum is increased during normal pregnancy, peaking at the end of the first trimester. We also demonstrate that a key source of the elevated Ang-2 levels during pregnancy is decidual endothelial cells (DECs) but not cytotrophoblasts. Secretion of Ang-2 by DECs relies on the release from intracellular stores and the synthesis of new Ang-2 protein and is regulated by serum factors at a translational level. Further studies on the role of Ang-2 during pregnancy are warranted as well as the evaluation of Ang-2 as a marker to predict adverse pregnancy outcomes. Crown Copyright © 2012 Published by Elsevier Inc. All rights reserved.

Introduction Angiopoetin-2 (Ang-2), first characterised in 1997, consists of 496 amino acids and contains a coiled-coil domain, a fibrinogen-like domain and a secretion signal peptide (Maisonpierre et al., 1997). Three isoforms of Ang-2 have been identified (Kim et al., 2000a; Mezquita et al., 2000) and these isoforms share up to 60% homology with angiopoietin-1 (Ang-1) (Maisonpierre et al., 1997). Both Ang-1 and Ang-2 have been shown to bind with similar affinity to the tyrosine kinase receptor Tunica interna endothelial cell kinase-2 (Tie-2) (Davis et al., 1996; Maisonpierre et al., 1997; Fiedler, et al., 2003); however, a recent study by Yuan et al. (2009) demonstrated Ang-1 has a higher binding affinity to Tie-2 than Ang-2. Many of the actions of Ang-2 are competitive and antagonistic to Ang-1. Ang-2 competes with Ang-1 for Tie-2 binding (Maisonpierre et al., 1997), inhibits Ang-1-induced receptor phosphorylation and the chemotactic effects of Ang-1 on human umbilical vein endothelial cells (HUVECs) (Maisonpierre et al., 1997; Witzenbichler et al., 1998; Yuan et al., 2009). Attenuation of Ang-1-induced Tie-2 phosphorylation by Ang-2 is dose-dependent (Yuan et al., 2009). Ang-1 increases

Abbreviations: BFA, Brefeldin A; CHX, Cycloheximide; DECs, Decidual endothelial cells; ECs, Endothelial cells. ⁎ Corresponding author at: Perinatal Research, Level 10 Kolling Building, Royal North Shore Hospital, St Leonards NSW 2065 Australia. Fax: +61 2 9906 1872. E-mail address: [email protected] (V. Tasevski). 1 Co-senior authors.

vascularisation, stabilises the vessel wall and prevents vascular leakage (Gamble et al., 2000; Suri et al., 1996; Thurston et al., 1999, 2000). In contrast, Ang-2 destabilises vessel walls and promotes vessel regression in the absence of VEGF or vessel sprouting (Maisonpierre et al., 1997; Lobov et al., 2002) and migration (Yuan et al., 2009) in the presence of VEGF. Mouse embryos that over-express Ang-2 are smaller and have a disrupted vascular network in a more severe form than the mice lacking either Ang-1 or Tie-2 (Maisonpierre et al., 1997). A recent study by Thomas et al. (2010) suggests that Ang-2-mediated destabilisation of the vessel wall may occur via formation of a Tie-2/αvβ3 integrin complex and the activation of the focal adhesion kinase (FAK) pathway. A number of studies however reveal a complicated role of Ang-2. At high concentrations Ang-2 can phosphorylate Tie-2 and other kinases, such as phosphatidylinositol 3′-kinase (PI 3-kinase), to induce an anti-apoptotic effect in HUVECs (Kim et al., 2000b); and promote ECs survival and migration (Yuan et al., 2009). Studies using knockout mice show that Ang-2 is required for normal lymphatic tissue development (Gale et al., 2002). Moreover, Ang-2 has additive effects to those of Ang-1 in a cutaneous wound healing model in the ear; however, Ang-2 plays an antagonistic role in Ang-1 induced blood and lymphatic remodelling in the trachea, suggesting cell type specific roles of Ang-2 (Kim et al., 2007). Ang-2 is expressed by endothelial cells in some physiological states (e.g. wound healing) and tissues (e.g. placenta) (Maisonpierre et al., 1997). Moreover, Ang-2 expression is observed in pathological tissues including various tumours (Stratmann et al., 1998; Tanaka et al., 1999; Kim et al., 2000a) and the respiratory epithelium of asthma patients (Makinde and Agrawal, 2011). Ang-2 is up-regulated under hypoxic conditions, by growth factors (such as vascular endothelial

0026-2862/$ – see front matter. Crown Copyright © 2012 Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.mvr.2012.08.003

368

C. Woolnough et al. / Microvascular Research 84 (2012) 367–374

growth factor (VEGF) and basic fibroblast growth factor), and by the transcriptional regulators HoxB5, GATA-2, Ets-1 (Mandriota and Pepper, 1998; Oh et al., 1999; Simon et al., 2008; Winnik et al., 2009). Synthesized Ang-2 is stored in Weibel–Palade bodies and released upon stimulation (Fiedler et al., 2004). The role of angiopoietins in the establishment and maintenance of normal pregnancy has not been studied extensively. We described that Ang-2 concentration in serum collected from normal pregnancy during first trimester is approximately 16 fold higher than nonpregnant serum (Wang et al., 2007). The aims of the current study were to 1) characterize the concentration of Ang-2 throughout the gestation period; and 2) identify the source(s) of the increased Ang-2 in serum during pregnancy.

Briefly, the villous tissue was washed and digested with 1% (w/v) trypsin, 0.08% (w/v) DNase I, 0.08% (w/v) EDTA overnight at 4 °C. Digestion of the villi was continued for another 15 min at 37 °C the next day and stopped with the addition 20% (v/v) FBS. The digested mixture was strained and the cytotrophoblasts were collected by centrifugation at 1000 g for 5 min at 4 °C. The resulting cell pellets were passed through a 70 μm cell strainer (BD Biosciences, USA) and centrifuged at 1000 g for 10 min at 4 °C. The resulting pellets were separated using a Percoll gradient and cells with a density between 1.048 and 1.062 g/mL were collected and subjected to a negative selection of anti-HLA Class I and anti-HLA Class II coated Dynabeads (Invitrogen, USA). Cytotrophoblasts were cultured using the same medium and conditions as described in above (DECs culturing conditions).

Materials and methods

Immunohistochemistry and immunocytochemistry

Subjects and sample collection

Immnohistochemistry Slides bearing sections of paraffin-embedded tissues (5 μm) were heated to 58 °C for 10 min and washed with SolV21C (Muraban Laboratories, Australia) followed by rehydration through graded alcohols. Antigen retrieval was carried out by incubation in retrieval solution (0.05% (w/v) EDTA, 0.032% (w/v) Tris sodium citrate, 0.025% (w/v) Tris base, pH 6.0) in the microwave (>700 W) for 7 min. Additional retrieval solution was added and the slides were microwaved for another 8 min. The slides were allowed to cool at room temperature for 20 min before they were rinsed for 5 min with RO-water and TBST (Tris-buffered saline with 0.1% Tween 20). Endogenous peroxidise activity was blocked by incubation with 0.2% (w/v) H2O2 for 15 min and non-specific binding blocked by incubation with serum free protein block, (Dako, Denmark) for another 15 min. Sections were probed with a primary antibody against Ang-2, or isotype-matched negative control antibody (R&D system, USA), for 1 h. Presence of Ang-2 was detected using Universal LSAB™2 Kit/HRP, Rabbit/Mouse (Dako, Denmark) according to manufacturer's instructions. Haematoxylin was added and the sections washed with MilliQ water until it is clear. After coverslipping images were captured and analysed using SIS View Fire Wire and an Olympus Bx41 microscope.

This study was approved by the Northern Sydney Health Human Research Ethics Committee and all subjects gave informed consent. To establish serum levels of Ang-1, Ang-2 and soluble Tie-2 (sTie-2), blood was collected from two groups of women: 1) non-pregnant women of reproductive age not taking contraceptive medication (n = 30), and 2) women with non-complicated singleton pregnancies (n = 53). The non-pregnant subjects were recruited from healthy volunteers at Royal North Shore Hospital, Australia. The pregnant women were recruited from the antenatal clinic at Royal North Shore Hospital, Australia at gestational ages 8, 10–13, 18, 28 and 36 weeks. All serum samples were stored at − 20 °C before analysis. Enzyme-linked immunosorbent assay (ELISA) for Ang-1, Ang-2 and sTie-2 Concentrations of Ang-1, -2 and sTie-2 in pregnant serum and tissue culture medium were measured in duplicate using commercially available ELISA kits (R&D Systems, USA). A standard curve of the recombinant Ang-1, Ang-2 or sTie-2 proteins provided was prepared according to the manufacturer's instructions. The kits are widely used in many research groups for detection of Ang-1, Ang-2 or sTie-2 in serum/body fluid/liquid reagents (Iribarren, et al., 2011; Lukasz et al., 2008; Patel et al., 2009; Scholz et al., 2007; Wang et al., 2007). In the current study, the detection limit for Ang-1 was 180 pg/mL, 125 pg/mL for Ang-2 and 320 pg/mL for sTie-2. The inter-assay coefficients of variation were 10–15% for all ELISAs. Cell culture Isolation of decidual endothelial cells (DECs) Uterine decidual biopsies were collected from non complicated pregnancies at the time of caesarean section. DECs were isolated by positive magnetic selection using lectin and cultured to passage five using the established protocols by Gallery et al. (1991). Experiments were conducted at passage five in M199 media (Invitrogen, USA) containing either pooled 20% first trimester serum (from non-complicated pregnancies at 10–13 weeks) or pooled 20% third trimester serum (from non-complicated pregnancies at 26–28 weeks) with cells incubated at 37 °C in a humidified incubator supplemented with 5% (v/v) CO2. For experiments using Brefeldin A (BFA), BFA was dissolved in methanol (10 mg/mL) and added to culture medium at a final concentration of 5 μM. The equivalent volume of methanol was added to another cell culture dishes as a vehicle control. For experiments requiring cycloheximide (CHX), CHX was dissolved in methanol (1 mg/mL) and added to cell culture medium at a final concentration of 5 μM. Isolation of cytotrophoblasts Cytotrophoblasts were isolated from term placental villi using procedures described in Ding et al. (1996) and Campbell et al. (2003).

Immunocytochemistry Isolated DECs and cytotrophoblasts were cultured on 13 mm coverslip and fixed with 3.7% (w/v) paraformaldehyde solution in phosphate buffered saline (PBS) containing 0.2% (v/v) Triton X. Fixation was performed for 30 min at room temperature. Fixed cells were blocked and detected as described above in the immunohistochemistry experiments. In addition to the angiopoietin-2 detection, primary antibodies anti-human CD31 (Dako, Denmark) and anti-human cytokeratin 7 (CK7) and were used to verify the purity of the isolated DEC and cytotrophoblast cultures respectively. Semi-quantitative reverse transcription PCR (RT-PCR) Cellular RNA was protected by adding RNAprotect Cell Reagent (QIAGEN, Australia) to the cell culture supernatant and extracted using the RNeasy Plus Mini Kit (QIAGEN, Australia). Reverse transcription was performed using 1 μg of total cellular RNA and Bioscript™ reverse transcriptase (Bioline, Australia). The resulting cDNA was subjected to PCR using BIOTAQ DNA polymerase (Bioline, Australia) under the following conditions: 3 minute denaturation step at 94 °C, followed by 23–35 cycles of 94 °C at 40 s, 57 °C at 50 s, 72 °C at 40 s and a final 3 minute extension step at 72 °C. Each PCR contained 1× manufacturer buffer, 1.5 mM MgCl2, 0.3 μM forward and reverse primers, 0.5 mM dNTPs. The primer sequences were as follows: Ang-2 forward 5′‐CAGATTTTGGACCAGACCAGTG‐3′; Ang-2 reverse 5′‐ACTGTAGTTGGATGATGTGCTTG;

C. Woolnough et al. / Microvascular Research 84 (2012) 367–374

369

β2microblobulin (β2M) forward 5′‐ACCCCACTGAAAAAGATGA‐3′; β2M reverse 5′‐ATCTTCAAACCTCCATGATG‐3′. The resulting PCR products were separated on a 2% agarose gel (in Tris-acetate-EDTA buffer) and visualised by Gel Red staining (Biotium, USA). The intensity of the band was quantified using Image J software (National Institute of Health, USA). Western blotting Cells were washed with ice-cold PBS and centrifuged at 1000 rpm for 5 min at 4 °C. Protein extracts were prepared by incubation of cells with lysis buffer (50 mM Tris HCl, 150 mM NaCl, 5 mM EDTA, 0.5% (v/v) Triton X 100, Complete Protease Inhibitor Cocktail Tablets, (Roche, Switzerland), pH 7.4) for 30 min on ice followed by sonication for 15 s and a further 15 minute incubation on ice. Cell debris was removed by centrifugation at 10,000 g for 10 min. Protein content of lysates was quantified using the Quick Start Bradford Protein Assay Kit 3 (Bio-Rad Laboratories, Australia). Equal amounts of protein were separated using 10% SDS-PAGE and transferred on to a nitrocellulose (Bio-Rad Laboratories, USA) or PVDF membrane (Millipore, Australia). The membrane was blocked with 5% (w/v) skim milk in TBST and probed with antibodies against human Ang-2 (R&D system, USA) and β-actin (Sigma, USA). The bound antibody was detected using HRP-labelled secondary antibody (Dako, Denmark) and visualised by ECL plus Western blotting detection system (GE Healthcare, Australia). Statistical analysis Values in the graphs are mean ± SE. ANOVA and Tukey's tests were performed using GraphPad Prism (version 5.02) to compare serum levels of Ang-1, Ang-2 and sTie2 at various gestation week and secretion of Ang-2 by DECs under various culturing conditions. Statistical significance was defined as p b 0.05. Results Ang-2 concentration in serum is increased during pregnancy Serum levels of Ang-1, Ang-2 and sTie2 of women at various stages of gestation are illustrated in Fig. 1. One-way ANOVA showed mean serum levels of Ang-1, Ang-2, and sTie2 were different across the gestational period (pb 0.001 for Ang-1 and Ang-2; p= 0.01 for sTie2). Results of Tukey's test showed serum levels of Ang-1 at week 8 were significantly lower in comparison to Ang-1 levels measured at other timepoints (pb 0.05). Serum levels of Ang-2 were significantly increased in weeks 8, 13, and 18 compared to those observed in the later stages of pregnancy studied (pb 0.05). Serum levels of sTie-2 at week 8 are significantly higher than non-pregnant, week 13 and week 18 (pb 0.05). These results suggested serum levels of Ang-1 and sTie2 fluctuate at week 8, otherwise, were stable during the pregnancy. Serum levels of Ang-2 were higher at all points throughout gestation compared to non-pregnant women (pb 0.05). Ang-2 is secreted from maternal DECs Immunohistochemical staining of tissues derived from pregnancies at term demonstrated Ang-2 expression in both the decidua (Fig. 2) and the syncytium of the placenta (Fig. 3). Multiple cell types, such as stromal cells and endothelial cells (arrows), express Ang-2 in the decidua (Fig. 2). In addition, endothelial cells (as denoted by CD31 staining (arrows)) and the syncytiotrophoblasts (identified by cytokeratin 7 staining) of the placenta are also positive for Ang-2 staining (Fig. 3). Our interest is the vascular remodelling/angiogenesis during placental development. Given both endothelial cells and cytotrophoblasts are

Fig. 1. Circulating levels of components of the angiopoietin system during pregnancy. Concentration of (A) Ang-2, (B) Ang-1, (C) sTie-2 in non-pregnant (week 0, n= 30) and pregnant serum throughout gestation (weeks 8, 10–13, 18, 28, and 36, n = 53). Ang-2 levels at weeks 8, 10–13, 18 were significantly higher than the rest of the gestation period (*p = b0.05). Serum level of Ang-1 at week 8 is significantly lower compare to the rest of the gestation period (*p = b0.05). Serum level of sTie-2 is higher compare to the rest of the gestation period (*p = b0.05).

involved in this process, DECs and cytotrophoblasts, from term decidua and placenta respectively, were therefore isolated for further study. Purity of the isolated DECs and cytotrophoblasts cultures were confirmed by immunohistochemical staining and representative results are shown (Fig. 4). Over 90% of isolated DECs (Fig. 4A) and cytotrophoblasts (Fig. 4B) are CD31 and CK7 positive, respectively, confirming the integrity of the isolated populations. Immunocytochemical staining for Ang-2 expression indicated that DECs showed positive staining with a punctate pattern (Fig. 4C). This is consistent with a previous study showing that Ang-2 is stored in the Weible–Palade body in ECs (Fiedler et al., 2004). No positive staining for Ang-2 was detected in isolated cultured cytotrophoblasts (Fig. 4C).

370

C. Woolnough et al. / Microvascular Research 84 (2012) 367–374

Fig. 2. Immunohistochemical staining of term decidua for Ang-2. Staining of serial sections with CD31 and negative IgG indicated endothelial cells and areas of specific staining. Ang-2 positive staining was observed in the endothelial cells (arrows) and stromal cells of the decidua. Magnification (400× total), images are representative of at least 10 samples per group.

Expression of Ang-2 in DECs and cytotrophoblasts (from 4 independent donors) was determined by semi-quantitative RT-PCR and Western blot. Ang-2 mRNA transcript levels were lower (p ≤ 0.05) in cytotrophoblasts compared to DECs, as assessed by RT-PCR (Fig. 5A). Similarly, Ang-2 intracellular protein was detectable in isolated DECs, but not cytotrophoblasts, by immunoblotting (Fig. 5B). The capacity of DECs to release Ang-2 was examined by ELISA. The conditioned media from cultures of DECs, but not cytotrophoblasts, contained elevated levels of Ang-2 at both 24 and 48 h after seeding (n = 4, p b 0.05) (Fig. 5C). Moreover, the CD31 negative fraction of the decidual isolates failed to secrete Ang-2 indicating that DECs are the key source in the decidua. These results are consistent with the

immunocytochemistry results that Ang-2 is expressed in DECs but not cytotrophoblasts. To determine the mechanism of Ang-2 release by DEC we prevented vesicular transport and protein synthesis by the inclusion of 5 μM BFA (an inhibitor of Golgi network transportation) or cycloheximide (CHX) for up to 24 h. DECs (from 3 different donors) were not cultured with BFA for more than 12 h due to the associated cytotoxicity (data not shown). Secretion of Ang-2 from DECs was demonstrated by a linear increase of Ang-2 levels in conditioned medium over 24 h (Fig. 6A). Release of Ang-2, which was at a rate of approximately 0.46 ng/mL/h, was not affected by the addition of the vehicle control methanol (solvent of the BFA and CHX) (p-value =0.36 by ANOVA). The increasing

Fig. 3. Immunohistochemical staining of Ang-2 in term placenta. Staining of serial sections with CD31, cytokeratin 7 (CK7) and negative IgG indicated endothelial cells, trophoblasts and areas of specific staining. Positive staining was observed in blood vessels (blue arrows) and syncytiotrophoblast layer (black arrows). Magnification (400× total), images are representative of at least 10 samples per group.

C. Woolnough et al. / Microvascular Research 84 (2012) 367–374

371

Fig. 4. Confirmation of Ang-2 release in isolated cells. Immunocytochemical staining of isolated cell populations (CD31 and CK7, respectively) verified DEC (A) and cytotrophoblast (B) isolates as more than 90% pure. Staining for Ang-2 (C) indicated positive staining in DECs but not cytotrophoblasts. Mouse IgG negative control was used to validate specific staining. Magnification (400× total), images are representative of at least 4 individual donors.

concentration of Ang-2 from control and methanol treated DECs was associated with increased intracellular Ang-2 (Fig. 6B). Addition of either BFA or CHX inhibited the release of Ang-2 from DECs within 4 h,

compared to vehicle control (Fig. 6A) (pb 0.01 and pb 0.0001, respectively). The effect of CHX was associated with a reduction of intracellular Ang-2 (Fig. 6B). These results suggest that the accumulation of Ang-2 in

Fig. 5. Characterisation of the level of Ang-2 regulation in DECs and CTB. (A) Ang-2 mRNA, and (B) intracellular and (C) secreted Ang-2 protein levels in cultured DECs and cytotrophoblasts were determined. Images are representative of at least 4 isolations per group. Data are represented as mean ± SD (n = 4). Significance (p ≤ 0.05) from control (*) is indicated.

372

C. Woolnough et al. / Microvascular Research 84 (2012) 367–374

are similar when DECs are cultured in first and third trimester serum. However, a significant decrease in intracellular Ang-2 levels was observed in DECs cultured with third trimester versus first trimester serum (pb 0.05) (Fig. 7B). Thus, Ang-2 release appears to be regulated at a post-transcriptional level. This decrease in intracellular Ang-2 correlated with decreased secreted Ang-2 in conditioned media of DECs cultured with third trimester serum (Fig. 7C). Taken together, this suggests that Ang-2 secretion from DECs remains functional throughout the pregnancy and is responsive to factors present in the extracellular milieu (serum factors) which may control the rate of placental growth and angiogenesis. Discussion

Fig. 6. Mechanism of Ang-2 release from DEC involves new synthesis and active release. (A) Concentration of Ang-2 in the conditioned medium of control (▲), vehicle (methanol; ■), BFA (○), and CHX (▽) treated DECs over 24 h. Data are represented as mean ± SD (n = 3). Significance (p ≤ 0.05) from control (*) is indicated. (B) Levels of intracellular Ang-2 at times corresponding to the release assays were also determined. Protein loading was monitored using β-actin levels. Representative blots are shown (n = 3).

culture medium results from both active secretion and new synthesis of Ang-2 protein by DECs. Taken together, these data show DECs, but not cytotrophoblasts, express and release Ang-2 in vitro. Up-regulation of Ang-2 when cells were cultured with first trimester serum Higher Ang-2 concentrations were detected in pregnant serum during first trimester than third trimester (Fig. 1A). We hypothesize this is due to a change in circulating growth factors in the serum rather than an intrinsic function of DECs. To examine whether DECs may modulate the release of Ang-2 during different gestational periods we compared the expression and secretion of Ang-2 from isolated DECs when medium was supplemented with serum from non-complicated first trimester pregnancies or third trimester pregnancies (Fig. 7). Ang-2 levels in medium collected from DECs cultures were measured and adjusted with the corresponding blank. A representative image of Ang-2 RT-PCR and the combined data from three independent experiments are shown in Fig. 7A. These results indicate that Ang-2 transcript levels

The novel data presented here show that 1) serum levels of Ang-2 are increased during the early stage of gestation (first trimester) while serum levels of Ang-1 and sTie2 are relatively stable throughout the gestation; 2) maternal DECs but not cytotrophoblasts secrete Ang-2 in vitro and 3) the secretion of maternal Ang-2 by DECs relies on both immediate release of Ang-2 from WB bodies as well as de novo protein synthesis. These results have a number of implications. Firstly, the increase in serum level of Ang-2 during first trimester suggests that Ang-2 is required at the early stage of pregnancy. Together with our previous study which showed serum level of Ang-2 is repressed in IUGR pregnancy (Wang et al., 2007), our results provide further support that Ang-2 is a potential biomarker that allows early detection of unfavourable pregnancy outcomes (e.g. IUGR). In addition, this increase of Ang-2 in pregnancy serum coincides with the timing of placental vascularisation and development. The initial stage of placentation involves remodelling of decidual spiral arteries by extravillous cytotrophoblasts (EVT) invading the decidua (Brosens et al., 1967; Craven et al., 1998; Pijnenborg et al., 1980, 1983; Robertson, 1976). Remodelling of spiral arteries is a multi-step event involving dilation of vessels, swelling of endothelial cells, deposition of the periodic acid Schiff-positive ‘fibrinoid-like’ material into the vessel walls, separation of vascular smooth muscle cell layers, progressive loss of vascular smooth muscles and stabilisation of wall of the lumen by fibrinoid and intramural EVT (Brosens et al., 1967; Craven et al., 1998; Pijnenborg et al., 1980, 1983; Robertson, 1976). It has previously been shown that Ang-2 destabilises vessel walls and promotes vessel regression in the absence of VEGF or vessel sprouting in the presence of VEGF (Maisonpierre et al., 1997; Lobov et al., 2002). The observed up-regulation of Ang-2 during first trimester is likely to be involved in the separation of vascular smooth cells during spiral arteries remodelling which is usually complete by the end of first trimester. The current study also shows DECs, but not cytotrophoblasts, are capable of secreting Ang-2 in vitro suggesting DECs are a significant source of the Ang-2 in pregnant serum. This indicates that placental development may not solely be dependent on foetal factors (e.g. factors that affect trophoblast invasion) but that maternal factors also regulate vascular remodelling. Endothelial cells from the villous compartment of the placenta have not been used in the current study; however, we believe this will not have a serious impact on our conclusions. Serum levels of Ang-2 in pregnant women are approximately 16 times higher than non-pregnant subjects and peak at the end of the first trimester. The mean volume of placenta at week 12 of gestation is 83 cm 3 (de Paula et al., 2008). This small volume of placenta suggests the number of endothelial cells in the villous compartment is relatively small at that stage. It is, therefore, unlikely that these small numbers of endothelial cells from the placenta would produce the increase in serum level of Ang-2 during first trimester of pregnancy. The substantial increase in the quantity of Ang-2 in pregnant serum during first trimester is more likely to be produced by endothelial cells in the decidua. Our study suggests that DECs as the main source of Ang-2. Lash et al. (2006) has shown that decidua-resident uterine natural killer cells

C. Woolnough et al. / Microvascular Research 84 (2012) 367–374

373

Fig. 7. Regulation of Ang-2 synthesis by pregnancy-related serum. (A) The effects of first or third trimester serum on Ang-2 synthesis by DECs. mRNA levels were detected by RT-PCR (at 23, 25 and 27 PCR cycles). Amplification of β2M mRNA levels was used as a loading control. Quantification of cycle 23 is shown. Data are represented as mean ± SD (n = 4). (B) Immunoblotting for intracellular Ang-2 was used to determine protein synthesis. β-actin protein was used as a loading control. Ang-2 levels were corrected for β-actin and quantified accordingly. Representative blots are shown (n = 3). (C) Concentrations of Ang-2 in DEC cell culture medium supplemented with first or third trimester serum. Data are represented as mean ± SD (n = 4). Significance (p ≤ 0.05) from first trimester serum (*) is indicated.

(uNK) are also capable of secreting Ang-2. It is possible that multiple cell types contribute to the secretion of Ang-2 during pregnancy and it is currently unknown what the relative contributions may be in maintaining an appropriate level of Ang-2 during pregnancy. Similarly, the discordant data on the production of Ang-2 by cytotrophoblasts in situ and in vitro suggests the cytotrophoblasts alone cannot express Ang-2 but they require interaction with other cellular or matrix components in vivo for the expression of Ang-2. Further studies are required to investigate the contribution of all these cell types and the extracellular milieu to Ang-2 production during normal pregnancy.

The profile of Ang-2 serum levels during pregnancy exhibits a similar pattern to human chorionic gonadotropin (hCG) (reviewed in Norris et al., 2011). Miyabayashi et al. (2005) showed that Ang-2 mRNA levels in the ovary are increased in response to hCG. We did not detect any effect of hCG on the secretion of Ang-2 (results not shown), although secretion of Ang-2 in our hands is not strongly associated with increases in Ang-2 mRNA level. Given that there are numerous serum factors, it is difficult for one to identify a pregnancy specific serum factor that may be involved in the up-regulation of Ang-2 during pregnancy. Pichiule et al. (2004) suggests that increases

374

C. Woolnough et al. / Microvascular Research 84 (2012) 367–374

in Ang-2 during hypoxic conditions may be via a COX-2-dependent prostanoids pathway. Furthermore, a reduction of COX-2 expression was observed in pregnancy induced hypertension (Okawara et al., 2009). It would therefore, be of interest to investigate the correlation of Ang-2 secretion and COX-2 (and its downstream elements) expression during normal pregnancy. In conclusion, our study shows that Ang-2 is significantly elevated during pregnancy and that it is primarily of maternal origin. Secretion of Ang-2 by DECs relies on the synthesis of new Ang-2 protein and is regulated by serum factors at a translational level. Further studies are required to investigate if Ang-2 is a potential marker for prediction of unfavourable pregnancy outcome, as well as the specific mechanisms that may be involved in regulation of Ang-2, and its role in during human pregnancy.

Acknowledgments This study was supported by funding from the National Health and Medical Research Council and the Pacific Laboratory Medicine Services. We thank Dr Janice Brewer and Ms Susan Smith for her assistance with the histopathology work.

References Brosens, I.A., Robertson, W.B., Dixon, H.G., 1967. The physiological response of the vessels of the placental bed to normal pregnancy. J. Pathol. Bacteriol. 93, 569–759. Campbell, S., Rowe, J., Jackson, C.J., Gallery, E.D.M., 2003. In vitro migration of cytotrophoblasts through a decidual endothelial cell monolayer: the role of matrix metalloproteinases. Placenta 24, 306–315. Craven, C.M., Morgan, T., Ward, K., 1998. Decidual spiral artery remodelling begins before cellular interaction with cytotrophoblasts. Placenta 19 (4), 241–252. Davis, S., Aldrich, T.H., Jones, P.F., Acheson, A., Compton, D.L., Jalin, V., Ryan, T.E., Bruno, J., Radziejewski, C., Maisonpierre, P.C., 1996. Isolation of angiopoietin-1 a ligand for the Tie-2 receptor, by secretion trap expression cloning. Cell 87, 1161–1169. de Paula, C.F.S., Ruano, R., Campos, J.A.D.B., Zugaib, M., 2008. Placental volumes measured by 3-dimensional ultrasonography in normal pregnancies from 12 to 40 weeks' gestation. J. Ultrasound Med. 27, 1583–1590. Ding, Z.Q., Rowe, J., Sinosich, M.J., Saunders, D.M., Gallery, E.D.M., 1996. In-vitro secretion of prostanoids by placental villous cytotrophoblasts in pre-eclampsia. Placenta 17, 407–411. Fiedler, U., Krissl, T., Koidl, S., Weiss, C., Koblizek, T., Deutsch, U., Martiny-Baron, G., Marme, D., Augustin, H.G., 2003. Angiopoietin-1 and angiopoietin-2 share the same binding domains in the Tie-2 receptor involving the first Ig-like loop and the epidermal growth factor-like repeats. J. Biol. Chem. 278 (3), 1721–1727. Fiedler, U., Scharpfenecker, M., Koidl, S., Hegen, A., Grunow, V., Schmidt, J.M., Kriz, W., Thurston, G., Augustin, H.G., 2004. The Tie-2 ligand angiopoietin-2 is stored in and rapidly released upon stimulation from endothelial cell Weibel–Palade bodies. Blood 103 (11), 4150–4156. Gale, N., Thurston, G., Hackett, S., Renard, R., Wang, Q., McClain, J., Martin, C., Witte, C., Witte, M., Jackson, D., Suri, C., Campochiaro, P., Wiegand, S., Yancopoulos, G., 2002. Angiopoietin-2 is required for postnatal angiogenesis and lymphatic patterning, and only the latter role is rescued by angiopoietin-1. Dev. Cell 3, 411–433. Gallery, E.D., Rowe, J., Schrieber, L., Jackson, C.J., 1991. Isolation and purification of microvascular endothelium from human decidual tissue in the late phase of pregnancy. Am. J. Obstet. Gynecol. 165 (1), 191–196. Gamble, J.R., Drew, J., Trezise, L., Underwood, A., Parsons, M., Kasminkas, L., Rudge, J., Yancopoulos, G., Vadas, M.A., 2000. Angiopoietin-1 is an antipermeability and anti-inflammatory agent in vitro and target cell junctions. Circ. Res. 87, 603–607. Iribarren, C., Phelps, B.H., Darbinian, J.A., McCluskey, E.R., Quesenberry, C.P., Hytopoulos, E., Vogelman, J.H., Orentreich, N., 2011. Circulating angiopoietins-1 and ‐2, angiopoietin receptor Tie-2 and vascular endothelial growth factor-A as biomarkers of acute myocardial infarction: a prospective nested case–control study. BMC Cardiovasc. Disord. 11, 31. Kim, I., Kim, J., Ryu, Y.S., Jung, S.H., Nah, J.J., Koh, G.Y., 2000a. Characterization and expression of a novel alternatively spliced human angiopoietin-2. J. Biol. Chem. 275 (24), 18550–18556. Kim, I., Kim, J., Moon, S., Kwak, H.J., Kim, N., Koh, G.Y., 2000b. Angiopoietin-2 at high concentration can enhance endothelial cell survival through the phosphatidylinositol 3′kinase/Akt signal transduction pathway. Oncogene 19, 4549–4552. Kim, K.E., Cho, C.H., Kim, H.Z., Baluk, P., McDonald, D.M., Koh, G.Y., 2007. In vivo actions of angiopoietins on quiescent and remodeling blood and lymphatic vessels in mouse airways and skin. Arterioscler. Thromb. Vasc. Biol. 27, 564–570.

Lash, G.E., Schiess, B., Kirkley, M., Innes, B.A., Cooper, A., Searle, R.F., Robson, S.C., Bulmer, J.N., 2006. Expression of angiogenic growth factors by uterine natural killer cells during early pregnancy. J. Leukoc. Biol. 80, 572–580. Lobov, I.B., Brooks, P.C., Lang, R.A., 2002. Angiopoietin-2 displays VEGF-dependent modulation of capillary structure and endothelial cell survival in vivo. PNAS 99 (17), 11205–11210. Lukasz, A., Hellpap, J., Horn, R., Kielstein, J.T., David, S., Haller, H., Kumpers, P., 2008. Circulating angiopoietin-1 and angiopoietin-2 in critically ill patients: development and clinical application of two new immunoassays. Crit. Care 129 (4), R94. Maisonpierre, P.C., Suri, C., Jones, P.F., Bartunkova, S., Wiegand, S.J., Radzijewski, C., Compton, D., McClain, J., Aldrich, T.H., Papadopoulos, N., Daly, T.J., Davis, S., Sato, T.N., Yancopoulos, G.D., 1997. Angiopoietin-2, a natural antagonist for Tie-2 that disrupts in vivo angiogenesis. Science 277 (55), 55–60. Makinde, T.O., Agrawal, K.K., 2011. Increased expression of angiopoietins and Tie-2 in the lungs of chronic asthmatic mice. Am. J. Respir. Cell Mol. Biol. 44, 384–393. Mandriota, S.J., Pepper, M.S., 1998. Regulation of angiopoietin-2 mRNA levels in bovine microvascular endothelial cells by cytokines and hypoxia. Circ. Res. 83 (8), 852–859. Mezquita, J., Mezquita, P., Montserrat, P., Mezquita, B., Francone, V., Vilagrasa, X., Mezquita, C., 2000. Genomic structure and alternative splicing of chicken angiopoietin-2. Biochem. Biophys. Res. Commun. 275, 643–651. Miyabayashi, K., Shimizu, T., Kawauchi, C., Sasada, H., Sato, E., 2005. Changes of mRNA expression of vascular endothelial growth factor, angiopoietins and their receptors during the periovulatory period in eCG/hCG-treated immature female rats. J. Exp. Zool. 303A, 590–597. Norris, W., Nevers, T., Sharma, S., Kalkunte, S., 2011. Review: hCG, preeclampsia and regulatory T cells. Placenta 25, S182–S185. Oh, H., Takagi, H., Suzuma, K., Otani, A., Matsumura, M., Honda, Y., 1999. Hypoxia and vascular endothelial growth factor selectively up-regulate angiopoietin-2 in bovine microvascular endothelial cells. J. Biol. Chem. 274 (22), 15732–15739. Okawara, M., Seki, H., Matsuoka, K., Hashimoto, F., Hayashi, H., Takeda, S., 2009. Examination of the expression of cyclooxygenase-2 placenta villi from sufferers of pregnancy induced hypertension. Biol. Pharm. Bull. 32 (12), 2053–2056. Patel, J.V., Abraheem, A., Chackathavil, J., Gunning, M., Creamer, J., Hughes, E.A., Lip, G.Y., 2009. Circulating biomarkers of angiogenesis as indicators of left ventricular systolic dysfunction amongst patients with coronary artery disease. J. Intern. Med. 265 (5), 562–567. Pichiule, P., Chavez, H.C., LaManna, J.C., 2004. Hypoxic regulation of angiopoietin-2 expression in endothelial cells. J. Biol. Chem. 279 (13), 12171–12180. Pijnenborg, R., Dixon, G., Robertson, W.B., Brosens, I., 1980. Trophoblastic invasion of human deciduas from 8 to 18 weeks of pregnancy. Placenta 1, 3–19. Pijnnborg, R., Bland, J.M., Robertson, W.B., Brosens, I., 1983. Uteroplacental arterial changes related to interstitial trophoblast migration in early human pregnancy. Placenta 4, 397–413. Robertson, W.B., 1976. Uteroplacental vasculature. J. Clin. Pathol. 29 (Suppl.), 9–17. Scholz, A., Rehm, V.A., Rieke, S., Derkow, K., Schulz, P., Neumann, K., Loch, I., Pascu, M., Wiedenmann, B., Berg, T., Schott, E., 2007. Angiopoietin-2 serum levels are elevated in patients with liver cirrhosis and hepatocellular carcinoma. Am. J. Gastroenterol. 102, 2471–2481. Simon, M.P., Tournaire, R., Pouyssegur, J., 2008. The angiopoietin-2 gene of endothelial cells is up-regulated in hypoxia by a HIF binding site located in its first intron and by the central factors GATA-2 and Ets-1. J. Cell. Physiol. 217, 809–818. Stratmann, A., Risau, W., Plate, K.H., 1998. Cell type-specific expression of angiopoietin1 and angiopoietin-2 suggests a role in glioblastoma angiogenesis. Am. J. Pathol. 153 (5), 1459–1466. Suri, C., Jones, P.F., Patan, S., Bartunkova, S., Maisonpierre, P.C., Davis, S., Sato, T.N., Yancopoulos, G.D., 1996. Requisite role of angiopoietin-1, a ligand for the Tie2 receptor, during embryonic angiogenesis. Cell 87, 1171–1180. Tanaka, S., Mori, M., Sakamoto, Y., Makuuchi, M., Sugimachi, K., Wands, J.R., 1999. Biological significance of angiopoietin-2 expression in human hepatocellular carcinoma. J. Clin. Invest. 103 (3), 341–345. Thomas, M., Felcht, M., Kruse, K., Kretschmer, S., Deppermann, C., Biesdorf, A., Rohr, K., Benest, A.V., Fiedler, U., Augustin, H.G., 2010. Angiopoeitin-2 stimulation of endothelial cells induces αvβ3 integrin internalisation and degradation. J. Biol. Chem. 285, 23842–23849. Thurston, G., Suri, C., Smith, K., McClain, J., Sato, T.N., Yancopoulos, G.D., McDonald, D.M., 1999. Leakage-resistant blood vessels in mice transgenically overexpressing angiopoietin-1. Science 286, 2511–2514. Thurston, G., Rudge, J.S., Ioffe, E., Zhou, H., Ross, L., Croll, S.D., Glazer, N., Holash, J., McDonald, D.M., Yancopoulos, G.D., 2000. Angiopoietin-1 protects the adult vasculature against plasma leakage. Nat. Med. 6, 460–463. Wang, Y., Tasevski, V., Wallace, E.M., Gallery, E.D., Morris, J.M., 2007. Reduced maternal serum concentrations of angiopoietin-2 in the first trimester precede intrauterine growth restriction associated with placental insufficiency. BJOG 114, 1427–1431. Winnik, S., Klinkert, M., Kurz, Y., Zoeller, C., Heinke, J., Wu, Y., Bode, C., Patterson, C., Moser, M., 2009. HoxB5 induces endothelial sprouting in vitro and modifies intussusceptive angiogenesis in vivo involving angiopoietin-2. Cardiovasc. Res. 83 (3), 558–565. Witzenbichler, B., Maisonpierre, P.C., Jones, P., Yancopoulos, G.D., Isner, J.M., 1998. Chemotactic properties of angiopoietin-1 and ‐2 ligands for the endothelial-specific receptor tyrosine kinase Tie-2. J. Biol. Chem. 273, 18514–18521. Yuan, H.T., Khankin, E.V., Karumanchi, A., Parikh, S.M., 2009. Angiopoietin 2 is a partial agonist/antagonist of Tie-2 signaling in the endothelium. Mol. Cell. Biol. 29 (8), 2011–2022.