- Email: [email protected]
South African sheep breeds: Population genetic structure and conservation implications
Small Ruminant Research 103 (2012) 112–119
Contents lists available at SciVerse ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
South African sheep breeds: Population genetic structure and conservation implications P. Soma a,∗ , A. Kotze b,c , J.P. Grobler b , J.B. van Wyk d a b c d
Agricultural Research Council, P/Bag X2, Irene 0062, South Africa Department of Genetics, University of the Free State, PO Box 339, Bloemfontein 9300, South Africa National Zoological Gardens of South Africa, PO Box 754, Tshwane 0001, South Africa Department of Animal, Wildlife and Grassland Sciences, University of the Free State, PO Box 339, Bloemfontein 9300, South Africa
a r t i c l e
i n f o
Article history: Received 28 July 2011 Received in revised form 9 September 2011 Accepted 13 September 2011 Available online 12 October 2011 Keywords: Genetic structure South African indigenous sheep breeds Microsatellites Conservation
a b s t r a c t This paper details the population genetic structure of South African indigenous, locally developed and introduced breeds using microsatellite markers, and the conservation implications of these results. Blood samples from 622 sheep, comprising 20 breeds, were collected from different regions in South Africa. All animals were genotyped at 12 microsatellite loci. Average unbiased heterozygosity (Hz) was lowest in the fat-rumped breeds (0.466); compared to higher average Hz values of 0.555 and 0.598 in the composite and indigenous fat-tailed breeds; and still higher values of 0.659 and 0.662 in Karakul and the wool breeds respectively. Analysis of patterns of differentiation showed that the average Fst value between fat-rumped and the fat-tailed indigenous breeds was 0.180, with an average Fst = 0.184 between indigenous fat-tailed and wool types, and a higher average Fst value of 0.260 between fat-rumped and wool type breeds. Fst values within breeds were generally lower. Results from both Bayesian analysis (STRUCTURE) and a neighbor-joining tree based on standard genetic distance confirmed the known patterns of relationships among these groups and (in some instances) breeds. The results of this study also suggest that the indigenous breeds studied have some uniqueness, which may well translate to local adaptation over time. These results thus provide additional support for programs aimed at the conservation of indigenous and locally developed breeds, in line with international programs that emphasize the conservation of indigenous animal genetic resources. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Sheep in Africa can be morphologically divided into four types: thin-tailed with hair, thin tailed with wool, fat tailed and fat rumped (Epstein, 1971). In 2000 the recognized number of African sheep breeds was 147 (Taberlet et al., 2008). According to archaeological records, sheep migrated to the southern point of Africa as recently as 2000 years ago (Plug and Badenhorst, 2001). Indigenous livestock species
∗ Corresponding author. Tel.: +27 126729218; fax: +27 12 6729214. E-mail address: [email protected] (P. Soma). 0921-4488/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.smallrumres.2011.09.041
and breeds sustained ancient pastoralists in this migration down the African continent. In South Africa indigenous and locally developed sheep breeds are important genetic resources as they have developed unique combinations of adaptive traits to best respond to pressures of the local environment (Peters et al., 2010). These include disease tolerance, fluctuations in nutrient availability and quality, extreme and harsh climatic conditions and ability to survive and reproduce for long periods of time, sometimes with poor quality feed (Hammond, 2000; Nsoso et al., 2004). A total of 23 sheep breeds are recognized through either breed societies or interest groups in South Africa (Campher et al.,
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
113
Table 1 Sheep breeds sampled, abbreviations useda , number sampled (n), classification and breed origin. Breed
Abbreviation
n
Type
Origin
Blackhead Persian Blackhead Speckled Persian Redhead Persian Redhead Speckled Persian Karakul Damara Namaqua Afrikaner Ronderib Afrikaner Pedi Swazi Zulu (Nguni) Van Rooy Dorper Afrino Dormer Dohne Letelle SA Mutton Merino SA Landsheep SA Merino
BhP (FR1) BhSP (FR2) RhP (FR3) RhSP (FR4) Kar Dam (FT1) Nam (FT2) RRA (FT3) Ped (FT4) Swa (FT5) Ngu (FT6) VanR (C1) Dor (C2) Let (W1) Dorm (W2) Doh (W3) Let (W3) SAMM (W4) SAL (W5) SAM (W6)
19 33 27 26 30 34 34 35 40 27 35 32 23 19 35 40 34 35 40 30
Fat rumped hair Fat rumped hair Fat rumped hair Fat rumped hair Fat-tailed fur Fat-tailed hair Fat-tailed hair Fat-tailed hair Fat-tailed hair Fat-tailed hair Fat-tailed hair Fat rump hair Course wool Fine wool Course wool Fine wool Fine wool Fine wool Fine wool Fine wool
Somalian/Saudi-Arabian origin Somalian/Saudi-Arabian origin Somalian/Saudi-Arabian origin Somalian/Saudi-Arabian origin Central Asia Migrated southward with Khoi Migrated southward with Khoi Migrated southward with Khoi Migrated with Bapedi Migrated with Nguni Migrated with Nguni Afrikaner × Rambouillet × Blackhead Pers Dorset Horn × Blackhead Persian Merino × Ronderib Afrikaner × SA mutton merino Dorset Horn × German Merino Local type Merino × German Mutton Merino Derived from Rambouillet Derived from German Mutton Merino Germany, other European Spain
a
Abbreviations consist of a shortened form of the breed name, plus a two-letter code indicating type (FR = fat rumped; FT = fat tailed, W = wool).
1998). The truly indigenous breeds that migrated southwards with Khoi, Bapedi and Nguni people are the Damara, Namaqua Afrikaner, Ronderib Afrikaner, Pedi, Swazi and Zulu (Nguni). The various South African Persian breeds (Blackhead Persian, Blackhead Speckled Persian, Redhead Persian and Redhead Speckled Persian) are of Somalian or Saudi-Arabian origin, and have been present in South Africa for several centuries. The Karakul is a unique breed developed in Central Asia. The Merino breeds, being important contributors to the wool and meat industry in South Africa, have undergone extensive selection to adapt to the local climatic conditions. Rege et al. (1996) classified the Merino breeds from South Africa in two main groups viz. fine wool and developed wool breeds. The fine wool breeds include the South African Merino, originally imported from Spain and the SA Mutton Merino, derived from the German mutton merino. The locally developed Merino breeds are grouped into coarse wool (Dormer) and fine wool breeds (Afrino, Dohne and Letelle). Two breeds, the Dorper and Van Rooy, are locally developed composite breeds resulting from crossbreeding between indigenous, Middle-Eastern and European breeds. An important area in livestock conservation is the documenting of existing genetic resources and in particular genetic diversity and uniqueness, for conserving breeds or populations. The data generated contribute to domestic animal diversity information databases and systems of, for example, the Food and Agriculture Organization (FAO) of the United Nations (http://Dagris.ILRI.cgiar.org/dagris/3/3/2010). Globally 14% of sheep breeds have already become extinct with five of these breeds being from Africa (FAO, 2007). The aim of the current study was primarily to evaluate the genetic relationships among the recognized sheep breeds in South Africa, and to gauge how patterns of differentiation as well as levels of diversity correlate with known breed histories. Published studies characterizing South African sheep populations with DNA markers are
restricted to the study of Kunene et al. (2009) on the Zulu (Nguni) breed, and the description of the Meatmaster breed by Peters et al. (2010). Microsatellite markers were thus used to determine the population genetic structure of sheep breeds in South Africa; specifically to determine the relationships among and within indigenous, introduced and locally develop breeds. 2. Materials and methods Blood samples from a total of 622 sheep comprising 20 breeds were collected from different regions in South Africa (Table 1). Breeds sampled were assigned to one of two broad groups, namely indigenous and nonindigenous (Merino-type) breeds, with indigenous groups further divided into fat-tailed and fat-rumped varieties. Furthermore, two composite breeds were sampled, each formed by crossbreeding between indigenous and Merino-type breeds (Dorper and Van Rooy). The aim was to sample 10 unrelated males and 30 unrelated females of each breed. We used FAO guidelines for sample composition. For each of the 20 breeds, animals from several different localities were sampled to ensure that the overall sample was representative of the breed. Furthermore, we used available pedigree information and sampled only older adult animals, to minimize the inclusion of related animals in our sample. DNA was extracted from whole blood with the WizardTM Genomic DNA Purification Kit (Miller et al., 1998). A total of 12 microsatellite markers were used for analysis in this study (Table 2). The microsatellite loci were selected on the basis of the degree of polymorphism and genome coverage as suggested by Barker et al. (2001). The selected microsatellite markers complied with those recommended by the Food and Agriculture Organization (FAO) of the United Nations and the International Society for Animal Genetics (ISAG). PCR reactions were prepared in four multiplexes. The reactions were performed in total volumes of 7.5–12 l, depending on plex. Reaction mixtures contained 2.5 mM dNTP’s, 20 mM Tris–HCl with 15 mM MgCl2, 50 pmol/l primer, Supertherm Gold Taq polymerase and 0.5 l of extracted DNA. The amplification was performed using a Perkin Elmer Gene Amp PCR System 9700 thermocycler. Reaction conditions consisted of 15 min at 95 ◦ C, followed by 35 cycles of 45 s at 94 ◦ C, 45 s at 59 ◦ C (annealing temperature) and 1 min at 72 ◦ C, and a final extension step at 72 ◦ C for 60 min. An internal ovine control DNA sample was included in each PCR. Genotyping was carried out on an automated ABI 377 DNA sequencer, with fragments separated using a 5% Long Ranger/6 M gel. The internal size standard ROX-350 (GenescanTM ) was used. The data were collected by GenescanTM analysis software (version 3.1, Applied Biosystems) and
114
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
Table 2 Characteristics of the microsatellite loci used to characterize 20 breeds. Primer
Chromosome number
Size range
Sequence (forward + reverse)
Reference
TGLA53
16 (bovine)
130–175
F: CAGCAGACAGCTGCAAGAGTTAGC R: TTTCAGAAATAGTTTGCATTCATGCAG
Crawford et al. (1995)
CSSM36
(Ovine) unassigned
150–210
F: GGATAACTCAACCACACGTCTCTG R: AAGAAGTACTGGTTGCCAATCGTG
MGTG4B
4 (ovine)
120–145
F: GAGCAGCTTCTTTCTTCTCATCTT R: GCTCTTGGAAGCTTATTGTATAAAG
Steffen and Eggen (1993)
OarFCB20
2 (ovine)
60–120
F: AAATGTGTTTAAGATTCCATACAGTG R: GGAAAACCCCCATATATACCTATAC
Buchanan and Crawford (1992)
ETH225
9 (bovine)
F: GATCACCTTGCCACTATTTCCT R: ACATGACAGCCAGCTGCTACT
Steffen and Eggen (1993)
TGLA57
1 (ovine)
F: GCTTTTTAATCCTCAGCTTGCTG R: GCTTCCAAAACTTTACAATATGTAT
Steffen and Eggen (1993)
CSRD247
Unassigned
220–260
F: GGACTTGCCAGAACTCTGCAAT R: CACTGTGGTTTGTATTAGTCAGG
Kemp et al. (1993)
ILSTS087
6 (ovine)
130–175
F: AGCAGACATGATGACTCAGC R: CTGCCTCTTTTCTTGAGAGC
Kemp et al. (1993)
RM004
15 (ovine)
100–160
F: CAGCAAAATATCAGCAAACCT R: CCACCTGGGAAGGCCTTTA
Kossarek et al. (1993)
MAF214
16 (ovine)
175–205
F: GGGTGATCTTAGGGAGGTTTTGGAGG R: AATGCAGGAGATCTAGGCAGGGACG
Buchanan and Crawford (1992)
MAF65
15 (ovine)
110–140
F: AAAGGCCAGAGTATGCAATTAGGAG R: CCACTCCTCCTGAGAATATAACATG
Buchanan et al. (1992)
TGLA126
20 (bovine)
105–135
F: CTAATTTAGAATGAGAGAGGCTTCT R: TTGGTCTCTATTCTCTGAATATTCC
Kemp et al. (1993)
120–160 80–120
the allele sizes were determined with the GenotyperTM software (version 2.0, Applied Biosystems). Microsatellite toolkit (Park, 2001) was used to determine observed heterozygosity (Ho) and unbiased heterozygosity (Hz – Nei, 1987). The latter approaches quantify genetic diversity as either the frequency of heterozygotes in a particular population (Ho) or the expected heterozygosity value calculated from observed allele frequencies (Hz). The MSToolkit software was also used to prepare the input files for other software used. Allele diversity was calculated as the mean number of alleles per locus (A) (from MSToolkit) and was also quantified as allelic richness (Rs), to account for un-equal sample sizes (using FSTAT software – Goudet, 2001). Genetic differentiation among breeds were first quantified as Fst (Wright, 1965), using ARLEQUIN software (Excoffier et al., 2005). Differences among breeds were also quantified as standard genetic distance (Ds – Nei, 1978), using Dispan software (Ota, 1993). The DS values were then used to construct a neighbor-joining tree, with 1000 bootstrap iterations to determine support for nodes. To determine the true number of genetic populations, without a priori assumption of breed identities, an assignment approach as implemented in the STRUCTURE programme (Pritchard et al., 2000; Falush et al., 2003) was used. This approach is based on a Bayesian method, where the hypotheses of K = 1–12, with five repetitions for each value of K, were tested. All runs consisted of a burn-in period of 100,000 steps, followed 200,000 MCMC iterations.
3. Results The levels of genetic diversity in 20 breeds are presented in Table 3. Average unbiased heterozygosity was lowest in the fat-rumped breeds (0.466); compared to higher average Hz values of 0.555 and 0.598 in the composite and indigenous fat-tailed breeds; and still higher values of 0.659 and 0.662 in Karakul and the wool breeds respectively. This trend remained the same using allelic richness and thus adjusting for un-equal sample sizes, with an average allelic richness of 2.348 in the fat-rumped breeds, compared to 2.658 and 2.808 in the composite and indigenous breeds,
Kemp et al. (1993)
and high values of 3.061 and 3.130 in the wool and Karakul breeds. Estimates of differentiation among all individual breeds are presented in Table 4. An analysis of differentiation within and between the major groups reveal the following patterns: the average Fst value between pooled fat-rumped and pooled fat-tailed indigenous breeds was 0.180, with average Fst = 0.184 between indigenous fat-tailed and wool types, and a higher average Fst value of 0.260 between fatrumped and wool type breeds. As expected, the average of Fst values within breeds types were lower, with average Fst values of 0.074 among fat-rumped breeds, 0.141 among fat-tailed indigenous breeds and 0.160 among the seven wool breeds. Differentiation between Karakul and all other breeds were comparatively high, with average Fst values of 0.270, 0.330 and 0.312 between this breed and indigenous fat-tailed, fat-rumped and wool-type breeds respectively. Initial results from STRUCTURE (Fig. 1) showed that −Ln Pr values increased only gradually for each successive K from K = 2–6, with low standard deviations in each case. At K = 7, standard deviation increased rapidly and −Ln Pr values reached a plateau from this value onwards. This suggests that the true number of genetic populations is probably less than seven. The simulation was therefore re-run with more iterations for each of K = 2–6, to determine outcomes at each of these values of K. Conditions for the additional runs were 100,000 burn-steps followed by 500,000 MCMC iterations. Histograms representing the outcomes for K = 2–6 are presented in Fig. 2. At all values from K = 2–6, a group consisting of the wool breeds plus the Dorper composite breed shows high cohesion. Some of the
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
115
Table 3 Breed, unbiased heterozygosity (Hz), observed heterozygosity (Ho), average number of alleles per locus (A) and allelic richness (Rs) in 20 sheep breeds sampled. Breed
Hz
BhP (FR1) BhSP (FR2) RhP (FR3) RhSP (FR4) Kar (FT4) Dam (FT1) NamA (FT2) RRA (FT3) Ped (FT5) Swa (FT6) Ngu (FT7) VanR (C1) Dor (C2) Afr (W1) Dorm (W2) Doh (W3) Let (W4) SAMM (W5) SAL (W6) SAM (W7)
0.520 0.486 0.457 0.401 0.654 0.637 0.564 0.480 0.653 0.642 0.615 0.583 0.527 0.590 0.631 0.677 0.641 0.694 0.711 0.687
Ho ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.093 0.044 0.048 0.060 0.052 0.036 0.045 0.072 0.037 0.060 0.037 0.063 0.066 0.054 0.044 0.038 0.044 0.029 0.035 0.043
0.430 0.374 0.349 0.308 0.527 0.564 0.375 0.435 0.504 0.520 0.597 0.476 0.311 0.481 0.579 0.646 0.536 0.607 0.596 0.641
A ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.034 0.024 0.028 0.032 0.027 0.025 0.025 0.024 0.023 0.028 0.025 0.028 0.028 0.035 0.024 0.022 0.025 0.024 0.023 0.026
4.833 5.167 4.500 3.167 6.750 5.167 4.500 4.250 6.917 5.833 5.583 4.667 4.250 4.333 5.333 6.333 5.583 6.417 6.750 6.000
Rs ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
3.040 2.480 2.393 1.337 2.927 1.946 1.931 2.050 2.193 1.899 1.881 1.614 1.865 1.670 2.103 2.015 1.975 2.429 1.960 1.758
2.721 2.363 2.296 2.011 3.130 2.895 2.594 2.398 3.070 3.055 2.835 2.776 2.540 2.751 2.872 3.155 2.965 3.135 3.322 3.224
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
1.262 0.549 0.574 0.516 0.850 0.675 0.625 0.813 0.669 0.834 0.521 0.783 0.825 0.687 0.655 0.685 0.675 0.627 0.620 0.710
Abbreviations of breeds in Table 1.
wool breeds do however show uniqueness at high values of K. Similarly, the fat-rumped breeds show strong cohesion at all K values from K = 3 onwards, while the Karakul breed also shows uniqueness at higher K values. The remaining breeds, consisting of the indigenous fat-tailed breeds plus the Van Rooy composite breed, start as a cohesive unit at K = 2, which then break down to smaller groups at higher K values. At high K values, groups that contain the Damara/Namaqua Afrikaner and the Swazi/Zulu/Van Rooy breeds respectively remain coherent, with the Ronderib Afrikaner and Pedi breeds showing some uniqueness (Fig. 2). The neighbor-joining tree based on standard genetic distance supports some of the trends STRUCTURE output (Fig. 3). All the fat-rumped breeds are contained in a monophyletic cluster with 55% bootstrap support. Furthermore, six out of seven wool breeds occur in a cluster with 77% support. The remaining branches of the tree contain all of the fat-tailed indigenous sheep, as well as the composite breeds.
4. Discussion 4.1. Differentiation and similarities: genetic variability within and between sheep breeds The results from this molecular genetic analysis accurately reflect the known histories of sheep breed development in South Africa. The fat-rumped Persian type breeds show significant divergence from both the indigenous sheep breeds and the wool breeds of European origin. These animals were imported from North Africa or the Middle East during the last few hundred years, either by coincidence in 1868 (Willcox, 1966) or by earlier trading. The fat-rumped Persian sheep show high cohesion based on both Fst values and Bayesian analysis, despite the presence of different colour varieties. In this regard, it should be noted that most of the colour varieties are the result of crossbreeding within the South African Persian population, and significant divergence was thus not expected. The Persian group also show less genetic diversity than any other
Fig. 1. Probability (−Ln Pr) of K = 1–12, averaged over 5 runs (light grey bars), with standard deviation over 5 runs for each value of K (dark grey bars). For clarity of interpretation, standard deviation is multiplied by 10 in all cases.
116
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
Fig. 2. Bar plot showing individual sheep by breed. Differently coloured zones on each vertical bar show the proportion of membership of each individual to each of one or more clusters identified from Bayesian analysis, for K = 2–6. Refer to Table 1 for breed abbreviations.
Fig. 3. Consensus neighbour-joining trees depicting standard genetic distances among 20 sheep populations. Bootstrap values at nodes are based on 1000 iterations; only values bigger than 50% are shown.
0.183 0.154 0.150 0.099 0.143 0.158 0.132 0.100 0.189 0.172 0.105 0.092 0.080 0.161 0.147 0.062 0.159 0.104 0.099 0.182 0.205 0.214 0.195 0.229 0.166 0.209 0.243 0.262 0.166 0.204 0.166 0.188 0.122 0.156 0.185 0.199 0.086 0.141 0.173 0.178 0.182 0.140 0.161 0.180 0.209 0.054 0.087 0.138 0.131 0.146 0.160 0.112 0.160 0.169 0.199 0.126 0.126 0.113 0.203 0.189 0.196 0.223 0.172 0.205 0.214 0.227 0.297 0.257 0.265 0.243 0.330 0.310 0.281 0.342 0.272 0.317 0.312 0.330 0.288 0.198 0.125 0.102 0.181 0.199 0.225 0.193 0.224 0.135 0.204 0.198 0.213 0.169 0.257 0.145 0.089 0.075 0.074 0.191 0.187 0.180 0.209 0.156 0.177 0.188 0.239 0.147 0.200 0.278 0.189 0.136 0.147 0.144 0.196 0.172 0.160 0.209 0.133 0.193 0.201 0.230 0.262 0.150 0.202 0.320 0.148 0.140 0.145 0.118 0.225 0.254 0.237 0.282 0.211 0.244 0.244 0.285 0.123 0.272 0.174 0.284 0.395 0.166 0.171 0.167 0.140 0.249 0.298 0.269 0.280 0.238 0.255 0.280 0.293 0.109 0.000 0.288 0.158 0.233 0.328 0.187 0.179 0.165 0.095 0.225 0.280 0.285 0.327 0.258 0.297 0.275 0.314 0.048 0.120 0.046 0.223 0.139 0.224 0.301 0.152 0.142 0.161 0.076 0.168 0.272 0.245 0.283 0.200 0.261 0.254 0.298 FR2 FR3 FR4 Kar FT1 FT2 FT3 FT4 FT5 FT6 C1 C2 W1 W2 W3 W4 W5 W6 W7
Kar FR4 FR3 FR2 FR1
Table 4 Genetic differentiation among 20 sheep breeds, from Fst values.
FT1
FT2
FT3
FT4
FT5
FT6
C1
C2
W1
W2
W3
W4
W5
W6
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
117
grouping, which may reflect the selection history of this group but may also be due to a small founder population of the breed in South Africa. The fat-tailed indigenous breeds show distinction from both the North African/Middle Eastern breeds and the European breeds studied, while significant structuring was also observed within this grouping. The output from Bayesian analyses identified groupings consisting of the Damara/Namaqua Afrikaner; the Swazi/Zulu/Van Rooy breeds, and the Pedi breed. This corresponds well to the known history of human migration into South Africa from 200 to 400 AD (Ramsay et al., 2001). The Nguni sheep are divided into three groups – the Swazi sheep, the Zulu sheep and the Pedi (Kruger, 2009). During these migrations, the Damara and Namaqua Afrikaner migrated to the south–west with the Khoi people, whereas the Pedi breed accompanied the Bapedi and the Swazi and Zulu breeds migrated with the Nguni people. However, the Ronderib Afrikaner, also descendent from sheep that accompanied the Khoi people, shows distinction from the Damara and Namaqua Afrikaner. Both the Damara and Namaqua Afrikaner breeds are well adapted to desert conditions (Kruger, 2009). Overall, levels of genetic diversity in the indigenous fat-tailed breeds are lower on the spectrum of the breeds studied, which may suggest relatively small population sizes during the migration of sheep with various tribes into South Africa. Nevertheless, the fat-tailed breeds are known for adaptability (Almeida, 2011). The group consisting of the wool breeds together with the Dorper composite breed, showed high identity. This is consistent with the finding of Kijas et al. (2009), who reported that Western breeds share high levels of genetic similarity which is consistent with their short history. In South Africa, the wool breeds are descendent from European countries, especially the Netherlands, Spain and Germany, with additional influence from the Rambouillet in France and Dorset Horn (United Kingdom) breeds. The latter breed also forms part of the Dorper ancestry (Milne, 2000; De Waal and Combrinck, 2000), which most likely explain the association of the Dorper with the wool breeds. Within individual wool breeds, the Afrino shows least cohesion as a group, with a high signature of introgression, reflecting the three breeds that gave rise to the breed (Merino × Ronderib Afrikaner × SA Mutton Merino). The SA Landsheep breed shows some uniqueness when compared to other wool breeds (at K = 6), which may reflect the fairly recent (1956) importation of the first animals of this breed from Germany. The remaining five wool breeds show high identity. Genetic diversity in the wool breeds are the highest among all the breeds screened. This most likely reflects careful management and large extant population sizes, spread over several continents (Europe, Africa, North America and Australia). The Van Rooy composite breed is unique among the breeds tested in having ancestors from all three the broad groups studied, with Blackhead Persian, Afrikaner and Rambouillet among its founders. The resultant breed is somewhat closer to the SA Persian (Fst = 0.107) and indigenous breeds (Fst = 0.131) compared to the wool breeds (Fst = 0.174).
118
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
The Karakul breed show low identity with all of the other breeds studies. This reflects the Central Asian origin of the breed, originally developed in present day Kazakhstan (Meadows et al., 2005). The level of genetic diversity in this group is however among the highest of the breeds studied. Possible mechanisms for this are a historically favorable level of high diversity in the breed, but also sound management practices by breeders. 5. Conservation implications for indigenous breeds The FAO aims to stimulate the evaluation of indigenous breeds of sheep (Hodges, 1986). This organization also suggests that such work commence with those breeds which are numerically more important and whose products are in demand with local needs. Based on these criteria, the Damara is the prime candidate for conservation actions that can progress to wider commercial use. Compared to other indigenous breeds, the future of the Damara is most secure because it is already farmed commercially by a number of farmers in South Africa and Namibia. Among the remaining indigenous breeds, the Afrikaner, Pedi and Zulu breeds occur in relatively low numbers and can be considered threatened, and this is particularly critical in the case of the Zulu breed. Yet our genetic analysis suggests that each of these indigenous groups have some uniqueness, which may well translate to local adaptation over many hundreds of years. It is thus important that these breeds be conserved, and it is hoped that our results will support existing initiatives to conserve these breeds. Uncontrolled crossbreeding poses an important threat to the conservation of local farm animal genetic resources, and this should be managed by appropriate actions to conserve both the number of animals and the integrity of genetic resources. Conversely, breeders and planners should not ignore the possible benefits of well-planned crossbreeding as a way to combine desirable characteristics with adaptation to local conditions. Hodges (1986) stated that planners should evaluate breeds for their potential in crossing with local breeds for increased production, and that such actions should include breeds from within and outside the region. In this regard, there have been some notable South African success stories, with the Van Rooy and Afrino breeds being good examples of composite breeds created by the crossbreeding of indigenous (Afrikaner type) breeds with imported sheep breeds (Merino and Black Head Persian). The use of indigenous breeds for crossbreeding should however not occur at the expense of numbers in threatened breeds, and the general aim of the conservation of indigenous animals. The diversity in South Africa’s sheep genetic resources as revealed in this study create opportunities to utilize this diversity to meet present and future market demands, to serve as insurance against environmental changes, to improve food security and to alleviate poverty. Acknowledgements The authors wish to thank the FAO and the Agricultural Research Council for their financial support for this study.
References Almeida, A.M., 2011. “By endurance we conquer”: fat tailed sheep in the twenty-first century. Trop. Anim. Health Prod., doi:10.1007/s11250011-9855-8. Applied Biosystems, 2000. Division of Perkin Elmer. ABI 377 Automated Sequencer, GeneScan 3.1. & Genotyper 2.0. Foster City, California. Barker, J.S.F., Tan, S.G., Moore, S.S., Mukherjee, T.K., Matheson, J.-L., Selvara, O.S., 2001. Genetic variation within and relationships among populations of Asian goats (Capra hircus). J. Anim. Breed. Genet. 118, 213–233. Buchanan, F.C., Crawford, A.M., 1992. Ovine dinucleotide repeat polymorphism at the MAF214 locus. Anim. Genet. 23, 394. Buchanan, F.C., Swarbrick, P.A., Crawford, A.M., 1992. Ovine dinucleotide repeat polymorphism at the MAF65 locus. Anim. Genet. 23, 85. Campher, J.P., Hunlun, C., Van Zyl, G.J., 1998. South African Livestock Breeding. South African Stud Book and Livestock Improvement Association, P.O. Box 270, Bloemfontein 9300, South Africa. Crawford, A.M., Dodds, K.G., Ede, A.J., Montgomery, G.W., Garmonsway, H.G., Beattie, A.E., Davies, K., Maddoz, J.F., Kappes, S.W., Stone, R.T., Nguyen, T.C., Penty, J.M., Lord, E.A., Broom, J.A., Buitkamp, J., 1995. An autosomal genetic linkage map of the sheep genome. Genetics 140, 703–724. De Waal, H.O., Combrinck, W.J., 2000. The development of the Dorper, its nutrition and a perspective of the grazing ruminant on veld. Small Ruminant Res. 36 (2), 103–117. Epstein, H., 1971. The Origin of the Domestic Animals of Africa. African Publishing Corporation, New York. Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin, Version 3. 0: An Integrated Software Package for Population Genetics Data Analysis. Computational and Molecular Population Genetics Laboratory (CMPG), Institute of Zoology, University of Berne, Switzerland. Falush, D., Stephens, M., Pritchard, J.K., 2003. Inference of population structure: extensions to linked loci and correlated allele frequencies. Genetics 164, 1567–1587. FAO, 2007. The State of the World’s Animal Genetic Resources for Food Agriculture., http://www.fao.org/docrep/010/a1250e/a1250e00.htm. Goudet, J., 2001. FSTAT, a Program to Estimate and Test Gene Diversities and Fixation Indices, Version 293. Institut de Zoologie et d’Ecologie Animale, Universite de Lausane, Lucerne, Switzerland. Hammond, K., 2000. A Global Strategy for the Development of Animal Breeding Programmes in Lower-input Production Environments. Animal Genetic Resources, Animal Production and Health Division, FAO, Rome, Italy, www.agriculture.de/acms1/conf6/ws7globstrat.htm. Hodges, J., 1986. Animal genetic resources: strategies for improved use and conservation. In: Proceedings of the 2nd Meeting of the FAO/UNEP Expert Panel, Warsaw, Poland, June 1986, with Proceedings of the EAAP/PSAS Symposium on Small Populations of Domestic Animals. Kemp, S.J., Brezinsky, L., Teale, A.J., 1993. A panel of bovine, ovine and caprine polymorphic microsatellites. Anim. Genet. 25, 363–365. Kijas, J.W., Townley, D., Dalrymple, B.P., Heaton, M.P., Maddox, F.J., McGrath, A., Wilson, P., Ingersoll, R.G., McCulloch, R., McWilliam, S., Tang, D., McEwan, J., Cockett, N., Oddy, V.H., Nicholas, F.W., Raadsma, H., 2009. A genome wide survey of SNP variation reveals the genetic structure of sheep breeds. PLoS One 4 (3), e4668. Kossarek, L.M., Grosse, W.M., Dietz, A.B., Womack, J.E., McGraw, R.A., 1993. Rapid communication: bovine dinucleotide repeat polymorphism RM004. J. Anim. Sci. 71, 3175. Kruger, I., 2009. The Indigenous Sheep Breeds of South Africa. Genetic Resource Department, ARC-Animal Improvement Institute (ARC-AII), http://www.arc.agric.za/home.asp?pid=2699. Kunene, N.W., Bezuidenhout, C.C., Nsahlai, I.V., 2009. Genetic and phenotypic diversity in Zulu sheep populations: implications for exploitation and conservation. Small Ruminant Res. 84, 100–107. Meadows, J.R.S., Li, K., Kantanen, J., Tapio, M., Sipos, W., Pardeshi, V., Gupta, V., Calvo, J.H., Whan, V., Norris, B., Kijas, J.W., 2005. Mitochondrial sequence reveals high levels of gene flow between breeds of domestic sheep from Asia and Europe. J. Hered. 96 (5), 494–501. Miller, S.A., Dykes, D.D., Polesky, H.F., 1998. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16, 1215–1220. Milne, C., 2000. The history of the Dorper sheep. Small Ruminant Res. 36 (2), 99–102. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. Nei, M., 1987. Molecular and Evolutionary Genetics. Columbia University Press, New York, NY, USA. Nsoso, S.J., Podisi, B., Otsogile, E., Mokhutshwane, B.S., Ahmadu, B., 2004. Phenotypic characterization of indigenous Tswana goats and sheep
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119 breeds in Botswana: continuous traits. Trop. Anim. Health Prod. 36, 789–800. Ota, T., 1993. Dispan: Genetic Distance and Phylogenetic Analysis. Pennsylvania State University, PA, USA. Park, S., 2001. Microsatellite Toolkit., http://oscar.gen.tcd.ie/sdepark/mstoolkit. Peters, F., Kotze, A., Van der Bank, F.H., Grobler, J.P., 2010. Genetic profile of the locally developed Meatmaster sheep breed in South Africa based on microsatellite analysis. Small Ruminant Res. 90, 101–108. Plug, I., Badenhorst, S., 2001. The Distribution of Macromammals in Southern Africa over the Past 30 000 years. Transvaal Museum, Pretoria. Pritchard, J.K., Stephens, M., Rosenburg, N.A., Donelly, P., 2000. Association mapping in structured populations. Am. J. Hum. Genet. 67, 170–178.
119
Ramsay, K., Harris, L., Kotze, A., 2001. Landrace Breeds: South Africa’s Indigenous and Locally Developed Farm Animals. Publication Farm Animal Conservation Trust, ISBN: 0-620-25493-9. Rege, J.E.O., Yapi-Gnaore, C.V., Tawah, C.L., 1996. The indigenous domestic ruminant genetic resources of Africa. In: “2nd All Africa Conference on Animal Agriculture” 1/4/1996, Pretoria, South Africa. Steffen, P., Eggen, A., 1993. Isolation and mapping of polymorphic microsatellites in cattle. Anim. Genet. 24, 121–124. Taberlet, P., Ajmone-Marsan, P., Valentini, A., Rezaei, H.R., Naderi, S., Pompanon, F., Negrini, R., 2008. Are cattle, sheep, and goats endangered species? Mol. Ecol. 17, 275–284. Willcox, A.R., 1966. Sheep and sheep herders in South Africa. Africa: J. Int. Afr. Inst. 36 (4), 432–438. Wright, S., 1965. The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution 19, 395–420.
Contents lists available at SciVerse ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
South African sheep breeds: Population genetic structure and conservation implications P. Soma a,∗ , A. Kotze b,c , J.P. Grobler b , J.B. van Wyk d a b c d
Agricultural Research Council, P/Bag X2, Irene 0062, South Africa Department of Genetics, University of the Free State, PO Box 339, Bloemfontein 9300, South Africa National Zoological Gardens of South Africa, PO Box 754, Tshwane 0001, South Africa Department of Animal, Wildlife and Grassland Sciences, University of the Free State, PO Box 339, Bloemfontein 9300, South Africa
a r t i c l e
i n f o
Article history: Received 28 July 2011 Received in revised form 9 September 2011 Accepted 13 September 2011 Available online 12 October 2011 Keywords: Genetic structure South African indigenous sheep breeds Microsatellites Conservation
a b s t r a c t This paper details the population genetic structure of South African indigenous, locally developed and introduced breeds using microsatellite markers, and the conservation implications of these results. Blood samples from 622 sheep, comprising 20 breeds, were collected from different regions in South Africa. All animals were genotyped at 12 microsatellite loci. Average unbiased heterozygosity (Hz) was lowest in the fat-rumped breeds (0.466); compared to higher average Hz values of 0.555 and 0.598 in the composite and indigenous fat-tailed breeds; and still higher values of 0.659 and 0.662 in Karakul and the wool breeds respectively. Analysis of patterns of differentiation showed that the average Fst value between fat-rumped and the fat-tailed indigenous breeds was 0.180, with an average Fst = 0.184 between indigenous fat-tailed and wool types, and a higher average Fst value of 0.260 between fat-rumped and wool type breeds. Fst values within breeds were generally lower. Results from both Bayesian analysis (STRUCTURE) and a neighbor-joining tree based on standard genetic distance confirmed the known patterns of relationships among these groups and (in some instances) breeds. The results of this study also suggest that the indigenous breeds studied have some uniqueness, which may well translate to local adaptation over time. These results thus provide additional support for programs aimed at the conservation of indigenous and locally developed breeds, in line with international programs that emphasize the conservation of indigenous animal genetic resources. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Sheep in Africa can be morphologically divided into four types: thin-tailed with hair, thin tailed with wool, fat tailed and fat rumped (Epstein, 1971). In 2000 the recognized number of African sheep breeds was 147 (Taberlet et al., 2008). According to archaeological records, sheep migrated to the southern point of Africa as recently as 2000 years ago (Plug and Badenhorst, 2001). Indigenous livestock species
∗ Corresponding author. Tel.: +27 126729218; fax: +27 12 6729214. E-mail address: [email protected] (P. Soma). 0921-4488/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.smallrumres.2011.09.041
and breeds sustained ancient pastoralists in this migration down the African continent. In South Africa indigenous and locally developed sheep breeds are important genetic resources as they have developed unique combinations of adaptive traits to best respond to pressures of the local environment (Peters et al., 2010). These include disease tolerance, fluctuations in nutrient availability and quality, extreme and harsh climatic conditions and ability to survive and reproduce for long periods of time, sometimes with poor quality feed (Hammond, 2000; Nsoso et al., 2004). A total of 23 sheep breeds are recognized through either breed societies or interest groups in South Africa (Campher et al.,
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
113
Table 1 Sheep breeds sampled, abbreviations useda , number sampled (n), classification and breed origin. Breed
Abbreviation
n
Type
Origin
Blackhead Persian Blackhead Speckled Persian Redhead Persian Redhead Speckled Persian Karakul Damara Namaqua Afrikaner Ronderib Afrikaner Pedi Swazi Zulu (Nguni) Van Rooy Dorper Afrino Dormer Dohne Letelle SA Mutton Merino SA Landsheep SA Merino
BhP (FR1) BhSP (FR2) RhP (FR3) RhSP (FR4) Kar Dam (FT1) Nam (FT2) RRA (FT3) Ped (FT4) Swa (FT5) Ngu (FT6) VanR (C1) Dor (C2) Let (W1) Dorm (W2) Doh (W3) Let (W3) SAMM (W4) SAL (W5) SAM (W6)
19 33 27 26 30 34 34 35 40 27 35 32 23 19 35 40 34 35 40 30
Fat rumped hair Fat rumped hair Fat rumped hair Fat rumped hair Fat-tailed fur Fat-tailed hair Fat-tailed hair Fat-tailed hair Fat-tailed hair Fat-tailed hair Fat-tailed hair Fat rump hair Course wool Fine wool Course wool Fine wool Fine wool Fine wool Fine wool Fine wool
Somalian/Saudi-Arabian origin Somalian/Saudi-Arabian origin Somalian/Saudi-Arabian origin Somalian/Saudi-Arabian origin Central Asia Migrated southward with Khoi Migrated southward with Khoi Migrated southward with Khoi Migrated with Bapedi Migrated with Nguni Migrated with Nguni Afrikaner × Rambouillet × Blackhead Pers Dorset Horn × Blackhead Persian Merino × Ronderib Afrikaner × SA mutton merino Dorset Horn × German Merino Local type Merino × German Mutton Merino Derived from Rambouillet Derived from German Mutton Merino Germany, other European Spain
a
Abbreviations consist of a shortened form of the breed name, plus a two-letter code indicating type (FR = fat rumped; FT = fat tailed, W = wool).
1998). The truly indigenous breeds that migrated southwards with Khoi, Bapedi and Nguni people are the Damara, Namaqua Afrikaner, Ronderib Afrikaner, Pedi, Swazi and Zulu (Nguni). The various South African Persian breeds (Blackhead Persian, Blackhead Speckled Persian, Redhead Persian and Redhead Speckled Persian) are of Somalian or Saudi-Arabian origin, and have been present in South Africa for several centuries. The Karakul is a unique breed developed in Central Asia. The Merino breeds, being important contributors to the wool and meat industry in South Africa, have undergone extensive selection to adapt to the local climatic conditions. Rege et al. (1996) classified the Merino breeds from South Africa in two main groups viz. fine wool and developed wool breeds. The fine wool breeds include the South African Merino, originally imported from Spain and the SA Mutton Merino, derived from the German mutton merino. The locally developed Merino breeds are grouped into coarse wool (Dormer) and fine wool breeds (Afrino, Dohne and Letelle). Two breeds, the Dorper and Van Rooy, are locally developed composite breeds resulting from crossbreeding between indigenous, Middle-Eastern and European breeds. An important area in livestock conservation is the documenting of existing genetic resources and in particular genetic diversity and uniqueness, for conserving breeds or populations. The data generated contribute to domestic animal diversity information databases and systems of, for example, the Food and Agriculture Organization (FAO) of the United Nations (http://Dagris.ILRI.cgiar.org/dagris/3/3/2010). Globally 14% of sheep breeds have already become extinct with five of these breeds being from Africa (FAO, 2007). The aim of the current study was primarily to evaluate the genetic relationships among the recognized sheep breeds in South Africa, and to gauge how patterns of differentiation as well as levels of diversity correlate with known breed histories. Published studies characterizing South African sheep populations with DNA markers are
restricted to the study of Kunene et al. (2009) on the Zulu (Nguni) breed, and the description of the Meatmaster breed by Peters et al. (2010). Microsatellite markers were thus used to determine the population genetic structure of sheep breeds in South Africa; specifically to determine the relationships among and within indigenous, introduced and locally develop breeds. 2. Materials and methods Blood samples from a total of 622 sheep comprising 20 breeds were collected from different regions in South Africa (Table 1). Breeds sampled were assigned to one of two broad groups, namely indigenous and nonindigenous (Merino-type) breeds, with indigenous groups further divided into fat-tailed and fat-rumped varieties. Furthermore, two composite breeds were sampled, each formed by crossbreeding between indigenous and Merino-type breeds (Dorper and Van Rooy). The aim was to sample 10 unrelated males and 30 unrelated females of each breed. We used FAO guidelines for sample composition. For each of the 20 breeds, animals from several different localities were sampled to ensure that the overall sample was representative of the breed. Furthermore, we used available pedigree information and sampled only older adult animals, to minimize the inclusion of related animals in our sample. DNA was extracted from whole blood with the WizardTM Genomic DNA Purification Kit (Miller et al., 1998). A total of 12 microsatellite markers were used for analysis in this study (Table 2). The microsatellite loci were selected on the basis of the degree of polymorphism and genome coverage as suggested by Barker et al. (2001). The selected microsatellite markers complied with those recommended by the Food and Agriculture Organization (FAO) of the United Nations and the International Society for Animal Genetics (ISAG). PCR reactions were prepared in four multiplexes. The reactions were performed in total volumes of 7.5–12 l, depending on plex. Reaction mixtures contained 2.5 mM dNTP’s, 20 mM Tris–HCl with 15 mM MgCl2, 50 pmol/l primer, Supertherm Gold Taq polymerase and 0.5 l of extracted DNA. The amplification was performed using a Perkin Elmer Gene Amp PCR System 9700 thermocycler. Reaction conditions consisted of 15 min at 95 ◦ C, followed by 35 cycles of 45 s at 94 ◦ C, 45 s at 59 ◦ C (annealing temperature) and 1 min at 72 ◦ C, and a final extension step at 72 ◦ C for 60 min. An internal ovine control DNA sample was included in each PCR. Genotyping was carried out on an automated ABI 377 DNA sequencer, with fragments separated using a 5% Long Ranger/6 M gel. The internal size standard ROX-350 (GenescanTM ) was used. The data were collected by GenescanTM analysis software (version 3.1, Applied Biosystems) and
114
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
Table 2 Characteristics of the microsatellite loci used to characterize 20 breeds. Primer
Chromosome number
Size range
Sequence (forward + reverse)
Reference
TGLA53
16 (bovine)
130–175
F: CAGCAGACAGCTGCAAGAGTTAGC R: TTTCAGAAATAGTTTGCATTCATGCAG
Crawford et al. (1995)
CSSM36
(Ovine) unassigned
150–210
F: GGATAACTCAACCACACGTCTCTG R: AAGAAGTACTGGTTGCCAATCGTG
MGTG4B
4 (ovine)
120–145
F: GAGCAGCTTCTTTCTTCTCATCTT R: GCTCTTGGAAGCTTATTGTATAAAG
Steffen and Eggen (1993)
OarFCB20
2 (ovine)
60–120
F: AAATGTGTTTAAGATTCCATACAGTG R: GGAAAACCCCCATATATACCTATAC
Buchanan and Crawford (1992)
ETH225
9 (bovine)
F: GATCACCTTGCCACTATTTCCT R: ACATGACAGCCAGCTGCTACT
Steffen and Eggen (1993)
TGLA57
1 (ovine)
F: GCTTTTTAATCCTCAGCTTGCTG R: GCTTCCAAAACTTTACAATATGTAT
Steffen and Eggen (1993)
CSRD247
Unassigned
220–260
F: GGACTTGCCAGAACTCTGCAAT R: CACTGTGGTTTGTATTAGTCAGG
Kemp et al. (1993)
ILSTS087
6 (ovine)
130–175
F: AGCAGACATGATGACTCAGC R: CTGCCTCTTTTCTTGAGAGC
Kemp et al. (1993)
RM004
15 (ovine)
100–160
F: CAGCAAAATATCAGCAAACCT R: CCACCTGGGAAGGCCTTTA
Kossarek et al. (1993)
MAF214
16 (ovine)
175–205
F: GGGTGATCTTAGGGAGGTTTTGGAGG R: AATGCAGGAGATCTAGGCAGGGACG
Buchanan and Crawford (1992)
MAF65
15 (ovine)
110–140
F: AAAGGCCAGAGTATGCAATTAGGAG R: CCACTCCTCCTGAGAATATAACATG
Buchanan et al. (1992)
TGLA126
20 (bovine)
105–135
F: CTAATTTAGAATGAGAGAGGCTTCT R: TTGGTCTCTATTCTCTGAATATTCC
Kemp et al. (1993)
120–160 80–120
the allele sizes were determined with the GenotyperTM software (version 2.0, Applied Biosystems). Microsatellite toolkit (Park, 2001) was used to determine observed heterozygosity (Ho) and unbiased heterozygosity (Hz – Nei, 1987). The latter approaches quantify genetic diversity as either the frequency of heterozygotes in a particular population (Ho) or the expected heterozygosity value calculated from observed allele frequencies (Hz). The MSToolkit software was also used to prepare the input files for other software used. Allele diversity was calculated as the mean number of alleles per locus (A) (from MSToolkit) and was also quantified as allelic richness (Rs), to account for un-equal sample sizes (using FSTAT software – Goudet, 2001). Genetic differentiation among breeds were first quantified as Fst (Wright, 1965), using ARLEQUIN software (Excoffier et al., 2005). Differences among breeds were also quantified as standard genetic distance (Ds – Nei, 1978), using Dispan software (Ota, 1993). The DS values were then used to construct a neighbor-joining tree, with 1000 bootstrap iterations to determine support for nodes. To determine the true number of genetic populations, without a priori assumption of breed identities, an assignment approach as implemented in the STRUCTURE programme (Pritchard et al., 2000; Falush et al., 2003) was used. This approach is based on a Bayesian method, where the hypotheses of K = 1–12, with five repetitions for each value of K, were tested. All runs consisted of a burn-in period of 100,000 steps, followed 200,000 MCMC iterations.
3. Results The levels of genetic diversity in 20 breeds are presented in Table 3. Average unbiased heterozygosity was lowest in the fat-rumped breeds (0.466); compared to higher average Hz values of 0.555 and 0.598 in the composite and indigenous fat-tailed breeds; and still higher values of 0.659 and 0.662 in Karakul and the wool breeds respectively. This trend remained the same using allelic richness and thus adjusting for un-equal sample sizes, with an average allelic richness of 2.348 in the fat-rumped breeds, compared to 2.658 and 2.808 in the composite and indigenous breeds,
Kemp et al. (1993)
and high values of 3.061 and 3.130 in the wool and Karakul breeds. Estimates of differentiation among all individual breeds are presented in Table 4. An analysis of differentiation within and between the major groups reveal the following patterns: the average Fst value between pooled fat-rumped and pooled fat-tailed indigenous breeds was 0.180, with average Fst = 0.184 between indigenous fat-tailed and wool types, and a higher average Fst value of 0.260 between fatrumped and wool type breeds. As expected, the average of Fst values within breeds types were lower, with average Fst values of 0.074 among fat-rumped breeds, 0.141 among fat-tailed indigenous breeds and 0.160 among the seven wool breeds. Differentiation between Karakul and all other breeds were comparatively high, with average Fst values of 0.270, 0.330 and 0.312 between this breed and indigenous fat-tailed, fat-rumped and wool-type breeds respectively. Initial results from STRUCTURE (Fig. 1) showed that −Ln Pr values increased only gradually for each successive K from K = 2–6, with low standard deviations in each case. At K = 7, standard deviation increased rapidly and −Ln Pr values reached a plateau from this value onwards. This suggests that the true number of genetic populations is probably less than seven. The simulation was therefore re-run with more iterations for each of K = 2–6, to determine outcomes at each of these values of K. Conditions for the additional runs were 100,000 burn-steps followed by 500,000 MCMC iterations. Histograms representing the outcomes for K = 2–6 are presented in Fig. 2. At all values from K = 2–6, a group consisting of the wool breeds plus the Dorper composite breed shows high cohesion. Some of the
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
115
Table 3 Breed, unbiased heterozygosity (Hz), observed heterozygosity (Ho), average number of alleles per locus (A) and allelic richness (Rs) in 20 sheep breeds sampled. Breed
Hz
BhP (FR1) BhSP (FR2) RhP (FR3) RhSP (FR4) Kar (FT4) Dam (FT1) NamA (FT2) RRA (FT3) Ped (FT5) Swa (FT6) Ngu (FT7) VanR (C1) Dor (C2) Afr (W1) Dorm (W2) Doh (W3) Let (W4) SAMM (W5) SAL (W6) SAM (W7)
0.520 0.486 0.457 0.401 0.654 0.637 0.564 0.480 0.653 0.642 0.615 0.583 0.527 0.590 0.631 0.677 0.641 0.694 0.711 0.687
Ho ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.093 0.044 0.048 0.060 0.052 0.036 0.045 0.072 0.037 0.060 0.037 0.063 0.066 0.054 0.044 0.038 0.044 0.029 0.035 0.043
0.430 0.374 0.349 0.308 0.527 0.564 0.375 0.435 0.504 0.520 0.597 0.476 0.311 0.481 0.579 0.646 0.536 0.607 0.596 0.641
A ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.034 0.024 0.028 0.032 0.027 0.025 0.025 0.024 0.023 0.028 0.025 0.028 0.028 0.035 0.024 0.022 0.025 0.024 0.023 0.026
4.833 5.167 4.500 3.167 6.750 5.167 4.500 4.250 6.917 5.833 5.583 4.667 4.250 4.333 5.333 6.333 5.583 6.417 6.750 6.000
Rs ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
3.040 2.480 2.393 1.337 2.927 1.946 1.931 2.050 2.193 1.899 1.881 1.614 1.865 1.670 2.103 2.015 1.975 2.429 1.960 1.758
2.721 2.363 2.296 2.011 3.130 2.895 2.594 2.398 3.070 3.055 2.835 2.776 2.540 2.751 2.872 3.155 2.965 3.135 3.322 3.224
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
1.262 0.549 0.574 0.516 0.850 0.675 0.625 0.813 0.669 0.834 0.521 0.783 0.825 0.687 0.655 0.685 0.675 0.627 0.620 0.710
Abbreviations of breeds in Table 1.
wool breeds do however show uniqueness at high values of K. Similarly, the fat-rumped breeds show strong cohesion at all K values from K = 3 onwards, while the Karakul breed also shows uniqueness at higher K values. The remaining breeds, consisting of the indigenous fat-tailed breeds plus the Van Rooy composite breed, start as a cohesive unit at K = 2, which then break down to smaller groups at higher K values. At high K values, groups that contain the Damara/Namaqua Afrikaner and the Swazi/Zulu/Van Rooy breeds respectively remain coherent, with the Ronderib Afrikaner and Pedi breeds showing some uniqueness (Fig. 2). The neighbor-joining tree based on standard genetic distance supports some of the trends STRUCTURE output (Fig. 3). All the fat-rumped breeds are contained in a monophyletic cluster with 55% bootstrap support. Furthermore, six out of seven wool breeds occur in a cluster with 77% support. The remaining branches of the tree contain all of the fat-tailed indigenous sheep, as well as the composite breeds.
4. Discussion 4.1. Differentiation and similarities: genetic variability within and between sheep breeds The results from this molecular genetic analysis accurately reflect the known histories of sheep breed development in South Africa. The fat-rumped Persian type breeds show significant divergence from both the indigenous sheep breeds and the wool breeds of European origin. These animals were imported from North Africa or the Middle East during the last few hundred years, either by coincidence in 1868 (Willcox, 1966) or by earlier trading. The fat-rumped Persian sheep show high cohesion based on both Fst values and Bayesian analysis, despite the presence of different colour varieties. In this regard, it should be noted that most of the colour varieties are the result of crossbreeding within the South African Persian population, and significant divergence was thus not expected. The Persian group also show less genetic diversity than any other
Fig. 1. Probability (−Ln Pr) of K = 1–12, averaged over 5 runs (light grey bars), with standard deviation over 5 runs for each value of K (dark grey bars). For clarity of interpretation, standard deviation is multiplied by 10 in all cases.
116
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
Fig. 2. Bar plot showing individual sheep by breed. Differently coloured zones on each vertical bar show the proportion of membership of each individual to each of one or more clusters identified from Bayesian analysis, for K = 2–6. Refer to Table 1 for breed abbreviations.
Fig. 3. Consensus neighbour-joining trees depicting standard genetic distances among 20 sheep populations. Bootstrap values at nodes are based on 1000 iterations; only values bigger than 50% are shown.
0.183 0.154 0.150 0.099 0.143 0.158 0.132 0.100 0.189 0.172 0.105 0.092 0.080 0.161 0.147 0.062 0.159 0.104 0.099 0.182 0.205 0.214 0.195 0.229 0.166 0.209 0.243 0.262 0.166 0.204 0.166 0.188 0.122 0.156 0.185 0.199 0.086 0.141 0.173 0.178 0.182 0.140 0.161 0.180 0.209 0.054 0.087 0.138 0.131 0.146 0.160 0.112 0.160 0.169 0.199 0.126 0.126 0.113 0.203 0.189 0.196 0.223 0.172 0.205 0.214 0.227 0.297 0.257 0.265 0.243 0.330 0.310 0.281 0.342 0.272 0.317 0.312 0.330 0.288 0.198 0.125 0.102 0.181 0.199 0.225 0.193 0.224 0.135 0.204 0.198 0.213 0.169 0.257 0.145 0.089 0.075 0.074 0.191 0.187 0.180 0.209 0.156 0.177 0.188 0.239 0.147 0.200 0.278 0.189 0.136 0.147 0.144 0.196 0.172 0.160 0.209 0.133 0.193 0.201 0.230 0.262 0.150 0.202 0.320 0.148 0.140 0.145 0.118 0.225 0.254 0.237 0.282 0.211 0.244 0.244 0.285 0.123 0.272 0.174 0.284 0.395 0.166 0.171 0.167 0.140 0.249 0.298 0.269 0.280 0.238 0.255 0.280 0.293 0.109 0.000 0.288 0.158 0.233 0.328 0.187 0.179 0.165 0.095 0.225 0.280 0.285 0.327 0.258 0.297 0.275 0.314 0.048 0.120 0.046 0.223 0.139 0.224 0.301 0.152 0.142 0.161 0.076 0.168 0.272 0.245 0.283 0.200 0.261 0.254 0.298 FR2 FR3 FR4 Kar FT1 FT2 FT3 FT4 FT5 FT6 C1 C2 W1 W2 W3 W4 W5 W6 W7
Kar FR4 FR3 FR2 FR1
Table 4 Genetic differentiation among 20 sheep breeds, from Fst values.
FT1
FT2
FT3
FT4
FT5
FT6
C1
C2
W1
W2
W3
W4
W5
W6
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
117
grouping, which may reflect the selection history of this group but may also be due to a small founder population of the breed in South Africa. The fat-tailed indigenous breeds show distinction from both the North African/Middle Eastern breeds and the European breeds studied, while significant structuring was also observed within this grouping. The output from Bayesian analyses identified groupings consisting of the Damara/Namaqua Afrikaner; the Swazi/Zulu/Van Rooy breeds, and the Pedi breed. This corresponds well to the known history of human migration into South Africa from 200 to 400 AD (Ramsay et al., 2001). The Nguni sheep are divided into three groups – the Swazi sheep, the Zulu sheep and the Pedi (Kruger, 2009). During these migrations, the Damara and Namaqua Afrikaner migrated to the south–west with the Khoi people, whereas the Pedi breed accompanied the Bapedi and the Swazi and Zulu breeds migrated with the Nguni people. However, the Ronderib Afrikaner, also descendent from sheep that accompanied the Khoi people, shows distinction from the Damara and Namaqua Afrikaner. Both the Damara and Namaqua Afrikaner breeds are well adapted to desert conditions (Kruger, 2009). Overall, levels of genetic diversity in the indigenous fat-tailed breeds are lower on the spectrum of the breeds studied, which may suggest relatively small population sizes during the migration of sheep with various tribes into South Africa. Nevertheless, the fat-tailed breeds are known for adaptability (Almeida, 2011). The group consisting of the wool breeds together with the Dorper composite breed, showed high identity. This is consistent with the finding of Kijas et al. (2009), who reported that Western breeds share high levels of genetic similarity which is consistent with their short history. In South Africa, the wool breeds are descendent from European countries, especially the Netherlands, Spain and Germany, with additional influence from the Rambouillet in France and Dorset Horn (United Kingdom) breeds. The latter breed also forms part of the Dorper ancestry (Milne, 2000; De Waal and Combrinck, 2000), which most likely explain the association of the Dorper with the wool breeds. Within individual wool breeds, the Afrino shows least cohesion as a group, with a high signature of introgression, reflecting the three breeds that gave rise to the breed (Merino × Ronderib Afrikaner × SA Mutton Merino). The SA Landsheep breed shows some uniqueness when compared to other wool breeds (at K = 6), which may reflect the fairly recent (1956) importation of the first animals of this breed from Germany. The remaining five wool breeds show high identity. Genetic diversity in the wool breeds are the highest among all the breeds screened. This most likely reflects careful management and large extant population sizes, spread over several continents (Europe, Africa, North America and Australia). The Van Rooy composite breed is unique among the breeds tested in having ancestors from all three the broad groups studied, with Blackhead Persian, Afrikaner and Rambouillet among its founders. The resultant breed is somewhat closer to the SA Persian (Fst = 0.107) and indigenous breeds (Fst = 0.131) compared to the wool breeds (Fst = 0.174).
118
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119
The Karakul breed show low identity with all of the other breeds studies. This reflects the Central Asian origin of the breed, originally developed in present day Kazakhstan (Meadows et al., 2005). The level of genetic diversity in this group is however among the highest of the breeds studied. Possible mechanisms for this are a historically favorable level of high diversity in the breed, but also sound management practices by breeders. 5. Conservation implications for indigenous breeds The FAO aims to stimulate the evaluation of indigenous breeds of sheep (Hodges, 1986). This organization also suggests that such work commence with those breeds which are numerically more important and whose products are in demand with local needs. Based on these criteria, the Damara is the prime candidate for conservation actions that can progress to wider commercial use. Compared to other indigenous breeds, the future of the Damara is most secure because it is already farmed commercially by a number of farmers in South Africa and Namibia. Among the remaining indigenous breeds, the Afrikaner, Pedi and Zulu breeds occur in relatively low numbers and can be considered threatened, and this is particularly critical in the case of the Zulu breed. Yet our genetic analysis suggests that each of these indigenous groups have some uniqueness, which may well translate to local adaptation over many hundreds of years. It is thus important that these breeds be conserved, and it is hoped that our results will support existing initiatives to conserve these breeds. Uncontrolled crossbreeding poses an important threat to the conservation of local farm animal genetic resources, and this should be managed by appropriate actions to conserve both the number of animals and the integrity of genetic resources. Conversely, breeders and planners should not ignore the possible benefits of well-planned crossbreeding as a way to combine desirable characteristics with adaptation to local conditions. Hodges (1986) stated that planners should evaluate breeds for their potential in crossing with local breeds for increased production, and that such actions should include breeds from within and outside the region. In this regard, there have been some notable South African success stories, with the Van Rooy and Afrino breeds being good examples of composite breeds created by the crossbreeding of indigenous (Afrikaner type) breeds with imported sheep breeds (Merino and Black Head Persian). The use of indigenous breeds for crossbreeding should however not occur at the expense of numbers in threatened breeds, and the general aim of the conservation of indigenous animals. The diversity in South Africa’s sheep genetic resources as revealed in this study create opportunities to utilize this diversity to meet present and future market demands, to serve as insurance against environmental changes, to improve food security and to alleviate poverty. Acknowledgements The authors wish to thank the FAO and the Agricultural Research Council for their financial support for this study.
References Almeida, A.M., 2011. “By endurance we conquer”: fat tailed sheep in the twenty-first century. Trop. Anim. Health Prod., doi:10.1007/s11250011-9855-8. Applied Biosystems, 2000. Division of Perkin Elmer. ABI 377 Automated Sequencer, GeneScan 3.1. & Genotyper 2.0. Foster City, California. Barker, J.S.F., Tan, S.G., Moore, S.S., Mukherjee, T.K., Matheson, J.-L., Selvara, O.S., 2001. Genetic variation within and relationships among populations of Asian goats (Capra hircus). J. Anim. Breed. Genet. 118, 213–233. Buchanan, F.C., Crawford, A.M., 1992. Ovine dinucleotide repeat polymorphism at the MAF214 locus. Anim. Genet. 23, 394. Buchanan, F.C., Swarbrick, P.A., Crawford, A.M., 1992. Ovine dinucleotide repeat polymorphism at the MAF65 locus. Anim. Genet. 23, 85. Campher, J.P., Hunlun, C., Van Zyl, G.J., 1998. South African Livestock Breeding. South African Stud Book and Livestock Improvement Association, P.O. Box 270, Bloemfontein 9300, South Africa. Crawford, A.M., Dodds, K.G., Ede, A.J., Montgomery, G.W., Garmonsway, H.G., Beattie, A.E., Davies, K., Maddoz, J.F., Kappes, S.W., Stone, R.T., Nguyen, T.C., Penty, J.M., Lord, E.A., Broom, J.A., Buitkamp, J., 1995. An autosomal genetic linkage map of the sheep genome. Genetics 140, 703–724. De Waal, H.O., Combrinck, W.J., 2000. The development of the Dorper, its nutrition and a perspective of the grazing ruminant on veld. Small Ruminant Res. 36 (2), 103–117. Epstein, H., 1971. The Origin of the Domestic Animals of Africa. African Publishing Corporation, New York. Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin, Version 3. 0: An Integrated Software Package for Population Genetics Data Analysis. Computational and Molecular Population Genetics Laboratory (CMPG), Institute of Zoology, University of Berne, Switzerland. Falush, D., Stephens, M., Pritchard, J.K., 2003. Inference of population structure: extensions to linked loci and correlated allele frequencies. Genetics 164, 1567–1587. FAO, 2007. The State of the World’s Animal Genetic Resources for Food Agriculture., http://www.fao.org/docrep/010/a1250e/a1250e00.htm. Goudet, J., 2001. FSTAT, a Program to Estimate and Test Gene Diversities and Fixation Indices, Version 293. Institut de Zoologie et d’Ecologie Animale, Universite de Lausane, Lucerne, Switzerland. Hammond, K., 2000. A Global Strategy for the Development of Animal Breeding Programmes in Lower-input Production Environments. Animal Genetic Resources, Animal Production and Health Division, FAO, Rome, Italy, www.agriculture.de/acms1/conf6/ws7globstrat.htm. Hodges, J., 1986. Animal genetic resources: strategies for improved use and conservation. In: Proceedings of the 2nd Meeting of the FAO/UNEP Expert Panel, Warsaw, Poland, June 1986, with Proceedings of the EAAP/PSAS Symposium on Small Populations of Domestic Animals. Kemp, S.J., Brezinsky, L., Teale, A.J., 1993. A panel of bovine, ovine and caprine polymorphic microsatellites. Anim. Genet. 25, 363–365. Kijas, J.W., Townley, D., Dalrymple, B.P., Heaton, M.P., Maddox, F.J., McGrath, A., Wilson, P., Ingersoll, R.G., McCulloch, R., McWilliam, S., Tang, D., McEwan, J., Cockett, N., Oddy, V.H., Nicholas, F.W., Raadsma, H., 2009. A genome wide survey of SNP variation reveals the genetic structure of sheep breeds. PLoS One 4 (3), e4668. Kossarek, L.M., Grosse, W.M., Dietz, A.B., Womack, J.E., McGraw, R.A., 1993. Rapid communication: bovine dinucleotide repeat polymorphism RM004. J. Anim. Sci. 71, 3175. Kruger, I., 2009. The Indigenous Sheep Breeds of South Africa. Genetic Resource Department, ARC-Animal Improvement Institute (ARC-AII), http://www.arc.agric.za/home.asp?pid=2699. Kunene, N.W., Bezuidenhout, C.C., Nsahlai, I.V., 2009. Genetic and phenotypic diversity in Zulu sheep populations: implications for exploitation and conservation. Small Ruminant Res. 84, 100–107. Meadows, J.R.S., Li, K., Kantanen, J., Tapio, M., Sipos, W., Pardeshi, V., Gupta, V., Calvo, J.H., Whan, V., Norris, B., Kijas, J.W., 2005. Mitochondrial sequence reveals high levels of gene flow between breeds of domestic sheep from Asia and Europe. J. Hered. 96 (5), 494–501. Miller, S.A., Dykes, D.D., Polesky, H.F., 1998. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16, 1215–1220. Milne, C., 2000. The history of the Dorper sheep. Small Ruminant Res. 36 (2), 99–102. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. Nei, M., 1987. Molecular and Evolutionary Genetics. Columbia University Press, New York, NY, USA. Nsoso, S.J., Podisi, B., Otsogile, E., Mokhutshwane, B.S., Ahmadu, B., 2004. Phenotypic characterization of indigenous Tswana goats and sheep
P. Soma et al. / Small Ruminant Research 103 (2012) 112–119 breeds in Botswana: continuous traits. Trop. Anim. Health Prod. 36, 789–800. Ota, T., 1993. Dispan: Genetic Distance and Phylogenetic Analysis. Pennsylvania State University, PA, USA. Park, S., 2001. Microsatellite Toolkit., http://oscar.gen.tcd.ie/sdepark/mstoolkit. Peters, F., Kotze, A., Van der Bank, F.H., Grobler, J.P., 2010. Genetic profile of the locally developed Meatmaster sheep breed in South Africa based on microsatellite analysis. Small Ruminant Res. 90, 101–108. Plug, I., Badenhorst, S., 2001. The Distribution of Macromammals in Southern Africa over the Past 30 000 years. Transvaal Museum, Pretoria. Pritchard, J.K., Stephens, M., Rosenburg, N.A., Donelly, P., 2000. Association mapping in structured populations. Am. J. Hum. Genet. 67, 170–178.
119
Ramsay, K., Harris, L., Kotze, A., 2001. Landrace Breeds: South Africa’s Indigenous and Locally Developed Farm Animals. Publication Farm Animal Conservation Trust, ISBN: 0-620-25493-9. Rege, J.E.O., Yapi-Gnaore, C.V., Tawah, C.L., 1996. The indigenous domestic ruminant genetic resources of Africa. In: “2nd All Africa Conference on Animal Agriculture” 1/4/1996, Pretoria, South Africa. Steffen, P., Eggen, A., 1993. Isolation and mapping of polymorphic microsatellites in cattle. Anim. Genet. 24, 121–124. Taberlet, P., Ajmone-Marsan, P., Valentini, A., Rezaei, H.R., Naderi, S., Pompanon, F., Negrini, R., 2008. Are cattle, sheep, and goats endangered species? Mol. Ecol. 17, 275–284. Willcox, A.R., 1966. Sheep and sheep herders in South Africa. Africa: J. Int. Afr. Inst. 36 (4), 432–438. Wright, S., 1965. The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution 19, 395–420.