- Email: [email protected]
Soybean isoflavones prevent atrazine-induced neurodegenerative damage by inducing autophagy
Ecotoxicology and Environmental Safety 190 (2020) 110065
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Soybean isoflavones prevent atrazine-induced neurodegenerative damage by inducing autophagy
T
Peng Li, Xueting Li, Liyan Yao, Yanping Wu, Baixiang Li∗ Department of Hygienic Toxicology, School of Public Health, Harbin Medical University, 157 Baojian Road, Harbin, Heilongjiang Province, 150081, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Soybean isoflavones Atrazine Prevention Apoptosis Autophagy
Atrazine (ATR) is a widely used herbicide with documented dopaminergic (DAergic) neurotoxicity that can lead to a Parkinson's disease (PD)-like motor syndrome. However, there have been few studies on preventative interventions. The aim of the present study was to investigate the neuroprotective efficacy of soybean isoflavones (SI) and associated molecular mechanisms in a rat model of ATR-induced DAergic toxicity. Male Sprague-Dawley rats (6 weeks old) received daily intraperitoneal injection of SI (10, 50, or 100 mg/kg) or vehicle followed 1 h later by oral gavage of ATR (50 mg/kg) for 45 consecutive days. Open field and grip-strength tests indicated no differences in motor function among treatment groups. Alternatively, histopathology revealed neuronal damage in the striatum of rats receiving vehicle plus ATR that was ameliorated by SI pretreatment. SI attenuate ATRinduced oxidative stress (indicated by MDA accumulation and GSH depletion) and inflammatory damage (as evidenced by TNF-α and IL-6 elevation) in the substantia nigra. ATR increased expression of the pro-apoptotic factor Bax and reduced expression levels of the DA synthesis enzyme tyrosine hydroxylase (TH) and the antiapoptotic factor Bcl-2 in the substantia nigra and striatum. All of these effects were reversed by SI pretreatment, suggesting that SI can inhibit ATR-induced apoptosis of DAergic neurons. ATR also inhibited autophagy in the substantial nigra as evidenced by LC3-II and Beclin-1 downregulation and increased expression of p62, whereas SI pretreatment reversed these effects, indicating autophagy induction. Furthermore, ATR increased the expression of mTOR and reduced the expression of phosphorylated S6 (p-S6) and BEX2 in the substantia nigra. Collectively, these findings suggest that SI can prevent ATR-mediated degeneration of DAergic neurons by inducing autophagy through an mTOR-dependent signaling pathway.
1. Introduction Atrazine (6-chloro-N-ethyl-N0-(1-methylethyl)-1,3,5-triazine-2,4diamine, ATR) is a broad-spectrum herbicide widely used in agriculture to remove weeds and gramineous grasses because of its efficacy for crop protection at relatively low cost (Meffe and de Bustamante, 2014). Despite substantial benefits for the cultivation of food crops, ATR has serious impacts on the ecological environment and human health due to its mobility and long-term residual persistence. Indeed, ATR is frequently detected in surface and ground water sources (Jablonowski et al., 2011; Konstantinou et al., 2006), and there is substantial evidence for occupational and non-occupational exposure within the
herbicidal dose range (Bouvier et al., 2006). Both ATR and its metabolites have also been detected in urine samples from farm workers and others living in farming communities (Bakke et al., 2009; Hines et al., 2006). Chronic low-dose ATR exposure leads to bioaccumulation in humans and animals, resulting in varying degrees of damage to multiple organs and tissues (Campos-Pereira et al., 2012; Foradori et al., 2011, 2013; Liu et al., 2017), including the reproductive, immune, and central nervous systems (Lin et al., 2014; Liu et al., 2017; PogrmicMajkic et al., 2016; Wang et al., 2015). ATR has been shown reduce the level of striatal dopamine (DA) and the number of tyrosine hydroxylase (TH)-positive dopaminergic (DAergic) neurons in the substantia nigra pars compacta (Coban and Filipov, 2007). At the cellular level, ATR
Abbreviations: ATR, Atrazine; Soybean isoflavones, SI; DA, Dopamine; MDA, Malondialdehyde; GSH, Glutathione; TNF-α, Tumor necrosis Factor-alpha; IL-6, Interleukin-6; TH, Tyrosine hydroxylase; BEX2, Brain-expressed X-linked 2; Bcl-2, B-cell lymphoma-2; Bax, B-cell lymphoma-2-associated X; LC3-II, Microtubuleassociated protein light chain 3B; p62/SQSTM1, Sequestosome 1; mTOR, Mammalian target of rapamycin; p-S6, Phosphorylated S6 ribosomal protein; S6, Ribosomal protein S6; ROS, Reactive oxygen species; OFT, Open field test; PBS, Phosphate buffered saline; TBST, Tris-buffered saline with Tween 20; TBS, Tris-buffered saline; RT-PCR, Reverse transcription-polymerase chain reaction; DAPI, 4,6-diamidino-2-phenylindole; BCA, Bicinchoninic acid ∗ Corresponding author. E-mail addresses: [email protected] (P. Li), [email protected] (X. Li), [email protected] (L. Yao), [email protected] (Y. Wu), [email protected] (B. Li). https://doi.org/10.1016/j.ecoenv.2019.110065 Received 23 May 2019; Received in revised form 12 September 2019; Accepted 6 December 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
by the National Institutes of Health.
interferes with the uptake and storage of DA in synaptic vesicles (Lin et al., 2013). Furthermore, ATR can significantly alter the levels of other monoamines (such as noradenaline) in brain DAergic systems (Cooper et al., 1996; Rodriguez et al., 2013). Decreased DA levels and DAergic neuron loss are the two major pathological features of Parkinson's disease (PD), and some investigators have posited a potential link between ATR exposure and PD (Bretaud et al., 2004). In fact, epidemiological studies have shown elevated PD incidence in agricultural workers under sustained high-dose ATR exposure (Brown et al., 2006; Priyadarshi et al., 2000). ATR induces reactive oxygen species (ROS) accumulation and apoptosis (Beal, 2001; Ma et al., 2015) and can disrupt spontaneous locomotor activity in ATR-exposed animal models (Bardullas et al., 2011). Therefore, there is compelling in vitro (Ma et al., 2015), in vivo (Bardullas et al., 2011; Coban and Filipov, 2007; Lin et al., 2013; Rodriguez et al., 2013; Wang et al., 2015), and population-level (Bretaud et al., 2004; Brown et al., 2006; Priyadarshi et al., 2000) evidence for DAergic system neurotoxicity. Given the pervasive global use of ATR, the most expedient strategy for reducing adverse effects on human health is to identify interventions that ameliorate apoptosis and necrosis of DAergic neurons. Although several drug interventions have shown promising neuroprotective efficacy, serious side effects have limited their application (LeWitt and Fahn, 2016; Tintner and Jankovic, 2002), necessitating the development of safer alternatives that can prevent, delay, or even reverse ATR-induced neural damage. Epidemiological studies have shown that regular consumption of polyphenol-rich foods can reduce the risks of many chronic diseases (Uysal et al., 2013). For instance, polyphenols such as resveratrol can prevent pathogenic processes associated with neurodegenerative disorders such as Alzheimer's disease (AD), including protein aggregation, oxidative stress, and neuroinflammation (Gomes et al., 2018; Li et al., 2019). Polyphenols are widely distributed throughout the plant kingdom where they participate in pollination and protection against pathogens and ultraviolet (UV) light (Carmona-Gutierrez et al., 2019). Flavonoids are the most abundant polyphenols, and many show antiinflammatory, anti-carcinogenic, and anti-apoptotic efficacy (Bisht et al., 2010; Singh et al., 2014). Thus, it is possible that polyphenols can protect against neurological damage induced by ATR. Most (if not all) behavioral, nutritional, pharmacological, and genetic manipulations known to protect neurons against stressors stimulate autophagy. For instance, resveratrol protected against early brain injury after subarachnoid hemorrhage by activating autophagy (Guo et al., 2018), and activation of autophagy by the combination of rapamycin and trehalose rescued both the DAergic and behavioral deficits in an animal model of PD (Pupyshev et al., 2019). Autophagy is a recycling process whereby cells phagocytize and degrade cytoplasmic proteins and organelles in autophagosomes to produce free metabolites and substrates for cytoplasmic renewal and cellular rejuvenation (Carmona-Gutierrez et al., 2019; Yin et al., 2016). Conversely, impaired or dysregulated autophagy can lead to neuropathological damage (Thellung et al., 2019). Our previous study showed that among 5 phytochemicals examined (soybean isoflavones, resveratrol, quercetin, curcumin, and green tea polyphenols), soybean isoflavones (SI) demonstrated the most potent neuroprotective effect in vitro (Li et al., 2017). Therefore, the present study was designed to investigate the protective and potential therapeutic effects of SI against the neurochemical and histopathological changes induced by ATR.
2.2. Animals and experimental design Sixty healthy male Sprague-Dawley (SD) rats (6 weeks old, 180–190 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Rats were housed in clean polypropylene cages in an air-conditioned animal house under a constant 12-h/12-h light/dark cycle with free access to drinking water and a standard rat pellet diet throughout the experimental period. Animals were weighed once per week. After a week of acclimatization, animals were randomly divided into six groups of 10 rats each. Group I (Vehicle/vehicle Control) received daily intraperitoneal (i.p.) injection of 1 ml/kg corn oil (Harbin, China) followed 1 h later by oral gavage of 1% methylcellulose (Sigma-Aldrich Corporation, St. Louis, Mo, USA) for 45 consecutive days. Group II (ATR alone) rats were administered 1 ml/ kg corn oil followed 1 h later by oral gavage of ATR (50 mg/kg, 98% pure; Trust Chem Co., Ltd., Shanghai, China) for 45 consecutive days. Group III (SI alone) rats were i. p. injected with 100 mg/kg SI (China Standard Material Center, Beijing, China) followed 1 h later by oral gavage of 1% methylcellulose for 45 consecutive days. Group IV (lowdose SI plus ATR) received 10 mg/kg SI and 50 mg/kg ATR at a 1-h interval by the same administration routes for 45 consecutive days. Group V (medium-dose SI plus ATR) received 50 mg/kg SI and 50 mg/ kg ATR by the same administration regimen. Group VI (high-dose SI plus ATR) received 100 mg/kg SI and 50 mg/kg ATR by the same administration regimen. The ATR dose was half of its lethal weight and the lowest known to damage the central nervous system without causing behavioral abnormalities (Bardullas et al., 2011; Ma et al., 2018; Song et al., 2015). The SI doses were chosen based on previous studies showing improved cognitive performance in postmenopausal women as well as in animal models (Duffy et al., 2003; Sandini et al., 2018). Behavioral experiments were performed immediately after the last drug administration on day 45. After behavioral tests, rats were fasted for 12 h and sacrificed for histopathology and molecular analyses. Briefly, the brain was quickly removed and transferred to an icecold Petri dish. Each brain was divided into left and right parts, and the substantia nigra and striatum were isolated as described in our previous study (Bardullas et al., 2011). Tissues were immediately frozen and stored at −80 °C until analyzed. The right half was used for histopathology and the left half was used for molecular experiments. 2.3. Behavioral analysis All behavioral experiments were conducted without interruption between 9.00 a.m. and 3.00 p.m. 2.3.1. Open field test (OFT) Rats were placed individually in the center of an open-field (l × w × h: 100 × 100 × 40 cm, divided into 16 square grids; Coulbourn Instruments, Whitehall, USA) in a darkened room and allowing to move freely. Three behavioral parameters were assessed for 5 min using Limelight video tracking software (Actimetrics, Wilmette, IL, USA): (1) Total distance travelled in the OF zone, (2) mean velocity (cm/s), (3) number of rearings. After each test, the OF apparatus was cleaned using 70% ethyl alcohol and permitted to dry before the next test (Krishna et al., 2016).
2. Material and methods 2.3.2. Grip strength test Briefly, a rat was placed on a grip plate and then gently pulled backward by the tail as the system (Bioseb, Vitrolles, France) measured the maximum grip strength at the time of paw release. Each rat was tested three times at 10-min intervals and the average used for statistical analysis (Krishna et al., 2014).
2.1. Ethics statement All experiments were approved by the Medical Ethics Committee of Harbin Medical University (Harbin, China) and conducted according to the Guidelines for the Care and Use of Laboratory Animals established 2
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 1. Neither atrazine (ATR), soybean isoflavones (SI), nor their combination altered motor activity as assessed by the open field (OF) and grip strength tests. (A) Total distance travelled in the OF zone. (B) Mean velocity (cm/s). (C) Number of rearings. (D) Grip strength. Data are presented as mean ± SEM of ten rats per group. Statistical significance was tested by nonparametric Kruskal-Wallis with post hoc Mann-Whitney paired comparisons. There were no group differences in OF parameters and grip strength.
2.4. Transmission electron microscopy
2.6. Immunofluorescence analysis
Following anesthesia by pentobarbital sodium, the striatum was quickly removed and fixed in a solution of 2% glutaraldehyde in 10 mM phosphate-buffered saline (PBS; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) for 48 h at 4 °C. The fixed striatum was cut into 1 mm3 blocks and post-fixed with 1% osmium tetroxide for 2 h, followed by dehydration and embedding in resin. Ultrathin sections were prepared using standard protocols, stained with lead citrate, and examined by transmission electron microscopy (TEM, JEM-2100; JEOL Ltd., Tokyo, Japan).
After pentobarbital anesthesia, rats were perfused through the aorta with 0.9% saline followed by 4% paraformaldehyde in PBS (10 mM, pH 7.2). The entire brain was quickly removed and fixed for 48 h in 4% paraformaldehyde at 4 °C. After fixation, the tissues were washed three times with PBS (10 mM, pH 7.2), then dehydrated in gradient sucrose (low to high) with sucrose concentration changed only after the sample sank. After dehydration, the brain was cut into 10-mm thick coronal sections on a cryostat (CM 1900; Leica Microsystems Gmbh, Wetzlar, Germany) and mounted onto poly-L-lysine-coated slides (Boster Biological Technology, Ltd., Wuhan, China). The sections were washed three times with 10 mM PBS (5 min/wash), blocked with 2% goat serum for 40 min at room temperature, then incubated with primary rabbit anti-rat TH antibody (dilution, 1:200; ImmunoWay Biotechnology Company, Plano, TX, USA) and mouse anti-rat BEX2 antibody (1:200; Santa Cruz, Dallas, TX, USA) overnight at 4 °C. The next day, slices were washed 3 time with PBS (5 min/wash), incubated with Alexa Fluor® 488 goat anti-rabbit IgG (1:200; ZSGB-BIO, Beijing, China) and Alexa Fluor® 488 goat anti-mouse IgG (1:200; ZSGB-BIO) at 37 °C for 30 min, washed 3 times in PBS (5 min/wash), incubated in 4,6-diamidino-2-phenylindole (DAPI, Beyotime Institute of Biotechnology, Shanghai, China) for 5 min at room temperature, washed 4 times in PBS (5 min/wash), dried, mounted with anti-quenching agent, and photographed under a fluorescence microscope (BX51; Olympus Corporation, Tokyo, Japan).
2.5. Neurochemical analysis 2.5.1. Determination of MDA content The concentration of MDA in the substantia nigra was measured with a MDA kit (Nanjing Jiancheng Bioengineering Institute, Nianjing, China), in accordance with the manufacturer's instructions. The MDA levels are expressed in nmol/mg protein. 2.5.2. Determination of GSH content The concentration of GSH in the substantia nigra was measured with a GSH kit (Nanjing Jiancheng Bioengineering Institute, Nianjing, China), in accordance with the manufacturer's instructions. The GSH levels are expressed in μmol/g protein. 2.5.3. Determination of TNF-ɑ and IL-6 content The concentrations of tumor necrosis factor-alpha (TNF-α) and Interleukin-6 (IL-6) in the substantia nigra were measured using ELISA kits (Elabscience Biotechnology Co., Ltd., Wuhan, China), in accordance with the manufacturer's instructions. The concentration of TNF-ɑ and IL-6 are expressed in pg/ml.
2.7. Quantitative real-time PCR Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) and reverse transcribed with SYBR Premix Ex Taq II Reagent Kit and gDNA Eraser reverse Transcriptase (TaKara Bio, Inc., Shiga, Japan) according to the manufacturers’ instructions. The following rat-specific 3
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 2. Soybean isoflavones (SI) can prevent atrazine (ATR)-induced ultrastructural damage to striatal neurons. The ultrastructural features of striatal neurons were examined by transmission electron microscopy. Scale bar, 2 μm. Three rats per treatment group were examined. Blue arrow with black edges: normal mitochondria; green arrow with black edges: normal chromatin; yellow arrow with black edges: normal nuclear membrane; black arrows: swelling and vacuolar degeneration; white arrow with black edges: fuzzy nuclear membrane; red arrow with black edges: concentrated chromatin granules. Table 1 Antioxidant and anti-inflammatory effects of soybean isoflavones (SI) in atrazine (ATR)-treated rat substantial nigra.
MDA GSH TNF-α IL-6
Control
ATR
SI 100
ATR + SI 10
ATR + SI 50
ATR + SI 100
0.46 ± 001 0.54 ± 0.03 189.09 ± 0.29 48.56 ± 0.29
0.70 ± 0.01* 0.36 ± 0.04* 263.98 ± 0.40* 55.00 ± 1.79*
0.46 ± 0.01 0.57 ± 0.01 187.74 ± 0.88 47.31 ± 0.53
0.55 ± 0.02*# 0.51 ± 0.04# 196.51 ± 0.29*# 47.14 ± 0.05#
0.61 ± 0.01*# 0.52 ± 0.04# 210.61 ± 0.39*# 49.81 ± 0.34
0.62 ± 0.01*# 0.49 ± 0.02# 183.86 ± 0.39*# 44.65 ± 0.24*#
Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group.
2.8. Western blotting
primer sequences were used for amplification (all from Generay Biotech, Co., Ltd., Shanghai, China): β-actin: forward GAGAGGGAAA TCGTGCGT, reverse GGAGGAAGAGGATGCGG; LC3-II: forward CCTT CTTCCTCCTGGTGA, reverse AGCCGTCTTCATCTCTCT; P62: forward CATTGCTTGCTTAAAGGTTCTGAAG, reverse AAATGTAGCCTAGTTTG GGATTCTG; Bcl-2: forward CCTGGCATCTTCTCCTTC, reverse GCTGA CTGGACATCTCTG; Bax: forward GATGATTGCTGATGTGGATAC, reverse AGTTGAAGTTGCCGTCTG. Relative mRNA expression levels of the target genes were normalized to β-actin expression using the 2−ΔΔCT method (where ΔCT is CT target gene - CT β-actin).
Total soluble proteins were extracted from tissue by 2 h of incubation in lysis buffer supplemented with 1 mM phenylmethanesulfonyl fluoride (Beyotime) at 4 °C, followed by centrifugation at 12,000 g for 10 min at 4 °C. Supernatant protein concentration was determined by a commercial bicinchoninic acid (BCA) protein assay (Beyotime). Total soluble protein (50 μg) was separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes. Membranes were blocked with 1% bovine serum albumin in PBS plus 0.05% Tween 20 (TBST) for 1 h at room temperature and then incubated at 4 °C
4
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 3. Soybean isoflavones (SI) prevented the atrazine (ATR)-induced decrease in striatal and nigral TH expression. Tyrosine hydroxylase protein expression levels in substantia nigra (A, C) and striatum (B, D) were estimated by western blotting and quantitative densitometry using ImageJ. Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group.
3. Results
overnight with antibodies against TH (rabbit polyclonal, 1:1000; ImmunoWay), BEX2 (mouse monoclonal, 1:1000; Santa Cruz), P–S6 (rabbit monoclonal, 1:1000; Cell Signaling Technology, Danvers, MA, USA), S6 (rabbit monoclonal, 1:1000; Cell Signaling Technology), LC3II (rabbit polyclonal, 1:1000; Abcam, New Territories, Hong Kong, China), p62 (mouse monoclonal, 1:1000; Abcam), Bcl-2 (rabbit polyclonal, 1:1000; ImmunoWay), Bax (rabbit polyclonal, 1:1000; ImmunoWay), mTOR (rabbit polyclonal, 1:1000; ImmunoWay), Beclin1 (mouse monoclonal, 1:1000; Santa Cruz), and (or) β-actin antibody (rabbit polyclonal, 1:1000; ImmunoWay) as a control. The next day, the membranes were washed three times (10 min/wash) in TBST and then incubated with alkaline phosphatase-conjugated goat anti-rabbit IgG (1:5000; ZSGB-BIO, Beijing, China) or alkaline phosphatase-conjugated goat anti-mouse IgG (1:5000; ZSGB-BIO) for 1 h at room temperature. Membranes were washed three times (10 min/wash) with TBST and immunolabeled bands were visualized using chemiluminescent substrate (Beyotime) and a chemiluminescence system (Tanon-5200; Tanon Science & Technology Co., Ltd., Shanghai, China). Band intensities were analyzed using ImageJ (v 1.51; NIH, Bethesda, MD, USA).
3.1. Behavioral tests Previous studies have shown that both acute high-dose exposure and sustained low-dose exposure to ATR can induce neurodegenerative changes and behavioral abnormalities resembling those of PD models, such as motor dysfunction and hypertonia (Bardullas et al., 2011; Ma et al., 2018; Rodriguez et al., 2013). In this study, we aimed to examine potential amelioration of ATR-induced neurological damage before the expression of behavioral abnormalities. Therefore, we evaluated an ATR regimen (50 mg/kg ATR daily for 45 days) shown to have no marked effects on autonomous motor activity. In accord with these findings, we found no obvious motor dysfunction in the open field (OF) and grip strength tests. Further, neither SI alone nor ATR plus SI at three different doses caused motor impairment (Fig. 1). 3.2. Soybean isoflavones reversed ATR-induced ultrastructural damage to striatal neurons To examine possible protective effects of SI against ATR at the cellular level, we compared the ultrastructural features of striatal neurons by transmission electron microscopy. Striatal neurons in ATRtreated rats exhibited unclear nuclear membrane profiles, shrunken nuclei, widening of perinuclear cisterna, chromatin margination or disappearance, chromatin condensation, swollen mitochondria, and vacuolar degeneration, consistent with ongoing apoptosis. These signs of neuronal apoptosis were largely mitigated by SI (Fig. 2).
2.9. Statistical analyses The data are expressed as mean ± SEM. Datasets that did not pass tests of normality and equal variance were analyzed using the nonparametric Kruskal-Wallis test, followed by post hoc Mann-Whitney tests for pair-wise comparisons. Where normality criteria were met, the data was compared by one-way ANOVA followed by Fisher's Least Significant Difference (LSD) post hoc tests for pair-wise comparisons. All statistical analyses were performed using SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA). A p < 0.05 (two-tailed) was considered significant for all tests.
3.3. Soybean isoflavones protected against ATR-induced oxidative and inflammatory neuronal damage Previous studies have shown that ATR damages nerves by inducing 5
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 4. Atrazine (ATR)-mediated apoptosis was prevented by soybean isoflavones (SI). Changes in anti-apoptotic Bcl-2 and pro-apoptotic Bax expression levels in substantia nigra (A, C, E, G, R) and striatum (B, D, F, H, L) examined by western blotting and real-time PCR. Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group. 6
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 5. The protective effects of soybean isoflavones (SI) were associated with enhanced autophagy. Changes in autophagy-related markers in the substantia nigra were examined at the protein and mRNA expression levels by western blotting and real-time PCR, respectively. Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group.
3.4. Soybean isoflavones prevented the ATR-evoked reduction in striatal and nigral TH expression
oxidative stress and inflammation (Abarikwu, 2014; Zhang et al., 2015). In order to determine whether SI prevent ATR-induced damage to DA neurons by anti-inflammatory and anti-oxidation, we measured levels of MDA, GSH, TNF-α and IL-6 in substantia nigra. Compared to the control group, ATR increased the levels of MDA, TNF-α, and IL-6, and decreased the level of GSH. Administration of SI (10, 50, and 100 mg/kg) to ATR-treated rats significantly reduced the levels of MDA, TNF-α, and IL-6, and increased the level of GSH. SI alone (100 mg/kg) did not induce any alterations in these parameters compared to the control group. These results indicate that SI attenuate ATR-induced damage to DA neurons by antioxidant and anti-inflammatory activities (Table 1).
Tyrosine hydroxylase is the rate-limiting enzyme for DA synthesis (Song et al., 2015). Expression of TH was significantly reduced by daily ATR treatment, while daily pretreatment with SI (10, 50, and 100 mg/ kg) rescued normal TH expression following ATR treatment (Fig. 3). High-dose SI alone (100 mg/kg) did not cause any significant change in striatal and nigral TH expression.
3.5. Soybean isoflavones prevented ATR-induced apoptosis of dopaminergic neurons Previous studies have shown that ATR exposure reduces DA 7
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 6. Soybean isoflavones (SI) activated the mTOR cytoprotective pathway in rat substantia nigra. (A–D) Changes in the phosphorylation level of the mTORassociated protein S6. (E) BEX2 protein expression was examined by immunofluorescence with quantitative analysis using Image Pro Plus. Green: TH (a marker of DAergic neuronal nuclei); red: BEX2. Scale bar: 40 μm. Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
2013). Thus, we examined whether autophagy mediated this protective effect of SI by comparing expression levels of three autophagy markers, LC3-II, p62, and Beclin-1, in the substantia nigra among treatment groups. ATR reduced the protein and mRNA expression levels of LC3-II and Beclin-1, and increased p62 expression (Fig. 5A−D). SI attenuated the ATR-induced decrease in LC3-II protein at doses of 10, 50, and 100 mg/kg, increased the expression of Beclin-1 at a dose of 10 mg/kg, and decreased the expression of p62 at doses of 10 and 50 mg/kg (Fig. 5A−D). Compared to ATR alone, pretreatment with SI increased the expression of LC3-II mRNA at 10 mg/kg and decreased the expression of p62 mRNA at 10, 50, and 100 mg/kg (Fig. 5E and F). Alternatively, SI alone (100 mg/kg) had no significant effect on the striatal expression levels of these autophagy markers. These results indicate that SI can induce autophagy, particularly at 10 mg/kg, and suggest that autophagy induction is involved in SI-mediated neuroprotection.
secretion in the rat nigrostriatal pathway by inducing neuronal apoptosis (Song et al., 2015). Ultrastructural examination revealed that ATR exposure caused mitochondrial swelling and neuronal degeneration. To determine whether SI prevent ATR-induced apoptosis in substantia nigra and striatum, we compared expression of anti-apoptotic Bcl-2 and pro-apoptotic Bax expression at both the protein and mRNA levels by western blotting and PCR, respectively. Consistent with ATR-induced apoptosis, rats receiving ATR alone demonstrated enhanced nigrostriatal expression of Bax protein (Fig. 4A−D) and reduced expression of Bcl-2 protein (Fig. 4A, B, E, F) compared to the control group. Administration of SI (10, 50, and 100 mg/kg) to ATR-treated rats significantly reduced the expression of Bax (Fig. 4A−D) and increased the expression of Bcl-2 (Fig. 4A, B, E, F). The changes in Bax and Bcl-2 protein expression were paralleled by qualitatively similar changes in mRNA expression (Fig. 4G, H, R, L). SI alone (100 mg/kg) did not cause any significant change in Bcl-2 or Bax expression at either the protein or mRNA level. These results indicate that SI attenuate ATR-induced damage to DA neurons by inhibiting apoptosis.
3.7. Soybean isoflavones activated the mTOR-dependent pathway in rat substantia nigra
3.6. Autophagy is required for soybean isoflavones -mediated protection against ATR-induced neuronal apoptosis
Next, we investigated the signaling pathway(s) activated by SI that may contribute to neuroprotection. Previous studies have shown that mTORC1 plays a very important role in cell survival (Zoncu et al., 2011), so we focused on the expression of several proteins known to be involved in mTOR signaling in the substantia nigra. ATR increased mTOR expression and reduced phosphorylation of the mTOR-regulated protein S6, an effect reversed by pretreatment with SI (10, 50, and
Autophagy is a protective mechanism that can reduce or delay damage by redirecting metabolic resources for cell survival (Choi et al., 2013). For instance, most anti-ageing interventions are dependent on autophagy (de Cabo et al., 2014), and several flavonoids have been reported to stimulate autophagy (Li et al., 2017; Pallauf and Rimbach, 8
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 6. (continued)
9
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
mRNA and protein levels, decreased Beclin-1 protein expression, and increased p62 mRNA and protein levels, consistent with a recent study (Chen et al., 2015). In contrast, ATR has been reported to induce autophagy (Ma et al., 2018; Song et al., 2015), a discrepancy that may be explained by differences in the ATR dose regimen and experimental model. Compared to ATR alone, SI increased the expression of Beclin-1 protein, LC3-II mRNA, and LC3-II protein at a dose of 10 mg/kg. At 50 and 100 mg/kg, SI also increased the expression of LC3-II protein, while mRNA level was unchanged. At 50 and 100 mg/kg, SI reduced the expression of p62 mRNA and protein, while 100 mg/kg reduced p62 mRNA expression but not protein expression. The quantitative relationship between mRNA and its encoded protein is often complex as it is influenced by differences in translation rate and protein degradation (de Sousa Abreu et al., 2009). Nonetheless, these results indicate that low-dose SI reduce ATR-induced neurodegenerative damage by inducing autophagy. It is known that mTORC1 is a critical regulator of cell survival and autophagy (Zoncu et al., 2011). In this study, ATR treatment increased mTOR expression and reduced phosphorylation of S6, in line with previous reports (Liu et al., 2013), while SI pretreatment significantly reduced mTOR and increased p-S6 expression, suggesting that SI mediate neuroprotection though an mTOR-dependent pathway. Brainexpressed X-linked 2 (BEX2) is a novel downstream effector of mTOR (Hu et al., 2015) widely expressed in the central nervous system (Alvarez et al., 2005). Studies have shown that BEX2 can inhibit tumor growth and mitochondrial apoptosis (Foltz et al., 2006; Naderi et al., 2010). Therefore, we hypothesized that SI protect against ATR-induced neurodegenerative damage through BEX2. Indeed, ATR inhibited BEX2 expression, a response reversed by SI pretreatment. Further studies are needed to confirm that autophagy induction via an mTOR-dependent pathway is necessary and sufficient for SI-induced DAergic neuroprotection against ATR.
100 mg/kg), while SI alone (100 mg/kg) had no effect on p-S6 expression (Fig. 6A−C). Brain-expressed X-linked 2 (BEX2) is a novel downstream effector of mTOR (Hu et al., 2015), so we also compared BEX2 expression among treatment groups. ATR reduced BEX2 expression, whereas SI prevented this reduction (Fig. 6A, D, E), while SI alone (100 mg/kg) had no effect (Fig. 6A, C, D; E). 4. Discussion Many recent reports have documented adverse effects of ATR exposure on the nervous system (Bardullas et al., 2011; Lin et al., 2013; Rodriguez et al., 2013; Song et al., 2015). Although several neuronal populations are damaged by ATR, substantia nigra pars compacta and striatal DAergic neurons appear most sensitive to ATR toxicity (Coban and Filipov, 2007; Surmeier et al., 2017). The present study demonstrates the SI protect nigrostriatal DAergic neurons against ATR-induced apoptosis in rat, consistent with prior studies reporting that flavonoids are effective neuroprotectants (Lin and Tsai, 2017). Open field and grip strength tests showed no significant adverse effects on motor function after 45 days of daily ATR exposure, which may be due to the short ATR exposure or low dose according to a previous study (Ma et al., 2018). Similarly, SI administration (50, 100, and 200 mg/kg) by gavage for 90 days had no effect on rat locomotor activity (Sandini et al., 2018). Thus, this dose regimen induces signs of nigrostriatal DAergic neuronal damage that are not yet manifested by motor deficits in the experimental period. However, SI did reverse ATR-induced neuronal damage, suggesting possible therapeutic utility prior to the emergence of motor impairment. ATR can induce the production of reactive oxygen species (ROS) and inflammatory factors in the central nervous system (CNS), which in turn can disrupt basic cellular functions and lead to mitochondrial dysfunction (Abarikwu, 2014; Zhang et al., 2015). In this study, transmission electron microscopy revealed degeneration of mitochondria and nuclei in the striatum of ATR-treated rats (Song et al., 2015), indicating that the DAergic neurons had been damaged. This ATR-induced neuronal damage was mediated at least in part by oxidative stress as evidenced by MDA accumulation and GSH depletion, and by inflammation as evidenced by elevated TNF-α and IL-6. Moreover, SI reversed these changes, indicating that SI protected nigral neurons by ameliorating oxidative and inflammatory damage. We then examined the possible signaling mechanisms underlying SImediated protection against ATR first by confirming the cellular identity of the target population by TH staining and then by demonstrating the roles of anti-apoptotic signaling, autophagy, and mTOR activity. Tyrosine hydroxylase is essential for maintenance of the DAergic phenotype by acting as the rate-limiting DA biosynthetic enzyme (Song et al., 2015). Therefore, we examined changes in TH expression following ATR treatment alone and ATR plus SI pretreatment. Nigrostriatal expression of TH was significantly reduced by ATR treatment, while co-administration of SI restored near-normal TH expression, confirming that ATR selectively damages and SI protects DAergic neurons. Atrazine-induced ultrastructural damage was consistent with mitochondria-dependent apoptosis, which is regulated by the balance between anti-apoptotic Bcl-2 and pro-apoptotic Bax (Song et al., 2015). Indeed, real-time PCR and Western blot revealed that ATR reduced Bcl2 expression and increased Bax expression, while pretreatment with SI significantly increased Bcl-2 compared to ATR alone, suggesting that SI mediate neuroprotection by inhibiting apoptosis. Autophagy is a critical cytoprotective mechanism under stress (Levine and Yuan, 2005). Autophagy-related genes such as LC3-II, p62, and Beclin-1 (especially LC3-II) are used as markers for the detection of autophagic activity (He and Levine, 2010). In addition, under dopaminergic toxicity, substantia nigra pars compacta DAergic neurons are among the first neurons to degenerate (Surmeier et al., 2017). Therefore, we examined the expression of LC3-II, p62, and Beclin-1 in the substantia nigra pars compacta and found that ATR reduced LC3-II
5. Conclusion The incidence and prevalence of late-onset diseases caused by the herbicide ATR are increasing due to its widespread use and persistence in the environment. Therefore, it is critical to design feasible interventions to prevent ATR toxicity. The present work identifies SI as potential protectants against ATR-induced DAergic neurodegeneration. Further studies are needed to reveal the precise molecular details of this protective mechanism and the efficacy against human ATR toxicity. Author contributions Peng Ii designed and performed the experiments. Xue-ting Li, Li-yan Yao and Yan-ping Wu performed statistical analysis of the data and proofreading of the article. Declaration of competing interest The authors declare no conflicts of interest. Acknowledgements This work was supported by the National Nature Science Foundation of China (grant number: 81273109). References Abarikwu, S.O., 2014. Protective effect of quercetin on atrazine-induced oxidative stress in the liver, kidney, brain, and heart of adult wistar rats. Toxicol. Int. 21, 148–155. https://doi.org/10.4103/0971-6580.139794. Alvarez, E., et al., 2005. Characterization of the Bex gene family in humans, mice, and rats. Gene 357, 18–28. https://doi.org/10.1016/j.gene.2005.05.012. Bakke, B., et al., 2009. Exposure to atrazine and selected non-persistent pesticides among corn farmers during a growing season. J. Expo. Sci. Environ. Epidemiol. 19, 544–554.
10
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
LeWitt, P.A., Fahn, S., 2016. Levodopa therapy for Parkinson disease: a look backward and forward. Neurology 86, S3–S12. https://doi.org/10.1212/WNL. 0000000000002509. Li, P., et al., 2017. Isoflavones induce BEX2-dependent autophagy to prevent ATR-induced neurotoxicity in SH-SY5Y cells. Cell. Physiol. Biochem. 43, 1866–1879. https://doi.org/10.1159/000484075. Li, Q.S., et al., 2019. Resveratrol and its analogues: recent advances in structural modification and bioactivity. Mini Rev. Med. Chem. https://doi.org/10.2174/ 1389557519666190128093840. Lin, C.Y., Tsai, C.W., 2017. Carnosic acid attenuates 6-hydroxydopamine-induced neurotoxicity in SH-SY5Y cells by inducing autophagy through an enhanced interaction of parkin and Beclin 1. Mol. Neurobiol. 54, 2813–2822. https://doi.org/10.1007/ s12035-016-9873-7. Lin, Z., et al., 2013. Short-term atrazine exposure causes behavioral deficits and disrupts monoaminergic systems in male C57BL/6 mice. Neurotoxicol. Teratol. 39, 26–35. https://doi.org/10.1016/j.ntt.2013.06.002. Lin, Z., et al., 2014. Gestational and lactational exposure to atrazine via the drinking water causes specific behavioral deficits and selectively alters monoaminergic systems in C57BL/6 mouse dams, juvenile and adult offspring. Toxicol. Sci. 141, 90–102. https://doi.org/10.1093/toxsci/kfu107. Liu, Q., et al., 2013. Characterization of Torin 2, an ATP-competitive inhibitor of mTOR, ATM, and ATR. Cancer Res. 73, 2574–2586. https://doi.org/10.1158/0008-5472. CAN-12-1702. Liu, Z., et al., 2017. Immunotoxic effects of atrazine and its main metabolites at environmental relevant concentrations on larval zebrafish (Danio rerio). Chemosphere 166, 212–220. https://doi.org/10.1016/j.chemosphere.2016.09.100. Ma, K., et al., 2018. LC3-II may mediate ATR-induced mitophagy in dopaminergic neurons through SQSTM1/p62 pathway. Acta Biochim. Biophys. Sin. 50, 1047–1061. https://doi.org/10.1093/abbs/gmy091. Ma, K., et al., 2015. Neurotoxicity effects of atrazine-induced SH-SY5Y human dopaminergic neuroblastoma cells via microglial activation. Mol. Biosyst. 11, 2915–2924. https://doi.org/10.1039/c5mb00432b. Meffe, R., de Bustamante, I., 2014. Emerging organic contaminants in surface water and groundwater: a first overview of the situation in Italy. Sci. Total Environ. 481, 280–295. https://doi.org/10.1016/j.scitotenv.2014.02.053. Naderi, A., et al., 2010. BEX2 regulates mitochondrial apoptosis and G1 cell cycle in breast cancer. Int. J. Cancer 126, 1596–1610. https://doi.org/10.1002/ijc.24866. Pallauf, K., Rimbach, G., 2013. Autophagy, polyphenols and healthy ageing. Ageing Res. Rev. 12, 237–252. https://doi.org/10.1016/j.arr.2012.03.008. Pogrmic-Majkic, K., et al., 2016. Atrazine activates multiple signaling pathways enhancing the rapid hCG-induced androgenesis in rat Leydig cells. Toxicology 368–369, 37–45. https://doi.org/10.1016/j.tox.2016.08.016. Priyadarshi, A., et al., 2000. A meta-analysis of Parkinson's disease and exposure to pesticides. Neurotoxicology (Little Rock) 21, 435–440. Pupyshev, A.B., et al., 2019. Therapeutic activation of autophagy by combined treatment with rapamycin and trehalose in a mouse MPTP-induced model of Parkinson's disease. Pharmacol. Biochem. Behav. 177, 1–11. https://doi.org/10.1016/j.pbb.2018. 12.005. Rodriguez, V.M., et al., 2013. Repeated exposure to the herbicide atrazine alters locomotor activity and the nigrostriatal dopaminergic system of the albino rat. Neurotoxicology (Little Rock) 34, 82–94. https://doi.org/10.1016/j.neuro.2012.10. 012. Sandini, T.M., et al., 2018. Effects of isoflavones on behavior, estradiol, glutamate, and GABA levels in intact middle-aged female rats. Nutr. Neurosci. 1–12. https://doi.org/ 10.1080/1028415X.2018.1447296. Singh, P., et al., 2014. Recent developments in biological activities of chalcones: a mini review. Eur. J. Med. Chem. 85, 758–777. https://doi.org/10.1016/j.ejmech.2014.08. 033. Song, X.Y., et al., 2015. Atrazine causes autophagy- and apoptosis-related neurodegenerative effects in dopaminergic neurons in the rat nigrostriatal dopaminergic system. Int. J. Mol. Sci. 16, 13490–13506. https://doi.org/10.3390/ijms160613490. Surmeier, D.J., et al., 2017. Selective neuronal vulnerability in Parkinson disease. Nat. Rev. Neurosci. 18, 101–113. https://doi.org/10.1038/nrn.2016.178. Thellung, S., et al., 2019. Autophagy activator drugs: a New opportunity in neuroprotection from misfolded protein toxicity. Int. J. Mol. Sci. 20. https://doi.org/10.3390/ ijms20040901. Tintner, R., Jankovic, J., 2002. Treatment options for Parkinson's disease. Curr. Opin. Neurol. 15, 467–476. Uysal, U., et al., 2013. Consumption of polyphenol plants may slow aging and associated diseases. Curr. Pharmaceut. Des. 19, 6094–6111. Wang, H., et al., 2015. Effects of atrazine on the development of neural system of zebrafish, Danio rerio. BioMed Res. Int. 2015, 976068. https://doi.org/10.1155/2015/ 976068. Yin, Z., et al., 2016. Autophagy: machinery and regulation. Microb Cell 3, 588–596. https://doi.org/10.15698/mic2016.12.546. Zhang, B., et al., 2015. Inflammatory reaction regulated by microglia plays a role in atrazine-induced dopaminergic neuron degeneration in the substantia nigra. J. Toxicol. Sci. 40, 437–450. https://doi.org/10.2131/jts.40.437. Zoncu, R., et al., 2011. mTOR: from growth signal integration to cancer, diabetes and ageing. Nat. Rev. Mol. Cell Biol. 12, 21–35. https://doi.org/10.1038/nrm3025.
https://doi.org/10.1038/jes.2008.53. Bardullas, U., et al., 2011. Chronic atrazine exposure causes disruption of the spontaneous locomotor activity and alters the striatal dopaminergic system of the male SpragueDawley rat. Neurotoxicol. Teratol. 33, 263–272. https://doi.org/10.1016/j.ntt.2010. 09.001. Beal, M.F., 2001. Experimental models of Parkinson's disease. Nat. Rev. Neurosci. 2, 325–334. https://doi.org/10.1038/35072550. Bisht, K., et al., 2010. Curcumin, resveratrol and flavonoids as anti-inflammatory, cytoand DNA-protective dietary compounds. Toxicology 278, 88–100. https://doi.org/ 10.1016/j.tox.2009.11.008. Bouvier, G., et al., 2006. Pesticide exposure of non-occupationally exposed subjects compared to some occupational exposure: a French pilot study. Sci. Total Environ. 366, 74–91. https://doi.org/10.1016/j.scitotenv.2005.08.016. Bretaud, S., et al., 2004. Sensitivity of zebrafish to environmental toxins implicated in Parkinson's disease. Neurotoxicol. Teratol. 26, 857–864. https://doi.org/10.1016/j. ntt.2004.06.014. Brown, T.P., et al., 2006. Pesticides and Parkinson's disease–is there a link? Environ. Health Perspect. 114, 156–164. https://doi.org/10.1289/ehp.8095. Campos-Pereira, F.D., et al., 2012. Early cytotoxic and genotoxic effects of atrazine on Wistar rat liver: a morphological, immunohistochemical, biochemical, and molecular study. Ecotoxicol. Environ. Saf. 78, 170–177. https://doi.org/10.1016/j.ecoenv. 2011.11.020. Carmona-Gutierrez, D., et al., 2019. The flavonoid 4,4'-dimethoxychalcone promotes autophagy-dependent longevity across species. Nat. Commun. 10, 651. https://doi. org/10.1038/s41467-019-08555-w. Chen, D., et al., 2015. Effects of atrazine and chlorpyrifos on oxidative stress-induced autophagy in the immune organs of common carp (Cyprinus carpio L.). Fish Shellfish Immunol. 44, 12–20. https://doi.org/10.1016/j.fsi.2015.01.014. Choi, A.M., et al., 2013. Autophagy in human health and disease. N. Engl. J. Med. 368, 1845–1846. https://doi.org/10.1056/NEJMc1303158. Coban, A., Filipov, N.M., 2007. Dopaminergic toxicity associated with oral exposure to the herbicide atrazine in juvenile male C57BL/6 mice. J. Neurochem. 100, 1177–1187. https://doi.org/10.1111/j.1471-4159.2006.04294.x. Cooper, R.L., et al., 1996. Effect of atrazine on ovarian function in the rat. Reprod. Toxicol. 10, 257–264. de Cabo, R., et al., 2014. The search for antiaging interventions: from elixirs to fasting regimens. Cell 157, 1515–1526. https://doi.org/10.1016/j.cell.2014.05.031. de Sousa Abreu, R., et al., 2009. Global signatures of protein and mRNA expression levels. Mol. Biosyst. 5, 1512–1526. https://doi.org/10.1039/b908315d. Duffy, R., et al., 2003. Improved cognitive function in postmenopausal women after 12 weeks of consumption of a soya extract containing isoflavones. Pharmacol. Biochem. Behav. 75, 721–729. https://doi.org/10.1016/s0091-3057(03)00116-3. Foltz, G., et al., 2006. Genome-wide analysis of epigenetic silencing identifies BEX1 and BEX2 as candidate tumor suppressor genes in malignant glioma. Cancer Res. 66, 6665–6674. https://doi.org/10.1158/0008-5472.CAN-05-4453. Foradori, C.D., et al., 2011. The differential effect of atrazine on luteinizing hormone release in adrenalectomized adult female Wistar rats. Biol. Reprod. 85, 684–689. https://doi.org/10.1095/biolreprod.111.092452. Foradori, C.D., et al., 2013. Atrazine inhibits pulsatile gonadotropin-releasing hormone (GnRH) release without altering GnRH messenger RNA or protein levels in the female rat. Biol. Reprod. 88, 9. https://doi.org/10.1095/biolreprod.112.102277. Gomes, B.A.Q., et al., 2018. Neuroprotective mechanisms of resveratrol in alzheimer's disease: role of SIRT1. Oxid Med Cell Longev 8152373. https://doi.org/10.1155/ 2018/8152373. 2018. Guo, D., et al., 2018. Resveratrol protects early brain injury after subarachnoid hemorrhage by activating autophagy and inhibiting apoptosis mediated by the Akt/mTOR pathway. Neuroreport 29, 368–379. https://doi.org/10.1097/WNR. 0000000000000975. He, C., Levine, B., 2010. The Beclin 1 interactome. Curr. Opin. Cell Biol. 22, 140–149. https://doi.org/10.1016/j.ceb.2010.01.001. Hines, C.J., et al., 2006. Mixed-effect models for evaluating multiple measures of atrazine exposure among custom applicators. J. Occup. Environ. Hyg. 3, 274–283. https://doi. org/10.1080/15459620600637366. Hu, Z., et al., 2015. Brain-expressed X-linked 2 is pivotal for hyperactive mechanistic target of rapamycin (mTOR)-mediated tumorigenesis. J. Biol. Chem. 290, 25756–25765. https://doi.org/10.1074/jbc.M115.665208. Jablonowski, N.D., et al., 2011. Still present after all these years: persistence plus potential toxicity raise questions about the use of atrazine. Environ. Sci. Pollut. Res. Int. 18, 328–331. https://doi.org/10.1007/s11356-010-0431-y. Konstantinou, I.K., et al., 2006. The status of pesticide pollution in surface waters (rivers and lakes) of Greece. Part I. Review on occurrence and levels. Environ. Pollut. 141, 555–570. https://doi.org/10.1016/j.envpol.2005.07.024. Krishna, S., et al., 2014. Brain deposition and neurotoxicity of manganese in adult mice exposed via the drinking water. Arch. Toxicol. 88, 47–64. https://doi.org/10.1007/ s00204-013-1088-3. Krishna, S., et al., 2016. Time-dependent behavioral, neurochemical, and metabolic dysregulation in female C57BL/6 mice caused by chronic high-fat diet intake. Physiol. Behav. 157, 196–208. https://doi.org/10.1016/j.physbeh.2016.02.007. Levine, B., Yuan, J., 2005. Autophagy in cell death: an innocent convict? J. Clin. Investig. 115, 2679–2688. https://doi.org/10.1172/JCI26390.
11
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Soybean isoflavones prevent atrazine-induced neurodegenerative damage by inducing autophagy
T
Peng Li, Xueting Li, Liyan Yao, Yanping Wu, Baixiang Li∗ Department of Hygienic Toxicology, School of Public Health, Harbin Medical University, 157 Baojian Road, Harbin, Heilongjiang Province, 150081, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Soybean isoflavones Atrazine Prevention Apoptosis Autophagy
Atrazine (ATR) is a widely used herbicide with documented dopaminergic (DAergic) neurotoxicity that can lead to a Parkinson's disease (PD)-like motor syndrome. However, there have been few studies on preventative interventions. The aim of the present study was to investigate the neuroprotective efficacy of soybean isoflavones (SI) and associated molecular mechanisms in a rat model of ATR-induced DAergic toxicity. Male Sprague-Dawley rats (6 weeks old) received daily intraperitoneal injection of SI (10, 50, or 100 mg/kg) or vehicle followed 1 h later by oral gavage of ATR (50 mg/kg) for 45 consecutive days. Open field and grip-strength tests indicated no differences in motor function among treatment groups. Alternatively, histopathology revealed neuronal damage in the striatum of rats receiving vehicle plus ATR that was ameliorated by SI pretreatment. SI attenuate ATRinduced oxidative stress (indicated by MDA accumulation and GSH depletion) and inflammatory damage (as evidenced by TNF-α and IL-6 elevation) in the substantia nigra. ATR increased expression of the pro-apoptotic factor Bax and reduced expression levels of the DA synthesis enzyme tyrosine hydroxylase (TH) and the antiapoptotic factor Bcl-2 in the substantia nigra and striatum. All of these effects were reversed by SI pretreatment, suggesting that SI can inhibit ATR-induced apoptosis of DAergic neurons. ATR also inhibited autophagy in the substantial nigra as evidenced by LC3-II and Beclin-1 downregulation and increased expression of p62, whereas SI pretreatment reversed these effects, indicating autophagy induction. Furthermore, ATR increased the expression of mTOR and reduced the expression of phosphorylated S6 (p-S6) and BEX2 in the substantia nigra. Collectively, these findings suggest that SI can prevent ATR-mediated degeneration of DAergic neurons by inducing autophagy through an mTOR-dependent signaling pathway.
1. Introduction Atrazine (6-chloro-N-ethyl-N0-(1-methylethyl)-1,3,5-triazine-2,4diamine, ATR) is a broad-spectrum herbicide widely used in agriculture to remove weeds and gramineous grasses because of its efficacy for crop protection at relatively low cost (Meffe and de Bustamante, 2014). Despite substantial benefits for the cultivation of food crops, ATR has serious impacts on the ecological environment and human health due to its mobility and long-term residual persistence. Indeed, ATR is frequently detected in surface and ground water sources (Jablonowski et al., 2011; Konstantinou et al., 2006), and there is substantial evidence for occupational and non-occupational exposure within the
herbicidal dose range (Bouvier et al., 2006). Both ATR and its metabolites have also been detected in urine samples from farm workers and others living in farming communities (Bakke et al., 2009; Hines et al., 2006). Chronic low-dose ATR exposure leads to bioaccumulation in humans and animals, resulting in varying degrees of damage to multiple organs and tissues (Campos-Pereira et al., 2012; Foradori et al., 2011, 2013; Liu et al., 2017), including the reproductive, immune, and central nervous systems (Lin et al., 2014; Liu et al., 2017; PogrmicMajkic et al., 2016; Wang et al., 2015). ATR has been shown reduce the level of striatal dopamine (DA) and the number of tyrosine hydroxylase (TH)-positive dopaminergic (DAergic) neurons in the substantia nigra pars compacta (Coban and Filipov, 2007). At the cellular level, ATR
Abbreviations: ATR, Atrazine; Soybean isoflavones, SI; DA, Dopamine; MDA, Malondialdehyde; GSH, Glutathione; TNF-α, Tumor necrosis Factor-alpha; IL-6, Interleukin-6; TH, Tyrosine hydroxylase; BEX2, Brain-expressed X-linked 2; Bcl-2, B-cell lymphoma-2; Bax, B-cell lymphoma-2-associated X; LC3-II, Microtubuleassociated protein light chain 3B; p62/SQSTM1, Sequestosome 1; mTOR, Mammalian target of rapamycin; p-S6, Phosphorylated S6 ribosomal protein; S6, Ribosomal protein S6; ROS, Reactive oxygen species; OFT, Open field test; PBS, Phosphate buffered saline; TBST, Tris-buffered saline with Tween 20; TBS, Tris-buffered saline; RT-PCR, Reverse transcription-polymerase chain reaction; DAPI, 4,6-diamidino-2-phenylindole; BCA, Bicinchoninic acid ∗ Corresponding author. E-mail addresses: [email protected] (P. Li), [email protected] (X. Li), [email protected] (L. Yao), [email protected] (Y. Wu), [email protected] (B. Li). https://doi.org/10.1016/j.ecoenv.2019.110065 Received 23 May 2019; Received in revised form 12 September 2019; Accepted 6 December 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
by the National Institutes of Health.
interferes with the uptake and storage of DA in synaptic vesicles (Lin et al., 2013). Furthermore, ATR can significantly alter the levels of other monoamines (such as noradenaline) in brain DAergic systems (Cooper et al., 1996; Rodriguez et al., 2013). Decreased DA levels and DAergic neuron loss are the two major pathological features of Parkinson's disease (PD), and some investigators have posited a potential link between ATR exposure and PD (Bretaud et al., 2004). In fact, epidemiological studies have shown elevated PD incidence in agricultural workers under sustained high-dose ATR exposure (Brown et al., 2006; Priyadarshi et al., 2000). ATR induces reactive oxygen species (ROS) accumulation and apoptosis (Beal, 2001; Ma et al., 2015) and can disrupt spontaneous locomotor activity in ATR-exposed animal models (Bardullas et al., 2011). Therefore, there is compelling in vitro (Ma et al., 2015), in vivo (Bardullas et al., 2011; Coban and Filipov, 2007; Lin et al., 2013; Rodriguez et al., 2013; Wang et al., 2015), and population-level (Bretaud et al., 2004; Brown et al., 2006; Priyadarshi et al., 2000) evidence for DAergic system neurotoxicity. Given the pervasive global use of ATR, the most expedient strategy for reducing adverse effects on human health is to identify interventions that ameliorate apoptosis and necrosis of DAergic neurons. Although several drug interventions have shown promising neuroprotective efficacy, serious side effects have limited their application (LeWitt and Fahn, 2016; Tintner and Jankovic, 2002), necessitating the development of safer alternatives that can prevent, delay, or even reverse ATR-induced neural damage. Epidemiological studies have shown that regular consumption of polyphenol-rich foods can reduce the risks of many chronic diseases (Uysal et al., 2013). For instance, polyphenols such as resveratrol can prevent pathogenic processes associated with neurodegenerative disorders such as Alzheimer's disease (AD), including protein aggregation, oxidative stress, and neuroinflammation (Gomes et al., 2018; Li et al., 2019). Polyphenols are widely distributed throughout the plant kingdom where they participate in pollination and protection against pathogens and ultraviolet (UV) light (Carmona-Gutierrez et al., 2019). Flavonoids are the most abundant polyphenols, and many show antiinflammatory, anti-carcinogenic, and anti-apoptotic efficacy (Bisht et al., 2010; Singh et al., 2014). Thus, it is possible that polyphenols can protect against neurological damage induced by ATR. Most (if not all) behavioral, nutritional, pharmacological, and genetic manipulations known to protect neurons against stressors stimulate autophagy. For instance, resveratrol protected against early brain injury after subarachnoid hemorrhage by activating autophagy (Guo et al., 2018), and activation of autophagy by the combination of rapamycin and trehalose rescued both the DAergic and behavioral deficits in an animal model of PD (Pupyshev et al., 2019). Autophagy is a recycling process whereby cells phagocytize and degrade cytoplasmic proteins and organelles in autophagosomes to produce free metabolites and substrates for cytoplasmic renewal and cellular rejuvenation (Carmona-Gutierrez et al., 2019; Yin et al., 2016). Conversely, impaired or dysregulated autophagy can lead to neuropathological damage (Thellung et al., 2019). Our previous study showed that among 5 phytochemicals examined (soybean isoflavones, resveratrol, quercetin, curcumin, and green tea polyphenols), soybean isoflavones (SI) demonstrated the most potent neuroprotective effect in vitro (Li et al., 2017). Therefore, the present study was designed to investigate the protective and potential therapeutic effects of SI against the neurochemical and histopathological changes induced by ATR.
2.2. Animals and experimental design Sixty healthy male Sprague-Dawley (SD) rats (6 weeks old, 180–190 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Rats were housed in clean polypropylene cages in an air-conditioned animal house under a constant 12-h/12-h light/dark cycle with free access to drinking water and a standard rat pellet diet throughout the experimental period. Animals were weighed once per week. After a week of acclimatization, animals were randomly divided into six groups of 10 rats each. Group I (Vehicle/vehicle Control) received daily intraperitoneal (i.p.) injection of 1 ml/kg corn oil (Harbin, China) followed 1 h later by oral gavage of 1% methylcellulose (Sigma-Aldrich Corporation, St. Louis, Mo, USA) for 45 consecutive days. Group II (ATR alone) rats were administered 1 ml/ kg corn oil followed 1 h later by oral gavage of ATR (50 mg/kg, 98% pure; Trust Chem Co., Ltd., Shanghai, China) for 45 consecutive days. Group III (SI alone) rats were i. p. injected with 100 mg/kg SI (China Standard Material Center, Beijing, China) followed 1 h later by oral gavage of 1% methylcellulose for 45 consecutive days. Group IV (lowdose SI plus ATR) received 10 mg/kg SI and 50 mg/kg ATR at a 1-h interval by the same administration routes for 45 consecutive days. Group V (medium-dose SI plus ATR) received 50 mg/kg SI and 50 mg/ kg ATR by the same administration regimen. Group VI (high-dose SI plus ATR) received 100 mg/kg SI and 50 mg/kg ATR by the same administration regimen. The ATR dose was half of its lethal weight and the lowest known to damage the central nervous system without causing behavioral abnormalities (Bardullas et al., 2011; Ma et al., 2018; Song et al., 2015). The SI doses were chosen based on previous studies showing improved cognitive performance in postmenopausal women as well as in animal models (Duffy et al., 2003; Sandini et al., 2018). Behavioral experiments were performed immediately after the last drug administration on day 45. After behavioral tests, rats were fasted for 12 h and sacrificed for histopathology and molecular analyses. Briefly, the brain was quickly removed and transferred to an icecold Petri dish. Each brain was divided into left and right parts, and the substantia nigra and striatum were isolated as described in our previous study (Bardullas et al., 2011). Tissues were immediately frozen and stored at −80 °C until analyzed. The right half was used for histopathology and the left half was used for molecular experiments. 2.3. Behavioral analysis All behavioral experiments were conducted without interruption between 9.00 a.m. and 3.00 p.m. 2.3.1. Open field test (OFT) Rats were placed individually in the center of an open-field (l × w × h: 100 × 100 × 40 cm, divided into 16 square grids; Coulbourn Instruments, Whitehall, USA) in a darkened room and allowing to move freely. Three behavioral parameters were assessed for 5 min using Limelight video tracking software (Actimetrics, Wilmette, IL, USA): (1) Total distance travelled in the OF zone, (2) mean velocity (cm/s), (3) number of rearings. After each test, the OF apparatus was cleaned using 70% ethyl alcohol and permitted to dry before the next test (Krishna et al., 2016).
2. Material and methods 2.3.2. Grip strength test Briefly, a rat was placed on a grip plate and then gently pulled backward by the tail as the system (Bioseb, Vitrolles, France) measured the maximum grip strength at the time of paw release. Each rat was tested three times at 10-min intervals and the average used for statistical analysis (Krishna et al., 2014).
2.1. Ethics statement All experiments were approved by the Medical Ethics Committee of Harbin Medical University (Harbin, China) and conducted according to the Guidelines for the Care and Use of Laboratory Animals established 2
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 1. Neither atrazine (ATR), soybean isoflavones (SI), nor their combination altered motor activity as assessed by the open field (OF) and grip strength tests. (A) Total distance travelled in the OF zone. (B) Mean velocity (cm/s). (C) Number of rearings. (D) Grip strength. Data are presented as mean ± SEM of ten rats per group. Statistical significance was tested by nonparametric Kruskal-Wallis with post hoc Mann-Whitney paired comparisons. There were no group differences in OF parameters and grip strength.
2.4. Transmission electron microscopy
2.6. Immunofluorescence analysis
Following anesthesia by pentobarbital sodium, the striatum was quickly removed and fixed in a solution of 2% glutaraldehyde in 10 mM phosphate-buffered saline (PBS; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) for 48 h at 4 °C. The fixed striatum was cut into 1 mm3 blocks and post-fixed with 1% osmium tetroxide for 2 h, followed by dehydration and embedding in resin. Ultrathin sections were prepared using standard protocols, stained with lead citrate, and examined by transmission electron microscopy (TEM, JEM-2100; JEOL Ltd., Tokyo, Japan).
After pentobarbital anesthesia, rats were perfused through the aorta with 0.9% saline followed by 4% paraformaldehyde in PBS (10 mM, pH 7.2). The entire brain was quickly removed and fixed for 48 h in 4% paraformaldehyde at 4 °C. After fixation, the tissues were washed three times with PBS (10 mM, pH 7.2), then dehydrated in gradient sucrose (low to high) with sucrose concentration changed only after the sample sank. After dehydration, the brain was cut into 10-mm thick coronal sections on a cryostat (CM 1900; Leica Microsystems Gmbh, Wetzlar, Germany) and mounted onto poly-L-lysine-coated slides (Boster Biological Technology, Ltd., Wuhan, China). The sections were washed three times with 10 mM PBS (5 min/wash), blocked with 2% goat serum for 40 min at room temperature, then incubated with primary rabbit anti-rat TH antibody (dilution, 1:200; ImmunoWay Biotechnology Company, Plano, TX, USA) and mouse anti-rat BEX2 antibody (1:200; Santa Cruz, Dallas, TX, USA) overnight at 4 °C. The next day, slices were washed 3 time with PBS (5 min/wash), incubated with Alexa Fluor® 488 goat anti-rabbit IgG (1:200; ZSGB-BIO, Beijing, China) and Alexa Fluor® 488 goat anti-mouse IgG (1:200; ZSGB-BIO) at 37 °C for 30 min, washed 3 times in PBS (5 min/wash), incubated in 4,6-diamidino-2-phenylindole (DAPI, Beyotime Institute of Biotechnology, Shanghai, China) for 5 min at room temperature, washed 4 times in PBS (5 min/wash), dried, mounted with anti-quenching agent, and photographed under a fluorescence microscope (BX51; Olympus Corporation, Tokyo, Japan).
2.5. Neurochemical analysis 2.5.1. Determination of MDA content The concentration of MDA in the substantia nigra was measured with a MDA kit (Nanjing Jiancheng Bioengineering Institute, Nianjing, China), in accordance with the manufacturer's instructions. The MDA levels are expressed in nmol/mg protein. 2.5.2. Determination of GSH content The concentration of GSH in the substantia nigra was measured with a GSH kit (Nanjing Jiancheng Bioengineering Institute, Nianjing, China), in accordance with the manufacturer's instructions. The GSH levels are expressed in μmol/g protein. 2.5.3. Determination of TNF-ɑ and IL-6 content The concentrations of tumor necrosis factor-alpha (TNF-α) and Interleukin-6 (IL-6) in the substantia nigra were measured using ELISA kits (Elabscience Biotechnology Co., Ltd., Wuhan, China), in accordance with the manufacturer's instructions. The concentration of TNF-ɑ and IL-6 are expressed in pg/ml.
2.7. Quantitative real-time PCR Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) and reverse transcribed with SYBR Premix Ex Taq II Reagent Kit and gDNA Eraser reverse Transcriptase (TaKara Bio, Inc., Shiga, Japan) according to the manufacturers’ instructions. The following rat-specific 3
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 2. Soybean isoflavones (SI) can prevent atrazine (ATR)-induced ultrastructural damage to striatal neurons. The ultrastructural features of striatal neurons were examined by transmission electron microscopy. Scale bar, 2 μm. Three rats per treatment group were examined. Blue arrow with black edges: normal mitochondria; green arrow with black edges: normal chromatin; yellow arrow with black edges: normal nuclear membrane; black arrows: swelling and vacuolar degeneration; white arrow with black edges: fuzzy nuclear membrane; red arrow with black edges: concentrated chromatin granules. Table 1 Antioxidant and anti-inflammatory effects of soybean isoflavones (SI) in atrazine (ATR)-treated rat substantial nigra.
MDA GSH TNF-α IL-6
Control
ATR
SI 100
ATR + SI 10
ATR + SI 50
ATR + SI 100
0.46 ± 001 0.54 ± 0.03 189.09 ± 0.29 48.56 ± 0.29
0.70 ± 0.01* 0.36 ± 0.04* 263.98 ± 0.40* 55.00 ± 1.79*
0.46 ± 0.01 0.57 ± 0.01 187.74 ± 0.88 47.31 ± 0.53
0.55 ± 0.02*# 0.51 ± 0.04# 196.51 ± 0.29*# 47.14 ± 0.05#
0.61 ± 0.01*# 0.52 ± 0.04# 210.61 ± 0.39*# 49.81 ± 0.34
0.62 ± 0.01*# 0.49 ± 0.02# 183.86 ± 0.39*# 44.65 ± 0.24*#
Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group.
2.8. Western blotting
primer sequences were used for amplification (all from Generay Biotech, Co., Ltd., Shanghai, China): β-actin: forward GAGAGGGAAA TCGTGCGT, reverse GGAGGAAGAGGATGCGG; LC3-II: forward CCTT CTTCCTCCTGGTGA, reverse AGCCGTCTTCATCTCTCT; P62: forward CATTGCTTGCTTAAAGGTTCTGAAG, reverse AAATGTAGCCTAGTTTG GGATTCTG; Bcl-2: forward CCTGGCATCTTCTCCTTC, reverse GCTGA CTGGACATCTCTG; Bax: forward GATGATTGCTGATGTGGATAC, reverse AGTTGAAGTTGCCGTCTG. Relative mRNA expression levels of the target genes were normalized to β-actin expression using the 2−ΔΔCT method (where ΔCT is CT target gene - CT β-actin).
Total soluble proteins were extracted from tissue by 2 h of incubation in lysis buffer supplemented with 1 mM phenylmethanesulfonyl fluoride (Beyotime) at 4 °C, followed by centrifugation at 12,000 g for 10 min at 4 °C. Supernatant protein concentration was determined by a commercial bicinchoninic acid (BCA) protein assay (Beyotime). Total soluble protein (50 μg) was separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes. Membranes were blocked with 1% bovine serum albumin in PBS plus 0.05% Tween 20 (TBST) for 1 h at room temperature and then incubated at 4 °C
4
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 3. Soybean isoflavones (SI) prevented the atrazine (ATR)-induced decrease in striatal and nigral TH expression. Tyrosine hydroxylase protein expression levels in substantia nigra (A, C) and striatum (B, D) were estimated by western blotting and quantitative densitometry using ImageJ. Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group.
3. Results
overnight with antibodies against TH (rabbit polyclonal, 1:1000; ImmunoWay), BEX2 (mouse monoclonal, 1:1000; Santa Cruz), P–S6 (rabbit monoclonal, 1:1000; Cell Signaling Technology, Danvers, MA, USA), S6 (rabbit monoclonal, 1:1000; Cell Signaling Technology), LC3II (rabbit polyclonal, 1:1000; Abcam, New Territories, Hong Kong, China), p62 (mouse monoclonal, 1:1000; Abcam), Bcl-2 (rabbit polyclonal, 1:1000; ImmunoWay), Bax (rabbit polyclonal, 1:1000; ImmunoWay), mTOR (rabbit polyclonal, 1:1000; ImmunoWay), Beclin1 (mouse monoclonal, 1:1000; Santa Cruz), and (or) β-actin antibody (rabbit polyclonal, 1:1000; ImmunoWay) as a control. The next day, the membranes were washed three times (10 min/wash) in TBST and then incubated with alkaline phosphatase-conjugated goat anti-rabbit IgG (1:5000; ZSGB-BIO, Beijing, China) or alkaline phosphatase-conjugated goat anti-mouse IgG (1:5000; ZSGB-BIO) for 1 h at room temperature. Membranes were washed three times (10 min/wash) with TBST and immunolabeled bands were visualized using chemiluminescent substrate (Beyotime) and a chemiluminescence system (Tanon-5200; Tanon Science & Technology Co., Ltd., Shanghai, China). Band intensities were analyzed using ImageJ (v 1.51; NIH, Bethesda, MD, USA).
3.1. Behavioral tests Previous studies have shown that both acute high-dose exposure and sustained low-dose exposure to ATR can induce neurodegenerative changes and behavioral abnormalities resembling those of PD models, such as motor dysfunction and hypertonia (Bardullas et al., 2011; Ma et al., 2018; Rodriguez et al., 2013). In this study, we aimed to examine potential amelioration of ATR-induced neurological damage before the expression of behavioral abnormalities. Therefore, we evaluated an ATR regimen (50 mg/kg ATR daily for 45 days) shown to have no marked effects on autonomous motor activity. In accord with these findings, we found no obvious motor dysfunction in the open field (OF) and grip strength tests. Further, neither SI alone nor ATR plus SI at three different doses caused motor impairment (Fig. 1). 3.2. Soybean isoflavones reversed ATR-induced ultrastructural damage to striatal neurons To examine possible protective effects of SI against ATR at the cellular level, we compared the ultrastructural features of striatal neurons by transmission electron microscopy. Striatal neurons in ATRtreated rats exhibited unclear nuclear membrane profiles, shrunken nuclei, widening of perinuclear cisterna, chromatin margination or disappearance, chromatin condensation, swollen mitochondria, and vacuolar degeneration, consistent with ongoing apoptosis. These signs of neuronal apoptosis were largely mitigated by SI (Fig. 2).
2.9. Statistical analyses The data are expressed as mean ± SEM. Datasets that did not pass tests of normality and equal variance were analyzed using the nonparametric Kruskal-Wallis test, followed by post hoc Mann-Whitney tests for pair-wise comparisons. Where normality criteria were met, the data was compared by one-way ANOVA followed by Fisher's Least Significant Difference (LSD) post hoc tests for pair-wise comparisons. All statistical analyses were performed using SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA). A p < 0.05 (two-tailed) was considered significant for all tests.
3.3. Soybean isoflavones protected against ATR-induced oxidative and inflammatory neuronal damage Previous studies have shown that ATR damages nerves by inducing 5
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 4. Atrazine (ATR)-mediated apoptosis was prevented by soybean isoflavones (SI). Changes in anti-apoptotic Bcl-2 and pro-apoptotic Bax expression levels in substantia nigra (A, C, E, G, R) and striatum (B, D, F, H, L) examined by western blotting and real-time PCR. Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group. 6
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 5. The protective effects of soybean isoflavones (SI) were associated with enhanced autophagy. Changes in autophagy-related markers in the substantia nigra were examined at the protein and mRNA expression levels by western blotting and real-time PCR, respectively. Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group.
3.4. Soybean isoflavones prevented the ATR-evoked reduction in striatal and nigral TH expression
oxidative stress and inflammation (Abarikwu, 2014; Zhang et al., 2015). In order to determine whether SI prevent ATR-induced damage to DA neurons by anti-inflammatory and anti-oxidation, we measured levels of MDA, GSH, TNF-α and IL-6 in substantia nigra. Compared to the control group, ATR increased the levels of MDA, TNF-α, and IL-6, and decreased the level of GSH. Administration of SI (10, 50, and 100 mg/kg) to ATR-treated rats significantly reduced the levels of MDA, TNF-α, and IL-6, and increased the level of GSH. SI alone (100 mg/kg) did not induce any alterations in these parameters compared to the control group. These results indicate that SI attenuate ATR-induced damage to DA neurons by antioxidant and anti-inflammatory activities (Table 1).
Tyrosine hydroxylase is the rate-limiting enzyme for DA synthesis (Song et al., 2015). Expression of TH was significantly reduced by daily ATR treatment, while daily pretreatment with SI (10, 50, and 100 mg/ kg) rescued normal TH expression following ATR treatment (Fig. 3). High-dose SI alone (100 mg/kg) did not cause any significant change in striatal and nigral TH expression.
3.5. Soybean isoflavones prevented ATR-induced apoptosis of dopaminergic neurons Previous studies have shown that ATR exposure reduces DA 7
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 6. Soybean isoflavones (SI) activated the mTOR cytoprotective pathway in rat substantia nigra. (A–D) Changes in the phosphorylation level of the mTORassociated protein S6. (E) BEX2 protein expression was examined by immunofluorescence with quantitative analysis using Image Pro Plus. Green: TH (a marker of DAergic neuronal nuclei); red: BEX2. Scale bar: 40 μm. Data presented as mean ± SEM of three independent experiments. Statistical significance was determined by ANOVA with post hoc LSD tests. *p < 0.05 versus control group, #p < 0.05 versus ATR alone group. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
2013). Thus, we examined whether autophagy mediated this protective effect of SI by comparing expression levels of three autophagy markers, LC3-II, p62, and Beclin-1, in the substantia nigra among treatment groups. ATR reduced the protein and mRNA expression levels of LC3-II and Beclin-1, and increased p62 expression (Fig. 5A−D). SI attenuated the ATR-induced decrease in LC3-II protein at doses of 10, 50, and 100 mg/kg, increased the expression of Beclin-1 at a dose of 10 mg/kg, and decreased the expression of p62 at doses of 10 and 50 mg/kg (Fig. 5A−D). Compared to ATR alone, pretreatment with SI increased the expression of LC3-II mRNA at 10 mg/kg and decreased the expression of p62 mRNA at 10, 50, and 100 mg/kg (Fig. 5E and F). Alternatively, SI alone (100 mg/kg) had no significant effect on the striatal expression levels of these autophagy markers. These results indicate that SI can induce autophagy, particularly at 10 mg/kg, and suggest that autophagy induction is involved in SI-mediated neuroprotection.
secretion in the rat nigrostriatal pathway by inducing neuronal apoptosis (Song et al., 2015). Ultrastructural examination revealed that ATR exposure caused mitochondrial swelling and neuronal degeneration. To determine whether SI prevent ATR-induced apoptosis in substantia nigra and striatum, we compared expression of anti-apoptotic Bcl-2 and pro-apoptotic Bax expression at both the protein and mRNA levels by western blotting and PCR, respectively. Consistent with ATR-induced apoptosis, rats receiving ATR alone demonstrated enhanced nigrostriatal expression of Bax protein (Fig. 4A−D) and reduced expression of Bcl-2 protein (Fig. 4A, B, E, F) compared to the control group. Administration of SI (10, 50, and 100 mg/kg) to ATR-treated rats significantly reduced the expression of Bax (Fig. 4A−D) and increased the expression of Bcl-2 (Fig. 4A, B, E, F). The changes in Bax and Bcl-2 protein expression were paralleled by qualitatively similar changes in mRNA expression (Fig. 4G, H, R, L). SI alone (100 mg/kg) did not cause any significant change in Bcl-2 or Bax expression at either the protein or mRNA level. These results indicate that SI attenuate ATR-induced damage to DA neurons by inhibiting apoptosis.
3.7. Soybean isoflavones activated the mTOR-dependent pathway in rat substantia nigra
3.6. Autophagy is required for soybean isoflavones -mediated protection against ATR-induced neuronal apoptosis
Next, we investigated the signaling pathway(s) activated by SI that may contribute to neuroprotection. Previous studies have shown that mTORC1 plays a very important role in cell survival (Zoncu et al., 2011), so we focused on the expression of several proteins known to be involved in mTOR signaling in the substantia nigra. ATR increased mTOR expression and reduced phosphorylation of the mTOR-regulated protein S6, an effect reversed by pretreatment with SI (10, 50, and
Autophagy is a protective mechanism that can reduce or delay damage by redirecting metabolic resources for cell survival (Choi et al., 2013). For instance, most anti-ageing interventions are dependent on autophagy (de Cabo et al., 2014), and several flavonoids have been reported to stimulate autophagy (Li et al., 2017; Pallauf and Rimbach, 8
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
Fig. 6. (continued)
9
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
mRNA and protein levels, decreased Beclin-1 protein expression, and increased p62 mRNA and protein levels, consistent with a recent study (Chen et al., 2015). In contrast, ATR has been reported to induce autophagy (Ma et al., 2018; Song et al., 2015), a discrepancy that may be explained by differences in the ATR dose regimen and experimental model. Compared to ATR alone, SI increased the expression of Beclin-1 protein, LC3-II mRNA, and LC3-II protein at a dose of 10 mg/kg. At 50 and 100 mg/kg, SI also increased the expression of LC3-II protein, while mRNA level was unchanged. At 50 and 100 mg/kg, SI reduced the expression of p62 mRNA and protein, while 100 mg/kg reduced p62 mRNA expression but not protein expression. The quantitative relationship between mRNA and its encoded protein is often complex as it is influenced by differences in translation rate and protein degradation (de Sousa Abreu et al., 2009). Nonetheless, these results indicate that low-dose SI reduce ATR-induced neurodegenerative damage by inducing autophagy. It is known that mTORC1 is a critical regulator of cell survival and autophagy (Zoncu et al., 2011). In this study, ATR treatment increased mTOR expression and reduced phosphorylation of S6, in line with previous reports (Liu et al., 2013), while SI pretreatment significantly reduced mTOR and increased p-S6 expression, suggesting that SI mediate neuroprotection though an mTOR-dependent pathway. Brainexpressed X-linked 2 (BEX2) is a novel downstream effector of mTOR (Hu et al., 2015) widely expressed in the central nervous system (Alvarez et al., 2005). Studies have shown that BEX2 can inhibit tumor growth and mitochondrial apoptosis (Foltz et al., 2006; Naderi et al., 2010). Therefore, we hypothesized that SI protect against ATR-induced neurodegenerative damage through BEX2. Indeed, ATR inhibited BEX2 expression, a response reversed by SI pretreatment. Further studies are needed to confirm that autophagy induction via an mTOR-dependent pathway is necessary and sufficient for SI-induced DAergic neuroprotection against ATR.
100 mg/kg), while SI alone (100 mg/kg) had no effect on p-S6 expression (Fig. 6A−C). Brain-expressed X-linked 2 (BEX2) is a novel downstream effector of mTOR (Hu et al., 2015), so we also compared BEX2 expression among treatment groups. ATR reduced BEX2 expression, whereas SI prevented this reduction (Fig. 6A, D, E), while SI alone (100 mg/kg) had no effect (Fig. 6A, C, D; E). 4. Discussion Many recent reports have documented adverse effects of ATR exposure on the nervous system (Bardullas et al., 2011; Lin et al., 2013; Rodriguez et al., 2013; Song et al., 2015). Although several neuronal populations are damaged by ATR, substantia nigra pars compacta and striatal DAergic neurons appear most sensitive to ATR toxicity (Coban and Filipov, 2007; Surmeier et al., 2017). The present study demonstrates the SI protect nigrostriatal DAergic neurons against ATR-induced apoptosis in rat, consistent with prior studies reporting that flavonoids are effective neuroprotectants (Lin and Tsai, 2017). Open field and grip strength tests showed no significant adverse effects on motor function after 45 days of daily ATR exposure, which may be due to the short ATR exposure or low dose according to a previous study (Ma et al., 2018). Similarly, SI administration (50, 100, and 200 mg/kg) by gavage for 90 days had no effect on rat locomotor activity (Sandini et al., 2018). Thus, this dose regimen induces signs of nigrostriatal DAergic neuronal damage that are not yet manifested by motor deficits in the experimental period. However, SI did reverse ATR-induced neuronal damage, suggesting possible therapeutic utility prior to the emergence of motor impairment. ATR can induce the production of reactive oxygen species (ROS) and inflammatory factors in the central nervous system (CNS), which in turn can disrupt basic cellular functions and lead to mitochondrial dysfunction (Abarikwu, 2014; Zhang et al., 2015). In this study, transmission electron microscopy revealed degeneration of mitochondria and nuclei in the striatum of ATR-treated rats (Song et al., 2015), indicating that the DAergic neurons had been damaged. This ATR-induced neuronal damage was mediated at least in part by oxidative stress as evidenced by MDA accumulation and GSH depletion, and by inflammation as evidenced by elevated TNF-α and IL-6. Moreover, SI reversed these changes, indicating that SI protected nigral neurons by ameliorating oxidative and inflammatory damage. We then examined the possible signaling mechanisms underlying SImediated protection against ATR first by confirming the cellular identity of the target population by TH staining and then by demonstrating the roles of anti-apoptotic signaling, autophagy, and mTOR activity. Tyrosine hydroxylase is essential for maintenance of the DAergic phenotype by acting as the rate-limiting DA biosynthetic enzyme (Song et al., 2015). Therefore, we examined changes in TH expression following ATR treatment alone and ATR plus SI pretreatment. Nigrostriatal expression of TH was significantly reduced by ATR treatment, while co-administration of SI restored near-normal TH expression, confirming that ATR selectively damages and SI protects DAergic neurons. Atrazine-induced ultrastructural damage was consistent with mitochondria-dependent apoptosis, which is regulated by the balance between anti-apoptotic Bcl-2 and pro-apoptotic Bax (Song et al., 2015). Indeed, real-time PCR and Western blot revealed that ATR reduced Bcl2 expression and increased Bax expression, while pretreatment with SI significantly increased Bcl-2 compared to ATR alone, suggesting that SI mediate neuroprotection by inhibiting apoptosis. Autophagy is a critical cytoprotective mechanism under stress (Levine and Yuan, 2005). Autophagy-related genes such as LC3-II, p62, and Beclin-1 (especially LC3-II) are used as markers for the detection of autophagic activity (He and Levine, 2010). In addition, under dopaminergic toxicity, substantia nigra pars compacta DAergic neurons are among the first neurons to degenerate (Surmeier et al., 2017). Therefore, we examined the expression of LC3-II, p62, and Beclin-1 in the substantia nigra pars compacta and found that ATR reduced LC3-II
5. Conclusion The incidence and prevalence of late-onset diseases caused by the herbicide ATR are increasing due to its widespread use and persistence in the environment. Therefore, it is critical to design feasible interventions to prevent ATR toxicity. The present work identifies SI as potential protectants against ATR-induced DAergic neurodegeneration. Further studies are needed to reveal the precise molecular details of this protective mechanism and the efficacy against human ATR toxicity. Author contributions Peng Ii designed and performed the experiments. Xue-ting Li, Li-yan Yao and Yan-ping Wu performed statistical analysis of the data and proofreading of the article. Declaration of competing interest The authors declare no conflicts of interest. Acknowledgements This work was supported by the National Nature Science Foundation of China (grant number: 81273109). References Abarikwu, S.O., 2014. Protective effect of quercetin on atrazine-induced oxidative stress in the liver, kidney, brain, and heart of adult wistar rats. Toxicol. Int. 21, 148–155. https://doi.org/10.4103/0971-6580.139794. Alvarez, E., et al., 2005. Characterization of the Bex gene family in humans, mice, and rats. Gene 357, 18–28. https://doi.org/10.1016/j.gene.2005.05.012. Bakke, B., et al., 2009. Exposure to atrazine and selected non-persistent pesticides among corn farmers during a growing season. J. Expo. Sci. Environ. Epidemiol. 19, 544–554.
10
Ecotoxicology and Environmental Safety 190 (2020) 110065
P. Li, et al.
LeWitt, P.A., Fahn, S., 2016. Levodopa therapy for Parkinson disease: a look backward and forward. Neurology 86, S3–S12. https://doi.org/10.1212/WNL. 0000000000002509. Li, P., et al., 2017. Isoflavones induce BEX2-dependent autophagy to prevent ATR-induced neurotoxicity in SH-SY5Y cells. Cell. Physiol. Biochem. 43, 1866–1879. https://doi.org/10.1159/000484075. Li, Q.S., et al., 2019. Resveratrol and its analogues: recent advances in structural modification and bioactivity. Mini Rev. Med. Chem. https://doi.org/10.2174/ 1389557519666190128093840. Lin, C.Y., Tsai, C.W., 2017. Carnosic acid attenuates 6-hydroxydopamine-induced neurotoxicity in SH-SY5Y cells by inducing autophagy through an enhanced interaction of parkin and Beclin 1. Mol. Neurobiol. 54, 2813–2822. https://doi.org/10.1007/ s12035-016-9873-7. Lin, Z., et al., 2013. Short-term atrazine exposure causes behavioral deficits and disrupts monoaminergic systems in male C57BL/6 mice. Neurotoxicol. Teratol. 39, 26–35. https://doi.org/10.1016/j.ntt.2013.06.002. Lin, Z., et al., 2014. Gestational and lactational exposure to atrazine via the drinking water causes specific behavioral deficits and selectively alters monoaminergic systems in C57BL/6 mouse dams, juvenile and adult offspring. Toxicol. Sci. 141, 90–102. https://doi.org/10.1093/toxsci/kfu107. Liu, Q., et al., 2013. Characterization of Torin 2, an ATP-competitive inhibitor of mTOR, ATM, and ATR. Cancer Res. 73, 2574–2586. https://doi.org/10.1158/0008-5472. CAN-12-1702. Liu, Z., et al., 2017. Immunotoxic effects of atrazine and its main metabolites at environmental relevant concentrations on larval zebrafish (Danio rerio). Chemosphere 166, 212–220. https://doi.org/10.1016/j.chemosphere.2016.09.100. Ma, K., et al., 2018. LC3-II may mediate ATR-induced mitophagy in dopaminergic neurons through SQSTM1/p62 pathway. Acta Biochim. Biophys. Sin. 50, 1047–1061. https://doi.org/10.1093/abbs/gmy091. Ma, K., et al., 2015. Neurotoxicity effects of atrazine-induced SH-SY5Y human dopaminergic neuroblastoma cells via microglial activation. Mol. Biosyst. 11, 2915–2924. https://doi.org/10.1039/c5mb00432b. Meffe, R., de Bustamante, I., 2014. Emerging organic contaminants in surface water and groundwater: a first overview of the situation in Italy. Sci. Total Environ. 481, 280–295. https://doi.org/10.1016/j.scitotenv.2014.02.053. Naderi, A., et al., 2010. BEX2 regulates mitochondrial apoptosis and G1 cell cycle in breast cancer. Int. J. Cancer 126, 1596–1610. https://doi.org/10.1002/ijc.24866. Pallauf, K., Rimbach, G., 2013. Autophagy, polyphenols and healthy ageing. Ageing Res. Rev. 12, 237–252. https://doi.org/10.1016/j.arr.2012.03.008. Pogrmic-Majkic, K., et al., 2016. Atrazine activates multiple signaling pathways enhancing the rapid hCG-induced androgenesis in rat Leydig cells. Toxicology 368–369, 37–45. https://doi.org/10.1016/j.tox.2016.08.016. Priyadarshi, A., et al., 2000. A meta-analysis of Parkinson's disease and exposure to pesticides. Neurotoxicology (Little Rock) 21, 435–440. Pupyshev, A.B., et al., 2019. Therapeutic activation of autophagy by combined treatment with rapamycin and trehalose in a mouse MPTP-induced model of Parkinson's disease. Pharmacol. Biochem. Behav. 177, 1–11. https://doi.org/10.1016/j.pbb.2018. 12.005. Rodriguez, V.M., et al., 2013. Repeated exposure to the herbicide atrazine alters locomotor activity and the nigrostriatal dopaminergic system of the albino rat. Neurotoxicology (Little Rock) 34, 82–94. https://doi.org/10.1016/j.neuro.2012.10. 012. Sandini, T.M., et al., 2018. Effects of isoflavones on behavior, estradiol, glutamate, and GABA levels in intact middle-aged female rats. Nutr. Neurosci. 1–12. https://doi.org/ 10.1080/1028415X.2018.1447296. Singh, P., et al., 2014. Recent developments in biological activities of chalcones: a mini review. Eur. J. Med. Chem. 85, 758–777. https://doi.org/10.1016/j.ejmech.2014.08. 033. Song, X.Y., et al., 2015. Atrazine causes autophagy- and apoptosis-related neurodegenerative effects in dopaminergic neurons in the rat nigrostriatal dopaminergic system. Int. J. Mol. Sci. 16, 13490–13506. https://doi.org/10.3390/ijms160613490. Surmeier, D.J., et al., 2017. Selective neuronal vulnerability in Parkinson disease. Nat. Rev. Neurosci. 18, 101–113. https://doi.org/10.1038/nrn.2016.178. Thellung, S., et al., 2019. Autophagy activator drugs: a New opportunity in neuroprotection from misfolded protein toxicity. Int. J. Mol. Sci. 20. https://doi.org/10.3390/ ijms20040901. Tintner, R., Jankovic, J., 2002. Treatment options for Parkinson's disease. Curr. Opin. Neurol. 15, 467–476. Uysal, U., et al., 2013. Consumption of polyphenol plants may slow aging and associated diseases. Curr. Pharmaceut. Des. 19, 6094–6111. Wang, H., et al., 2015. Effects of atrazine on the development of neural system of zebrafish, Danio rerio. BioMed Res. Int. 2015, 976068. https://doi.org/10.1155/2015/ 976068. Yin, Z., et al., 2016. Autophagy: machinery and regulation. Microb Cell 3, 588–596. https://doi.org/10.15698/mic2016.12.546. Zhang, B., et al., 2015. Inflammatory reaction regulated by microglia plays a role in atrazine-induced dopaminergic neuron degeneration in the substantia nigra. J. Toxicol. Sci. 40, 437–450. https://doi.org/10.2131/jts.40.437. Zoncu, R., et al., 2011. mTOR: from growth signal integration to cancer, diabetes and ageing. Nat. Rev. Mol. Cell Biol. 12, 21–35. https://doi.org/10.1038/nrm3025.
https://doi.org/10.1038/jes.2008.53. Bardullas, U., et al., 2011. Chronic atrazine exposure causes disruption of the spontaneous locomotor activity and alters the striatal dopaminergic system of the male SpragueDawley rat. Neurotoxicol. Teratol. 33, 263–272. https://doi.org/10.1016/j.ntt.2010. 09.001. Beal, M.F., 2001. Experimental models of Parkinson's disease. Nat. Rev. Neurosci. 2, 325–334. https://doi.org/10.1038/35072550. Bisht, K., et al., 2010. Curcumin, resveratrol and flavonoids as anti-inflammatory, cytoand DNA-protective dietary compounds. Toxicology 278, 88–100. https://doi.org/ 10.1016/j.tox.2009.11.008. Bouvier, G., et al., 2006. Pesticide exposure of non-occupationally exposed subjects compared to some occupational exposure: a French pilot study. Sci. Total Environ. 366, 74–91. https://doi.org/10.1016/j.scitotenv.2005.08.016. Bretaud, S., et al., 2004. Sensitivity of zebrafish to environmental toxins implicated in Parkinson's disease. Neurotoxicol. Teratol. 26, 857–864. https://doi.org/10.1016/j. ntt.2004.06.014. Brown, T.P., et al., 2006. Pesticides and Parkinson's disease–is there a link? Environ. Health Perspect. 114, 156–164. https://doi.org/10.1289/ehp.8095. Campos-Pereira, F.D., et al., 2012. Early cytotoxic and genotoxic effects of atrazine on Wistar rat liver: a morphological, immunohistochemical, biochemical, and molecular study. Ecotoxicol. Environ. Saf. 78, 170–177. https://doi.org/10.1016/j.ecoenv. 2011.11.020. Carmona-Gutierrez, D., et al., 2019. The flavonoid 4,4'-dimethoxychalcone promotes autophagy-dependent longevity across species. Nat. Commun. 10, 651. https://doi. org/10.1038/s41467-019-08555-w. Chen, D., et al., 2015. Effects of atrazine and chlorpyrifos on oxidative stress-induced autophagy in the immune organs of common carp (Cyprinus carpio L.). Fish Shellfish Immunol. 44, 12–20. https://doi.org/10.1016/j.fsi.2015.01.014. Choi, A.M., et al., 2013. Autophagy in human health and disease. N. Engl. J. Med. 368, 1845–1846. https://doi.org/10.1056/NEJMc1303158. Coban, A., Filipov, N.M., 2007. Dopaminergic toxicity associated with oral exposure to the herbicide atrazine in juvenile male C57BL/6 mice. J. Neurochem. 100, 1177–1187. https://doi.org/10.1111/j.1471-4159.2006.04294.x. Cooper, R.L., et al., 1996. Effect of atrazine on ovarian function in the rat. Reprod. Toxicol. 10, 257–264. de Cabo, R., et al., 2014. The search for antiaging interventions: from elixirs to fasting regimens. Cell 157, 1515–1526. https://doi.org/10.1016/j.cell.2014.05.031. de Sousa Abreu, R., et al., 2009. Global signatures of protein and mRNA expression levels. Mol. Biosyst. 5, 1512–1526. https://doi.org/10.1039/b908315d. Duffy, R., et al., 2003. Improved cognitive function in postmenopausal women after 12 weeks of consumption of a soya extract containing isoflavones. Pharmacol. Biochem. Behav. 75, 721–729. https://doi.org/10.1016/s0091-3057(03)00116-3. Foltz, G., et al., 2006. Genome-wide analysis of epigenetic silencing identifies BEX1 and BEX2 as candidate tumor suppressor genes in malignant glioma. Cancer Res. 66, 6665–6674. https://doi.org/10.1158/0008-5472.CAN-05-4453. Foradori, C.D., et al., 2011. The differential effect of atrazine on luteinizing hormone release in adrenalectomized adult female Wistar rats. Biol. Reprod. 85, 684–689. https://doi.org/10.1095/biolreprod.111.092452. Foradori, C.D., et al., 2013. Atrazine inhibits pulsatile gonadotropin-releasing hormone (GnRH) release without altering GnRH messenger RNA or protein levels in the female rat. Biol. Reprod. 88, 9. https://doi.org/10.1095/biolreprod.112.102277. Gomes, B.A.Q., et al., 2018. Neuroprotective mechanisms of resveratrol in alzheimer's disease: role of SIRT1. Oxid Med Cell Longev 8152373. https://doi.org/10.1155/ 2018/8152373. 2018. Guo, D., et al., 2018. Resveratrol protects early brain injury after subarachnoid hemorrhage by activating autophagy and inhibiting apoptosis mediated by the Akt/mTOR pathway. Neuroreport 29, 368–379. https://doi.org/10.1097/WNR. 0000000000000975. He, C., Levine, B., 2010. The Beclin 1 interactome. Curr. Opin. Cell Biol. 22, 140–149. https://doi.org/10.1016/j.ceb.2010.01.001. Hines, C.J., et al., 2006. Mixed-effect models for evaluating multiple measures of atrazine exposure among custom applicators. J. Occup. Environ. Hyg. 3, 274–283. https://doi. org/10.1080/15459620600637366. Hu, Z., et al., 2015. Brain-expressed X-linked 2 is pivotal for hyperactive mechanistic target of rapamycin (mTOR)-mediated tumorigenesis. J. Biol. Chem. 290, 25756–25765. https://doi.org/10.1074/jbc.M115.665208. Jablonowski, N.D., et al., 2011. Still present after all these years: persistence plus potential toxicity raise questions about the use of atrazine. Environ. Sci. Pollut. Res. Int. 18, 328–331. https://doi.org/10.1007/s11356-010-0431-y. Konstantinou, I.K., et al., 2006. The status of pesticide pollution in surface waters (rivers and lakes) of Greece. Part I. Review on occurrence and levels. Environ. Pollut. 141, 555–570. https://doi.org/10.1016/j.envpol.2005.07.024. Krishna, S., et al., 2014. Brain deposition and neurotoxicity of manganese in adult mice exposed via the drinking water. Arch. Toxicol. 88, 47–64. https://doi.org/10.1007/ s00204-013-1088-3. Krishna, S., et al., 2016. Time-dependent behavioral, neurochemical, and metabolic dysregulation in female C57BL/6 mice caused by chronic high-fat diet intake. Physiol. Behav. 157, 196–208. https://doi.org/10.1016/j.physbeh.2016.02.007. Levine, B., Yuan, J., 2005. Autophagy in cell death: an innocent convict? J. Clin. Investig. 115, 2679–2688. https://doi.org/10.1172/JCI26390.
11