- Email: [email protected]
Sp-CBL inhibits white spot syndrome virus replication by enhancing apoptosis in mud crab (Scylla paramamosain)
Developmental and Comparative Immunology 105 (2020) 103580
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
Sp-CBL inhibits white spot syndrome virus replication by enhancing apoptosis in mud crab (Scylla paramamosain)
T
Tongtong Konga,b, Shanmeng Lina,b, Yi Gonga,b, Ngoc Tuan Trana,b, Yueling Zhanga,b, Huaiping Zhenga,b, Hongyu Maa,b, Shengkang Lia,b,∗ a b
Guangdong Provincial Key Laboratory of Marine Biotechnology, Institute of Marine Sciences, Shantou University, Shantou, 515063, China STU-UMT Joint Shellfish Research Laboratory, Shantou University, Shantou, 515063, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Scylla paramamosain Casitas B-Lineage lymphoma Caspase Apoptosis
In mammals, casitas B-lineage lymphoma (CBL) family proteins, a RING-type E3 ubiquitin ligase, are involved in many signal transduction pathways. However, the functions of CBL in invertebrates are not well elucidated. In this study, Sp-CBL containing CBL-N, CBL-2, CBL-3 and RING domains was identified in mud crab Scylla paramamosain. Sp-CBL was widely expressed in all tissues tested and found to be significantly up-regulated in the hemocytes of mud crab challenged by white spot syndrome virus (WSSV). The RNA interference of Sp-CBL increased the copy number of WSSV and declined the apoptosis rate of hemocytes. In addition, Sp-CBL could affect the activities of caspase 3 and the mitochondrial membrane potential. Taken together, the results of this study revealed that Sp-CBL could restrict WSSV proliferation through enhancing the apoptosis of the hemocytes, which would provide a novel insight into the anti-viral response in the innate immunity system of mud crab.
1. Introduction Casitas B-lineage lymphoma (CBL) family proteins act as a RINGtype E3 ubiquitin ligase (Fang et al., 2001), which has been found in metazoans (including both invertebrates and vertebrates) (Blake et al., 1991; Hime et al., 1997; Keane et al., 1999). The mammalian CBL family consists of c-CBL, CBL-b, and CBL-3 (Keane et al., 1995, 1999; Rao et al., 2002). These homologs encompass highly conserved domains: a tyrosine kinase binding domain (TKB), a linker (L), and a RING figure domain (RF) (Ryan et al., 2006). In invertebrates, D-CBL has been firstly identified in Drosophila, which consists of TKB, L and RF domains, but lacks an entire C-terminal proline-rich domain of mammalian CBL (Meisner et al., 1997). The TKB domain serves as domain-targeting of activated tyrosine kinases, while the RING domain may interact with E2 ubiquitin-conjugating enzymes (Duan et al., 2004; Schmidt and Dikic, 2005). It has been considered that the CBL family proteins involve many signal transduction pathways and regulate the development and function of cells (Dikic et al., 2003; Duan et al., 2004; Ryan et al., 2006). For instance, CBL is required in epithelial stem cell maintenance during organ development (Mohapatra et al., 2017). CBL-b, a member of the mammalian CBL family, plays a key role in the control of T cell immunity in vaccination, cancer biology or auto-immunity (Magdalena et al., 2011). The mammalian CBL proteins have also been reported to
∗
negatively regulate epidermal growth factor (EGR) and protein tyrosine kinase (PTKs), including receptor tyrosine kinases (RTKs) and non-receptor PTKs (Ettenberg, 1999; Levkowitz et al., 2000; Mohapatra et al., 2013). The adaptor protein, c-CBL, can stimulate the activation of mitogen-activated protein (MAP) kinase (Swaminathan and Tsygankov, 2010). Meanwhile, the D-CBL (identified from Drosophila eye) shares similar functions to the mammalian CBL when it acts as a negative regulator of receptor tyrosine kinase signals (Meisner et al., 1997). White spot syndrome virus (WSSV) is a common pathogen causing infection in marine animals, especially in crustaceans (shrimps and crabs) (Mazumder et al., 2016). Mud crab S. paramamosain, one of the economically important species for aquaculture, has been reported to be infected by WSSV with high mortality (Jithendran et al., 2010; Wang et al., 2005). Generally, the immune system of invertebrates recognizes and eliminates the invading microbes mainly via the innate immunity contributed by humoral and cellular immune responses (Rowley and Adam, 2007; Wei et al., 2018; Zhang et al., 2019). There were the inclusive studies that viral infection induces apoptosis of target cells in the host. For example, the human immunodeficiency virus (HIV) resulted in an induction of T cell apoptosis in humans (Muthumani et al., 2003) or the virulent avian influenza A virus caused vascular endothelial cell apoptosis in chickens (Ito et al., 2002). It has been found that cell undergoing apoptosis plays important roles in both vertebrates
Corresponding author. Guangdong Provincial Key Laboratory of Marine Biotechnology, Institute of Marine Sciences, Shantou University, Shantou, 515063, China. E-mail address: [email protected] (S. Li).
https://doi.org/10.1016/j.dci.2019.103580 Received 23 October 2019; Received in revised form 14 December 2019; Accepted 16 December 2019 Available online 17 December 2019 0145-305X/ © 2019 Published by Elsevier Ltd.
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
2.3. RNA interference of Sp-CBL
and invertebrates as protection against viral infection (Koyama et al., 1998, 2000). Mitochondria is a multifunction organelle, which acts as a crucial regulator of apoptosis (Galluzzi et al., 2010). A reduction in mitochondrial membrane potential, caspase 3 activation, and hyperproduction of reactive oxygen has been reported to be essential for apoptosis (Green and Reed., 1998). Mitochondria decreases the mitochondrial membrane potential during the early stage of the apoptosis (Otera and Mihara, 2014), while the B-cell lymphoma 2 (BCL-2) family proteins serve as important components in this process (Vieira et al., 2002). It has been demonstrated that caspase 3 is an ultimate effector of the apoptosis pathway, and a reduction in the activity of caspase 3 induces the descent of apoptosis rate (Galluzzi et al., 2008). Previous studies have reported that mammalian CBL-b is involved in apoptosis of various cells (Li et al., 2009; Rao et al., 2002), while the relationship between CBL and apoptosis in invertebrates is not clearly elucidated. In the present study, Sp-CBL was cloned and characterized from the mud crab. Sp-CBL was up-regulated in mud crab after WSSV challenge. Moreover, a decrease in apoptosis rate, an impairment in caspase 3 activity and an increase in mitochondrial membrane potential and the number of WSSV copies were found in Sp-CBL knockdown crabs after WSSV challenge, compared to those in the controls. These results suggested that Sp-CBL could restrict the virus proliferation through enhancing the apoptosis of the hemocytes in mud crab.
The small interfering RNA (siRNA), (siSp-CBL, 5′-GGUUAAGCAGU GUCAGCAA-3′) and the green fluorescent protein (GFP) sequence (siGFP, 5′-GGAGUUGUCCCAAUUCUUG-3′) were synthesized using In vitro Transcription T7 Kit (TaKaRa, Dalian, China) according to the manufacture's instruction. Then, 50 μg siCBL and siGFP were injected into the experimental and control groups, respectively. The hemocytes from the mud crabs in each group were collected (at different postinjection, 24 and 48 h) and used for further experiments. 2.4. Spatial expression analysis of Sp-CBL mRNA via real-time quantitative PCR Total RNAs, extracted from tissues, were used for the synthesis of the first-strand cDNA with PrimeScript™ RT Reagent Kit (Takara, Japan). The real-time quantitative PCR (qPCR) was carried out with the Premix Ex Taq (Perfect Real Time) (Takara, Japan). Primers (Sp-CBLF2: 5′-CTCCACCCAAACTCGTGATAGA-3′, Sp-CBL-R2: 5′-GGCAAAATG TCCAGGATAAAAG-3′, β-actin-F: 5′-GCGGCAGTGGTCATCTCCT-3′ and β-actin-R: 5′-GCCCTTCCTCACGCTAT CCT-3′) were used in this experiment. β-Actin was used as an internal control Relative fold change of mRNA expression level of Sp-CBL was calculated by 2-ΔΔCt algorithm. Each sample was tested in triplicate.
2. Materials and methods
2.5. Preparation of recombinant and polyclonal antibody Sp-CBL
2.1. Experimental animals and WSSV challenge
The complete ORF sequence of Sp-CBL was amplified using primers rSp-CBL-F (5′-CCCCTGGGATCCCCGGAATTCATGGCTACTAGTGGCAA GACGCGCAAC-3′) and rSp-CBL-R (5′-TCAGTCACGATGCGGCCGCTCG AGCTCCATCAGTACCTCATCCTCCTCCT CC -3′). Then PCR product was purified and ligated into a clone vector pGEX-6p-1, which was digested with EcoR I and Xho I (Takara, Japan) and purified in advance. The recombinant plasmid was transformed into Rosetta-gami™2 (DE3) plysS competent cells (Novagen, Germany) for protein expression. The recombination protein expressed in the supernatant with 0.1 mM IPTG induction and was purified as follows: harvested cells were re-suspended in PBS (pH 7.4) and sonicated at 4 °C for 20 min with a sonicator (BILON-250Y) set at 3 s sonication and 5 s interval under 30% power. Later, the supernatant was collected at 4 °C, and then ProteinIso® GST Resin (TransGen Biotech, Beijing, China) was added to purify the recombinant proteins. Purified proteins were assayed via 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and the BCA protein assay kit (Byotime, China) was used to evaluate the purified protein concentrations. The emulsive mixture of recombinant Sp-CBL protein and complete or incomplete Freund's adjuvant was injected into healthy mice intraperitoneally. The mice were immunized with 100 or 50 μg protein once a week. A week after the last injection, antisera of mice were harvested through the eyeball method and stored at −80 °C for subsequent use.
Healthy mud crabs (body weight 50 ± 10 g) purchased from Niutianyang (Shantou, Guangdong, China) were acclimatized under the laboratory conditions (at 25 °C and 10‰ salinity) for a week before further processing. Each crab was injected with 200 μL of WSSV suspension (1 × 106 copies/mL) through the base of the fourth leg. At different time post-infection (0, 12, 24, and 48 h), hemolymph of three randomly chosen crabs per group was collected into tubes containing ice-cold acid citrate dextrose (ACD) anticoagulant buffer (1.32% sodium citrate, 0.48% citric acid, 1.47% glucose), followed by centrifugation (10 min, 600×g at 4 °C).
2.2. Gene cloning and bioinformatics analysis Total RNA was extracted from hemocytes using Trizol (Invitrogen). Five μg RNA was used for the synthesis of the first-strand cDNA with the PrimeScriptTM II 1st Strand cDNA Kit (Takara, Japan). Specific primers (Sp-CBL-F1, 5′-CGTTGAGTTAGCAAGTGGTGT-3′ and Sp-CBL-R1, 5′-GTGGTATCACTCCATCAGTACCT-3′) were used to amplify the partial cDNA sequence of Sp-CBL from mud crab, containing a complete open reading frame (ORF). The PCR products were purified and ligated into a cloning vector using the pMD® 19-T vector (TaKaRa, Dalian, China) and transformed into Escherichia coli. Primers M13F (5′-CGCC AGGGTTTTCCCAGTCACGAC-3′) and M13R (5′-AGCGGATAACAATTT CACACAG GA-3′) were used to screen the positive recombinant clones. The selected clones were sequenced by a commercial company (IGE Biotechnology LTD, Guangzhou, China). The deduced Sp-CBL amino acid sequence was obtained using the ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/). BLAST algorithm at the National Center for Biotechnology Information (http:// www.ncbi.nlm.nih.gov/blast) and SMART software (http://smart.emblheidelberg.de/) were used to predict the Sp-CBL conserved domains. TASSER (https://zhanglab.ccmb.med.umich.edu/I-TASSER/) and PyMol viewer Software edited were used to predict and edit the 3D structure of Sp-CBL. The multiple alignments of amino acid sequences were analyzed by DNAMAN software Version 6.0.
2.6. Subcellular localization of Sp-CBL The hemocytes of mud crab were seeded onto the polylysine-coated coverslips, and fixed with 4% polyformaldehyde overnight at 4 °C. Then, hemocytes were washed three times with PBS and permeabilized with immunostaining permeabilization buffer with saponin (Byotime, China) for 10 min at room temperature. After washing three times with TBST (20 mM Tris-HCl, 150 mM NaCl and 0.05% Tween-20), the hemocytes were blocked with QuickBlock™ Primary Antibody Dilution Buffer for Western Blot (Byotime, China) for 30 min at room temperature, followed by incubation with antibodies that diluted at 1:500 in QuickBlock™ Primary Antibody Dilution Buffer at 4 °C overnight. The slides were washed three times with TBST, incubated with the Cy3labelled Goat Anti-Mouse IgG diluted at 1:500 in QuickBlock™ Primary Antibody Dilution Buffer for 30 min at room temperature in dark, and 2
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
Fig. 1. Bioinformatics analysis of Sp-CBL. (A) Schematic views of the structures of the protein Sp-CBL, D-CBL and CBL-b-like. (B) A three-dimensional (3D) model of the Sp-CBL protein. The CBl-N, CBl-2, CBl-3 and RING domains were highlighted with different colors, respectively. (C) Protein sequence alignment of Sp-CBL, DCBL and CBL-b-like. The eight conserved Zn-binding sites (C367, C370, C382, H384, C387, C390, C402 and C405) are marked in red boxes, and nine phosphotyrosinebinding pockets (Y260, R280, S282, C283, T284, R285, A290 and I304) are marked in green boxes.
washed three times with TBST. The hemocytes on the slides were dyed with DAPI Staining Solution (Byotime, China), washed (three times), and observed using a confocal microscope (Carl Zeiss, Germany).
hemocytes. The cell extracts were collected and mixed with 5 × SDS sample loading buffer. After boiling for 5 min, the proteins were separated by 10% SDS-polyacrylamide gel electrophoresis and then transferred onto a nitrocellulose membrane (Millipore, USA). The membrane was blocked with 5% (w/v) non-fat dry milk buffer (Trisbuffered saline containing 0.1% Tween 20 (TBST)) and further incubated with an appropriate primary antibody at 4 °C. The membrane was washed three times with TBST, followed by incubation with
2.7. Western blot analysis RIPA buffer (Beyotime Biotechnology, China) containing 1 mM phenylmethanesulfonyl fluoride (PMSF) was used to obtain the lysate of 3
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
A DAPI
Sp-CBL
Bright filed
Merge
Fig. 2. The subcellular localization and tissue distribution of Sp-CBL. (A) The subcellular localization of Sp-CBL in hemocytes of mud crab. The nuclear and Sp-CBL protein were marked with blue and red fluorescence, respectively. (B) Spatial expression analysis of Sp-CBL in various tissues of healthy mud crabs determined by qPCR. Sp-CBL transcript levels in different tissues were normalized to that in the hemocytes; β-actin was used as an internal reference gene.
Relative expression of Sp-CBL/ -actin H em oc yt M e id -in s te st in e Br Su a bc in ut ic M ul us ar ep cle id er m is
B 8 6 4 2
G ill
0
2.10. Mitochondrial membrane potential assay
horseradish peroxidase-conjugated secondary antibody (Bio-Rad, USA) for subsequent detection by ECL substrate (Thermo Scientific, USA).
Mitochondrial membrane potential was detected using a mitochondrial membrane potential kit with JC-1 (Beyotime, China) according to the manufacturer's protocol. Briefly, the hemocytes of mud crab were incubated with 5,5′,6,6′-Tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine (JC-1) dyeing buffer at 37 °C for 20 min. The cells were then washed three times with washing buffer, and re-suspended in washing buffer. The fixed hemocytes were used to examine the JC-1 monomers and aggregates by a Flex Station II microplate reader (Molecular Devices, USA) at 490/530 and 525/590 nm of excitation/ emission (Ex/Em), respectively. The results were converted into multiple relationships between different groups. Besides, the hemocytes were seeded on polylysine-coated slides and the images were captured using a confocal microscope (Carl Zeiss, Germany).
2.8. Quantitative analysis of WSSV copy number by real-time PCR The real-time PCR analysis was used to detect WSSV copy number in mud crab as previously described (Kong et al., 2018). Primers WSSV-1 ( 5′-TTGGTTTCATGCCCGAGATT-3′) and WSSV-2 (5′-CCTTGGTCAGCCC CTTGA-3′) and Premix Ex Taq™ (Probe qPCR) (Takara, Dalian, China), labelled with the fluorescent dye 5-carboxyfluorescein (FAM) ( 5′-FAM-TGCTGCCGTCTCCAA-TAMRA-3′) were used in this study. A 1400-bp DNA fragment of the WSSV genome was used as an internal standard (Gong et al., 2015). Each reaction mixture (10 μL) consisted of 5 μL of 2 × Premix Ex Taq™ (Probe qPCR), 0.2 μL of 10 mM primers each, 0.15 μL of 10 mM TaqMan fluorogenic probe, 1 μL of DNA template and nuclease-free water. LightCycler® 480 (Roche, USA) was used to perform the PCR with cycling conditions: initial denaturation at 94 °C for 3 min, 45 cycles at 95 °C for 5 s, 52 °C for 20 s and 72 °C for 20 s. For each treatment, the WSSV copy number was quantified for three times independently.
3. Results 3.1. Bioinformatics analysis of Sp-CBL cDNA The partial cDNA sequence of CBL from mud crab S. paramamosain (Sp-CBL) containing an ORF of 1347 bp encoding 448 deduced amino acids was cloned. The putative Sp-CBL protein contains cbl-N, cbl-N2, cbl-N3 and RING finger domains (Fig. 1A), which are highly similar to Drosophila melanogaster D-CBL (GenBank accession no. AAC47487.1) and Penaeus vannamei CBL-b-like (XP_027206464.1). Among the domains, the RING finger domain with an E3-bound E2 may act as scaffolds, transferring ubiquitin to the targets (Mohapatra et al., 2013). The estimated molecular weight of Sp-CBL protein is 51.6 kDa. The presumed 3D structure of Sp-CBL was predicted (Fig. 1B). The eight conserved Zn-binding sites (C367, C370, C382, H384, C387, C390, C402, and C405) (in red boxes) and nine phosphotyrosine-binding pockets (Y260,
2.9. Apoptosis rate and caspase 3 activity assay The apoptosis rate of hemocytes was evaluated using the FITC Annexin V Apoptosis Detection Kit I (BD PharmingenTM, USA in a Flow cytometry (AccuriTM C6 Plus, BD biosciences, USA). The caspase 3 activity of the hemocytes was determined using the Caspase 3 Activity Assay Kit (Beyotime, China) following the manufacturer's instructions. The results were expressed as μM/mg protein. Each sample was repeated three times. t-test was carried out to show the differences. 4
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
the muscles of Sp-CBL knockdown mud crabs was significantly increased (Fig. 4D). These results indicated that Sp-CBL might play an important role in the immune system of mud crab against virus infection. 3.5. Sp-CBL promotes apoptosis in hemocytes In the present study, it has been found that Sp-CBL could restrain WSSV proliferation in mud crab. To ascertain whether or not Sp-CBL could affect the apoptosis, the apoptosis rate was determined in the siSp-CBL mud crabs after WSSV infection. The results showed that the siSp-CBL-treated group had a lower apoptosis rate than the siGFPtreated group (Fig. 5A). In addition, caspase 3 has been proved to be essential in apoptotic progress. The caspase 3 activity was significantly impaired in the Sp-CBL knockdown mud crabs (Fig. 5B). These results suggested the important role of Sp-CBL involved in the apoptosis in mud crab after challenged by WSSV.
Fig. 3. The SDS-PAGE analysis of the recombinant Sp-CBL and the specificity determination of polyclonal antibody of Sp-CBL. (A) Expression and purification of recombinant Sp-CBL. Purified Sp-CBL protein was ascertained on 10% SDS-PAGE. Lane M, protein marker; lane 1, uninduced protein; lane 2, protein-induced with IPTG; lane 3, purified recombinant Sp-CBL. (B) The specificity of anti-Sp-CBL was examined by Western blot. The total proteins of hemocytes were analyzed. Lane 4, Sp-CBL protein in the hemocytes.
3.6. The mitochondrial membrane potential is regulated by Sp-CBL The mitochondrial membrane potential of the hemocytes was determined using confocal microscopy, with an observation of the JC-1 monomers (green fluorescence) and aggregates (red fluorescence). After the challenge test, the level of red fluorescence was impaired, while those of green fluorescence was enhanced (Fig. 6A), indicating the high apoptosis rate was found in the Sp-CBL knockdown mud crab during WSSV infection. The ratio of green to red in the Sp-CBL knockdown groups was decreased and increased when compared to that in the siGFP treated groups and the controls, respectively (Fig. 6B). Taken together, these results suggested that WSSV infection could induce the decline of mitochondrial membrane potential (based on the ratio of red to green), which suggested the role of Sp-CBL in this biological process in mud crab S. paramamosain.
R280, S282, C283, T284, R285, A290, and I304) (in green boxes) were found in Sp-CBL, D-CBL and CBL-b-like proteins (Fig. 1C). The partial cDNA sequence of Sp-CBL was deposited in GenBank under the accession number MN432486.2. 3.2. Sp-CBL polyclonal antibody preparation The recombinant protein of Sp-CBL was expressed in Rosettagami™2 (DE3) plysS competent cells and purified using GST Resin. The molecular weight of the recombinant protein was 75 kDa (Fig. 2A). Mice were immunized with purified recombinant protein to raise the polyclonal anti-Sp-CBL antibody. The specificity of anti-Sp-CBL was examined by Western blot and the results showed a single band with a molecular size of 51.6 kDa (Fig. 2B), suggesting that the antibody had high specificity. The antibody, therefore, can be used for the subsequent research.
4. Discussion CBL proteins are a highly conserved family of ubiquitin ligases that regulate many signaling pathways in different cells and in response to different stimuli (Dikic et al., 2003). Mammalian CBL has been reported to be a key negative regulator of activated tyrosine kinase-coupled receptors (Duan et al., 2004). However, the functions of CBL in invertebrates are poorly understood. In this study, we identified the SpCBL in mud crab for the first time and its structures was found to be highly similar to those of D. melanogaster D-CBL and P. vannamei CBL-blike. There were Zn-binding sites and phosphotyrosine-binding pockets, but not proline-rich motifs, were found in the structure of Sp-CBL. This differs from the mammalian CBL (Keane et al., 1999). The recombinant protein of Sp-CBL was expressed and purified for the preparation of polyclonal antibody. Then we found that Sp-CBL protein was expressed in the cytoplasm of hemocytes, suggesting that Sp-CBL mainly functions in the cytoplasm. The results is similar to the previous report of the subcellular location of c-CBL in NIH 3T3 cells (Tanaka et al., 1995). The results of this study revealed that the expression of Sp-CBL were significantly increased in mud crab following WSSV infection. Moreover, the knockdown of Sp-CBL increased the copy number of WSSV. These results suggested that Sp-CBL may play an important role in the innate immune system of mud crab against the viral infection. Also, this is the first report that CBL could attenuate the replication of WSSV in invertebrates. The previous study has demonstrated that CBL protein can promote shikonin-induced apoptosis by negatively regulating phosphoinositide 3-kinase/protein kinase B signaling in lung cancer cells (Qu et al., 2015). The apoptosis has been found to be decreased in NB 4 cells after inhibition of CBL with the proteasome inhibitor (Li et al., 2009). Herein, we found that the apoptosis activity of hemocytes in mud crab was increased after WSSV infection. The apoptosis rate analysis confirmed the effects of Sp-CBL on the
3.3. The subcellular localization and tissue distribution of Sp-CBL To understand more about the functions of Sp-CBL in mud crab, its subcellular localization in hemocytes was ascertained. As shown in Fig. 3A, the nuclear was stained with DAPI (blue), while the Sp-CBL protein was marked with red fluorescence. The results revealed that the Sp-CBL protein was expressed in the cytoplasm of hemocytes. Moreover, Sp-CBL was found to be expressed in all tissues, including hemocytes, mid-intestine, brain, muscle, subcuticular epidermis and gill (Fig. 3B), with a higher expression occurring in mid-intestine and subcuticular and a lower expression occurring in brain and subcuticular epidermis in mud crab S. paramamosain. 3.4. Effects of Sp-CBL on WSSV infection The transcriptional and translational levels of Sp-CBL in the hemocytes of mud crabs during WSSV infection were investigated using qPCR and Western blot. As shown in Fig. 4A, the mRNA of Sp-CBL was significantly up-regulated at 12, 24 and 48 h post-injection. The Western blot results revealed a significant increase in the protein level of Sp-CBL during the WSSV challenge (Fig. 4B). These results suggested that SpCBL was involved in viral infection in mud crab. The effect of Sp-CBL on WSSV proliferation was investigated using the RNAi approach. The efficiency of the Sp-CBL knockdown in mud crab hemocytes was determined by Western blot. At 24 and 48 h post-siRNA injection, the SpCBL was significantly reduced in the siSp-CBL crabs, while kept unchanged in the siGFP individuals (Fig. 4C). The WSSV copy number in 5
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
B
3
** *
2
* Sp-CBL
1
Tubulin
0
C
oh
12h 24h 48h
D WSSV copies / ng DNA
Relative expression of CBL / actin
A
10 5
**
Fig. 4. The influence of Sp-CBL on the controlling of WSSV infection in mud crab. (A) Expression patterns of Sp-CBL in the hemocytes of mud crabs after challenge with WSSV, determined by qPCR. (B) Western blot analysis of the Sp-CBL protein expression in mud crabs at different time points after challenge with WSSV challenge, the Sp-CBL protein levels of hemocytes were determined based on the expression levels of the internal control (tubulin protein). (C) The efficiency of the RNA interference at 24 and 48 h post-siSp-CBL or siGFP injection was determined by Western blot. (D) The WSSV copy number in the muscle were detected by TaqMan realtime PCR in siSp-CBL or siGFP-injected mud crabs challenged by WSSV. Data was generated from three biological replicates and shown as mean values ± standard deviations. Statistical significance is indicated by asterisks (*, P < 0.05; **, P < 0.01).
**
10 4 10 3 10 2 10 1 1000
al SV SV rm WS WS No + + L FP CB siG siSpFig. 5. Sp-CBL promoted the apoptosis in hemocytes. (A and B) The apoptosis rate of the mud crab hemocytes was evaluated using FITC Annexin V Apoptosis Detection Kit I and flow cytometry was used to analyze the apoptosis rate. (C) The activity of caspase 3 in the hemocytes of mud crabs treated with siSp-CBL and siGFP and both of those groups challenged by WSSV, respectively. The significant differences between treatments are indicated by asterisks (**, P < 0.01).
6
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
Fig. 6. Regulation of mitochondrial membrane potential by Sp-CBL in mud crab. Regulation of mitochondrial membrane potential by Sp-CBL in mud crab after a 36-h post-WSSV injection of siSp-CBL or siGFP-injected mud crabs. The mitochondrial membrane potential was valued using a confocal microscopy approach. The results were converted into multiple relationships between different groups. The values referred to the means ± standard deviation of triplicate assays (*, P < 0.05; **, P < 0.01).
including cytochrome c and other mitochondrial factors into the cytosol (Suzanne and Adams, 2002). Caspases, a family of cysteine proteases, are the central components of the apoptotic response (Fankhauser et al., 2000). In the extrinsic apoptotic pathway, the formation of the deathinducing signaling complex (DISC) results in the activation of caspase 8, the initiator caspase, which then cleaves and activates the effector caspases, caspase 3 and caspase 7 (Nagata, 2003; Tait and Green, 2010). In the intrinsic apoptotic pathway, following MOMP, and the formation of the apoptosome, the caspase-9-caspase-3 proteolytic cascade carry out (Li et al., 1997; Zou et al., 1997). In this study, the activity of caspase 3 decreased in the Sp-CBL knockdown mud crabs during the WSSV infection, compared to that in the controls. Besides, the mitochondrial membrane potential of hemocytes in the Sp-CBL knockdown mud crabs challenged by WSSV was enhanced compared to those in the siGFP controls. Therefore, Sp-CBL may take part in the apoptotic progress in the hemocytes through the regulation of caspase 3 and mitochondrial membrane potential. This is the first study showing the role of an invertebrate CBL (SpCBL) in the host immune system in response to the virus (WSSV) infection. The schematic model was showed in Fig. 7. The knockdown of Sp-CBL led to the impairment of caspase 3-dependent apoptosis activity
proliferation of WSSV in mud crabs, which was found to decrease in the Sp-CBL knockdown mud crabs after challenge with WSSV. These results indicated that Sp-CBL could enhance the apoptosis of hemocytes in mud crab, which was consistent with the previous reports. For example, CBLb promotes chemotherapy-induced apoptosis in rat basophilic leukemia cells (Rao et al., 2002) and potentiates the apoptotic action of arsenic trioxide (Li et al., 2011). Apoptosis, a type of energy-dependent progress, is extensively investigated programmed cell death (PCD) during viral infection (Zhou et al., 2017). Apoptosis can be triggered by both the extrinsic (or death receptor) and intrinsic pathways (Igney and Krammer, 2002). Extrinsic apoptosis could be induced by extracellular stress signals that are sensed and triggered by specific transmembrane receptors, including death receptors of the tumour necrosis factor family (Galluzzi et al., 2012). Mitochondria is not necessary for the extrinsic apoptosis mediated via death receptor (Zhou et al., 2017). While mitochondrial plays a vital role in the intrinsic apoptotic pathway (Parsons and Green, 2010). The intrinsic apoptosis can be elicited by extensive intracellular stress conditions and also the viral infection (Bellet et al., 2004; Zhou et al., 2017). Mitochondrial outer membrane permeabilization (MOMP) in the intrinsic apoptosis induces the release of proapoptotic proteins 7
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
Fig. 7. A proposed model of Sp-CBL mediated immune response to WSSV infection.
with the enhancement of mitochondrial membrane potential. An increased level of Sp-CBL transcript was found in mud crabs after challenge with WSSV. The overexpression of Sp-CBL promoted the activity of caspase 3 and led to the depression of mitochondrial membrane potential, resulting in the enhancement of the apoptosis rate. Consequently, the viral proliferation was attenuated. To the best of our knowledge, this is the first time to show that Sp-CBL could restrict the virus proliferation through enhancing the apoptosis of the hemocytes during WSSV infection in invertebrate mud crab S. paramamosain.
virus infection in shrimp. Fish Shellfish Immunol. 46, 516–522. Green, D.R., Reed, J.C., 1998. Mitochondria and apoptosis. Science 281, 1309–1312. Hime, G.R., Dhungat, M.P., Ng, A., Bowtell, D.D., 1997. D-Cbl, the Drosophila homologue of the c-Cbl proto-oncogene, interacts with the Drosophila EGF receptor in vivo, despite lacking C-terminal adaptor binding sites. Oncogene 14, 2709–2719. Igney, F.H., Krammer, P.H., 2002. Death and anti-death: tumor resistance to apoptosis. Nat. Rev. Cancer 2, 277–288. Ito, T., Kobayashi, Y., Morita, T., Horimoto, T., Kawaoka, Y., 2002. Virulent influenza A viruses induce apoptosis in chickens. Virus Res. 84, 27–35. Jithendran, K.P., Poornima, M., Balasubramanian, C.P., Kulasekarapandian, S., 2010. Diseases of mud crabs (Scylla spp.): an overview. Indian J. Fish. 57, 55–63. Keane, M.M., Rivero-Lezcano, O.M., Mitchell, J.A., Robbins, K.C., Lipkowitz, S., 1995. Cloning and characterization of cbl-b: a SH3 binding protein with homology to the ccbl proto-oncogene. Oncogene 10, 2367–2377. Keane, M.M., Ettenberg, S.A., Nau, M.M., Banerjee, P., Cuello, M., Penninger, J., Lipkowitz, S., 1999. cbl-3: a new mammalian cbl family protein. Oncogene 18, 3365–3375. Kong, T., Gong, Y., Liu, Y., Wen, X., Tran, N.T., Aweya, J.J., Zhang, Y., Ma, H., Zheng, H., Li, S., 2018. Scavenger receptor B promotes bacteria clearance by enhancing phagocytosis and attenuates white spot syndrome virus proliferation in Scylla paramamosian. Fish Shellfish Immunol. 78, 79–90. Koyama, A.H., Irie, H., Fukumori, T., Hata, S., Iida, S., Akari, H., Adachi, A., 1998. Role of virus-induced apoptosis in a host defense mechanism against virus infection. J. Med. Investig. 45, 37–45. Koyama, A.H., Fukumori, T., Fujita, M., Irie, H., Adachi, A., 2000. Physiological significance of apoptosis in animal virus infection. Int. Rev. Immunol. 22, 341–359. Levkowitz, G., Oved, S., Klapper, L.N., Harari, D., Lavi, S., Sela, M., Yarden, Y., 2000. cCbl is a suppressor of the neu oncogene. J. Biol. Chem. 275, 35532–35539. Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S., Wang, X., 1997. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489. Li, Y., Qu, X., Qu, J., Zhang, Y., Liu, J., Teng, Y., Hu, X., Hou, K., Liu, Y., 2009. Arsenic trioxide induces apoptosis and G2/M phase arrest by inducing Cbl to inhibit PI3K/Akt signaling and thereby regulate p53 activation. Cancer Lett. 284, 208–215. Li, Y., Qu, X., Qu, J., Zhang, Y., Liu, J., 2011. E3 ubiquitin ligase Cbl-b potentiates the apoptotic action of arsenic trioxide by inhibiting the PI3K/Akt pathway. Braz. J. Med. Biol. Res. 44, 105–111. Magdalena, P., Thien, C.B.F., Thomas, G., Reinhard, H., Gottfried, B., Langdon, W.Y., Penninger, J.M., 2011. Essential role of E3 ubiquitin ligase activity in Cbl-b-regulated T cell functions. J. Immunol. 186, 2138–2147. Mazumder, S.K., Ghaffar, M.A., Das, S.K., Alam, M.S., 2016. Low occurrence of WSSV in Penaeus monodon nauplii and post-larvae produced from PCR-negative broodstocks. Aquacult. Int. 23, 1–15. Meisner, H., Daga, A., Buxton, J., Fernandez, B., Chawla, A., Banerjee, U., Czech, M.P., 1997. Interactions of Drosophila Cbl with epidermal growth factor receptors and role of Cbl in R7 photoreceptor cell development. Mol. Cell. Biol. 17, 2217–2225. Mohapatra, B., Ahmad, G., Nadeau, S., Zutshi, N., An, W., Scheffe, S., Dong, L., Feng, D., Goetz, B., Arya, P., 2013. Protein tyrosine kinase regulation by ubiquitination: critical roles of Cbl-family ubiquitin ligases. Biochim. Biophys. Acta Mol. Cell Res. 1833, 122–139. Mohapatra, B., Zutshi, N., An, W., Goetz, B., Arya, P., Bielecki, T.A., Mustaq, I., Storck, M.D., Meza, J.L., Band, V., 2017. An essential role of CBL and CBL-B ubiquitin ligases in mammary stem cell maintenance. Development 144, 1072–1086. Muthumani, K., Choo, A.Y., Hwang, D.S., Chattergoon, M.A., Dayes, N.N., Zhang, D., Lee, M.D., Duvvuri, U., Weiner, D.B., 2003. Mechanism of HIV-1 viral protein R-induced
Acknowledgments The work was supported by grants from National Natural Science Foundation of China (41876152, 31850410487, 31802341), Guangdong provincial project of Science and Technology (2017B020204003), the ‘Sail Plan’ Program for Outstanding Talents of Guangdong Province (14600605) and support from Department of Education of Guangdong Province (2017KCXTD014). References Bellet, V., Delebassée, S., Bosgiraud, C., 2004. Visna/maedi virus-induced apoptosis involves the intrinsic mitochondrial pathway. Arch. Virol. 149, 1293–1307. Blake, T.J., Shapiro, M., Rd, M.H., Langdon, W.Y., 1991. The sequences of the human and mouse c-cbl proto-oncogenes show v-cbl was generated by a large truncation encompassing a proline-rich domain and a leucine zipper-like motif. Oncogene 6, 653–657. Dikic, I., Szymkiewicz, I., Soubeyran, P., 2003. Cbl signaling networks in the regulation of cell function. Cell. Mol. Life Sci. 60, 1805–1823. Duan, L., Reddi, A.L., Ghosh, A., Dimri, M., Band, H., 2004. The Cbl family and other ubiquitin ligases: destructive forces in control of antigen receptor signaling. Immunity 21, 7–17. Ettenberg, S.A., 1999. Ubiquitin ligase activity and tyrosine phosphorylation underlie suppression of growth factor signaling by c-Cbl/Sli-1. Mol. Cell 4, 1029–1040. Fang, D., Wang, H.N., Altman, Y., Elly, C., Liu, Y., 2001. Cbl-b, a RING-type E3 ubiquitin ligase, targets phosphatidylinositol 3-kinase for ubiquitination in T cells. J. Biol. Chem. 276, 4872–4878. Fankhauser, C., Friedlander, R.M., Gagliardini, V., 2000. Prevention of nuclear localization of activated caspases correlates with inhibition of apoptosis. Apoptosis 5, 117–132. Galluzzi, L., Brenner, C., Morselli, E., Touat, Z., Kroemer, G., 2008. Viral control of mitochondrial apoptosis. PLoS Pathog. 4, e1000018. Galluzzi, L., Morselli, E., Kepp, O., Vitale, I., Rigoni, A., Vacchelli, E., Michaud, M., Zischka, H., Castedo, M., Kroemer, G., 2010. Mitochondrial gateways to cancer. Mol. Asp. Med. 31, 1–20. Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G., 2012. Mitochondrial control of cellular life, stress, and death. Circ. Res. 111, 1198–1207. Gong, Y., Ju, C., Zhang, X., 2015. The miR-1000-p53 pathway regulates apoptosis and
8
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
Tanaka, S., Neff, L., Baron, R., Levy, J.B., 1995. Tyrosine phosphorylation and translocation of the c-cbl protein after activation of tyrosine kinase signaling pathways. J. Biol. Chem. 270, 14347–14351. Vieira, H.A., Patricia, B., Isabelle, C., Chahrazed, E.H., Delphine, H., Sabine, D., Annesophie, B., Catherine, B., Bernard, R., Guido, K., 2002. Cell permeable BH3peptides overcome the cytoprotective effect of Bcl-2 and Bcl-X(L). Oncogene 21, 1963–1977. Wang, G.Z., Li, S.J., Zeng, C.S., Lin, S.J., Kong, X.H., Ai, C.X., Lin, Q.W., 2005. Status of biological studies and aquaculture development of the mud crab, Scylla serrata, in China: an experimental ecological studies. Aquacult. Int. 13, 459–468. Wei, X.Y., Wang, L.M., Sun, W.W., Zhang, M., Ma, H.Y., Zhang, Y.L., Zhang, X.X., Li, S.K., 2018. C-type lectin B (SpCTL-B) regulates the expression of antimicrobial peptides and promotes phagocytosis in mud crab Scylla paramamosain. Dev. Comp. Immunol. 84, 213–229. Zhang, X.S., Tang, X.X., Tran, N.T., Huang, Y., Gong, Y., Zhang, Y.L., Zheng, H.P., Ma, H.Y., Li, S.K., 2019. Innate immune responses and metabolic alterations of mud crab (Scylla paramamosain) in response to Vibrio parahaemolyticus infection. Fish Shellfish Immunol. 87, 166–177. Zhou, X., Jiang, W., Liu, Z., Liu, S., Liang, X., 2017. Virus infection and death receptormediated apoptosis. Viruses 9, 316–335. Zou, H., Henzel, W.J., Liu, X., Lutschg, A., Wang, X., 1997. Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c–dependent activation of caspase-3. Cell 90, 405–413.
apoptosis. Biochem. Biophys. Res. Commun. 304, 583–592. Nagata, S., 2003. Fas ligand-induced apoptosis. Annu. Rev. Genet. 33, 29–55. Otera, H., Mihara, K., 2014. Mitochondrial dynamics: functional link with apoptosis. Int. J. Cell Biol. 821676–821686 2012. Parsons, M.J., Green, D.R., 2010. Mitochondria in cell death. Essays Biochem. 47, 99–114. Qu, D., Xu, X.M., Zhang, M., Jiang, T.S., Zhang, Y., Li, S.Q., 2015. Cbl participates in shikonin-induced apoptosis by negatively regulating phosphoinositide 3-kinase/ protein kinase B signaling. Mol. Med. Rep. 12, 1305–1313. Rao, N., Dodge, I., Band, H., 2002. The Cbl family of ubiquitin ligases: critical negative regulators of tyrosine kinase signaling in the immune system. J. Leukoc. Biol. 71, 753–763. Rowley, A.F., Adam, P., 2007. Invertebrate immune systems specific, quasi-specific, or nonspecific? J. Immunol. 179, 7209–7214. Ryan, P.E., Davies, G.C., Nau, M.M., Lipkowitz, S., 2006. Regulating the regulator: negative regulation of Cbl ubiquitin ligases. Trends Biochem. Sci. 31, 79–88. Schmidt, M.H., Dikic, I., 2005. The Cbl interactome and its functions. Nat. Rev. Mol. Cell Biol. 6, 907–918. Suzanne, C., Adams, J.M., 2002. The Bcl 2 family: regulators of the cellular life-or-death switch. Nat. Rev. Cancer 2, 647–656. Swaminathan, G., Tsygankov, A.Y., 2010. The Cbl family proteins: ring leaders in regulation of cell signaling. J. Cell. Physiol. 209, 21–43. Tait, S.W.G., Green, D.R., 2010. Mitochondria and cell death: outer membrane permeabilization and beyond. Nat. Rev. Mol. Cell Biol. 11, 621–632.
9
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
Sp-CBL inhibits white spot syndrome virus replication by enhancing apoptosis in mud crab (Scylla paramamosain)
T
Tongtong Konga,b, Shanmeng Lina,b, Yi Gonga,b, Ngoc Tuan Trana,b, Yueling Zhanga,b, Huaiping Zhenga,b, Hongyu Maa,b, Shengkang Lia,b,∗ a b
Guangdong Provincial Key Laboratory of Marine Biotechnology, Institute of Marine Sciences, Shantou University, Shantou, 515063, China STU-UMT Joint Shellfish Research Laboratory, Shantou University, Shantou, 515063, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Scylla paramamosain Casitas B-Lineage lymphoma Caspase Apoptosis
In mammals, casitas B-lineage lymphoma (CBL) family proteins, a RING-type E3 ubiquitin ligase, are involved in many signal transduction pathways. However, the functions of CBL in invertebrates are not well elucidated. In this study, Sp-CBL containing CBL-N, CBL-2, CBL-3 and RING domains was identified in mud crab Scylla paramamosain. Sp-CBL was widely expressed in all tissues tested and found to be significantly up-regulated in the hemocytes of mud crab challenged by white spot syndrome virus (WSSV). The RNA interference of Sp-CBL increased the copy number of WSSV and declined the apoptosis rate of hemocytes. In addition, Sp-CBL could affect the activities of caspase 3 and the mitochondrial membrane potential. Taken together, the results of this study revealed that Sp-CBL could restrict WSSV proliferation through enhancing the apoptosis of the hemocytes, which would provide a novel insight into the anti-viral response in the innate immunity system of mud crab.
1. Introduction Casitas B-lineage lymphoma (CBL) family proteins act as a RINGtype E3 ubiquitin ligase (Fang et al., 2001), which has been found in metazoans (including both invertebrates and vertebrates) (Blake et al., 1991; Hime et al., 1997; Keane et al., 1999). The mammalian CBL family consists of c-CBL, CBL-b, and CBL-3 (Keane et al., 1995, 1999; Rao et al., 2002). These homologs encompass highly conserved domains: a tyrosine kinase binding domain (TKB), a linker (L), and a RING figure domain (RF) (Ryan et al., 2006). In invertebrates, D-CBL has been firstly identified in Drosophila, which consists of TKB, L and RF domains, but lacks an entire C-terminal proline-rich domain of mammalian CBL (Meisner et al., 1997). The TKB domain serves as domain-targeting of activated tyrosine kinases, while the RING domain may interact with E2 ubiquitin-conjugating enzymes (Duan et al., 2004; Schmidt and Dikic, 2005). It has been considered that the CBL family proteins involve many signal transduction pathways and regulate the development and function of cells (Dikic et al., 2003; Duan et al., 2004; Ryan et al., 2006). For instance, CBL is required in epithelial stem cell maintenance during organ development (Mohapatra et al., 2017). CBL-b, a member of the mammalian CBL family, plays a key role in the control of T cell immunity in vaccination, cancer biology or auto-immunity (Magdalena et al., 2011). The mammalian CBL proteins have also been reported to
∗
negatively regulate epidermal growth factor (EGR) and protein tyrosine kinase (PTKs), including receptor tyrosine kinases (RTKs) and non-receptor PTKs (Ettenberg, 1999; Levkowitz et al., 2000; Mohapatra et al., 2013). The adaptor protein, c-CBL, can stimulate the activation of mitogen-activated protein (MAP) kinase (Swaminathan and Tsygankov, 2010). Meanwhile, the D-CBL (identified from Drosophila eye) shares similar functions to the mammalian CBL when it acts as a negative regulator of receptor tyrosine kinase signals (Meisner et al., 1997). White spot syndrome virus (WSSV) is a common pathogen causing infection in marine animals, especially in crustaceans (shrimps and crabs) (Mazumder et al., 2016). Mud crab S. paramamosain, one of the economically important species for aquaculture, has been reported to be infected by WSSV with high mortality (Jithendran et al., 2010; Wang et al., 2005). Generally, the immune system of invertebrates recognizes and eliminates the invading microbes mainly via the innate immunity contributed by humoral and cellular immune responses (Rowley and Adam, 2007; Wei et al., 2018; Zhang et al., 2019). There were the inclusive studies that viral infection induces apoptosis of target cells in the host. For example, the human immunodeficiency virus (HIV) resulted in an induction of T cell apoptosis in humans (Muthumani et al., 2003) or the virulent avian influenza A virus caused vascular endothelial cell apoptosis in chickens (Ito et al., 2002). It has been found that cell undergoing apoptosis plays important roles in both vertebrates
Corresponding author. Guangdong Provincial Key Laboratory of Marine Biotechnology, Institute of Marine Sciences, Shantou University, Shantou, 515063, China. E-mail address: [email protected] (S. Li).
https://doi.org/10.1016/j.dci.2019.103580 Received 23 October 2019; Received in revised form 14 December 2019; Accepted 16 December 2019 Available online 17 December 2019 0145-305X/ © 2019 Published by Elsevier Ltd.
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
2.3. RNA interference of Sp-CBL
and invertebrates as protection against viral infection (Koyama et al., 1998, 2000). Mitochondria is a multifunction organelle, which acts as a crucial regulator of apoptosis (Galluzzi et al., 2010). A reduction in mitochondrial membrane potential, caspase 3 activation, and hyperproduction of reactive oxygen has been reported to be essential for apoptosis (Green and Reed., 1998). Mitochondria decreases the mitochondrial membrane potential during the early stage of the apoptosis (Otera and Mihara, 2014), while the B-cell lymphoma 2 (BCL-2) family proteins serve as important components in this process (Vieira et al., 2002). It has been demonstrated that caspase 3 is an ultimate effector of the apoptosis pathway, and a reduction in the activity of caspase 3 induces the descent of apoptosis rate (Galluzzi et al., 2008). Previous studies have reported that mammalian CBL-b is involved in apoptosis of various cells (Li et al., 2009; Rao et al., 2002), while the relationship between CBL and apoptosis in invertebrates is not clearly elucidated. In the present study, Sp-CBL was cloned and characterized from the mud crab. Sp-CBL was up-regulated in mud crab after WSSV challenge. Moreover, a decrease in apoptosis rate, an impairment in caspase 3 activity and an increase in mitochondrial membrane potential and the number of WSSV copies were found in Sp-CBL knockdown crabs after WSSV challenge, compared to those in the controls. These results suggested that Sp-CBL could restrict the virus proliferation through enhancing the apoptosis of the hemocytes in mud crab.
The small interfering RNA (siRNA), (siSp-CBL, 5′-GGUUAAGCAGU GUCAGCAA-3′) and the green fluorescent protein (GFP) sequence (siGFP, 5′-GGAGUUGUCCCAAUUCUUG-3′) were synthesized using In vitro Transcription T7 Kit (TaKaRa, Dalian, China) according to the manufacture's instruction. Then, 50 μg siCBL and siGFP were injected into the experimental and control groups, respectively. The hemocytes from the mud crabs in each group were collected (at different postinjection, 24 and 48 h) and used for further experiments. 2.4. Spatial expression analysis of Sp-CBL mRNA via real-time quantitative PCR Total RNAs, extracted from tissues, were used for the synthesis of the first-strand cDNA with PrimeScript™ RT Reagent Kit (Takara, Japan). The real-time quantitative PCR (qPCR) was carried out with the Premix Ex Taq (Perfect Real Time) (Takara, Japan). Primers (Sp-CBLF2: 5′-CTCCACCCAAACTCGTGATAGA-3′, Sp-CBL-R2: 5′-GGCAAAATG TCCAGGATAAAAG-3′, β-actin-F: 5′-GCGGCAGTGGTCATCTCCT-3′ and β-actin-R: 5′-GCCCTTCCTCACGCTAT CCT-3′) were used in this experiment. β-Actin was used as an internal control Relative fold change of mRNA expression level of Sp-CBL was calculated by 2-ΔΔCt algorithm. Each sample was tested in triplicate.
2. Materials and methods
2.5. Preparation of recombinant and polyclonal antibody Sp-CBL
2.1. Experimental animals and WSSV challenge
The complete ORF sequence of Sp-CBL was amplified using primers rSp-CBL-F (5′-CCCCTGGGATCCCCGGAATTCATGGCTACTAGTGGCAA GACGCGCAAC-3′) and rSp-CBL-R (5′-TCAGTCACGATGCGGCCGCTCG AGCTCCATCAGTACCTCATCCTCCTCCT CC -3′). Then PCR product was purified and ligated into a clone vector pGEX-6p-1, which was digested with EcoR I and Xho I (Takara, Japan) and purified in advance. The recombinant plasmid was transformed into Rosetta-gami™2 (DE3) plysS competent cells (Novagen, Germany) for protein expression. The recombination protein expressed in the supernatant with 0.1 mM IPTG induction and was purified as follows: harvested cells were re-suspended in PBS (pH 7.4) and sonicated at 4 °C for 20 min with a sonicator (BILON-250Y) set at 3 s sonication and 5 s interval under 30% power. Later, the supernatant was collected at 4 °C, and then ProteinIso® GST Resin (TransGen Biotech, Beijing, China) was added to purify the recombinant proteins. Purified proteins were assayed via 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and the BCA protein assay kit (Byotime, China) was used to evaluate the purified protein concentrations. The emulsive mixture of recombinant Sp-CBL protein and complete or incomplete Freund's adjuvant was injected into healthy mice intraperitoneally. The mice were immunized with 100 or 50 μg protein once a week. A week after the last injection, antisera of mice were harvested through the eyeball method and stored at −80 °C for subsequent use.
Healthy mud crabs (body weight 50 ± 10 g) purchased from Niutianyang (Shantou, Guangdong, China) were acclimatized under the laboratory conditions (at 25 °C and 10‰ salinity) for a week before further processing. Each crab was injected with 200 μL of WSSV suspension (1 × 106 copies/mL) through the base of the fourth leg. At different time post-infection (0, 12, 24, and 48 h), hemolymph of three randomly chosen crabs per group was collected into tubes containing ice-cold acid citrate dextrose (ACD) anticoagulant buffer (1.32% sodium citrate, 0.48% citric acid, 1.47% glucose), followed by centrifugation (10 min, 600×g at 4 °C).
2.2. Gene cloning and bioinformatics analysis Total RNA was extracted from hemocytes using Trizol (Invitrogen). Five μg RNA was used for the synthesis of the first-strand cDNA with the PrimeScriptTM II 1st Strand cDNA Kit (Takara, Japan). Specific primers (Sp-CBL-F1, 5′-CGTTGAGTTAGCAAGTGGTGT-3′ and Sp-CBL-R1, 5′-GTGGTATCACTCCATCAGTACCT-3′) were used to amplify the partial cDNA sequence of Sp-CBL from mud crab, containing a complete open reading frame (ORF). The PCR products were purified and ligated into a cloning vector using the pMD® 19-T vector (TaKaRa, Dalian, China) and transformed into Escherichia coli. Primers M13F (5′-CGCC AGGGTTTTCCCAGTCACGAC-3′) and M13R (5′-AGCGGATAACAATTT CACACAG GA-3′) were used to screen the positive recombinant clones. The selected clones were sequenced by a commercial company (IGE Biotechnology LTD, Guangzhou, China). The deduced Sp-CBL amino acid sequence was obtained using the ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/). BLAST algorithm at the National Center for Biotechnology Information (http:// www.ncbi.nlm.nih.gov/blast) and SMART software (http://smart.emblheidelberg.de/) were used to predict the Sp-CBL conserved domains. TASSER (https://zhanglab.ccmb.med.umich.edu/I-TASSER/) and PyMol viewer Software edited were used to predict and edit the 3D structure of Sp-CBL. The multiple alignments of amino acid sequences were analyzed by DNAMAN software Version 6.0.
2.6. Subcellular localization of Sp-CBL The hemocytes of mud crab were seeded onto the polylysine-coated coverslips, and fixed with 4% polyformaldehyde overnight at 4 °C. Then, hemocytes were washed three times with PBS and permeabilized with immunostaining permeabilization buffer with saponin (Byotime, China) for 10 min at room temperature. After washing three times with TBST (20 mM Tris-HCl, 150 mM NaCl and 0.05% Tween-20), the hemocytes were blocked with QuickBlock™ Primary Antibody Dilution Buffer for Western Blot (Byotime, China) for 30 min at room temperature, followed by incubation with antibodies that diluted at 1:500 in QuickBlock™ Primary Antibody Dilution Buffer at 4 °C overnight. The slides were washed three times with TBST, incubated with the Cy3labelled Goat Anti-Mouse IgG diluted at 1:500 in QuickBlock™ Primary Antibody Dilution Buffer for 30 min at room temperature in dark, and 2
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
Fig. 1. Bioinformatics analysis of Sp-CBL. (A) Schematic views of the structures of the protein Sp-CBL, D-CBL and CBL-b-like. (B) A three-dimensional (3D) model of the Sp-CBL protein. The CBl-N, CBl-2, CBl-3 and RING domains were highlighted with different colors, respectively. (C) Protein sequence alignment of Sp-CBL, DCBL and CBL-b-like. The eight conserved Zn-binding sites (C367, C370, C382, H384, C387, C390, C402 and C405) are marked in red boxes, and nine phosphotyrosinebinding pockets (Y260, R280, S282, C283, T284, R285, A290 and I304) are marked in green boxes.
washed three times with TBST. The hemocytes on the slides were dyed with DAPI Staining Solution (Byotime, China), washed (three times), and observed using a confocal microscope (Carl Zeiss, Germany).
hemocytes. The cell extracts were collected and mixed with 5 × SDS sample loading buffer. After boiling for 5 min, the proteins were separated by 10% SDS-polyacrylamide gel electrophoresis and then transferred onto a nitrocellulose membrane (Millipore, USA). The membrane was blocked with 5% (w/v) non-fat dry milk buffer (Trisbuffered saline containing 0.1% Tween 20 (TBST)) and further incubated with an appropriate primary antibody at 4 °C. The membrane was washed three times with TBST, followed by incubation with
2.7. Western blot analysis RIPA buffer (Beyotime Biotechnology, China) containing 1 mM phenylmethanesulfonyl fluoride (PMSF) was used to obtain the lysate of 3
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
A DAPI
Sp-CBL
Bright filed
Merge
Fig. 2. The subcellular localization and tissue distribution of Sp-CBL. (A) The subcellular localization of Sp-CBL in hemocytes of mud crab. The nuclear and Sp-CBL protein were marked with blue and red fluorescence, respectively. (B) Spatial expression analysis of Sp-CBL in various tissues of healthy mud crabs determined by qPCR. Sp-CBL transcript levels in different tissues were normalized to that in the hemocytes; β-actin was used as an internal reference gene.
Relative expression of Sp-CBL/ -actin H em oc yt M e id -in s te st in e Br Su a bc in ut ic M ul us ar ep cle id er m is
B 8 6 4 2
G ill
0
2.10. Mitochondrial membrane potential assay
horseradish peroxidase-conjugated secondary antibody (Bio-Rad, USA) for subsequent detection by ECL substrate (Thermo Scientific, USA).
Mitochondrial membrane potential was detected using a mitochondrial membrane potential kit with JC-1 (Beyotime, China) according to the manufacturer's protocol. Briefly, the hemocytes of mud crab were incubated with 5,5′,6,6′-Tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine (JC-1) dyeing buffer at 37 °C for 20 min. The cells were then washed three times with washing buffer, and re-suspended in washing buffer. The fixed hemocytes were used to examine the JC-1 monomers and aggregates by a Flex Station II microplate reader (Molecular Devices, USA) at 490/530 and 525/590 nm of excitation/ emission (Ex/Em), respectively. The results were converted into multiple relationships between different groups. Besides, the hemocytes were seeded on polylysine-coated slides and the images were captured using a confocal microscope (Carl Zeiss, Germany).
2.8. Quantitative analysis of WSSV copy number by real-time PCR The real-time PCR analysis was used to detect WSSV copy number in mud crab as previously described (Kong et al., 2018). Primers WSSV-1 ( 5′-TTGGTTTCATGCCCGAGATT-3′) and WSSV-2 (5′-CCTTGGTCAGCCC CTTGA-3′) and Premix Ex Taq™ (Probe qPCR) (Takara, Dalian, China), labelled with the fluorescent dye 5-carboxyfluorescein (FAM) ( 5′-FAM-TGCTGCCGTCTCCAA-TAMRA-3′) were used in this study. A 1400-bp DNA fragment of the WSSV genome was used as an internal standard (Gong et al., 2015). Each reaction mixture (10 μL) consisted of 5 μL of 2 × Premix Ex Taq™ (Probe qPCR), 0.2 μL of 10 mM primers each, 0.15 μL of 10 mM TaqMan fluorogenic probe, 1 μL of DNA template and nuclease-free water. LightCycler® 480 (Roche, USA) was used to perform the PCR with cycling conditions: initial denaturation at 94 °C for 3 min, 45 cycles at 95 °C for 5 s, 52 °C for 20 s and 72 °C for 20 s. For each treatment, the WSSV copy number was quantified for three times independently.
3. Results 3.1. Bioinformatics analysis of Sp-CBL cDNA The partial cDNA sequence of CBL from mud crab S. paramamosain (Sp-CBL) containing an ORF of 1347 bp encoding 448 deduced amino acids was cloned. The putative Sp-CBL protein contains cbl-N, cbl-N2, cbl-N3 and RING finger domains (Fig. 1A), which are highly similar to Drosophila melanogaster D-CBL (GenBank accession no. AAC47487.1) and Penaeus vannamei CBL-b-like (XP_027206464.1). Among the domains, the RING finger domain with an E3-bound E2 may act as scaffolds, transferring ubiquitin to the targets (Mohapatra et al., 2013). The estimated molecular weight of Sp-CBL protein is 51.6 kDa. The presumed 3D structure of Sp-CBL was predicted (Fig. 1B). The eight conserved Zn-binding sites (C367, C370, C382, H384, C387, C390, C402, and C405) (in red boxes) and nine phosphotyrosine-binding pockets (Y260,
2.9. Apoptosis rate and caspase 3 activity assay The apoptosis rate of hemocytes was evaluated using the FITC Annexin V Apoptosis Detection Kit I (BD PharmingenTM, USA in a Flow cytometry (AccuriTM C6 Plus, BD biosciences, USA). The caspase 3 activity of the hemocytes was determined using the Caspase 3 Activity Assay Kit (Beyotime, China) following the manufacturer's instructions. The results were expressed as μM/mg protein. Each sample was repeated three times. t-test was carried out to show the differences. 4
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
the muscles of Sp-CBL knockdown mud crabs was significantly increased (Fig. 4D). These results indicated that Sp-CBL might play an important role in the immune system of mud crab against virus infection. 3.5. Sp-CBL promotes apoptosis in hemocytes In the present study, it has been found that Sp-CBL could restrain WSSV proliferation in mud crab. To ascertain whether or not Sp-CBL could affect the apoptosis, the apoptosis rate was determined in the siSp-CBL mud crabs after WSSV infection. The results showed that the siSp-CBL-treated group had a lower apoptosis rate than the siGFPtreated group (Fig. 5A). In addition, caspase 3 has been proved to be essential in apoptotic progress. The caspase 3 activity was significantly impaired in the Sp-CBL knockdown mud crabs (Fig. 5B). These results suggested the important role of Sp-CBL involved in the apoptosis in mud crab after challenged by WSSV.
Fig. 3. The SDS-PAGE analysis of the recombinant Sp-CBL and the specificity determination of polyclonal antibody of Sp-CBL. (A) Expression and purification of recombinant Sp-CBL. Purified Sp-CBL protein was ascertained on 10% SDS-PAGE. Lane M, protein marker; lane 1, uninduced protein; lane 2, protein-induced with IPTG; lane 3, purified recombinant Sp-CBL. (B) The specificity of anti-Sp-CBL was examined by Western blot. The total proteins of hemocytes were analyzed. Lane 4, Sp-CBL protein in the hemocytes.
3.6. The mitochondrial membrane potential is regulated by Sp-CBL The mitochondrial membrane potential of the hemocytes was determined using confocal microscopy, with an observation of the JC-1 monomers (green fluorescence) and aggregates (red fluorescence). After the challenge test, the level of red fluorescence was impaired, while those of green fluorescence was enhanced (Fig. 6A), indicating the high apoptosis rate was found in the Sp-CBL knockdown mud crab during WSSV infection. The ratio of green to red in the Sp-CBL knockdown groups was decreased and increased when compared to that in the siGFP treated groups and the controls, respectively (Fig. 6B). Taken together, these results suggested that WSSV infection could induce the decline of mitochondrial membrane potential (based on the ratio of red to green), which suggested the role of Sp-CBL in this biological process in mud crab S. paramamosain.
R280, S282, C283, T284, R285, A290, and I304) (in green boxes) were found in Sp-CBL, D-CBL and CBL-b-like proteins (Fig. 1C). The partial cDNA sequence of Sp-CBL was deposited in GenBank under the accession number MN432486.2. 3.2. Sp-CBL polyclonal antibody preparation The recombinant protein of Sp-CBL was expressed in Rosettagami™2 (DE3) plysS competent cells and purified using GST Resin. The molecular weight of the recombinant protein was 75 kDa (Fig. 2A). Mice were immunized with purified recombinant protein to raise the polyclonal anti-Sp-CBL antibody. The specificity of anti-Sp-CBL was examined by Western blot and the results showed a single band with a molecular size of 51.6 kDa (Fig. 2B), suggesting that the antibody had high specificity. The antibody, therefore, can be used for the subsequent research.
4. Discussion CBL proteins are a highly conserved family of ubiquitin ligases that regulate many signaling pathways in different cells and in response to different stimuli (Dikic et al., 2003). Mammalian CBL has been reported to be a key negative regulator of activated tyrosine kinase-coupled receptors (Duan et al., 2004). However, the functions of CBL in invertebrates are poorly understood. In this study, we identified the SpCBL in mud crab for the first time and its structures was found to be highly similar to those of D. melanogaster D-CBL and P. vannamei CBL-blike. There were Zn-binding sites and phosphotyrosine-binding pockets, but not proline-rich motifs, were found in the structure of Sp-CBL. This differs from the mammalian CBL (Keane et al., 1999). The recombinant protein of Sp-CBL was expressed and purified for the preparation of polyclonal antibody. Then we found that Sp-CBL protein was expressed in the cytoplasm of hemocytes, suggesting that Sp-CBL mainly functions in the cytoplasm. The results is similar to the previous report of the subcellular location of c-CBL in NIH 3T3 cells (Tanaka et al., 1995). The results of this study revealed that the expression of Sp-CBL were significantly increased in mud crab following WSSV infection. Moreover, the knockdown of Sp-CBL increased the copy number of WSSV. These results suggested that Sp-CBL may play an important role in the innate immune system of mud crab against the viral infection. Also, this is the first report that CBL could attenuate the replication of WSSV in invertebrates. The previous study has demonstrated that CBL protein can promote shikonin-induced apoptosis by negatively regulating phosphoinositide 3-kinase/protein kinase B signaling in lung cancer cells (Qu et al., 2015). The apoptosis has been found to be decreased in NB 4 cells after inhibition of CBL with the proteasome inhibitor (Li et al., 2009). Herein, we found that the apoptosis activity of hemocytes in mud crab was increased after WSSV infection. The apoptosis rate analysis confirmed the effects of Sp-CBL on the
3.3. The subcellular localization and tissue distribution of Sp-CBL To understand more about the functions of Sp-CBL in mud crab, its subcellular localization in hemocytes was ascertained. As shown in Fig. 3A, the nuclear was stained with DAPI (blue), while the Sp-CBL protein was marked with red fluorescence. The results revealed that the Sp-CBL protein was expressed in the cytoplasm of hemocytes. Moreover, Sp-CBL was found to be expressed in all tissues, including hemocytes, mid-intestine, brain, muscle, subcuticular epidermis and gill (Fig. 3B), with a higher expression occurring in mid-intestine and subcuticular and a lower expression occurring in brain and subcuticular epidermis in mud crab S. paramamosain. 3.4. Effects of Sp-CBL on WSSV infection The transcriptional and translational levels of Sp-CBL in the hemocytes of mud crabs during WSSV infection were investigated using qPCR and Western blot. As shown in Fig. 4A, the mRNA of Sp-CBL was significantly up-regulated at 12, 24 and 48 h post-injection. The Western blot results revealed a significant increase in the protein level of Sp-CBL during the WSSV challenge (Fig. 4B). These results suggested that SpCBL was involved in viral infection in mud crab. The effect of Sp-CBL on WSSV proliferation was investigated using the RNAi approach. The efficiency of the Sp-CBL knockdown in mud crab hemocytes was determined by Western blot. At 24 and 48 h post-siRNA injection, the SpCBL was significantly reduced in the siSp-CBL crabs, while kept unchanged in the siGFP individuals (Fig. 4C). The WSSV copy number in 5
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
B
3
** *
2
* Sp-CBL
1
Tubulin
0
C
oh
12h 24h 48h
D WSSV copies / ng DNA
Relative expression of CBL / actin
A
10 5
**
Fig. 4. The influence of Sp-CBL on the controlling of WSSV infection in mud crab. (A) Expression patterns of Sp-CBL in the hemocytes of mud crabs after challenge with WSSV, determined by qPCR. (B) Western blot analysis of the Sp-CBL protein expression in mud crabs at different time points after challenge with WSSV challenge, the Sp-CBL protein levels of hemocytes were determined based on the expression levels of the internal control (tubulin protein). (C) The efficiency of the RNA interference at 24 and 48 h post-siSp-CBL or siGFP injection was determined by Western blot. (D) The WSSV copy number in the muscle were detected by TaqMan realtime PCR in siSp-CBL or siGFP-injected mud crabs challenged by WSSV. Data was generated from three biological replicates and shown as mean values ± standard deviations. Statistical significance is indicated by asterisks (*, P < 0.05; **, P < 0.01).
**
10 4 10 3 10 2 10 1 1000
al SV SV rm WS WS No + + L FP CB siG siSpFig. 5. Sp-CBL promoted the apoptosis in hemocytes. (A and B) The apoptosis rate of the mud crab hemocytes was evaluated using FITC Annexin V Apoptosis Detection Kit I and flow cytometry was used to analyze the apoptosis rate. (C) The activity of caspase 3 in the hemocytes of mud crabs treated with siSp-CBL and siGFP and both of those groups challenged by WSSV, respectively. The significant differences between treatments are indicated by asterisks (**, P < 0.01).
6
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
Fig. 6. Regulation of mitochondrial membrane potential by Sp-CBL in mud crab. Regulation of mitochondrial membrane potential by Sp-CBL in mud crab after a 36-h post-WSSV injection of siSp-CBL or siGFP-injected mud crabs. The mitochondrial membrane potential was valued using a confocal microscopy approach. The results were converted into multiple relationships between different groups. The values referred to the means ± standard deviation of triplicate assays (*, P < 0.05; **, P < 0.01).
including cytochrome c and other mitochondrial factors into the cytosol (Suzanne and Adams, 2002). Caspases, a family of cysteine proteases, are the central components of the apoptotic response (Fankhauser et al., 2000). In the extrinsic apoptotic pathway, the formation of the deathinducing signaling complex (DISC) results in the activation of caspase 8, the initiator caspase, which then cleaves and activates the effector caspases, caspase 3 and caspase 7 (Nagata, 2003; Tait and Green, 2010). In the intrinsic apoptotic pathway, following MOMP, and the formation of the apoptosome, the caspase-9-caspase-3 proteolytic cascade carry out (Li et al., 1997; Zou et al., 1997). In this study, the activity of caspase 3 decreased in the Sp-CBL knockdown mud crabs during the WSSV infection, compared to that in the controls. Besides, the mitochondrial membrane potential of hemocytes in the Sp-CBL knockdown mud crabs challenged by WSSV was enhanced compared to those in the siGFP controls. Therefore, Sp-CBL may take part in the apoptotic progress in the hemocytes through the regulation of caspase 3 and mitochondrial membrane potential. This is the first study showing the role of an invertebrate CBL (SpCBL) in the host immune system in response to the virus (WSSV) infection. The schematic model was showed in Fig. 7. The knockdown of Sp-CBL led to the impairment of caspase 3-dependent apoptosis activity
proliferation of WSSV in mud crabs, which was found to decrease in the Sp-CBL knockdown mud crabs after challenge with WSSV. These results indicated that Sp-CBL could enhance the apoptosis of hemocytes in mud crab, which was consistent with the previous reports. For example, CBLb promotes chemotherapy-induced apoptosis in rat basophilic leukemia cells (Rao et al., 2002) and potentiates the apoptotic action of arsenic trioxide (Li et al., 2011). Apoptosis, a type of energy-dependent progress, is extensively investigated programmed cell death (PCD) during viral infection (Zhou et al., 2017). Apoptosis can be triggered by both the extrinsic (or death receptor) and intrinsic pathways (Igney and Krammer, 2002). Extrinsic apoptosis could be induced by extracellular stress signals that are sensed and triggered by specific transmembrane receptors, including death receptors of the tumour necrosis factor family (Galluzzi et al., 2012). Mitochondria is not necessary for the extrinsic apoptosis mediated via death receptor (Zhou et al., 2017). While mitochondrial plays a vital role in the intrinsic apoptotic pathway (Parsons and Green, 2010). The intrinsic apoptosis can be elicited by extensive intracellular stress conditions and also the viral infection (Bellet et al., 2004; Zhou et al., 2017). Mitochondrial outer membrane permeabilization (MOMP) in the intrinsic apoptosis induces the release of proapoptotic proteins 7
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
Fig. 7. A proposed model of Sp-CBL mediated immune response to WSSV infection.
with the enhancement of mitochondrial membrane potential. An increased level of Sp-CBL transcript was found in mud crabs after challenge with WSSV. The overexpression of Sp-CBL promoted the activity of caspase 3 and led to the depression of mitochondrial membrane potential, resulting in the enhancement of the apoptosis rate. Consequently, the viral proliferation was attenuated. To the best of our knowledge, this is the first time to show that Sp-CBL could restrict the virus proliferation through enhancing the apoptosis of the hemocytes during WSSV infection in invertebrate mud crab S. paramamosain.
virus infection in shrimp. Fish Shellfish Immunol. 46, 516–522. Green, D.R., Reed, J.C., 1998. Mitochondria and apoptosis. Science 281, 1309–1312. Hime, G.R., Dhungat, M.P., Ng, A., Bowtell, D.D., 1997. D-Cbl, the Drosophila homologue of the c-Cbl proto-oncogene, interacts with the Drosophila EGF receptor in vivo, despite lacking C-terminal adaptor binding sites. Oncogene 14, 2709–2719. Igney, F.H., Krammer, P.H., 2002. Death and anti-death: tumor resistance to apoptosis. Nat. Rev. Cancer 2, 277–288. Ito, T., Kobayashi, Y., Morita, T., Horimoto, T., Kawaoka, Y., 2002. Virulent influenza A viruses induce apoptosis in chickens. Virus Res. 84, 27–35. Jithendran, K.P., Poornima, M., Balasubramanian, C.P., Kulasekarapandian, S., 2010. Diseases of mud crabs (Scylla spp.): an overview. Indian J. Fish. 57, 55–63. Keane, M.M., Rivero-Lezcano, O.M., Mitchell, J.A., Robbins, K.C., Lipkowitz, S., 1995. Cloning and characterization of cbl-b: a SH3 binding protein with homology to the ccbl proto-oncogene. Oncogene 10, 2367–2377. Keane, M.M., Ettenberg, S.A., Nau, M.M., Banerjee, P., Cuello, M., Penninger, J., Lipkowitz, S., 1999. cbl-3: a new mammalian cbl family protein. Oncogene 18, 3365–3375. Kong, T., Gong, Y., Liu, Y., Wen, X., Tran, N.T., Aweya, J.J., Zhang, Y., Ma, H., Zheng, H., Li, S., 2018. Scavenger receptor B promotes bacteria clearance by enhancing phagocytosis and attenuates white spot syndrome virus proliferation in Scylla paramamosian. Fish Shellfish Immunol. 78, 79–90. Koyama, A.H., Irie, H., Fukumori, T., Hata, S., Iida, S., Akari, H., Adachi, A., 1998. Role of virus-induced apoptosis in a host defense mechanism against virus infection. J. Med. Investig. 45, 37–45. Koyama, A.H., Fukumori, T., Fujita, M., Irie, H., Adachi, A., 2000. Physiological significance of apoptosis in animal virus infection. Int. Rev. Immunol. 22, 341–359. Levkowitz, G., Oved, S., Klapper, L.N., Harari, D., Lavi, S., Sela, M., Yarden, Y., 2000. cCbl is a suppressor of the neu oncogene. J. Biol. Chem. 275, 35532–35539. Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S., Wang, X., 1997. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489. Li, Y., Qu, X., Qu, J., Zhang, Y., Liu, J., Teng, Y., Hu, X., Hou, K., Liu, Y., 2009. Arsenic trioxide induces apoptosis and G2/M phase arrest by inducing Cbl to inhibit PI3K/Akt signaling and thereby regulate p53 activation. Cancer Lett. 284, 208–215. Li, Y., Qu, X., Qu, J., Zhang, Y., Liu, J., 2011. E3 ubiquitin ligase Cbl-b potentiates the apoptotic action of arsenic trioxide by inhibiting the PI3K/Akt pathway. Braz. J. Med. Biol. Res. 44, 105–111. Magdalena, P., Thien, C.B.F., Thomas, G., Reinhard, H., Gottfried, B., Langdon, W.Y., Penninger, J.M., 2011. Essential role of E3 ubiquitin ligase activity in Cbl-b-regulated T cell functions. J. Immunol. 186, 2138–2147. Mazumder, S.K., Ghaffar, M.A., Das, S.K., Alam, M.S., 2016. Low occurrence of WSSV in Penaeus monodon nauplii and post-larvae produced from PCR-negative broodstocks. Aquacult. Int. 23, 1–15. Meisner, H., Daga, A., Buxton, J., Fernandez, B., Chawla, A., Banerjee, U., Czech, M.P., 1997. Interactions of Drosophila Cbl with epidermal growth factor receptors and role of Cbl in R7 photoreceptor cell development. Mol. Cell. Biol. 17, 2217–2225. Mohapatra, B., Ahmad, G., Nadeau, S., Zutshi, N., An, W., Scheffe, S., Dong, L., Feng, D., Goetz, B., Arya, P., 2013. Protein tyrosine kinase regulation by ubiquitination: critical roles of Cbl-family ubiquitin ligases. Biochim. Biophys. Acta Mol. Cell Res. 1833, 122–139. Mohapatra, B., Zutshi, N., An, W., Goetz, B., Arya, P., Bielecki, T.A., Mustaq, I., Storck, M.D., Meza, J.L., Band, V., 2017. An essential role of CBL and CBL-B ubiquitin ligases in mammary stem cell maintenance. Development 144, 1072–1086. Muthumani, K., Choo, A.Y., Hwang, D.S., Chattergoon, M.A., Dayes, N.N., Zhang, D., Lee, M.D., Duvvuri, U., Weiner, D.B., 2003. Mechanism of HIV-1 viral protein R-induced
Acknowledgments The work was supported by grants from National Natural Science Foundation of China (41876152, 31850410487, 31802341), Guangdong provincial project of Science and Technology (2017B020204003), the ‘Sail Plan’ Program for Outstanding Talents of Guangdong Province (14600605) and support from Department of Education of Guangdong Province (2017KCXTD014). References Bellet, V., Delebassée, S., Bosgiraud, C., 2004. Visna/maedi virus-induced apoptosis involves the intrinsic mitochondrial pathway. Arch. Virol. 149, 1293–1307. Blake, T.J., Shapiro, M., Rd, M.H., Langdon, W.Y., 1991. The sequences of the human and mouse c-cbl proto-oncogenes show v-cbl was generated by a large truncation encompassing a proline-rich domain and a leucine zipper-like motif. Oncogene 6, 653–657. Dikic, I., Szymkiewicz, I., Soubeyran, P., 2003. Cbl signaling networks in the regulation of cell function. Cell. Mol. Life Sci. 60, 1805–1823. Duan, L., Reddi, A.L., Ghosh, A., Dimri, M., Band, H., 2004. The Cbl family and other ubiquitin ligases: destructive forces in control of antigen receptor signaling. Immunity 21, 7–17. Ettenberg, S.A., 1999. Ubiquitin ligase activity and tyrosine phosphorylation underlie suppression of growth factor signaling by c-Cbl/Sli-1. Mol. Cell 4, 1029–1040. Fang, D., Wang, H.N., Altman, Y., Elly, C., Liu, Y., 2001. Cbl-b, a RING-type E3 ubiquitin ligase, targets phosphatidylinositol 3-kinase for ubiquitination in T cells. J. Biol. Chem. 276, 4872–4878. Fankhauser, C., Friedlander, R.M., Gagliardini, V., 2000. Prevention of nuclear localization of activated caspases correlates with inhibition of apoptosis. Apoptosis 5, 117–132. Galluzzi, L., Brenner, C., Morselli, E., Touat, Z., Kroemer, G., 2008. Viral control of mitochondrial apoptosis. PLoS Pathog. 4, e1000018. Galluzzi, L., Morselli, E., Kepp, O., Vitale, I., Rigoni, A., Vacchelli, E., Michaud, M., Zischka, H., Castedo, M., Kroemer, G., 2010. Mitochondrial gateways to cancer. Mol. Asp. Med. 31, 1–20. Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G., 2012. Mitochondrial control of cellular life, stress, and death. Circ. Res. 111, 1198–1207. Gong, Y., Ju, C., Zhang, X., 2015. The miR-1000-p53 pathway regulates apoptosis and
8
Developmental and Comparative Immunology 105 (2020) 103580
T. Kong, et al.
Tanaka, S., Neff, L., Baron, R., Levy, J.B., 1995. Tyrosine phosphorylation and translocation of the c-cbl protein after activation of tyrosine kinase signaling pathways. J. Biol. Chem. 270, 14347–14351. Vieira, H.A., Patricia, B., Isabelle, C., Chahrazed, E.H., Delphine, H., Sabine, D., Annesophie, B., Catherine, B., Bernard, R., Guido, K., 2002. Cell permeable BH3peptides overcome the cytoprotective effect of Bcl-2 and Bcl-X(L). Oncogene 21, 1963–1977. Wang, G.Z., Li, S.J., Zeng, C.S., Lin, S.J., Kong, X.H., Ai, C.X., Lin, Q.W., 2005. Status of biological studies and aquaculture development of the mud crab, Scylla serrata, in China: an experimental ecological studies. Aquacult. Int. 13, 459–468. Wei, X.Y., Wang, L.M., Sun, W.W., Zhang, M., Ma, H.Y., Zhang, Y.L., Zhang, X.X., Li, S.K., 2018. C-type lectin B (SpCTL-B) regulates the expression of antimicrobial peptides and promotes phagocytosis in mud crab Scylla paramamosain. Dev. Comp. Immunol. 84, 213–229. Zhang, X.S., Tang, X.X., Tran, N.T., Huang, Y., Gong, Y., Zhang, Y.L., Zheng, H.P., Ma, H.Y., Li, S.K., 2019. Innate immune responses and metabolic alterations of mud crab (Scylla paramamosain) in response to Vibrio parahaemolyticus infection. Fish Shellfish Immunol. 87, 166–177. Zhou, X., Jiang, W., Liu, Z., Liu, S., Liang, X., 2017. Virus infection and death receptormediated apoptosis. Viruses 9, 316–335. Zou, H., Henzel, W.J., Liu, X., Lutschg, A., Wang, X., 1997. Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c–dependent activation of caspase-3. Cell 90, 405–413.
apoptosis. Biochem. Biophys. Res. Commun. 304, 583–592. Nagata, S., 2003. Fas ligand-induced apoptosis. Annu. Rev. Genet. 33, 29–55. Otera, H., Mihara, K., 2014. Mitochondrial dynamics: functional link with apoptosis. Int. J. Cell Biol. 821676–821686 2012. Parsons, M.J., Green, D.R., 2010. Mitochondria in cell death. Essays Biochem. 47, 99–114. Qu, D., Xu, X.M., Zhang, M., Jiang, T.S., Zhang, Y., Li, S.Q., 2015. Cbl participates in shikonin-induced apoptosis by negatively regulating phosphoinositide 3-kinase/ protein kinase B signaling. Mol. Med. Rep. 12, 1305–1313. Rao, N., Dodge, I., Band, H., 2002. The Cbl family of ubiquitin ligases: critical negative regulators of tyrosine kinase signaling in the immune system. J. Leukoc. Biol. 71, 753–763. Rowley, A.F., Adam, P., 2007. Invertebrate immune systems specific, quasi-specific, or nonspecific? J. Immunol. 179, 7209–7214. Ryan, P.E., Davies, G.C., Nau, M.M., Lipkowitz, S., 2006. Regulating the regulator: negative regulation of Cbl ubiquitin ligases. Trends Biochem. Sci. 31, 79–88. Schmidt, M.H., Dikic, I., 2005. The Cbl interactome and its functions. Nat. Rev. Mol. Cell Biol. 6, 907–918. Suzanne, C., Adams, J.M., 2002. The Bcl 2 family: regulators of the cellular life-or-death switch. Nat. Rev. Cancer 2, 647–656. Swaminathan, G., Tsygankov, A.Y., 2010. The Cbl family proteins: ring leaders in regulation of cell signaling. J. Cell. Physiol. 209, 21–43. Tait, S.W.G., Green, D.R., 2010. Mitochondria and cell death: outer membrane permeabilization and beyond. Nat. Rev. Mol. Cell Biol. 11, 621–632.
9