Sp1 binding sites inserted into the Rous sarcoma virus long terminal repeat enhance LTR-driven gene expression

Gene 208 (1998) 73–82

Sp1 binding sites inserted into the Rous sarcoma virus long terminal repeat enhance LTR-driven gene expression ˇ ˇ ˇ´ Ondrej Machon, Veronika Strmen, Jirı Hejnar, Josef Geryk, Jan Svoboda * Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Flemingovo nam. 2, CZ-166 37 Prague, Czech Republic Received 15 July 1997; received in revised form 21 November 1997; accepted 21 November 1997

Abstract Although the Rous sarcoma virus (RSV ) long terminal repeat (LTR) is an efficient promoter of transcription, most RSV proviruses are down-regulated upon retroviral integration in non-permissive mammalian cells. Among other mechanisms, DNA methylation has been shown to be involved in proviral silencing. The presence of Sp1 binding sites has been demonstrated to be essential for protection of a CpG island and also non-island DNA regions from de novo methylation. Also, the presence of these sites in the LTRs correlates with the transcriptional activity of certain proviral structures. Using transient and stable transfection assays, we demonstrate that insertion of Sp1 binding sites into the RSV LTR remarkably increases expression of the LTR-driven genes in permissive and non-permissive cells, despite the reported negative effect of insertion of the non-specific DNA into the LTR promoter/enhancer sequences. Particular arrangement of inserted Sp1 sites was effective even in stably transfected reporter gene constructs into non-permissive mammalian cells, where additional factors exert negative effects on expression. © 1998 Elsevier Science B.V. Keywords: Retroviral integration; Proviral DNA methylation; CpG island; DNA–protein interaction; Gene silencing

1. Introduction The RSV proviruses are efficiently integrated in nonpermissive mammalian cells although their ability to transform such cells is three to four orders of magnitude lower than in permissive chicken cells ( Varmus et al., 1975; Wyke and Quade, 1980). The vast majority of integrated proviruses are down-regulated in non-permissive cells, despite the fact that RSV long terminal repeat (LTR) is an efficient promoter of transcription both in avian and mammalian cells after transfection (Overbeek ˇ et al., 1986; Machon et al., 1996). A proviral integration locus remarkably determines whether a provirus is active or silenced, as shown on RSV-infected rodent cells in vitro (Akroyd et al., 1987). Rearranged parts of viral * Corresponding author. Tel.: +420 2 24310234; Fax: +420 2 24310955; e-mail: [email protected] Abbreviations: bp, base pair(s); CAT, chloramphenicol acetyltransferase; cat, gene encoding CAT; CEF, chicken embryo fibroblast; EMSA, electrophoretic mobility shift assay; HIV, human immunodeficiency virus; kb, kilobase(s) or 1000 bp; LTR, long terminal repeat; mAb, monoclonal antibody; oligo, oligodeoxyribonucleotide; nt, nucleotide(s); RSV, Rous sarcoma virus; SV40, simian virus 40. 0378-1119/98/$19.00 © 1998 Elsevier Science B.V. All rights reserved. PII S 03 7 8 -1 1 1 9 ( 9 7 ) 0 0 6 59 - 8

and cellular DNA upstream of active proviruses but not of the non-transcribed ones have been demonstrated (Green et al., 1986; Fincham and Wyke, 1992). Such recombinations may relieve the negative effects of flanking chromosomal sequences. We have previously reported that H-19 hamster tumor transformed by a simplified LTR, v-src, LTR provirus segregates in tissue culture morphological revertants in which the provirus is transcriptionally silenced and methylated (Hejnar et al., 1994) and we have characterized a negative ˇ regulatory region adjacent to this provirus (Machon et al., 1996). Transcriptionally active, intact RSV proviruses were found to be integrated mostly in the vicinity of CpG islands ( Fincham and Wyke, 1991). Since CpG islands reside almost exclusively upstream of the genes (Bird, 1986; Bird, 1987), it may suggest that active proviruses were integrated in regions of transcribed cellular DNA. Except for rare examples, the CpG islands are free of methylation in somatic cells (for review see Bird, 1993) because these loci resist the wave of de novo methylation during embryogenesis ( Kafri et al., 1992). Sp1 binding sites present in the CpG island of the adenine phosphoribosyltransferase (aprt) gene play a crucial role in protect-

74

ˇ O. Machon et al. / Gene 208 (1998) 73–82

ing this gene locus from de novo methylation (Brandeis et al., 1994; Macleod et al., 1994). In addition, Brandeis et al. (1994) showed that Sp1 motifs could also prevent methylation of a non-island DNA region, although this protection is limited to the region of 120 bp around the Sp1 site. Therefore, Sp1 motifs can function as a barrier to DNA methylation. The protection is not absolute and certain CpG sites remained methylated (Silke et al., 1995). A protective effect against DNA methylation could be exerted by other Sp1 family proteins, since CpG islands are maintained methylation free in the Sp1-deficient embryonal stem cells (Marin et al., 1997). Sp1 protein is a basal transcription factor involved in the assembly of the transcription initiation complex TFIID (Chen et al., 1994). Via binding to DNA it also remodels an inactive nucleosomal chromatin structure to active open chromatin (Jongstra et al., 1984), which allows high-level expression of Sp1-dependent genes integrated in the genome (Laybourn and Kadonaga, 1991; Pondel et al., 1995). The Sp1 factor also participates in regulating the transcription of some mammalian retroviruses. Moloney murine leukemia (Mo-MLV ) and Moloney murine sarcoma (Mo-MSV ) proviruses fail to be expressed in embryonal stem cells and their transcriptional silence is accompanied with methylation of proviral sequences (Stuhlmann et al., 1981; Stewart et al., 1982). A Mo-MSV variant being transcribed in embryonal carcinoma stem cells gained a functional Sp1 binding site by point mutation in its LTR (Prince and Rigby, 1991). Further, expression of human endogenous retroviruslike elements (HERV-H family) correlated with the presence of the binding sites for Sp1 family proteins in their LTRs (Nelson et al., 1996; Sjottem et al., 1996). And finally, Sp1 binding sites in the human immunodeficiency virus (HIV ) and human T-cell leukemia virus (HTLV ) LTRs are essential for the basal transcription of the HIV provirus (Harrich et al., 1989; Sune and Garcia-Blanco, 1995) and the HTLV provirus (Barnhart et al., 1997), respectively. Guntaka et al. (1987) demonstrated the sensitivity of the RSV LTR-driven expression to the methylation of the LTR enhancer sequences. The RSV LTR may lack some yet undefined elements, which provide protective signals for promoting transcription of proviruses in nonpermissive mammalian host cells. We have therefore modified the RSV LTR by the insertion of Sp1 binding sites, assuming that it may increase LTR-driven expression and/or prevent repressive mechanisms of transcription (e.g. DNA methylation) in non-permissive cells. 2. Materials and methods 2.1. Plasmid constructions The pLCL construct was described previously ˇ (Machon et al., 1996). The vector was derived from the

cloned LTR, v-src, LTR proviral structure which arose by integration of the v-src mRNA reverse transcript in the H-19 Syrian hamster tumor cell line (Bodor and Svoboda, 1989; Bodor et al., 1989). In pLCL, the v-src gene of the H-19 proviral structure was substituted with a cat reporter gene and nearly all the flanking chromosomal sequences were stripped off (Fig. 1). SphI (−137 bp position relative to the transcription start site) and EcoRI (−53 bp position) in the 5∞ LTR were used for insertion of the Sp1 binding sites. The oligonucleotide (oligo) S+ (5∞CGGGGCGGGGCGGAACTGGGCGGAGTTAGGCATG) was annealed to oligo S− (5∞ CCTAACTCCGCCCAGTTCCGCCCCGCCCCGCATG); similarly, oligos E+ (5∞ AATTCGGGGCGGGGCGGAACTGGGCGGAGTTAGG) and E− (5∞ AATTCCTAACTCCGCCCAGTTCCGCCCCGCCCCG) were annealed. Sp1 binding sites are in bold letters. The point mutations in the oligo with mutated binding sites are depicted in lower-case letters: Sm+ (5∞ CGGttaGGGtaGGAACTGttaGGAGTTAGGCATG) and Sm− (5∞ CCTAACTCCtaaCAGTTCCtaCCCtaaCCGCATG). After annealing, double-stranded oligos with cohesive SphI (S) and EcoRI ( E) ends were directly used for ligation. The plasmid constructs with one (1S) and mutated (1Sm), two (2S) and three (3S ) inserts at the SphI site and one (1E) and three (3E) inserts at the EcoRI site were prepared. Plasmid pLCLneo is a derivative of pLCL: the 1146-bp fragment containing the neo gene together with TK promoter and simian virus 40 (SV40)-polyadenylation signal was excised from the plasmid pMC1neoPolyA (Stratagene, La Jolla, CA) (bp positions 451–1597) and inserted into a unique NarI site of pLCL, 212 bp upstream of the 5∞ RSV LTR. Plasmid pHIVS comprises a 120-bp ScaI–PvuII fragment excised from the 5∞ LTR of the HIV-1 strain HXB2 (position −139 to −19 with respect to the transcription start site) (Shaw et al., 1984) which has been cloned into the SphI site (blunt-ended by T4 polymerase) of the 5∞ LTR in the plasmid pLCLneo. Plasmid pN111 contains a non-specific 111-bp ScaI–PvuI fragment originating from plasmid pUC19, which has also been blunt-end ligated into the SphI site of the 5∞ LTR of the pLCLneo. 2.2. Cell lines Syrian hamster immortalized fibroblastoid cell line NIL-2 (Diamond, 1967) was maintained in Dulbecco’s minimal essential medium (DMEM ) and F12 (1:1) medium supplemented with 5% calf serum. During stable transfections, 5% fetal calf serum was added. Chicken embryo fibroblasts (CEF ) were prepared by standard procedures and maintained in DMEM and F12 (1:1) medium supplemented with 5% calf serum, 2% fetal calf serum and 1% chicken serum. F9 teratocarcinoma cell

ˇ O. Machon et al. / Gene 208 (1998) 73–82

75

Fig. 1. Scheme of the cat reporter gene vector pLCL employed for transfection experiments and a structure of RSV LTR. pLCL (LTR, cat, LTR) plasmid was constructed on the basis at the H-19 proviral structure LTR, v-src, LTR (Bodor and Svoboda, 1989) by substitution of the v-src gene with the cat reporter gene. The reporter gene is therefore driven by 5∞ LTR and the polyadenylation signal resides in the 3∞ LTR. s.d., s.a., represent joining of the splice donor with the splice acceptor site in the original H-19 proviral structure. TATA consensus sequence and CAP site in the 5∞ LTR are indicated. Base pair positions of restriction sites are relative to the transcription start site.

line (Sherman and Miller, 1978) was maintained at a maximum density of 80% confluence in DMEM and F12 (1:1) medium supplemented with 10% fetal calf serum. BM-2 chicken monoblasts (Moscovici, 1975) were passaged in DMEM and F12 (1:1) medium supplemented with 8% fetal calf serum and 2% chicken serum at density 1.5×106 cells/ml. 2.3. Transfection experiments 2.3.1. Transient transfection assay NIL-2 cells (60-mm dishes) were transfected by standard calcium phosphate–DNA precipitation (Sambrook et al., 1989) with 2 mg of CsCl gradient-purified cat plasmid constructs. CEF cells were transfected by lipofection using DOTAP reagents (Boehringer Mannheim, Germany) according to manufacturer’s instructions. 5×106 BM-2 cells in 0.4 ml media supplemented with 1.25% DMSO were electroporated by an Easyject Plus electroporator ( Equibio, Monchelsea, UK ) in 4-mm cuvettes at 260 V, 1050 mF and 2310 V. 24 h post-transfection, DMSO-containing medium was exchanged for standard medium. Cell lysates were prepared by three consecutive freeze–thawing cycles 48 h post-transfection and tested for CAT activity by the liquid scintillation method using 14C-labeled chloramphenicol (Amersham, Bucks, UK; 55 mCi/mmol ) and butyryl-coenzyme A. CAT activity was estimated as the radioactivity of butyrylated labeled chloramphenicol extracted into xylene and measured in a liquid scintillator (Seed and Sheen, 1988). We have also used a CAT ELISA Kit (Boehringer Mannheim) as an alternative method for measuring CAT activity. Samples were tested for bgalactosidase activity on a parallel dish and we found a minimal variance among them; we considered the transfection efficiency very reproducible. Enzyme activities were thus normalized just to protein concentration mea-

sured by the Bradford dye protein assay (Bio-Rad, Hercules, CA). 2.3.2. Stable transfection assay NIL-2 cells (60-mm dishes) were co-transfected by calcium phosphate–DNA precipitation with 10 mg of CsCl-purified cat plasmid constructs and 1 mg of neo plasmid pMC1neoPolyA (Stratagene); in the case of the pLCLneo and its derivatives the co-transfection was not essential. Two days post-transfection, all the cells from 60-mm dishes were transferred to 100-mm dishes and selection of the G418 antibiotics was introduced, 0.4 mg/ml Geneticin (Sigma, St Louis, MO). 12–14 days post-transfection, resistant colonies were pooled and cells were harvested as soon as they reached confluence (1–2 days). Each 100-mm dish contained 100–120 resistant colonies. 2.4. Electrophoretic mobility shift asssay (EMSA) Nuclear extracts were prepared according to Dignam et al. (1983). Briefly, 2×108 cells were washed in 5 ml phosphate-buffered saline and centrifuged at 2000 rpm at 4°C. Pelleted cells were resuspended in hypotonic buffer (10 mM Tris–Cl, pH 7.4, 10 mM NaCl, 1.6 mM MgCl , 1 mM CaCl ), maintained 15 min on ice and 2 2 lysed in a homogenizer in the presence of 0.1% Triton X-100. The homogenate was centrifuged as described above and pelleted nuclei were washed in 5 ml of TMS buffer (0.25 M sucrose, 5 mM MgCl , 10 mM Tris–Cl, 2 pH 7.4) and extracted in 1 ml of storage buffer (20 mM Hepes–KOH, pH 7.5, 5 mM MgCl , 0.1 mM EGTA, 2 20% glycerol, 400 mM NaCl ). All solutions were kept on ice and contained 5 mM DTT, 0.5 mM PMSF, 20 mM benzamidine, 20 mM glycerophosphate and 5 mg/ml pepstatin, leupeptin and aprotinin. The KpnI–EcoRI subfragments of the modified LTR (with

76

ˇ O. Machon et al. / Gene 208 (1998) 73–82

oligo inserts at the SphI site) were isolated from lowmelting agarose, purified, 5∞ labeled by filling in with T4 polymerase and used as probes in EMSA. The reactions were performed as follows: 2.4 mg of NIL-2 nuclear extract was incubated with 1 mg of poly(dI-dC ) (Boehringer Mannheim) on ice for 30 min in a 14 ml reaction mixture consisting of 15 mM Tris–Cl, pH 7.5, 15 mM Hepes, 100 mM KCl, 25 mM NaCl, 0.1 mM EDTA, 0.5 mM DTT and 5% glycerol. A 100-fold molar excess of 34-bp oligo used for LTR modifications served as a specific competitor. For supershift assays, 5 ml of monoclonal antibody (mAb) anti-Sp1 (100 mg/ml, Santa Cruz Biotech, Santa Cruz, CA), or polyclonal anti-Sp3 and anti-Sp4 antibody, was added and within 5 min followed by 1–2 ng of labeled DNA (30–50 counts per second), and the reaction was performed for another 30 min at 0°C. Samples were loaded onto 4% nondenaturing acrylamide gel and electrophoresed with 0.5×Tris–borate–EDTA, 12 V/cm, at 4°C. A 2 h prerun under the same conditions appeared to be essential.

3. Results and discussion 3.1. Influence of insertion of the high-affinity Sp1 binding sites into the RSV LTR on transient expression DNA sequence of the Sp1 transcription factor binding site varies in promoters of many genes. Generally, the core cognate sequence, GGGCGG, is mostly preserved (for review see Kadonaga et al., 1986), although some theoretical studies suggest other possible variations of this binding motif (Bucher, 1990; Berg, 1992). For insertion into the RSV LTR, we employed a 34-bp synthesized oligo encompassing two cognate binding elements for the Sp1 transcription factor. One motif is derived from promoters of Herpes simplex virus or dihydrofolate reductase and the other is derived from SV40 enhancer. These sequences were reported as highaffinity consensus binding sites ( Kadonaga et al., 1986). The effect of insertion of the Sp1 recognition site inside the RSV LTR was assessed on the reporter ˇ plasmid construct pLCL described previously (Machon et al., 1996). The pLCL (LTR, cat, LTR) contains a cat reporter gene under the control of RSV 5∞ LTR and the polyadenylation signal is localized in the 3∞ LTR ( Fig. 1). SphI (−137 bp position) and EcoRI (−53 bp position) restriction sites in the 5∞ LTR were used for the oligo insertion. Generated plasmid constructs contain one, two or three oligo inserts, meaning that they have obtained two, four or six Sp1 binding sites, respectively. We used three cell lines for transient expression of the cat reporter gene driven by the modified LTR: chicken embryo fibroblasts (CEF ) permissive for RSV replication, and the non-permissive hamster fibroblastoid NIL-2 and mouse embryonal carcinoma F9 cell lines.

The F9 cells possess a highly methylated genome and the methylation status of the DNA can profoundly change during differentiation ( Yeivin et al., 1996). Results are depicted in Fig. 2. The basic experiment was performed on the NIL-2 cell line (Fig. 2A). Transient expression of the reporter gene was elevated 3.5-fold relative to the control vector pLCL by the insertion of a single 34-bp oligo into the SphI site of the LTR (1S, 34 bp), and by the insertion of a double insert (2S, 68 bp) more than 6-fold, whereas the triple insert (3S, 102 bp) decreased transient expression to 45% of the control. One insert at the EcoRI site of the LTR (1E, 34 bp) increased expression 1.5-fold and, on the contrary, a triple insert (3E, 102 bp) decreased transcription to 22% of the control. A mutated oligo was generated by point mutations at both recognition motifs and at the sequence that resembles the binding motif. These mutations significantly disrupt the Sp1 protein binding. Indeed, insertion of such mutated oligo in the SphI site (1Sm) had a negligible effect on plasmid expression. When we performed transient transfections with the same constructs on chicken cells (CEF ) (Fig. 2B) or mouse F9 cells ( Fig. 2C ), we observed similar effects on expression of the reporter gene as those on NIL-2 cells. Interestingly, Sp1 modifications of the LTR remarkably increased expression also in permissive chicken cells, therefore the LTR promoter/enhancer sequences can be equipped with additional elements that are even more effective in promoting transcription in permissive cells. Of note, one insert both at the SphI (1S ) or at the EcoRI site (1E) produced comparable elevation of the transcriptional level in CEF and F9 cells, whereas the 1S construct compared with 1E construct was more efficient in the NIL-2 cell line. Cullen et al. (1985) reported a negative influence of RSV LTR insertional mutagenesis on its ability to assure expression of a reporter gene: insertion of the 79-bp non-specific fragment at the SphI site caused a decrease in expression to 40% and a 109-bp insert to 27%; a result that agrees with data reported by Norton and Coffin (1987). Oligos which we used for insertion possess cohesive SphI and EcoRI ends, respectively. Therefore, the two restriction sites are not disrupted after oligo insertion, although disruption of the SphI site by a 4-bp deletion slightly affected expression (Norton and Coffin, 1987). The triple insert both at the SphI site or at the EcoRI site (3S, 3E) decreased transcription, which could be due to a large insert size (102 bp). However, we reached an elevation of expression with a 120-bp HIV LTR insert encompassing three Sp1 binding sites at the SphI site (see Section 3.4). It suggests that condensation of multiple Sp1 binding sites in the LTR might negatively influence its promoter–enhancer activity, although it contrasts with SV40 enhancer with six Sp1 sites located within the 64-bp region. Nonetheless, despite the

ˇ O. Machon et al. / Gene 208 (1998) 73–82

77

reported negative effect of the non-specific insertion, we observed a clear transcriptional elevation as a result of insertion of particular Sp1 site arrangement in the RSV LTR. 3.2. Influence of insertion of the high-affinity Sp1 binding sites into the RSV LTR on stable expression The constructs enhancing transient expression were used for stable transfection of the hamster NIL-2 cell line. Co-transfection of the neo resistance gene in pMC1neoPolyA plasmid together with the cat reporter pLCL construct generated G418 resistant colonies that were consequently pooled and analyzed for CAT activity. Each resistant colony should contain at least one cat reporter transgene under the control of LTR, cat, LTR vector since the co-transfection conditions guarantee more than a 90% probability of successful gene transfer (Sambrook et al., 1989). However, multiple copies of the transgene can be expected as well. By pooling a large number of colonies and measuring expression we assessed only an average influence of the tested LTR modifications. Such experiment cannot reflect a behavior of individual proviral structure at distinct integration sites. As shown in Fig. 3, only the 2S modification (four Sp1 binding sites), which turned out to be the most efficient in transient assay, increased expression after the plasmid integration. The 2S construct, compared with the control pLCL, elevated stable expression 3.5-fold, whereas the 1S, the 1Sm and the 1E constructs retained activities comparable with the control. When CAT activities of transiently and stably expressed plasmid constructs are evaluated, the LTR

Fig. 2. Transient expression of the pLCL reporter plasmid and its modifications produced by insertion of high-affinity Sp1 binding sites. 1S represents the LTR modification with one synthesized 34-bp oligonucleotide insert containing two Sp1 binding sites at the SphI site of the 5∞ LTR; similarly 2S, 3S contain two and three inserts, respectively. 1Sm means one oligonucleotide insert variant with point mutations disrupting Sp1 protein binding. 1E and 3E are constructs with one and three oligonucleotide inserts at the EcoRI site of the 5∞ LTR, respectively. Three cell lines were employed for transfection: (A) hamster fibroblastoid NIL-2; (B) chicken embryo fibroblasts (CEF ); and (C ) mouse teratocarcinoma F9 cells. CAT activities are presented as an average of at least two independent experiments, each performed in duplicate, with standard deviations. Percent values are relative activities compared with the control plasmid pLCL.

Fig. 3. Stable expression of the pLCL reporter plasmid either unmodified or endowed with high-affinity Sp1 binding sites. Constructs found to be effective in transient expression assay were used for stable transfection. CAT activities are presented as an average of three independent experiments, each performed in triplicate, with standard deviations. Each 100-mm Petri dish contained more than 100 colonies before the CAT assay. Percent values are relative activities compared with the control plasmid pLCL.

78

ˇ O. Machon et al. / Gene 208 (1998) 73–82

modifications are less efficient upon plasmid integration. In the case of integrated plasmids, not only the LTR regulatory elements but also flanking chromosomal sequences have to be taken into account as factors controlling gene expression. On the one hand, the clearly detectable increase of reporter gene expression in nonpermissive NIL-2 cells might be contributed to by a generally higher expression of the vector equipped with the 2S insert, as revealed by transient expression assay. On the other hand, four Sp1 sites might exert a protection against the DNA methylation (Brandeis et al., 1994; Macleod et al., 1994), which had been shown to participate in down-regulating transcription of the integrated proviruses (Stuhlmann et al., 1981; Hejnar et al., 1994). Therefore, two events could be involved: an increase in the expression of active proviruses and/or an increased number of active proviruses after the LTR modification. However, we cannot distinguish which mechanism prevails or whether they act synergistically. 3.3. Electrophoretic mobility shift assay confirms the Sp1 transcription factor binding to the modified LTR Insertion of Sp1 binding sites in the RSV LTR augments both the transient and, to a lesser extent, stable expression. Provided that Sp1 transcription factor does affect the expression, it has to interact with the modified LTR sequences. We performed an electrophoretic mobility shift assay to verify this DNA–protein interaction. End-labeled KpnI–EcoRI fragments (see Fig. 1) of modified LTRs obtained from 1S, 1Sm, 2S and 3S constructs were used as probes. A similar fragment of unmodified LTR from pLCL plasmid served as a control. The specificity of DNA–protein complexes was examined either with anti-Sp1 mAb or with a specific competitor 34-bp oligo which was used for insertions in the LTR. As Fig. 4A shows, the control unmodified fragment from pLCL produced poorly detectable complexes that should correspond to the binding of transcription factors to promoter/enhancer sequences in the LTR fragment (Guntaka et al., 1994; for review see Ruddell, 1995). However, neither of these complexes were further retarded after adding the anti-Sp1 mAb. Similarly, the DNA fragment encompassing a mutated insert in SphI (1Sm) produced non-Sp1 complexes, although a slight Sp1-specific complex was detected. Inactivation by the point mutation of the binding element may not have been 100% efficient, especially when other variations of the binding motif were suggested (Bucher, 1990; Berg, 1992). Some remaining binding activity of 1Sm corresponds to the slight increase in transient expression (see Fig. 2A). DNA fragments of 1S, 2S and 3S constructs gave rise to prominent Sp1-specific complexes (indicated by an arrow). Several Sp1-specific bands might represent higher ternary structures of Sp1 protein, since this protein forms multimers (Mastrangelo et al., 1991).

When anti-Sp1 mAb had been added to the reaction, the lower Sp1-specific band was supershifted and the upper bands of Sp1 multimers were absent. Moreover, Sp1-specific DNA–protein complexes were competed when a excess of cold specific oligo encompassing two Sp1 sites had been added to the reaction. In the presence of the anti-Sp3 and anti-Sp4 antibodies no supershift was detected (Fig. 4B), thus confirming the specificity of anti-Sp1 mAb complex formation. Sp1 protein binds very efficiently to the 3S modification, although this modification caused a strong negative effect on the expression. This opposite effect on expression could be exerted by inappropriate structural arrangement of the binding sites but we also cannot exclude the possibility that such strong Sp1 binding to the LTR might interfere with LTR promoter/enhancer function. Altogether, the results of EMSA assays document that inserted Sp1 sites bind specifically Sp1 protein present in cells employed for transfection. Mutations impairing the binding also abolish the positive effect on the expression, which indicates strongly that binding of Sp1 is required for the biological effect of insertion of the Sp1 binding sites. 3.4. Inserted medium-affinity Sp1 binding sites derived from HIV-1 LTR produce a lower effect on RSV LTRdriven gene expression We further tested the effect of insertion of natural HIV-1 LTR Sp1 recognition sites inside the RSV LTR. Study of the promoter region of the HIV-1 LTR revealed three Sp1 binding sites necessary for basal and Tatstimulated transcriptional activation of HIV-1 (Harrich et al., 1989; Sune and Garcia-Blanco, 1995). An analysis of occupancy of the Sp1 binding sites at different protein concentrations indicated that two of the three HIV-1 Sp1 sites are of medium affinity, although the most distal site from the transcription start site has a comparable magnitude of binding as the high-affinity consensus GC boxes (Jones et al., 1986; Kadonaga et al., 1986). A 120-bp ScaI–PvuII fragment excised from the LTR of HIV-1 strain HXB2 ( Venkatesh et al., 1990), which contains three Sp1 recognition sites and two NF-kB binding sites, was inserted into the SphI site of the pLCLneo vector. This vector is similar to pLCL but contains an additional neo gene cassette. Since a specific interaction occurs between NF-kB and Sp1, which synergistically induces transcription (Perkins et al., 1993), we designed the plasmid pHIVS such that it contains both Sp1 and NF-kB motifs. Further findings suggest that NF-kB binding activity provides one of the signals for HIV activation in lymphoid cells (Griffin et al., 1989). Unlike in HIV-1, efficient transcription and replication in SIVmac239 can occur even in the absence of NF-kB and Sp1 (Ilyinskii and Desrosiers, 1996). Construct pN111, representing pLCLneo equipped with a non-

ˇ O. Machon et al. / Gene 208 (1998) 73–82

79

Fig. 4. EMSA of 5∞ LTR fragments with inserted high-affinity Sp1 binding sites. (A) End-labeled 5∞ LTR KpnI–EcoRI fragments (see Fig. 1) of modified variants 1Sm, 1S, 2S, 3S and control unmodified LCL were complexed with NIL-2 crude nuclear extract and anti-Sp1 mAb. Lane represents DNA–protein complexes in the absence of antiSp1 mAb; lane antiSp1 shows supershifted complexes with anti-Sp1 mAb; lane oligo indicates the presence of a 100-fold molar excess of cold specific competitor and the fragment mobility without protein is shown in lane C. (B) Incubation of anti-Sp3 and anti-Sp4 antibodies with probe 1S did not produce supershift, similarly with 2S and 3S which are not shown.

specific 111-bp fragment from pUC19 plasmid, was used to assess the negative effects of the insertion. Vector pLCLneo was used as a control of the transfection experiments. We employed the hamster NIL-2 and chicken monoblast BM-2 cell lines for transient expression of the cat reporter gene driven by modified LTR. Results are shown in Fig. 5. Transient expression experiments on the NIL-2 cell line (Fig. 5A) show that insertion of the specific Sp1-containing fragment increased the expression from RSV LTR 5-fold, compared with the control vector pLCLneo, whereas the non-specific insert decreased transient expression to 32% of the control. Thus, the specific fragment not only overcame the expected negative effect of insertion of non-specific DNA, but it

increased significantly net expression. The effect was slightly lower compared with that of the 2S construct containing four Sp1 binding sites in the LTR. This agrees with data reported by Koken et al. (1992), where the natural variant of HIV LTR containing four Sp1 sites exerted higher promoter activity and virus production. It is interesting to note that the synthetic 102-bp 3S fragment containing six binding sites significantly decreased expression, whereas the 120-bp fragment possessing three binding sites in pHIVS increased expression 5-fold. It is possible that the presence of NF-kB sites in the 120-bp HIV LTR fragment acted in cooperation with Sp1 sites to increase expression from this vector. An additional experiment was performed in order to verify the importance of the insertion site. The same

80

ˇ O. Machon et al. / Gene 208 (1998) 73–82

Fig. 5. (A) Transient expression of pLCLneo and its variant with HIV-1 LTR Sp1 binding sites. pHIVS represents the pLCLneo vector with a 120 bp HIV-1 LTR insert containing three Sp1 binding elements. pN111 plasmid contains a 111-bp nonspecific insert at the same SphI site of the RSV 5∞ LTR in the pLCLneo. Two cell lines were employed for transfection: hamster fibroblastoid NIL-2 and chicken monoblasts BM2. (B) The same constructs were employed for stable expression in hamster NIL-2 cells. CAT activities are presented as an average of three independent experiments, each performed in triplicate, with standard deviations. Each 100-mm Petri dish contained more than 100 colonies before the CAT assay. Percent values are relative activities compared with the control plasmid pLCLneo.

120-bp fragment as above was cloned upstream of the 5∞ RSV LTR into the unique KpnI site (−268 bp position relative to the start site) (see Fig. 1). Such an insertion had no effect on transient or stable transfection (results not shown), which shows the significance of insert localization. When we used the chicken monocytic BM-2 cell line for the transient transfection, we obtained a similar picture. Specific insertion caused a 4-fold increase in cat expression, whereas the non-specific fragment reduced the transient expression to 17% of the control. For stable expression, we transfected the NIL-2 cell line ( Fig. 5B). Unlike in the transient assay, the 120-bp specific fragment did not increase expression of the reporter gene and the non-specific N111 fragment caused a decrease in expression to 40% of the control. This finding suggests a slight positive effect also on the stable expression driven by HIV–RSV chimeric LTR, which is

in agreement with aforementioned data where four Sp1 sites (2S insert) were introduced in the LTR.

4. Conclusions All the results indicate strongly that insertion of a certain array of Sp1 binding sites derived from various viruses enhance the RSV LTR-driven expression when tested on different cell lines in transient transfections assays. This has been reflected not only in heterologous mammalian but also in homologous chicken cells. Insertion of particular arrangements of Sp1 binding sites elevates expression also upon stable transfection into non-permissive cells where RSV proviruses are profoundly transcriptionally down-regulated by flanking chromosomal DNA and by methylation. A potentially

ˇ O. Machon et al. / Gene 208 (1998) 73–82

complex set of events which can be triggered by Sp1 enrichment of LTR is being further clarified.

Acknowledgement This work was supported by grant No. 312/95/0583 from the Grant Agency of the Czech Republic and, in part, by Fogarty International Research Collaboration Award No. NIH/1R03-TW00155-01A1.

References Akroyd, J., Fincham, V.J., Green, A.R., Levantis, P., Searle, S., Wyke, J.A., 1987. Transcription of Rous sarcoma proviruses in rat cells is determined by chromosomal position effects that fluctuate and can operate over long distances. Oncogene 1, 347–354. Barnhart, M.K., Connor, L.M., Marriott, S.J., 1997. Function of the human T-cell leukemia virus type 1 21-base-pair repeats in basal transcription. J. Virol. 71, 337–344. Berg, J.M., 1992. Sp1 and the subfamily of zinc finger proteins with guanine-rich binding sites. Proc. Natl. Acad. Sci. USA 89, 11109–11110. Bird, A.P., 1986. CpG-rich islands and the function of DNA methylation. Nature 321, 209–213. Bird, A.P., 1987. CpG islands as gene markers in the vertebrate nucleus. Trends Genet. 3, 342–347. Bird, A.P., 1993. Functions for DNA methylation in vertebrates. Cold Spring Harbor Symp. Quant. Biol. 58, 281–285. ´ Bodor, J., Poliak, E., Pichrtova, J., Geryk, J., Svoboda, J., 1989. Complete nucleotide sequence of LTR, v-src, LTR provirus H-19. Nucl. Acids Res. 17, 8869 Bodor, J., Svoboda, J., 1989. The LTR, v-src, LTR provirus generated in the mammalian genome by v-src mRNA reverse transcription and integration. J. Virol. 63, 1015–1018. Brandeis, M., Fran, D., Keshet, I., Siegfried, Z., Mendelsohn, M., Nemes, A., Temper, V., Razin, A., Cedar, H., 1994. Sp1 elements protect a CpG island from de novo methylation. Nature 371, 435–438. Bucher, P., 1990. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J. Mol. Biol. 212, 563–578. Chen, J.-L., Attardi, L.D., Verrijzer, C.P., Yokomori, K., Tjian, R., 1994. Assembly of recombinant TFIID reveals differential coactivator requirements for distinct transcriptional activators. Cell 79, 93–105. Cullen, B.R., Raymond, K., Ju, G., 1985. Functional analysis of the transcription control region located within the avian retroviral long terminal repeat. Mol. Cell. Biol. 5, 438–447. Diamond, L., 1967. Two spontaneously transformed cell lines derived from the same hamster embryo culture. Int. J. Cancer 2, 143–152. Dignam, J.D., Lebowitz, R.M., Roeder, R.G., 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian cells. Nucl. Acids Res. 11, 1475–1489. Fincham, V.J., Wyke, J.A., 1991. Differences between cellular integration sites of transcribed and nontranscribed Rous sarcoma proviruses. J. Virol. 65, 461–463. Fincham, V.J., Wyke, J.A., 1992. On the structure, genesis and significance of the DNA duplications at the Rous sarcoma proviral insertion sites in rat-1 cells. J. Gen. Virol. 73, 3247–3250. Green, A.R., Searle, S., Gillespie, D.A.F., Bissell, M., Wyke, J.A., 1986. Expression of integrated Rous sarcoma viruses DNA rearrangements 5∞ to the provirus are common in transformed rat

81

cells but not seen in infected but untransformed cells. EMBO J. 5, 707–711. Griffin, G.E., Leung, K., Folks, T.M., Kunkel, S., Nabel, G.J., 1989. Activation of HIV gene expression during monocyte differentiation by induction of NF-kB. Nature 339, 70–73. Guntaka, R.V., Gowda, S., Wagner, H., Simon, D., 1987. Methylation of the enhancer region of avian sarcoma virus long terminal repeat suppresses transcription. FEBS Lett. 221, 332–336. Guntaka, R.V., Kandala, J.C., Shin, B.A., Nambiar, A., Svoboda, J., Cleavinger, P., 1994. Host- and tissue-specific factors that interact with the enhancer sequences of Rous sarcoma virus LTR. Folia Biol. (Praha) 40, 237–247. Harrich, D., Garcia, J., Foon, W., Mitsuyasu, R., Gonzales, J., Gaynor, R., 1989. Role of Sp1-binding domains in in vivo transcriptional regulation of the human immunodeficiency virus type 1 long terminal repeat. J. Virol. 63, 2585–2591. ´ Hejnar, J., Svoboda, J., Geryk, J., Fincham, V.J., Hak, R., 1994. High rate of morphological reversion in tumor cell line H-19 associated with permanent transcriptional suppression of LTR, v-src LTR provirus. Cell Growth Differ. 5, 277–285. Ilyinskii, P.O., Desrosiers, R.C., 1996. Efficient transcription and replication of simian immunodeficiency virus in the absence of NF-kB and Sp1 binding elements. J. Virol. 70, 3118–3126. Jones, K.A., Kadonaga, J.T., Luciw, P.A., Tjian, R., 1986. Activation of the AIDS retrovirus promoter by the cellular transcription factor Sp1. Science 232, 755–759. Jongstra, J., Reudelhuber, T.L., Oudet, P., Benoist, C., Chae, Ch.-B., Jeltsch, J.-M., Mathis, D.J., Chambon, P., 1984. Induction of altered chromatin structures by simian virus 40 enhancer and promoter elements. Nature 307, 708–714. Kadonaga, J.T., Jones, K.A., Tjian, R., 1986. Promoter-specific activation of RNA polymerase II transcription by Sp1. Trends Biochem. Sci. 11, 20–23. Kafri, T., Ariel, M., Brandeis, M., Shemer, R., Urven, L., McCarrey, J., Cedar, H., Razin, A., 1992. Developmental pattern of genespecific DNA methylation in the mouse embryo. Genes Dev. 6, 704–714. Koken, S.E., van Wamel, J.L., Goudsmit, J., Berkhout, B., Geelen, J.L., 1992. Natural variants of the HIV-1 long terminal repeat: analysis of promoters with duplicated DNA regulatory motifs. Virology 191, 968–972. Laybourn, P.J., Kadonaga, J.T., 1991. Role of nucleosomal cores and histone H1 in regulation of transcription by RNA polymerase II. Science 254, 238–245. ˇ ´ ´ Machon, O., Hejnar, J., Hajkova, P., Geryk, J., Svoboda, J., 1996. The LTR, v-src, LTR provirus in H-19 hamster tumor cell line is integrated adjacent to the negative regulatory region. Gene 174, 9–17. Macleod, D., Charlton, J., Mullins, J., Bird, A.P., 1994. Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island. Genes Dev. 8, 2282–2292. Marin, M., Karis, A., Visser, P., Grosveld, F., Philipsen, S., 1997. Transcription factor Sp1 is essential for early embryonic development but dispensable for cell growth and differentiation. Cell 89, 619–628. Mastrangelo, I.A., Courey, A.J., Wall, J.S., Jackson, S.P., Hough, P.V.C., 1991. DNA looping and Sp1 multimers links: a mechanism for transcriptional synergism and enhancement. Proc. Natl. Acad. Sci. USA 88, 5670–5674. Moscovici, C., 1975. Leukemic transformation with avian myeloblastosis virus: present status. Curr. Top. Microbiol. Immunol. 71, 79–101. Nelson, D.T., Goodchild, N.L., Mager, D.L., 1996. Gain of Sp1 sites and loss of repressor sequences associated with a young, transcriptionally active subset of HERV-H endogenous long terminal repeats. Virology 220, 213–218. Norton, P.A., Coffin, J.M., 1987. Characterization of Rous sarcoma

82

ˇ O. Machon et al. / Gene 208 (1998) 73–82

virus sequences essential for viral gene expression. J. Virol. 61, 1171–1179. Overbeek, P.A., Lai, S.-P., Van Quill, K.R., Westphal, H., 1986. Tissue-specific expression in transgenic mice of a fused gene containing RSV terminal sequences. Science 231, 1574–1577. Perkins, N.D., Edwards, N.L., Colin, S.D., Agranoff, A.B., Schmid, R.M., Nabel, G.J., 1993. A cooperative interaction between NF-kB and Sp1 is required for HIV-1 enhancer activation. EMBO J. 12, 3551–3558. Pondel, M.D., Murphy, S., Pearson, L., Craddock, C., Proudfoot, N.J., 1995. Sp1 functions in a chromatin-dependent manner to augment human a-globin promoter activity. Proc. Natl. Acad. Sci. USA 92, 7237–7241. Prince, V.E., Rigby, P.W.J., 1991. Derivatives of Moloney murine sarcoma virus capable of being transcribed in embryonal carcinoma stem cells have gained a functional Sp1 binding site. J. Virol. 65, 1803–1811. Ruddell, A., 1995. Transcription regulatory elements of the avian retroviral long terminal repeat. Virology 206, 1–7. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Seed, B., Sheen, Y., 1988. A simple-phase extraction assay for CAT activity. Gene 67, 271–277. Shaw, G.M., Hahn, B.H., Arya, S.K., Groopman, J.E., Gallo, R.C., Wong-Staal, F., 1984. Molecular characterization of human T-cell leukemia ( lymphotropic) virus type III in the acquired immune deficiency syndrome. Science 226, 1165–1171. Sherman, M.I., Miller, R.A., 1978. F9 embryonal carcinoma cells can differentiate into endoderm-like cells. Dev. Biol. 63, 27–34. Silke, J., Rother, K.I., Georgiev, O., Schaffner, W., Matsuo, K., 1995.

Complex demethylation patterns at Sp1 binding sites in F9 embryonal carcinoma cells. FEBS Lett. 370, 170–174. Sjottem, E., Anderssen, S., Johansen, T., The promoter activity of long terminal repeats of the HERV-H family of human retrovirus-like elements is critically dependent on Sp1 family proteins interacting with a GC/GT box located immediately 3∞ to the TATA box. 1996. J. Virol. 70, 188–198. Stewart, C.L., Stuhlmann, H., Jahner, D., Jaenisch, R., 1982. De novo methylation, expression, and infectivity of retroviral genomes into embryonal carcinoma cells. Proc. Natl. Acad. Sci. USA 79, 4098–4102. Stuhlmann, H., Jahner, D., Jaenisch, R., 1981. Infectivity and methylation of retroviral genomes is correlated with expression in the animal. Cell 26, 221–232. Sune, C., Garcia-Blanco, M.A., 1995. Sp1 transcription factor is required for in vitro basal and Tat-activated transcription from the human immunodeficiency virus type 1 long terminal repeat. J. Virol. 69, 6572–6576. Varmus, H.E., Guntaka, R.V., Deng, C.-T., Bishop, J.M., 1975. Synthesis, structure and function of avian sarcoma virus-specific DNA in permissive and non-permissive cells. Cold Spring Harbor Symp. Quant. Biol. 39, 987–996. Venkatesh, L.K., Arens, M.Q., Subramanian, T., Chinnadurai, G., 1990. Selective induction of toxicity to human cells expressing human immunodeficiency virus type 1 Tat by a conditionally cytotoxic adenovirus vector. Proc. Natl. Acad. Sci. USA 87, 8746–8750. Wyke, J.A., Quade, K., 1980. Infection of rat cells by avian sarcoma virus: factors affecting transformation and subsequent reversion. Virology 106, 217–233. Yeivin, A., Levine, A., Razin, A., 1996. DNA methylation patterns in tumors derived from F9 cells resemble methylation at the blastula cells. FEBS Lett. 395, 11–16.