Sp1-independent downregulation of NHEJ in response to BER deficiency

Journal Pre-proof s Sp1-independent downregulation of NHEJ in response to BER deficiency Polina S. Loshchenova, Svetlana V. Sergeeva, Dmitry V. Limonov, Zhigang Guo, Grigory L. Dianov

PII:

S1568-7864(19)30165-X

DOI:

https://doi.org/10.1016/j.dnarep.2019.102740

Reference:

DNAREP 102740

To appear in:

DNA Repair

Received Date:

27 May 2019

Revised Date:

18 September 2019

Accepted Date:

23 October 2019

Please cite this article as: Loshchenova PS, Sergeeva SV, Limonov DV, Guo Z, Dianov GL, s Sp1-independent downregulation of NHEJ in response to BER deficiency, DNA Repair (2019), doi: https://doi.org/10.1016/j.dnarep.2019.102740

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Sp1-independent downregulation of NHEJ in response to BER deficiency

POLINA S. LOSHCHENOVA1,2*, SVETLANA V. SERGEEVA1,2*, DMITRY V. LIMONOV1,2, ZHIGANG GUO3 AND GRIGORY L. DIANOV1,2,3,4,5

1

Institute of Cytology and Genetics, Russian Academy of Sciences, Lavrentieva 10 Novosibirsk

630090, Russian Federation 2

ro of

Novosibirsk State University, Pirogova 2, Novosibirsk 630090, Russian Federation

3

Jiangsu Key Laboratory for Molecular and Medical Biotechnology, College of Life Sciences,

Nanjing Normal University, 1 WenYuan Road, Nanjing, China 210023 4

Oxford Institute for Radiation Oncology, Department of Oncology, University of Oxford, Old

Road Campus Research Building, Oxford OX3 7DQ, United Kingdom 5

re

-p

Corresponding author

lP

* These authors contributed equally to this work

na

Correspondence: [email protected]

Keywords: DNA damage, Base Excision Repair (BER), Non-homologous End Joining (NHEJ),

Jo

ur

transcription factor Sp1, genome stability.

1

SUMMARY Base excision repair (BER) is the major repair pathway that removes DNA single strand breaks (SSBs) arising spontaneously due to the inherent instability of DNA. Unrepaired SSBs promote cell-cycle delay, which facilitates DNA repair prior to replication. On the other hand, in response to persistent DNA strand breaks, ATM-dependent degradation of transcription factor Sp1 leads to downregulation of BER genes expression, further accumulation of SSBs and renders cells susceptible to elimination via apoptosis. In contrast, many cancer cells are not able to block replication and to downregulate the

ro of

expression of Sp1 in response to DNA damage. However, knockdown of BER in cancer cells leads to the accumulation of DNA double strand breaks (DSBs), suggesting deficiency in non-homologous end joining (NHEJ) repair of DSBs. Here we investigated whether DNA repair deficiency caused by

-p

knockdown of the XRCC1 gene expression in proliferating cells results in downregulation of NHEJ genes expression. We find that knockdown of the XRCC1 gene expression does not cause degradation

re

of Sp1, but leads to downregulation of Lig4/XRCC4 and Ku70/80 at the transcription and protein levels. We thus propose the existence of Sp1-independent backup mechanism that in response to BER

lP

deficiency downregulates NHEJ in proliferating cells. HIGHLIGHT

BER deficiency leads to Sp1-independent downregulation of NHEJ in proliferating cells

Jo

ur

na

•

1. Introduction

2

Failure to preserve genome stability underlies the decline of every organism through physiopathological processes such as ageing, neurodegeneration and cancer. For this reason, the cellular genome is constantly guarded against DNA lesions generated by both exogenous and endogenous mutagens. In order to maintain genome stability, cells employ a number of DNA repair systems. Amongst these, the BER pathway constitutes the frontline defence against endogenously-generated DNA damage including DNA base lesions and SSBs [1, 2]. BER is a robust pathway that, under normal circumstances, is sufficient to cope with endogenous DNA damage. However, low BER efficiency can

ro of

occur as a result of a malfunction of BER components or overload of cellular repair capacity by acute DNA damage. We have recently demonstrated that activation of ATM protein kinase (ataxiatelangiectasia mutated), which responses to a wide range of genome-threatening lesions including

-p

SSBs and DSBs [3, 4] by mobilising a cascade of phosphorylation events that commands cell cycle delay, thus providing additional time for DNA repair prior to replication [5]. ATM is also a molecular rheostat

re

that decides the fate of the cell in response to persistent DNA strand breaks (SB). In normal human fibroblasts, persistent DNA strand breaks activate ATM which phosphorylates transcription factor Sp1

lP

at serine 101, initiating its proteasomal degradation [6]. We also found that Sp1 controls the expression of the key BER gene XRCC1 and that degradation of Sp1in response to persistent SBs

na

decreases DNA repair capacity and aggravates the load of DNA damage. This feeds a vicious cycle that further supports Sp1 degradation. Furthermore, we also demonstrated that downregulation of Sp1

ur

primes cells to apoptosis and to the elimination by natural killer cells. We proposed that this mechanism allows the intracellular detection of genetically unstable cells and activates a pro-

Jo

apoptotic response leading to elimination of these cells through apoptosis and via the innate immune system [6]. In contrast, many cancer cells overexpress Sp1 [7-10] and are not able to block replication and to downregulate the expression of Sp1 in response to DNA damage [11, 12]. Nevertheless, knockdown of BER in cancer cells leads to accumulation of DSBs [11] and sensitivity to ionizing irradiation [12], suggesting deficiency in non-homologous end joining (NHEJ) repair and indicating the existence of Sp1-independent mechanism for downregulation of NHEJ in response to persistent SBs. 3

Here we demonstrate that cells which are not able to block replication in response to DNA damage and to degrade Sp1 transcription factor, are still able to downregulate NHEJ gene expression through Sp1-independent mechanism.

2. Material and Methods 2.1 Cell culture The normal human bronchial epithelium cell line LIMM-NBE1 (RRID:CVCL_9Y83) (LIMM-NBE1)

ro of

generated by Dr Pamela Rabbitts [13], (Leeds Institute of Molecular Medicine, University of Leeds, UK) were kindly provided by Prof. A. Ryan (University of Oxford). Cells were cultured in DMEM low glucose (Life Technologies) supplemented with 15% FBS at 37°C in a humidified atmosphere with 5% CO2. Cells

-p

were routinely checked for mycoplasma. C-NHEJ reporter cells (H1299 non-small cell lung carcinoma cells with integrated NHEJ reporter) were a kind gift from Atsushi Shibata and Takashi Kohno and were

re

maintained in 2μg/ml Puromycin.

lP

2.2 GFP-based I-SceI-cleavable C-NHEJ reporter assay

To examine the effects of gene loss of function on the C-NHEJ repair pathway GFP-based I-

na

SceI-cleavable reporter cell line was used [14]. The cells were transfected with an I-SceI plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions in 6-well plates 48 h

ur

after the siRNA knockdowns. After 2 days, the cells from each well were trypsinised and dispersed in 200 µl medium. The 400 µl suspension was then immediately mixed with 200 µl of 10% formaldehyde,

Jo

and vortexed for 2–3 s before FACS (FACSCalibur) to quantitate the number of GFP positive cells. Flow cytometry for the analysis of the number of GFP-positive cells was performed using a BD FACSAria III flow cytometer and BD FACSDiva 8.0.2 software. 10000 cells were analysed for each sample. All experiments were performed in three biological repeats.

2.3 Cell cycle analyses 4

Trypsinized cells were fixed in ice-cold 70% ethanol for at least 30 min. After removal of the fixation solution by centrifugation, cells were washed with PBS, treated with 100 µg/ml of DNase free RNase A (Sigma) at 37oC in phosphate buffered saline for 30 min and further stained with 10 µg/ml propidium iodide (Sigma). Samples were run on a Becton– Dickinson FACScan (BDBiosciences) and the cell cycle distribution analysed using Modfit LT software (Verity Software House).

2.4 Statistical analyses

ro of

Statistical analyses were performed by using Student’s t-test using Microsoft Excel. The sample size is indicated for each experiment.

2.5 siRNA transfections

-p

siRNA transfections were carried out using the Lipofectamine RNAiMAX reagent (Life

re

Technologies) according to the manufacturer’s protocol. Unless otherwise indicated, cells were transfected with 30 nM siRNA and analysed 72 hours after transfection. Control transfections were

lP

carried out using a non-targeting siRNA (Eurogentec, SR-CL000-005). siRNA oligonucleotides were obtained from Eurogentec. Sequences used were:

Sequence (5' to 3') AGGGAAGAGGAAGUUGGAU AACAGCGUUUCUGCAGCUACC

ur

na

Target XRCC1 Sp1

2.6 Real-time PCR (qPCR)

Jo

Extraction of total RNA, reverse transcription and qPCR were performed as described previously [11]. The comparative CT method was applied for quantification of gene expression; B2M was used as an endogenous control.

Primers used were: Target B2M

Forward primer (5' to 3') ATGTCTCGCTCCGTGGCCTTA 5

Reverse primer (5' to 3') ATCTTGGGCTGTGACAAAGTC

XRCC1 Lig 4 XRCC4 Ku70 Ku80 Sp1

CCAGTGCTCCAGGAAGATATAG GAAGGCATCTGGTAAGCTCG TGCAAAGAAATCTTGGGACAG GTTGATGCCTCCAAGGCTATG TCCAAAAACTGTTCGATGTGA CTATAGCAAATGCCCCAGGT

CATTGTCCTGTCCTTCTGACT TTTCTTCATCTTTGGGGCAG TGCTCCTTTTTAGACGTCTC CCCCTTAAACTGGTCAAGCTCTA TGGAAGTGTGAATCCTGCTG TCCACCTGCTGTGTCATCAT

2.7 Western blot Whole cell extracts for western blot analysis were prepared as described previously [15]. Secondary antibodies conjugated with horseradish peroxidase were used for detection. Acquisition

ro of

and densitometric quantification were carried out using a ChemiDoc XRS+ System (Bio-Rad). Antibodies used were:

re

-p

Antibody 07-645 – Millipore MS-1393-P0 – Thermo Scientific ab6276 – Abcam T6199 - Sigma 66621-1-Ig – Proteintech ab193353 – Abcam NB100-1915 – Novus Biologicals ab119935 – Abcam TREVIGEN 4335-ACM-050

na

lP

Target Sp1 XRCC1 β-actin Tubulin XRCC4 DNA Ligase IV Ku70 Ku80 PAR

3. RESULTS AND DISCUSSION

ur

To generate persistent SB we knockdown XRCC1 gene encoding essential BER protein that forms a complex with DNA ligase IIIα and is required for the final step of the BER process, ligation of the DNA

Jo

nick [16]. Knockdown of XRCC1 in normal human cells by siRNA leads to downregulation of both XRCC1 and DNA ligase IIIα protein levels, accumulation of SBs and DNA replication delay in G1 phase [12]. Many cancer cells that are not able to block DNA replication and not downregulating Sp1 in response to DNA SB [11, 12] appealing as a suitable model for studying the role of Sp1-independent regulation of the NHEJ repair. However, due to genetic instability, established cancer cells are loaded with multiple random mutations that may complicate the outcome of the cellular responses.

6

We,

therefore, decided to use telomerase reverse transcriptase (hTERT) transfected LIMM-NBE1 cells which considered to be normal, while being able to undergo unlimited cell divisions [13]. It was previously reported that transfection of cells with hTERT gene inhibits activation of ATM-induced cellular responses to persistent DNA damage [17]. In agreement with that we found that, unlike in normal cells [18], knockdown of XRCC1 in NBE1 cells (Figure 1A) did not block cell cycle progression in G1 phase (71,5±0,5 in XRCC1 KD cells versus 84,2 ± 1,2 in control cells), but rather leads to accumulation of cells in S (10,8±0,15 in XRCC1 KD cells versus 2±1,7 in control cells) and G2 (10±1 in

ro of

XRCC1 KD cells versus 5,7±0,5 in control cells) phases of the cell cycle, Figure 1B. Furthermore, XRCC1 knockdown stimulates the accumulation of Sp1 (Figure 1C), which is reminiscent of the observations of the high level of Sp1 in various cancer cells [7-9, 19, 20]. To address the question of whether XRCC1

-p

knockdown in NBE1 cells leads to downregulation of the NHEJ, we first checked the expression of Ku70/80 proteins involved in the first step of DSB repair by NHEJ. The Ku70/80 heterodimer is the

re

central regulator of NHEJ. The Ku heterodimer binds to the DSB ends and recruits the NHEJ machinery to process and ligate the DSB. Ku’s central role in NHEJ is supported by the evidence that either Ku70

lP

or Ku80 deficiency leads to profound sensitization to DSB-inducing DNA damaging agents [21]. We found that both Ku70 and Ku80 are downregulated to a similar degree after XRCC1 knockdown

na

(Figures 2A and 2B). Since both Ku70 and Ku80 may have DSB repair-independent functions [22, 23], it was also important to check the expression of XRCC4 and DNA Ligase IV (Lig 4), which undoubtedly

ur

play a major role in DSB repair [21]. As shown in Figures 2C and 2D, the expression of both genes is reduced in response to XRCC1 depletion. Finally, to examine the effect of downregulation of the key

Jo

NHEJ genes on the repair of DSB we used C-NHEJ repair pathway GFP-based I-SceI-cleavable reporter cell line H1293 [14]. We first demonstrated that, as in NBE1 cells, XRCC1 knockdown leads to downregulation of Ku70/80 genes expression (data not shown) and then showed that indeed, downregulation of XRCC1 gene expression in H1292 cells leads to deficient repair of DSB (Figure 2E). We have previously demonstrated that Sp1 is responsible for transcription of the key BER genes [6], and it was previously shown that Ku70/80 promoters also have consensus Sp1 recognition 7

elements in its promoter region [24]. Therefore, it was of interest to check whether downregulation of Sp1 expression in NBE1 cells also affects the expression of NHEJ genes. To this end, we knocked down Sp1 by siRNA and found that transcription of XRCC1 was reduced (Figure 3A) as well as a transcription of XRCC4, DNA Ligase IV, Ku70 and Ku80 genes (Figure 3B). Notably, the degree of downregulation of NHEJ genes after Sp1 knockdown was much higher than after knockdown of XRCC1 (compare Figures 2 A-D and 3B), suggesting that in addition to the regulation of expression of BER genes Sp1 may participate in the transcription of the NHEJ genes. Taken together our data

ro of

demonstrate that cells which are not able to block replication in response to DNA damage and to degrade Sp1 transcription factor, are still able to downregulate NHEJ gene expression by Sp1independent mechanism. In normal cells, accumulation of unrepaired DNA SB leads to ATM-

-p

dependent degradation of Sp1 and downregulation of BER genes. In opposite, at least several previously tested cancer cell lines, fails to downregulate Sp1 in response to persistent DNA SB [11].

re

We speculate that, when Sp1-dependent mechanism fails to block proliferation of BER deficient cells, a backup Sp1-independent downregulation of NHEJ may facilitate the accumulation of DNA damage

lP

to promote the death of genetically unstable cells through apoptosis and via the innate immune

na

system.

ur

Conflict of interest: The authors declare no conflict of interest.

Acknowledgements

Jo

The authors thank Samuel Hume for critically reading the manuscript. Financial support: This research was supported by the grants from the Federal Agency for Scientific Organizations (FASO Russia grant № 0324-2019-0040) and from the Russian Foundation for Basic Research (RFBR grant for research project № 19-04-00067) to G.L.D. ZG was supported by the National Natural Science Foundation of China grant № 81872284 and Changzhou Sci & Tech Program CE20175035. 8

References [1] T. Lindahl, Instability and decay of the primary structure of DNA, Nature 362(6422) (1993) 70915. [2] G.L. Dianov, U. Hubscher, Mammalian base excision repair: the forgotten archangel, Nucleic Acids Res 41(6) (2013) 3483-90. [3] S.V. Khoronenkova, G.L. Dianov, ATM prevents DSB formation by coordinating SSB repair and cell

ro of

cycle progression, Proc Natl Acad Sci U S A 112(13) (2015) 3997-4002. [4] C.J. Bakkenist, M.B. Kastan, DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation, Nature 421(6922) (2003) 499-506.

[5] Y. Shiloh, ATM: expanding roles as a chief guardian of genome stability, Exp Cell Res 329(1) (2014)

-p

154-61.

re

[6] S.C. Fletcher, C.P. Grou, A.J. Legrand, X. Chen, K. Soderstrom, M. Poletto, G.L. Dianov, Sp1 phosphorylation by ATM downregulates BER and promotes cell elimination in response to persistent

lP

DNA damage, Nucleic Acids Res 46(4) (2018) 1834-1846.

[7] Q. Shi, X. Le, J.L. Abbruzzese, Z. Peng, C.N. Qian, H. Tang, Q. Xiong, B. Wang, X.C. Li, K. Xie,

na

Constitutive Sp1 activity is essential for differential constitutive expression of vascular endothelial growth factor in human pancreatic adenocarcinoma, Cancer Res 61(10) (2001) 4143-54.

ur

[8] E. Chiefari, A. Brunetti, F. Arturi, J.M. Bidart, D. Russo, M. Schlumberger, S. Filetti, Increased expression of AP2 and Sp1 transcription factors in human thyroid tumors: a role in NIS expression

Jo

regulation?, BMC Cancer 2 (2002) 35. [9] L. Wang, D. Wei, S. Huang, Z. Peng, X. Le, T.T. Wu, J. Yao, J. Ajani, K. Xie, Transcription factor Sp1 expression is a significant predictor of survival in human gastric cancer, Clin Cancer Res 9(17) (2003) 6371-80. [10] J.C. Yao, L. Wang, D. Wei, W. Gong, M. Hassan, T.T. Wu, P. Mansfield, J. Ajani, K. Xie, Association between expression of transcription factor Sp1 and increased vascular endothelial growth factor

9

expression, advanced stage, and poor survival in patients with resected gastric cancer, Clin Cancer Res 10(12 Pt 1) (2004) 4109-17. [11] M. Poletto, A.J. Legrand, S.C. Fletcher, G.L. Dianov, p53 coordinates base excision repair to prevent genomic instability, Nucleic Acids Res 44(7) (2016) 3165-75. [12] R. Brem, J. Hall, XRCC1 is required for DNA single-strand break repair in human cells, Nucleic Acids Res 33(8) (2005) 2512-20. [13] L.F. Stead, S. Berri, H.M. Wood, P. Egan, C. Conway, C. Daly, K. Papagiannopoulos, P. Rabbitts,

ro of

The transcriptional consequences of somatic amplifications, deletions, and rearrangements in a human lung squamous cell carcinoma, Neoplasia 14(11) (2012) 1075-86.

[14] H. Ogiwara, A. Ui, A. Otsuka, H. Satoh, I. Yokomi, S. Nakajima, A. Yasui, J. Yokota, T. Kohno,

-p

Histone acetylation by CBP and p300 at double-strand break sites facilitates SWI/SNF chromatin

remodeling and the recruitment of non-homologous end joining factors, Oncogene 30(18) (2011)

re

2135-46.

[15] G. Orlando, S.V. Khoronenkova, Dianova, II, J.L. Parsons, G.L. Dianov, ARF induction in response

lP

to DNA strand breaks is regulated by PARP1, Nucleic Acids Res 42(4) (2014) 2320-9. [16] K.W. Caldecott, XRCC1 and DNA strand break repair, DNA Repair (Amst) 2(9) (2003) 955-69.

na

[17] G. Hewitt, D. Jurk, F.D. Marques, C. Correia-Melo, T. Hardy, A. Gackowska, R. Anderson, M. Taschuk, J. Mann, J.F. Passos, Telomeres are favoured targets of a persistent DNA damage response

ur

in ageing and stress-induced senescence, Nat Commun 3 (2012) 708. [18] E. Markkanen, R. Fischer, M. Ledentcova, B.M. Kessler, G.L. Dianov, Cells deficient in base-

Jo

excision repair reveal cancer hallmarks originating from adjustments to genetic instability, Nucleic Acids Res 43(7) (2015) 3667-79. [19] J.H. Yang, X.Y. Li, X. Wang, W.J. Hou, X.S. Qiu, E.H. Wang, G.P. Wu, Long-term persistent infection of HPV 16 E6 up-regulate SP1 and hTERT by inhibiting LKB1 in lung cancer cells, PLoS One 12(8) (2017) e0182775.

10

[20] J. Wang, M. Kang, Y.T. Qin, Z.X. Wei, J.J. Xiao, R.S. Wang, Sp1 is over-expressed in nasopharyngeal cancer and is a poor prognostic indicator for patients receiving radiotherapy, Int J Clin Exp Pathol 8(6) (2015) 6936-43. [21] A.J. Davis, D.J. Chen, DNA double strand break repair via non-homologous end-joining, Transl Cancer Res 2(3) (2013) 130-143. [22] V.B. Holcomb, H. Vogel, P. Hasty, Deletion of Ku80 causes early aging independent of chronic inflammation and Rag-1-induced DSBs, Mech Ageing Dev 128(11-12) (2007) 601-8.

ro of

[23] H. Li, H. Vogel, V.B. Holcomb, Y. Gu, P. Hasty, Deletion of Ku70, Ku80, or both causes early aging without substantially increased cancer, Mol Cell Biol 27(23) (2007) 8205-14.

[24] Y. Hosoi, T. Watanabe, K. Nakagawa, Y. Matsumoto, A. Enomoto, A. Morita, H. Nagawa, N.

Jo

ur

na

lP

re

International Journal of Oncology 25(2) (2004) 461-468.

-p

Suzuki, Up-regulation of DNA-dependent protein kinase activity and Sp1 in colorectal cancer,

11

Jo

ur

na

lP

re

-p

ro of

Figures and figure legends

Figure 1. Knockdown of XRCC1 in NBE1 cells doesn’t lead to G1 cell cycle arrest and results in accumulation of Sp1 12

(A). Representative Western blot with the indicated antibodies, quantification of Western blot and QPCR analysis of cells treated with XRCC1-targeting siRNA (siXRCC1) or control siRNA (siCTRL). (B) Cell cycle analysis of NBE1 cells treated with XRCC1-targeting siRNA. The histograms report the distribution as average from three independent experiments. (C) Representative Western blot with the indicated antibodies, quantification of Western blot and Q-PCR analysis of NBE1 cells treated with XRCC1targeting siRNA. The protein level histograms report the distribution as average ± SD from three independent experiments: *: p<0.05; **: p<0.01. Q-PCR data are reported as average ± SD from three

Jo

ur

na

lP

re

-p

ro of

independent experiments *: p<0.05; **: p<0.01; ***:p<0.001..

13

14

ro of

-p

re

lP

na

ur

Jo

ro of -p re lP na ur Jo Figure 2. Knockdown of XRCC1 leads to decrease in Ku 70 and Ku 80 gene expression and NHEJ repair

15

(A-D). Representative Western blots, quantification of Western blots and Q-PCR analyses of cells treated with XRCC1-targeting siRNA (siXRCC1) or control siRNA (siCtrl). The histograms report the distribution as average ± SD from three independent experiments. (E) C-NHEJ repair efficacy of break-

Jo

ur

na

lP

re

-p

ro of

induced GFP reporter cells treated with control siRNA (Ctrl) or XRCC1 siRNA (siXRCC1).

16

ro of -p re lP na ur Jo Figure 3. Depletion of Sp1 leads to XRCC1 downregulation and impairs transcription of NHEJ genes

17

Representative Western blot, quantification of Western blot and Q-PCR analysis of XRCC4, DNA ligase IV, Ku70 and Ku80 expression in NBE1 cells treated with either Sp1-targeting siRNA (siSp1) or control

Jo

ur

na

lP

re

-p

ro of

siRNA (siCtrl). Q-PCR data are reported as average ± SD from three independent experiments.

18