- Email: [email protected]
Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Sp1 promotes ovarian cancer cell migration through repressing miR335 expression Shaohai Wang a, Yuan Li b, Si Sun a, Jing Cai a, Jin Cao a, * a b
Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 430022, China Department of Obstetrics and Gynecology, The First People’s Hospital of Shangqiu, Shangqiu, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 19 December 2019 Accepted 11 January 2020 Available online xxx
Decreased miR-335 has been reported in a variety of cancers. We previously showed that miR-335 played an important role in ovarian cancer metastasis and prognosis. However, miR-335 is down-regulated in ovarian cancer by mechanisms that remain unclear. In silico analysis identified putative transcription factor specificity protein 1 (SP1) transcription factor binding sites in the miR-335 promoter. To investigate the relation between SP1 and miR-335, qRT-PCR was performed. Our results showed both Sp1 knockdown and mithramycin A increased miR-335 expression in ovarian cancer cell lines. Luciferase reporter assays indicated that Sp1 knockdown increased miR-335 transcriptional activity. ChIP experiments showed that Sp1 bound directly to miR-335 promoter. Moreover, transwell migration and woundhealing assays showed that Sp1 knockdown resulted in inhibited cell migration, which was in turn mitigated by miR-335 inhibitor. We propose that miR-335 was negatively regulated by SP1, which in turn contributes to miR-335 deregulation and tumor cells migration. © 2020 Elsevier Inc. All rights reserved.
Keywords: miR-335 SP1 DNA methyltransferase (DNMT) Migration EOC
1. Introduction Ovarian cancer is the highest lethal rate of gynecological tumors, located in the female tumor mortality rate of the fifth. Due to its insidious onset, the disease is diagnosed in 70% of cases in an advanced stage [1]. Prognosis is poor with a relatively low rate of 5year survival, largely because of extensive invasion and metastasis of the tumor. It is very urgent and important to explore which factors play a role in the process of invasion and metastasis of ovarian cancer and to study the specific mechanism of promoting the development of tumor. MicroRNAs (miRNAs) are an abundant class of small nonprotein-coding RNAs that play an important role in a variety of biological events, including tumors [2,3]. miRNAs play important gene-regulatory roles by pairing to the mRNAs of protein-coding genes to direct their posttranscriptional repression [4]. A large number of miRNA, its expression disorder associated with the occurrence and development of many diseases including malignant tumors [2].Our previous studies show that the low expression of miRNA-335 in ovarian cancer can promote the
* Corresponding author. E-mail addresses: E-mail address: [email protected] (J. Cao).Jin_Cao@hust. edu.cn (J. Cao).
invasion and metastasis of ovarian cancer, which leads to the poor prognosis of ovarian cancer [5]. However, the mechanism of miRNA-335 low expression remains to be elucidated. Epigenetic regulation plays a central role in the regulation of genes. DNA methyltransferase (DNMTs) and Histone deacetylase 1 (HDAC1) are important epigentic regulators. Transcription factor Sp1 can promote gene expression by recognize and combined with the same GC-(GGGGCGGGG) and GT-(GGTGTGGGG) boxes of multiple target genes [6]. In addition, transcription factor Sp1 can also negatively regulate the expression of certain genes by regulating DNMTs, HDAC1 [7]. It has been reported that high expression of Sp1 in ovarian cancer cells can promote metastasis of ovarian cancer, resulting in poor prognosis, and the combination of Sp1 inhibitors and platinum drugs can prolong the survival time of tumor patients [7,8].Recently studies reported that miRNAs such as miR-205 [9],miR-182 [10],miR-200 [11],miR-7a [12],miR-20b [13],could be epigenetically regulated by Sp1. It seems that over-expression of Sp1 may partly explain the suppression of tumor suppressor miRNAs. We propose that transcription factors Sp1 and methylation levels of miR-335 promoters may be involved in the expression of miR-335. In this paper shRNA transfection and Mithramycin A treatment were used to down-regulate the Sp1 expression in ovarian cancer cell to detect the expression of miR-335 and its
https://doi.org/10.1016/j.bbrc.2020.01.063 0006-291X/© 2020 Elsevier Inc. All rights reserved.
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
2
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
effect on tumor proliferation and migration ability. Finally, elucidating the molecular mechanism of low expression of miR-335 may provide a new approach for the pathogenesis, prognosis analysis and targeted therapy of ovarian cancer.
crystal violet stain. After 24 h of incubation, the cells that had not invaded upper chamber were removed, and migration cells were fixed and stained.The cells on the lower surface of the filter were counted under a microscope.
2. Materials and methods
2.5. Wound-healing assays
2.1. Cell lines and cell culture
For the wound-healing assays, cells were transfected with shSp1 or co-transfected shSp1 and MiR-335inhibitor. After 48 h, cells were reseeded on a six-well tissue culture plate. After 12 h, the attached cells were grown to confluency. A linear wound was made by scraping with a 200 ml pipette tip and 0 h images were captured using microscope. The plates were placed back at 37 C and 5% CO2 for 24 h, and another set of images were captured of the same wounds. The wound widths were measured by ImageJ (version 1.44, NIH), normalized and presented as the percentage of wound measured at time 0 (mean ± s.d.). The percent migration was calculated by following equation: [D area / area (day 0)] 100.
The A2780 and SKOV3 human epithelial ovarian cancer cell lines were purchased from China Center for Type Culture Collection (CCTCC). Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum under a humidified atmosphere containing 5% CO2 at 37 C. All transfections were performed using Lipofectamine™ 2000 reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocols. 2.2. RNA extraction and real-time quantitative PCR
2.6. Cell proliferation analysis Total RNA was extracted from ovarian cancer cells using TRIzol Reagent according to the manufacturer’s instructions (Takara, Japan). Bulge-Loop™ hsa-miR-335e5p qRT-PCR Primer Set (RiboBio, Guangzhou, China) was used to analyze the expression of miR335 according to the manufacturer’s instructions. Expression of miR-335 was normalized to that of the U6 snRNA. PCR reactions were performed by using an ABI PRISM 7300 Step-One Plus instrument (Applied Biosystems, Foster City, CA, USA) with SYBR Green PCR Master Mix (Takara). The cycling method for the reverse transcription reaction was as follows: 70 C for 10 min, 2 min on ice followed by 42 C for 1 h and 70 C for 10 min. The cycling conditions of PCR consist of an initial denaturizing step of 20 s at 95 C and 40 cycles of denaturing at 95 C for 10s, annealing at 60 C for 20s and extension at 70 C for 10s.For mRNA expression levels, bactin levels were used as internal controls. The primers used for qRT-PCR were as follows: Sp1, 50 - GCGAGAGGCCATTTATGTGTAC-3’ (forward) and 50 - CAAATTTCTTCTCACCTGTGTGTGT-3’ (reverse); DNMT1, 50 - ACCGCTTCTACTTCCTCGAGGCCTA -3’ (forward) and 50 GTTGCAGTCCTCTGTGAACACTGTGG -3’ (reverse); DNMT3, 50 CACACAGAAGCATATCCAGGAGTG -3’ (forward) and 50 - AGTGGACTGGGAAACCAAATACCC -3’ (reverse); DNMT3b, 50 - AATGTGAA TCCAGCCAGGAAAGGC-3’ (forward) and 50 - ACTGGATTACACTCCA GGAACCGT -3’ (reverse); b-actin, 50 -TACATGGCTGGGGTGTTGAA -3’ (forward) and 50 - AAGAGAGGCATCCTCACCCT -3’ (reverse).Reverse transcription PCR was done using the PrimeScript RT Reagent Kit (TaKaRa).PCR conditions included an initial holding period at 95 C for 30s, followed by a two-step PCR program consisting of 94 C for 5 s and 60 C for 30 s for 40 cycles. 2.3. Transfection of RNA oligoribonucleotides Transfection was performed with Lipofectamine 2000 Reagent (Invitrogen, USA), following the manufacturer’s protocol. One day before transfection, cells were plated in 6-well plates (2 105/ well). The next day, the cells were transfected with miR-126 inhibitors (target sequence 50 CGCAUUAUUACUCACGGUACGA30 , GenePharma, Shanghai, China) or its negative control siRNAs (MNC and INC) (GenePharma, Shanghai, China) until 70% confluent. 2.4. Transwell migration assays For the transwell migration assay, 5.0 105 cells were suspended in serum-free medium and plated in Transwell chambers chambers. Medium containing 10% FBS was added to the lower chamber. Then, the filters were fixed in 90% alcohol and followed by
2.6.1. Cell proliferation was measured by detecting incorporation of 5-ethynyl-20 -deoxyuridine (Edu) during DNA synthesis was performed using Clik-iT® EdU Imaging Kit (Invitrogen) with minor modifications to the manufacturer’s protocol. Briefly, cells that had been propagated in a 96-well plate for 48 h were exposed to 10 mM of EdU for 4 h. After EdU exposure, cells were fixed with 4% formaldehyde and treated with 0.5% Triton X-100. Proliferative cells were visualized using Click-iT ® reaction cocktail. Subsequently, cells were counterstained with Hoechst 33342. All assays were carried out in triplicate. 2.6.2. Luciferase reporter assay The plasmids included MiR-335 promoter and pRL-TK vector expressing the Renilla luciferase using Lipofectamine 2000 reagent (Invitrogen), After 24 h, cells were treatment with various concentrations of Mithramycin A for an additional 24h.Then, cells were harvested and lysed and luciferase activity was measured using the DualLuciferase Reporter Assay System (Promega) according to the manufacturer’s protocol. Renilla luciferase was used for normalization. 2.6.3. Chromatin immunoprecipitation (ChIP) ChIP assay was performed using EpiQuik™ chromatin immunoprecipitation kit (Epigentek, Farmingdale, NY, USA) according to the manufacturer’s protocol. Briefly, the cells were transfected with sh-SP1 or sh-control for 48 h prior to formaldehyde fixation. After cell lysis, the chromatin was fragmented to ~200e1,000 bp. The DNA fragment was then enriched with anti-SP1 (Santa Crus), antiH3 or normal IgG antibodies (Cell Signaling Technology). The purified DNA was used as template and quantified by qRT-PCR method. The primers for ChIP were as follows: miR-335 Region 11-L 50 - GGGAGCAAGCTGAACTCAAG-30 , Region 1-1-R 50 TCACCTCCTCTTTCCCACAC -30 , Region 1-2-L 50 - GCCTGCCATTTCATACCCTT -30 , Region 1-2-R 50 - ACAGGACTCCATGTTTCGGA-30 , Region 1-3-L 50 - TGACTCATTCTGGCTGGAGG -30 , Region 1-3-R 50 CTCACCACAGTCCCCTAAGG-3’. Region 2-1-L 50 - TATTAGGGGCCAGCTTTGTG-30 , Region 2-1-R 50 - GGGGTGCGAAATAAATGAGA -30 , Region 2-2-L 50 - CCTCCGCAGGTGAGTGTG -30 , Region 2-2-R 50 TGACACCCCCTCCTCAAGTA-30 , Region 2-3-L 50 - GCTCTGGTGC GACTTAAAGG -30 , Region 2-3-R 50 - GGGCACTGCGAGTTCTAGTC-3’. Region 3-1-L 50 - GGGGGTAGTGGGTAGATGGT-30 , Region 3-1-R 50 CCGACTTTAACCCCTTAGCC -30 , Region 3-2-L 50 - CAGTGGGTC TCTGCTTTTCC -30 , Region 3-2-R 50 - GACCGATACACGCAGGACTT-30 , Region 3-3-L 50 - AGATTGGGTCTCCTGCTGAA -30 , Region 3-3-R 50 -
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. Mir-335 is negatively regulated by Sp1. (A) A2780 and SKOV3 cells were transfected with sh-Sp1 or sh-control (NC) for 72 h. The expression of miR-335 was detected by qRTPCR. (B) A2780 and SKOV3 cells were treated with Mithramycin A. The expression of miR-335 was determined by qRT-PCR. (C) Luciferase reporter assays in EOC cells. shSp1 A2780 cells were transfected with miR-335 promoter luciferase reporter gene and the luciferase activity was measured. *p < 0.01. (D) Illustration shows the locations of 3 possible Sp1 binding sites upstream of the transcription start site of miR-335 defined as region1, region2 and region3 (around 500 - 600bp/per region); 3 pairs of primers, sequentially referred to as P1, P2 and P3, were designed within the span of each possible binding site at an interval of 150e200bp. (E &F) CHIP assay shows the enrichment of Sp1 on region2 (P1) promoter region. Data are presented as the fold of enrichment relative to IP % input/IgG % input; **p < 0.01.
AGCATCTCCCCATTTCTCCT-3’. 2.6.4. Statistical analysis In study, the quantitative data between groups were compared and analyzed by Student’s t-test (two tailed) or a one-way analysis of variance. The data are expressed as the means ± standard deviation (SD), and P 0.05 was considered to indicate a significant difference. Each experiment was repeated at least three times. 3. Results 3.1. Mir-335 is negatively regulated by Sp1 in ovarian cancer cells To investigate whether miR-335 could be inhibited by Sp1 in EOC cells, we constructed ShSp1 to knock down Sp1 expression in A2780 and SKOV3 cells. The results showed that knockdown of Sp1
led to an increase of miR-335 in A2780 and SKOV3 cells (Fig. 1A). Similar results were acquired with Sp1 inhibitor, mithramycin A (Fig. 1B). To further explore the specific mechanism through which Sp1 regulates miR-335 expression, A luciferase reporter gene containing miR-335 promoter was constructed according to the miR-335 TSS information acquired from an online database (http:// mirstart.mbc.nctu.edu.tw/). The luciferase reporter assay showed that Sp1 knockdown significantly enhanced the transcriptional activity of the miR-335 promoter compared with the negative control (Fig. 1C). Three putative core promoter regions that might be responsible for miR-335 regulation are identified upstream to the 94 bp hsamiR-335 coding region according to the Chip-seq results based on 9 different cell lines from UCSC Genome Browser. To determine whether Sp1 could bind to miR-335 promoter
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
4
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. Sp1 promotes ovarian cancer migration via down-regulating miR-335. The shSp1-SKOV3 and shSp1-A2780 cells were concomitantly transfected with miR-335 inhibitor or inhibitor NC. (A) The indicated cell transfectants were planted onto uncoated polycarbonate filters to analyze their migratory potentials.The cells were photographed at 200 magnification. (B) The migration of the indicated cells was evaluated by wound healing assay. Magnification: 200 . *p < 0.01.
region, we performed ChIP assay near the TSS on region 1(P1, P2, P3), region 2 (P1, P2, P3) and region 3 (P1, P2, P3) of the miR-335 promoter, which containing rich CpG islands and were highly conserved according to the data shown in UCSC Genome Browser (Fig. 1D). Among the three regions, region 2 contains a GC box element 50 -GGGGCGGGC-30 , which is the perfect match for Sp1 binding. As shown in Fig. 1E and F, Sp1 was enriched at region 2 (P1) of the miR-335 promoter. Knockdown of Sp1 decreased the binding of Sp1 on region 2 (P1) of the miR-335 promoter. The result indicates that miR-335 is repressed by Sp1. 3.2. Sp1 promotes ovarian cancer migration via down-regulating miR-335 The shSp1-SKOV3 and shSp1-A2780 cells were concomitantly transfected with miR-335 inhibitor or negative control inhibitor NC. The transwell migration assays and wound-healing assays were used to detect the migration ability of ovarian cancer cells. The transwell migration assays revealed significant decreases in migrating cells after shSp1 transfection compared with NC. The migration inhibitory effects of shSP1 could be largely relieved by miR-335 inhibitor (Fig. 2A). Similar results were acquired with wound-healing assays (Fig. 2B). 3.3. Sp1 does not promote the proliferation of ovarian cancer cells by regulating miR-335 Edu assays were used to detect the proliferation ability of ovarian cancer cells. The cell proliferation analysis revealed significant decreases in proliferating cells after shSp1 transfection
compared with NC. However, the inhibitory effects of shSP1 on proliferation could not be mitigated by miR-335 inhibitor (Fig. 3A&B). 3.4. Sp1 inhibitor down-regulates DNA methyltransferase expression Previous studies show that Sp1 can also represses gene expression through the recruitment of histone deacetylase or DNA methyltransferase. Bioinformatics (http://www.urogene.org/) shows that a large number of CpG islands exist in the promoter region of miR-335 (Fig. 4A). To investigate whether Sp1 regulates the expression of DNA methyltransferases, the expression of DNMT1, DNMT3a and DNMT3b was detected using qRT-PCR after Sp1 knockdown. The results showed mithramycin A treatment reduced the expression of these methyltransferases, suggesting the involvement of DNA methylation in the regulation of miR-335 (Fig. 4B and C). 4. Discussion Like mRNAs, miRNA expression is often tissue specific and developmentally regulated and regulation takes place both transcriptionally and posttranscriptionally. MiR-335 is an intragenic miRNA residing in the second intron of the mesoderm-specific transcript Mest [14]. We previously found that miR-335 was down-regulated in ovarian cancer [5,15,16]. The underlying mechanisms, however, remain unknown. In this study, we found that miR-335 was negatively regulated by Sp1. Sp1 was the founding member of the Sp transcription factor
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 3. Sp1 does not promote the proliferation of ovarian cancer cells by regulating miR-335. The Edu assays were performed to evaluate the proliferative ability of A2780 cells (A) and SKOV3 cells(B). The average value of the percentage of proliferating cells in three repeated experiments was quantitatively analyzed. Magnification: 200 .*p < 0.01.
Fig. 4. Knockdown of Sp1 reduces mRNA expression of DNMTs in EOC cells. A2780 and SKOV3 cells were treated with Mithramycin A. (A) The methylation sites of miR-335 promoter region. (B) The expression of DNMTs in A2780 cells on Sp1 knockdown. (C) The expression of DNMTs in SKOV3 cellson Sp1 knockdown. *p < 0.01.
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
6
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
family. Sp1 is over-expressed in lung, breast, pancreatic, gastric and thyroid cancers. In patient samples and cancer models, Sp1 levels correlate with stage, invasive potential and metastasis [17]. Sp1 levels correlate with the survival of patients in almost all cancers, with high levels of Sp1 being associated with poor prognoses [18]. Our results showed that Sp1 inhibited the transcriptional activity of the miR-335 promoter and the region 2 of miR-335 promoter was important for the negative control of miR-335, suggesting that Sp1 can repress miR-335 by directly binding to miR-335 promoter. Besides this mechanism, previous studies show that Sp1 can also repress gene expression through the recruitment of histone deacetylase or DNA methyltransferase [19]. Consistent with this, we found that there are a large number of CpG islands in the promoter region of miR-335 and Sp1 could negatively regulate the expression of DNMTs in ovarian cancer cells, suggesting that the regulation of miR-335 by Sp1 can also be achieved by inhibiting the methylation level of the miR-335 promoter. These results suggest that the Sp1DNMTs-miR-335 regulatory pathway in ovarian cancer cells may provide a new theoretical basis for targeted therapy of ovarian cancer. In this study we found that Sp1 promoted the migration and proliferation of ovarian cancer cells. Interestingly, however, the inhibitory effects of shSP1 on proliferation could not be mitigated by miR-335 inhibitor. This is consistent with our previous finding that miR-335 does not inhibit cell proliferation, highlighting the pleiotropic action of Sp1. In conclusion, we have confirmed that transcription factor Sp1 can negatively regulate the expression of miR-335 and promote the migration of ovarian cancer cells, which provides new ideas and strategies for targeted therapy of ovarian cancer. However, whether the regulation of Sp1 on miR-335 is by mediate promoter methylation more research is needed to confirm.
Declaration of competing interest The authors claim that none of the material in the paper has been published or is under consideration for publication elsewhere and declare that there are no conflicts of interest.
Acknowledgments The present study was supported by the National Natural Science Foundation of China (no.81402166).
References [1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, 2019, CA A Cancer J. Clin. 69 (2019) 7e34. [2] M. Acunzo, G. Romano, D. Wernicke, C.M. Croce, MicroRNA and cancer–a brief overview, Adv. Biol. Regul. 57 (2015) 1e9. [3] Y. Toiyama, Y. Okugawa, A. Goel, DNA methylation and microRNA biomarkers for noninvasive detection of gastric and colorectal cancer, Biochem. Biophys. Res. Commun. 455 (2014) 43e57. [4] C. Moutinho, M. Esteller, MicroRNAs and epigenetics, Adv. Cancer Res. 135 (2017) 189e220. [5] J. Cao, J. Cai, D. Huang, Q. Han, Y. Chen, Q. Yang, C. Yang, Y. Kuang, D. Li, Z. Wang, miR-335 represents an independent prognostic marker in epithelial ovarian cancer, Am. J. Clin. Pathol. 141 (2014) 437e442. [6] P. Bouwman, S. Philipsen, Regulation of the activity of Sp1-related transcription factors, Mol. Cell. Endocrinol. 195 (2002) 27e38. [7] L. Li, S. He, J.M. Sun, J.R. Davie, Gene regulation by Sp1 and Sp3, Biochem. Cell Biol. 82 (2004) 460e471. [8] S. Previdi, A. Malek, V. Albertini, C. Riva, C. Capella, M. Broggini, G.M. Carbone, J. Rohr, C.V. Catapano, Inhibition of Sp1-dependent transcription and antitumor activity of the new aureolic acid analogues mithramycin SDK and SK in human ovarian cancer xenografts, Gynecol. Oncol. 118 (2010) 182e188. [9] F. Pan, H. Mao, F. Bu, X. Tong, J. Li, S. Zhang, X. Liu, L. Wang, L. Wu, R. Chen, H. Wei, B. Li, C. Li, Y. Yang, C.J. Steer, J. Zhao, Y. Guo, Sp1-mediated transcriptional activation of miR-205 promotes radioresistance in esophageal squamous cell carcinoma, Oncotarget 8 (2017) 5735e5752. [10] W.B. Yang, P.H. Chen, T.s. Hsu, T.F. Fu, W.C. Su, H. Liaw, W.C. Chang, J.J. Hung, Sp1-mediated microRNA-182 expression regulates lung cancer progression, Oncotarget 5 (2014) 740e753. [11] N. Kolesnikoff, J.L. Attema, S. Roslan, A.G. Bert, Q.P. Schwarz, P.A. Gregory, G.J. Goodall, Specificity protein 1 (Sp1) maintains basal epithelial expression of the miR-200 family: implications for epithelial-mesenchymal transition, J. Biol. Chem. 289 (2014) 11194e11205. [12] R. Li, J. Xiao, X. Qing, J. Xing, Y. Xia, J. Qi, X. Liu, S. Zhang, X. Sheng, X. Zhang, X. Ji, Sp1 mediates a therapeutic role of MiR-7a/b in angiotensin II-induced cardiac fibrosis via mechanism involving the TGF-beta and MAPKs pathways in cardiac fibroblasts, PLoS One 10 (2015) e0125513. [13] S. Guo, H. Wang, Y. Luo, J. He, H. Ma, L. Shen, J. Tang, Q. Fang, Z. Qian, C. Song, Sp-1 negatively regulates miR-20b expression in macrophages, Ann. Clin. Lab. Sci. 47 (2017) 706e712. [14] M. Girardot, J. Cavaille, R. Feil, Small regulatory RNAs controlled by genomic imprinting and their contribution to human disease, Epigenetics 7 (2012) 1341e1348. [15] J. Cao, J. Cai, D. Huang, Q. Han, Q. Yang, T. Li, H. Ding, Z. Wang, miR-335 represents an invasion suppressor gene in ovarian cancer by targeting Bcl-w, Oncol. Rep. 30 (2013) 701e706. [16] Y. Yu, R. Gao, Z. Kaul, L. Li, Y. Kato, Z. Zhang, J. Groden, S.C. Kaul, R. Wadhwa, Loss-of-function screening to identify miRNAs involved in senescence: tumor suppressor activity of miRNA-335 and its new target CARF, Sci. Rep. 6 (2016) 30185. [17] S. Safe, M. Abdelrahim, Sp transcription factor family and its role in cancer, Eur. J. Cancer 41 (2005) 2438e2448. [18] K. Beishline, J. Azizkhan-Clifford, Sp1 and the ’hallmarks of cancer, FEBS J. 282 (2015) 224e258. [19] Q. Fang, W. Yang, H. Li, W. Hu, L. Chen, S. Jiang, K. Dong, Q. Song, C. Wang, S. Chen, F. Liu, W. Jia, Negative regulation of DsbA-L gene expression by the transcription factor Sp1, Diabetes 63 (2014) 4165e4171.
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Sp1 promotes ovarian cancer cell migration through repressing miR335 expression Shaohai Wang a, Yuan Li b, Si Sun a, Jing Cai a, Jin Cao a, * a b
Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 430022, China Department of Obstetrics and Gynecology, The First People’s Hospital of Shangqiu, Shangqiu, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 19 December 2019 Accepted 11 January 2020 Available online xxx
Decreased miR-335 has been reported in a variety of cancers. We previously showed that miR-335 played an important role in ovarian cancer metastasis and prognosis. However, miR-335 is down-regulated in ovarian cancer by mechanisms that remain unclear. In silico analysis identified putative transcription factor specificity protein 1 (SP1) transcription factor binding sites in the miR-335 promoter. To investigate the relation between SP1 and miR-335, qRT-PCR was performed. Our results showed both Sp1 knockdown and mithramycin A increased miR-335 expression in ovarian cancer cell lines. Luciferase reporter assays indicated that Sp1 knockdown increased miR-335 transcriptional activity. ChIP experiments showed that Sp1 bound directly to miR-335 promoter. Moreover, transwell migration and woundhealing assays showed that Sp1 knockdown resulted in inhibited cell migration, which was in turn mitigated by miR-335 inhibitor. We propose that miR-335 was negatively regulated by SP1, which in turn contributes to miR-335 deregulation and tumor cells migration. © 2020 Elsevier Inc. All rights reserved.
Keywords: miR-335 SP1 DNA methyltransferase (DNMT) Migration EOC
1. Introduction Ovarian cancer is the highest lethal rate of gynecological tumors, located in the female tumor mortality rate of the fifth. Due to its insidious onset, the disease is diagnosed in 70% of cases in an advanced stage [1]. Prognosis is poor with a relatively low rate of 5year survival, largely because of extensive invasion and metastasis of the tumor. It is very urgent and important to explore which factors play a role in the process of invasion and metastasis of ovarian cancer and to study the specific mechanism of promoting the development of tumor. MicroRNAs (miRNAs) are an abundant class of small nonprotein-coding RNAs that play an important role in a variety of biological events, including tumors [2,3]. miRNAs play important gene-regulatory roles by pairing to the mRNAs of protein-coding genes to direct their posttranscriptional repression [4]. A large number of miRNA, its expression disorder associated with the occurrence and development of many diseases including malignant tumors [2].Our previous studies show that the low expression of miRNA-335 in ovarian cancer can promote the
* Corresponding author. E-mail addresses: E-mail address: [email protected] (J. Cao).Jin_Cao@hust. edu.cn (J. Cao).
invasion and metastasis of ovarian cancer, which leads to the poor prognosis of ovarian cancer [5]. However, the mechanism of miRNA-335 low expression remains to be elucidated. Epigenetic regulation plays a central role in the regulation of genes. DNA methyltransferase (DNMTs) and Histone deacetylase 1 (HDAC1) are important epigentic regulators. Transcription factor Sp1 can promote gene expression by recognize and combined with the same GC-(GGGGCGGGG) and GT-(GGTGTGGGG) boxes of multiple target genes [6]. In addition, transcription factor Sp1 can also negatively regulate the expression of certain genes by regulating DNMTs, HDAC1 [7]. It has been reported that high expression of Sp1 in ovarian cancer cells can promote metastasis of ovarian cancer, resulting in poor prognosis, and the combination of Sp1 inhibitors and platinum drugs can prolong the survival time of tumor patients [7,8].Recently studies reported that miRNAs such as miR-205 [9],miR-182 [10],miR-200 [11],miR-7a [12],miR-20b [13],could be epigenetically regulated by Sp1. It seems that over-expression of Sp1 may partly explain the suppression of tumor suppressor miRNAs. We propose that transcription factors Sp1 and methylation levels of miR-335 promoters may be involved in the expression of miR-335. In this paper shRNA transfection and Mithramycin A treatment were used to down-regulate the Sp1 expression in ovarian cancer cell to detect the expression of miR-335 and its
https://doi.org/10.1016/j.bbrc.2020.01.063 0006-291X/© 2020 Elsevier Inc. All rights reserved.
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
2
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
effect on tumor proliferation and migration ability. Finally, elucidating the molecular mechanism of low expression of miR-335 may provide a new approach for the pathogenesis, prognosis analysis and targeted therapy of ovarian cancer.
crystal violet stain. After 24 h of incubation, the cells that had not invaded upper chamber were removed, and migration cells were fixed and stained.The cells on the lower surface of the filter were counted under a microscope.
2. Materials and methods
2.5. Wound-healing assays
2.1. Cell lines and cell culture
For the wound-healing assays, cells were transfected with shSp1 or co-transfected shSp1 and MiR-335inhibitor. After 48 h, cells were reseeded on a six-well tissue culture plate. After 12 h, the attached cells were grown to confluency. A linear wound was made by scraping with a 200 ml pipette tip and 0 h images were captured using microscope. The plates were placed back at 37 C and 5% CO2 for 24 h, and another set of images were captured of the same wounds. The wound widths were measured by ImageJ (version 1.44, NIH), normalized and presented as the percentage of wound measured at time 0 (mean ± s.d.). The percent migration was calculated by following equation: [D area / area (day 0)] 100.
The A2780 and SKOV3 human epithelial ovarian cancer cell lines were purchased from China Center for Type Culture Collection (CCTCC). Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum under a humidified atmosphere containing 5% CO2 at 37 C. All transfections were performed using Lipofectamine™ 2000 reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocols. 2.2. RNA extraction and real-time quantitative PCR
2.6. Cell proliferation analysis Total RNA was extracted from ovarian cancer cells using TRIzol Reagent according to the manufacturer’s instructions (Takara, Japan). Bulge-Loop™ hsa-miR-335e5p qRT-PCR Primer Set (RiboBio, Guangzhou, China) was used to analyze the expression of miR335 according to the manufacturer’s instructions. Expression of miR-335 was normalized to that of the U6 snRNA. PCR reactions were performed by using an ABI PRISM 7300 Step-One Plus instrument (Applied Biosystems, Foster City, CA, USA) with SYBR Green PCR Master Mix (Takara). The cycling method for the reverse transcription reaction was as follows: 70 C for 10 min, 2 min on ice followed by 42 C for 1 h and 70 C for 10 min. The cycling conditions of PCR consist of an initial denaturizing step of 20 s at 95 C and 40 cycles of denaturing at 95 C for 10s, annealing at 60 C for 20s and extension at 70 C for 10s.For mRNA expression levels, bactin levels were used as internal controls. The primers used for qRT-PCR were as follows: Sp1, 50 - GCGAGAGGCCATTTATGTGTAC-3’ (forward) and 50 - CAAATTTCTTCTCACCTGTGTGTGT-3’ (reverse); DNMT1, 50 - ACCGCTTCTACTTCCTCGAGGCCTA -3’ (forward) and 50 GTTGCAGTCCTCTGTGAACACTGTGG -3’ (reverse); DNMT3, 50 CACACAGAAGCATATCCAGGAGTG -3’ (forward) and 50 - AGTGGACTGGGAAACCAAATACCC -3’ (reverse); DNMT3b, 50 - AATGTGAA TCCAGCCAGGAAAGGC-3’ (forward) and 50 - ACTGGATTACACTCCA GGAACCGT -3’ (reverse); b-actin, 50 -TACATGGCTGGGGTGTTGAA -3’ (forward) and 50 - AAGAGAGGCATCCTCACCCT -3’ (reverse).Reverse transcription PCR was done using the PrimeScript RT Reagent Kit (TaKaRa).PCR conditions included an initial holding period at 95 C for 30s, followed by a two-step PCR program consisting of 94 C for 5 s and 60 C for 30 s for 40 cycles. 2.3. Transfection of RNA oligoribonucleotides Transfection was performed with Lipofectamine 2000 Reagent (Invitrogen, USA), following the manufacturer’s protocol. One day before transfection, cells were plated in 6-well plates (2 105/ well). The next day, the cells were transfected with miR-126 inhibitors (target sequence 50 CGCAUUAUUACUCACGGUACGA30 , GenePharma, Shanghai, China) or its negative control siRNAs (MNC and INC) (GenePharma, Shanghai, China) until 70% confluent. 2.4. Transwell migration assays For the transwell migration assay, 5.0 105 cells were suspended in serum-free medium and plated in Transwell chambers chambers. Medium containing 10% FBS was added to the lower chamber. Then, the filters were fixed in 90% alcohol and followed by
2.6.1. Cell proliferation was measured by detecting incorporation of 5-ethynyl-20 -deoxyuridine (Edu) during DNA synthesis was performed using Clik-iT® EdU Imaging Kit (Invitrogen) with minor modifications to the manufacturer’s protocol. Briefly, cells that had been propagated in a 96-well plate for 48 h were exposed to 10 mM of EdU for 4 h. After EdU exposure, cells were fixed with 4% formaldehyde and treated with 0.5% Triton X-100. Proliferative cells were visualized using Click-iT ® reaction cocktail. Subsequently, cells were counterstained with Hoechst 33342. All assays were carried out in triplicate. 2.6.2. Luciferase reporter assay The plasmids included MiR-335 promoter and pRL-TK vector expressing the Renilla luciferase using Lipofectamine 2000 reagent (Invitrogen), After 24 h, cells were treatment with various concentrations of Mithramycin A for an additional 24h.Then, cells were harvested and lysed and luciferase activity was measured using the DualLuciferase Reporter Assay System (Promega) according to the manufacturer’s protocol. Renilla luciferase was used for normalization. 2.6.3. Chromatin immunoprecipitation (ChIP) ChIP assay was performed using EpiQuik™ chromatin immunoprecipitation kit (Epigentek, Farmingdale, NY, USA) according to the manufacturer’s protocol. Briefly, the cells were transfected with sh-SP1 or sh-control for 48 h prior to formaldehyde fixation. After cell lysis, the chromatin was fragmented to ~200e1,000 bp. The DNA fragment was then enriched with anti-SP1 (Santa Crus), antiH3 or normal IgG antibodies (Cell Signaling Technology). The purified DNA was used as template and quantified by qRT-PCR method. The primers for ChIP were as follows: miR-335 Region 11-L 50 - GGGAGCAAGCTGAACTCAAG-30 , Region 1-1-R 50 TCACCTCCTCTTTCCCACAC -30 , Region 1-2-L 50 - GCCTGCCATTTCATACCCTT -30 , Region 1-2-R 50 - ACAGGACTCCATGTTTCGGA-30 , Region 1-3-L 50 - TGACTCATTCTGGCTGGAGG -30 , Region 1-3-R 50 CTCACCACAGTCCCCTAAGG-3’. Region 2-1-L 50 - TATTAGGGGCCAGCTTTGTG-30 , Region 2-1-R 50 - GGGGTGCGAAATAAATGAGA -30 , Region 2-2-L 50 - CCTCCGCAGGTGAGTGTG -30 , Region 2-2-R 50 TGACACCCCCTCCTCAAGTA-30 , Region 2-3-L 50 - GCTCTGGTGC GACTTAAAGG -30 , Region 2-3-R 50 - GGGCACTGCGAGTTCTAGTC-3’. Region 3-1-L 50 - GGGGGTAGTGGGTAGATGGT-30 , Region 3-1-R 50 CCGACTTTAACCCCTTAGCC -30 , Region 3-2-L 50 - CAGTGGGTC TCTGCTTTTCC -30 , Region 3-2-R 50 - GACCGATACACGCAGGACTT-30 , Region 3-3-L 50 - AGATTGGGTCTCCTGCTGAA -30 , Region 3-3-R 50 -
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. Mir-335 is negatively regulated by Sp1. (A) A2780 and SKOV3 cells were transfected with sh-Sp1 or sh-control (NC) for 72 h. The expression of miR-335 was detected by qRTPCR. (B) A2780 and SKOV3 cells were treated with Mithramycin A. The expression of miR-335 was determined by qRT-PCR. (C) Luciferase reporter assays in EOC cells. shSp1 A2780 cells were transfected with miR-335 promoter luciferase reporter gene and the luciferase activity was measured. *p < 0.01. (D) Illustration shows the locations of 3 possible Sp1 binding sites upstream of the transcription start site of miR-335 defined as region1, region2 and region3 (around 500 - 600bp/per region); 3 pairs of primers, sequentially referred to as P1, P2 and P3, were designed within the span of each possible binding site at an interval of 150e200bp. (E &F) CHIP assay shows the enrichment of Sp1 on region2 (P1) promoter region. Data are presented as the fold of enrichment relative to IP % input/IgG % input; **p < 0.01.
AGCATCTCCCCATTTCTCCT-3’. 2.6.4. Statistical analysis In study, the quantitative data between groups were compared and analyzed by Student’s t-test (two tailed) or a one-way analysis of variance. The data are expressed as the means ± standard deviation (SD), and P 0.05 was considered to indicate a significant difference. Each experiment was repeated at least three times. 3. Results 3.1. Mir-335 is negatively regulated by Sp1 in ovarian cancer cells To investigate whether miR-335 could be inhibited by Sp1 in EOC cells, we constructed ShSp1 to knock down Sp1 expression in A2780 and SKOV3 cells. The results showed that knockdown of Sp1
led to an increase of miR-335 in A2780 and SKOV3 cells (Fig. 1A). Similar results were acquired with Sp1 inhibitor, mithramycin A (Fig. 1B). To further explore the specific mechanism through which Sp1 regulates miR-335 expression, A luciferase reporter gene containing miR-335 promoter was constructed according to the miR-335 TSS information acquired from an online database (http:// mirstart.mbc.nctu.edu.tw/). The luciferase reporter assay showed that Sp1 knockdown significantly enhanced the transcriptional activity of the miR-335 promoter compared with the negative control (Fig. 1C). Three putative core promoter regions that might be responsible for miR-335 regulation are identified upstream to the 94 bp hsamiR-335 coding region according to the Chip-seq results based on 9 different cell lines from UCSC Genome Browser. To determine whether Sp1 could bind to miR-335 promoter
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
4
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. Sp1 promotes ovarian cancer migration via down-regulating miR-335. The shSp1-SKOV3 and shSp1-A2780 cells were concomitantly transfected with miR-335 inhibitor or inhibitor NC. (A) The indicated cell transfectants were planted onto uncoated polycarbonate filters to analyze their migratory potentials.The cells were photographed at 200 magnification. (B) The migration of the indicated cells was evaluated by wound healing assay. Magnification: 200 . *p < 0.01.
region, we performed ChIP assay near the TSS on region 1(P1, P2, P3), region 2 (P1, P2, P3) and region 3 (P1, P2, P3) of the miR-335 promoter, which containing rich CpG islands and were highly conserved according to the data shown in UCSC Genome Browser (Fig. 1D). Among the three regions, region 2 contains a GC box element 50 -GGGGCGGGC-30 , which is the perfect match for Sp1 binding. As shown in Fig. 1E and F, Sp1 was enriched at region 2 (P1) of the miR-335 promoter. Knockdown of Sp1 decreased the binding of Sp1 on region 2 (P1) of the miR-335 promoter. The result indicates that miR-335 is repressed by Sp1. 3.2. Sp1 promotes ovarian cancer migration via down-regulating miR-335 The shSp1-SKOV3 and shSp1-A2780 cells were concomitantly transfected with miR-335 inhibitor or negative control inhibitor NC. The transwell migration assays and wound-healing assays were used to detect the migration ability of ovarian cancer cells. The transwell migration assays revealed significant decreases in migrating cells after shSp1 transfection compared with NC. The migration inhibitory effects of shSP1 could be largely relieved by miR-335 inhibitor (Fig. 2A). Similar results were acquired with wound-healing assays (Fig. 2B). 3.3. Sp1 does not promote the proliferation of ovarian cancer cells by regulating miR-335 Edu assays were used to detect the proliferation ability of ovarian cancer cells. The cell proliferation analysis revealed significant decreases in proliferating cells after shSp1 transfection
compared with NC. However, the inhibitory effects of shSP1 on proliferation could not be mitigated by miR-335 inhibitor (Fig. 3A&B). 3.4. Sp1 inhibitor down-regulates DNA methyltransferase expression Previous studies show that Sp1 can also represses gene expression through the recruitment of histone deacetylase or DNA methyltransferase. Bioinformatics (http://www.urogene.org/) shows that a large number of CpG islands exist in the promoter region of miR-335 (Fig. 4A). To investigate whether Sp1 regulates the expression of DNA methyltransferases, the expression of DNMT1, DNMT3a and DNMT3b was detected using qRT-PCR after Sp1 knockdown. The results showed mithramycin A treatment reduced the expression of these methyltransferases, suggesting the involvement of DNA methylation in the regulation of miR-335 (Fig. 4B and C). 4. Discussion Like mRNAs, miRNA expression is often tissue specific and developmentally regulated and regulation takes place both transcriptionally and posttranscriptionally. MiR-335 is an intragenic miRNA residing in the second intron of the mesoderm-specific transcript Mest [14]. We previously found that miR-335 was down-regulated in ovarian cancer [5,15,16]. The underlying mechanisms, however, remain unknown. In this study, we found that miR-335 was negatively regulated by Sp1. Sp1 was the founding member of the Sp transcription factor
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 3. Sp1 does not promote the proliferation of ovarian cancer cells by regulating miR-335. The Edu assays were performed to evaluate the proliferative ability of A2780 cells (A) and SKOV3 cells(B). The average value of the percentage of proliferating cells in three repeated experiments was quantitatively analyzed. Magnification: 200 .*p < 0.01.
Fig. 4. Knockdown of Sp1 reduces mRNA expression of DNMTs in EOC cells. A2780 and SKOV3 cells were treated with Mithramycin A. (A) The methylation sites of miR-335 promoter region. (B) The expression of DNMTs in A2780 cells on Sp1 knockdown. (C) The expression of DNMTs in SKOV3 cellson Sp1 knockdown. *p < 0.01.
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063
6
S. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
family. Sp1 is over-expressed in lung, breast, pancreatic, gastric and thyroid cancers. In patient samples and cancer models, Sp1 levels correlate with stage, invasive potential and metastasis [17]. Sp1 levels correlate with the survival of patients in almost all cancers, with high levels of Sp1 being associated with poor prognoses [18]. Our results showed that Sp1 inhibited the transcriptional activity of the miR-335 promoter and the region 2 of miR-335 promoter was important for the negative control of miR-335, suggesting that Sp1 can repress miR-335 by directly binding to miR-335 promoter. Besides this mechanism, previous studies show that Sp1 can also repress gene expression through the recruitment of histone deacetylase or DNA methyltransferase [19]. Consistent with this, we found that there are a large number of CpG islands in the promoter region of miR-335 and Sp1 could negatively regulate the expression of DNMTs in ovarian cancer cells, suggesting that the regulation of miR-335 by Sp1 can also be achieved by inhibiting the methylation level of the miR-335 promoter. These results suggest that the Sp1DNMTs-miR-335 regulatory pathway in ovarian cancer cells may provide a new theoretical basis for targeted therapy of ovarian cancer. In this study we found that Sp1 promoted the migration and proliferation of ovarian cancer cells. Interestingly, however, the inhibitory effects of shSP1 on proliferation could not be mitigated by miR-335 inhibitor. This is consistent with our previous finding that miR-335 does not inhibit cell proliferation, highlighting the pleiotropic action of Sp1. In conclusion, we have confirmed that transcription factor Sp1 can negatively regulate the expression of miR-335 and promote the migration of ovarian cancer cells, which provides new ideas and strategies for targeted therapy of ovarian cancer. However, whether the regulation of Sp1 on miR-335 is by mediate promoter methylation more research is needed to confirm.
Declaration of competing interest The authors claim that none of the material in the paper has been published or is under consideration for publication elsewhere and declare that there are no conflicts of interest.
Acknowledgments The present study was supported by the National Natural Science Foundation of China (no.81402166).
References [1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, 2019, CA A Cancer J. Clin. 69 (2019) 7e34. [2] M. Acunzo, G. Romano, D. Wernicke, C.M. Croce, MicroRNA and cancer–a brief overview, Adv. Biol. Regul. 57 (2015) 1e9. [3] Y. Toiyama, Y. Okugawa, A. Goel, DNA methylation and microRNA biomarkers for noninvasive detection of gastric and colorectal cancer, Biochem. Biophys. Res. Commun. 455 (2014) 43e57. [4] C. Moutinho, M. Esteller, MicroRNAs and epigenetics, Adv. Cancer Res. 135 (2017) 189e220. [5] J. Cao, J. Cai, D. Huang, Q. Han, Y. Chen, Q. Yang, C. Yang, Y. Kuang, D. Li, Z. Wang, miR-335 represents an independent prognostic marker in epithelial ovarian cancer, Am. J. Clin. Pathol. 141 (2014) 437e442. [6] P. Bouwman, S. Philipsen, Regulation of the activity of Sp1-related transcription factors, Mol. Cell. Endocrinol. 195 (2002) 27e38. [7] L. Li, S. He, J.M. Sun, J.R. Davie, Gene regulation by Sp1 and Sp3, Biochem. Cell Biol. 82 (2004) 460e471. [8] S. Previdi, A. Malek, V. Albertini, C. Riva, C. Capella, M. Broggini, G.M. Carbone, J. Rohr, C.V. Catapano, Inhibition of Sp1-dependent transcription and antitumor activity of the new aureolic acid analogues mithramycin SDK and SK in human ovarian cancer xenografts, Gynecol. Oncol. 118 (2010) 182e188. [9] F. Pan, H. Mao, F. Bu, X. Tong, J. Li, S. Zhang, X. Liu, L. Wang, L. Wu, R. Chen, H. Wei, B. Li, C. Li, Y. Yang, C.J. Steer, J. Zhao, Y. Guo, Sp1-mediated transcriptional activation of miR-205 promotes radioresistance in esophageal squamous cell carcinoma, Oncotarget 8 (2017) 5735e5752. [10] W.B. Yang, P.H. Chen, T.s. Hsu, T.F. Fu, W.C. Su, H. Liaw, W.C. Chang, J.J. Hung, Sp1-mediated microRNA-182 expression regulates lung cancer progression, Oncotarget 5 (2014) 740e753. [11] N. Kolesnikoff, J.L. Attema, S. Roslan, A.G. Bert, Q.P. Schwarz, P.A. Gregory, G.J. Goodall, Specificity protein 1 (Sp1) maintains basal epithelial expression of the miR-200 family: implications for epithelial-mesenchymal transition, J. Biol. Chem. 289 (2014) 11194e11205. [12] R. Li, J. Xiao, X. Qing, J. Xing, Y. Xia, J. Qi, X. Liu, S. Zhang, X. Sheng, X. Zhang, X. Ji, Sp1 mediates a therapeutic role of MiR-7a/b in angiotensin II-induced cardiac fibrosis via mechanism involving the TGF-beta and MAPKs pathways in cardiac fibroblasts, PLoS One 10 (2015) e0125513. [13] S. Guo, H. Wang, Y. Luo, J. He, H. Ma, L. Shen, J. Tang, Q. Fang, Z. Qian, C. Song, Sp-1 negatively regulates miR-20b expression in macrophages, Ann. Clin. Lab. Sci. 47 (2017) 706e712. [14] M. Girardot, J. Cavaille, R. Feil, Small regulatory RNAs controlled by genomic imprinting and their contribution to human disease, Epigenetics 7 (2012) 1341e1348. [15] J. Cao, J. Cai, D. Huang, Q. Han, Q. Yang, T. Li, H. Ding, Z. Wang, miR-335 represents an invasion suppressor gene in ovarian cancer by targeting Bcl-w, Oncol. Rep. 30 (2013) 701e706. [16] Y. Yu, R. Gao, Z. Kaul, L. Li, Y. Kato, Z. Zhang, J. Groden, S.C. Kaul, R. Wadhwa, Loss-of-function screening to identify miRNAs involved in senescence: tumor suppressor activity of miRNA-335 and its new target CARF, Sci. Rep. 6 (2016) 30185. [17] S. Safe, M. Abdelrahim, Sp transcription factor family and its role in cancer, Eur. J. Cancer 41 (2005) 2438e2448. [18] K. Beishline, J. Azizkhan-Clifford, Sp1 and the ’hallmarks of cancer, FEBS J. 282 (2015) 224e258. [19] Q. Fang, W. Yang, H. Li, W. Hu, L. Chen, S. Jiang, K. Dong, Q. Song, C. Wang, S. Chen, F. Liu, W. Jia, Negative regulation of DsbA-L gene expression by the transcription factor Sp1, Diabetes 63 (2014) 4165e4171.
Please cite this article as: S. Wang et al., Sp1 promotes ovarian cancer cell migration through repressing miR-335 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.063