- Email: [email protected]
Spatial expression of the mevalonate enzymes involved in juvenile hormone biosynthesis in the corpora allata in Bombyx mori
Journal of Insect Physiology 55 (2009) 798–804
Contents lists available at ScienceDirect
Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys
Spatial expression of the mevalonate enzymes involved in juvenile hormone biosynthesis in the corpora allata in Bombyx mori Hiroto Ueda a, Tetsuro Shinoda b, Kiyoshi Hiruma a,c,* a
Faculty of Agriculture and Life Sciences, Hirosaki University, Hirosaki 036-8561, Japan National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8634, Japan c Graduate School of Agricultural Sciences, Iwate University, Morioka 020-8550, Japan b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 8 March 2009 Received in revised form 20 April 2009 Accepted 22 April 2009
The developmental expressions of the mRNA of JH synthetic enzymes have been studied using homogenates of the corpora cardiaca–corpora allata (CC–CA) complexes in Bombyx mori [Kinjoh, T., Kaneko, Y., Itoyama, K., Mita, K., Hiruma, K., Shinoda, T., 2007. Control of juvenile hormone biosynthesis in Bombyx mori: cloning of the enzymes in the mevalonate pathway and assessment of their developmental expression in the corpora allata. Insect Biochemistry and Molecular Biology 37, 808– 818]. The in situ hybridization analyses in the CC–CA complex showed that the distribution of the mRNAs of all the mevalonate enzymes and juvenile hormone (JH) acid O-methyltransferase occurred only in the CA cells, indicating that the fluctuations of the enzyme mRNA amounts in the CC–CA complexes were derived solely from the CA. In addition, the size of the CA and their nuclei was not associated with the JH synthetic activity by the CA until the pharate adult. Only female adult CA synthesized JH in B. mori, and the CA and the nuclei were significantly larger than those of male CA which do not synthesize JH. ß 2009 Elsevier Ltd. All rights reserved.
Keywords: Juvenile hormone Bombyx mori Mevalonate pathway Corpora allata In situ hybridization Enzyme
1. Introduction Insect corpora allata (CA), which are derived from ectoderm (Cassier, 1979), are the site of juvenile hormone (JH) biosynthesis as well as neurohemal organs for neurosecretions such as prothoracicotropic hormone (PTTH) from the brain neurosecretory cells in the Lepidoptera (Agui et al., 1980). The CA synthesize and secrete JH, but do not store JH as intraglandular JH was not detected in Manduca sexta and other species (Granger et al., 1979; see review, Feyereisen, 1985); therefore, the rate and timing of secretion of JH are determined by the rate of the synthesis. JH is a sesquiterpenoid hormone that modulates 20-hydroxyecdysone action during insect development, and the coordinated regulation of JH biosynthesis is one of the major factors in determining the JH titer in the hemolymph that is crucial for normal development. The activity of the CA is under the control of many factors: neuropeptide hormones such as allatropin, allatostatin (Goodman and Granger, 2005; Stay and Tobe, 2007; Audsley et al., 2008) and short neuropeptide F (sNPF) (Yamanaka et al., 2008), catecholamines (Granger et al., 1996, 2000), 20-hydroxyecdysone (20E) (Whisenton et al., 1985, 1987; Gu et al., 1995) and nutrition
* Corresponding author at: Faculty of Agriculture and Life Sciences, Hirosaki University, Bunkyo-machi 3, Hirosaki 036-8561, Japan. Tel.: +81 172 39 3819. E-mail address: [email protected] (K. Hiruma). 0022-1910/$ – see front matter ß 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jinsphys.2009.04.013
(Cymborowski et al., 1982; Noriega, 2004) as well as by nervous connections (Feyereisen, 1985; Tobe and Stay, 1985). JH biosynthesis is also controlled by the expression of JH biosynthetic enzymes (Shinoda and Itoyama, 2003; Kinjoh et al., 2007; Minakuchi et al., 2008), and some of the factors, such as 20E, regulate JH synthesis through the regulation of the expression of these enzymes in the CA (Kaneko, Kinjoh, Kiuchi, and Hiruma, unpublished). Studies on the JH biosynthetic enzymes in the CA are limited. Among the enzymes necessary to synthesize compounds up to farnesyl diphosphate (FPP) (the mevalonate enzymes), only HMGCoA reductase and HMG-CoA synthase are well characterized, but most of the studies utilized non-CA tissues which are not involved in JH biosynthesis (see review, Belle´s et al., 2005) with a few exceptions (Bhaskaran et al., 1987; Feyereisen and Farnsworth, 1987; Couillaud and Feyereisen, 1991; Mane´-Padro´s et al., 2008). Recently, genes for two enzymes have been isolated which are involved in the conversion of FPP to JH: JH acid O-methyltransferase (JHAMT) (Shinoda and Itoyama, 2003; Niwa et al., 2008; Minakuchi et al., 2008; Sheng et al., 2008; Mayoral et al., 2009) and epoxidase (CYP15A1) (Helvig et al., 2004). Although it is important to identify the exact cellular site of the JH biosynthetic enzymes, there are no detailed systematic studies in a single species regarding the localization of these enzymes, in particular, mevalonate enzymes in cephalic organs. In Bombyx mori, all genes encoding enzymes involved in the mevalonate pathway (Kinjoh et al., 2007) and a gene for JHAMT
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
(Shinoda and Itoyama, 2003) have been isolated, and the highest levels of transcripts of these enzymes were found in the CC–CA complex except for FPPS1, which was expressed most highly in the Malpighian tubules although also in the CC–CA complex. The mRNAs of each mevalonate enzyme and JHAMT in the CC–CA complex correlated well with the JH synthesis by the CA (Kinjoh et al., 2007). Indeed the knockout of HMG-CoA reductase with an inhibitor, statin, a specific inhibitor of HMG-CoA reductase, completely prevented the RNA expression of the enzyme and consequently JH synthesis by the CA (Kaneko, Kinjoh, and Hiruma, unpublished). Yet it was not clear whether or not these JH biosynthetic enzymes were synthesized solely by the CA. Due to the minute size of the CC–CA, it is not practical to identify the exact site of enzyme synthesis using extracted RNA. Here we show by in situ hybridization analyses in B. mori that the CA are the site of the JH biosynthetic enzymes and not the CC. 2. Materials and methods 2.1. Insects Larvae of the silkworm, B. mori (Kinshu Showa, F1), were reared on an artificial diet (Silkmate, Nippon Nousan Kogyo, Japan) at 25 8C under a 12L:12D photoperiod. Light-on was designated as 00:00 Arbitrary Zeitgeber Time (AZT) (Pittendrigh, 1965). 2.2. DAPI staining CC–CA complexes were dissected in phosphate buffered saline (PBS: 137 mM NaCl, 8.10 mM Na2HPO4, 1.47 mM KH2PO4, 2.68 mM KCl), and fixed with 4% formaldehyde in PBS for 30 min at room temperature followed by washing in PBS. DAPI (40 ,6-diamidino-2-phenylindole dihydrochloride) (Sigma) staining in PBS was then performed at room temperature for 30 min followed by washing in PBS and then the CC–CA complexes were mounted in 70% glycerol.
799
Table 1 The oligonucleotide primers used for in situ hybridizations. Primers
Sequences (50 –30 )
AACT/forward AACT/reverse HMGS/forward HMGS/reverse HMGR/forward HMGR/reverse MevK/forward MevK/reverse MevPK/forward MevPK/reverse MevPPD/forward MevPPD/reverse IPPI/forward IPPI/reverse FPPS1/forward FPPS1/reverse FPPS2/forward FPPS2/reverse FPPS3/forward FPPS3/reverse JHAMT/forward JHAMT/reverse
ATGGGTTCTTTCCGAGGGAG TTACATTTTTTCAATCATTACAGATGATG ATGGGCGGAAAAGTTGAGAATG TTAATGTTTCCTATCATAAGTACGCCTTC ATGGGAAGTCATCGTAGCCA TTCCCCCACCTACTGTGCC GGAACTGAAGACAATCCACGCGTTCACCCA CACAGGTCCGTGCGCTATGAGACCCGT ATGTCTCCAAAAATTATCTTGTTATTCAGT TCATAAATTAGACACTAATTTTAATATGCTATCCAA TAACTTATTTTCGCCTAATTCGAACAGCCATTCCT TCCATCTGCTACACATCAGCACCCCTTGTTT ATGTTCCTTCAGAGGAGATCAAGC TTATTTTTTATCAACAAATTTTTGTATTTTCTCC ATG TTC TCG ACA AAG AAA AGC TTA G TTA CAC GCT TCG CCT GAA GAT ATGAGTGTATTTAATTGTCTCAAATTTACCC TTAATGTTGCCTATTGTACGTAATATCCA ATGAACACCACATCGATGTTTCTA TTAATAACTTCTCTTGAATATCATATCGA ATGAACAATGCAGATTTATACCGCA TTACATTAAACTTAAACATAATTTTCTCGCGTA
nate decarboxylase; IPPI, isopentenyl diphosphate isomerase; FPPS1, farnesyl diphosphate synthase 1; FPPS2, farnesyl diphosphate synthase 2; FPPS3, farnesyl diphosphate synthase 3; JHAMT, JH acid O-methyltransferase. 3. Results In the CC–CA complex of B. mori, the amounts of mRNA expression of the mevalonate enzymes and JHAMT fluctuate during development (Kinjoh et al., 2007; Fig. 1A), and their expression patterns fall into three different types: HMGS type that includes AACT, HMGS, HMGR, FPPS1 and FPPS3; MevK type that includes MevK, MevPK, MevPPD, IPPI and FPPS2; JHAMT type (Fig. 1A).
2.3. Preparation of probes and in situ hybridization 3.1. Changes in size of CA and nuclei of CA cells during development The coding regions of cDNA of the mevalonate enzymes (except MevK and MevPPD which contain 50 non-coding regions) and JHAMT were obtained using the primers in Table 1 and the cDNA of each enzyme as templates (Kinjoh et al., 2007). Amplification using Ex Taq (Takara) was performed by denaturing at 98 8C for 10 s (94 8C for 30 s, only for the first cycle), annealing at 55 8C (except for FPPS1 in day 2 4th and day 0 adult at 38 8C) for 30 s, followed by extension at 72 8C for 90 s, for 35 cycles. The PCR products were ligated to the pBluescript SK Vector. Digoxigenin-labelled sense and antisense cRNA were prepared by DIG RNA Labelling Kit (Roche). The CC–CA complexes were dissected in PBS and fixed in 4% paraformaldehyde in PBS at 4 8C for 20 min followed by washing in PBST (0.5% Triton X-100 in PBS). The tissues were transferred to PTW (0.1% Tween 20 in PBS), and then they were treated with 5 mg/ ml Protein Kinase K (Nacalai) for 75 s at room temperature before re-fixation in the solution containing 0.2% glutaraldehyde, 0.1% Tween 20 and 4% paraformaldehyde for 20 min at room temperature. Hybridization (50 8C for overnight) and detection were based on the method by Niwa et al. (2004) with alkaline phosphate-conjugated anti-DIG FAB fragments (Roche). After the hybridization and detection, the tissues were mounted in 70% glycerol for microscopic observation. Studied enzymes in this paper and their abbreviations are as follows: AACT, acetoacetyl-CoA thiolase; HMGS, HMG-CoA synthase; HMGR, HMG-CoA reductase; MevK, mevalonate kinase; MevPK, phosphomevalonate kinase; MevPPD, diphosphomevalo-
The volume of B. mori CA, which were determined by the diameter, increased with development. The average diameter of day 2 4th instar larvae was about 126 mm and the relative JH production by the CA was 190 in a comparison with the JH production in day 0 5th instar as 100 (Fig. 1A and Table 2; Kinjoh et al., 2007). The diameters slightly increased during the final (5th) instar larvae (156 mm in day 4 5th), but these CA did not synthesize Table 2 The size of corpora allata (CA) and their nuclei during development. Stage (A) CA Day 2 Day 4 Day 4 Day 0 Day 0
4th instar 5th instar pupa adult (male) adult (female)
No. of CA
Diameter (mm) (mean S.D.)
15 18 15 38 46
126.4 16.2 155.6 20.0 385.2 67.6 377.5 54.2a 415.9 54.8a
Stage
No. of nuclei
Diameter (mm) (mean S.D.)
(B) Nuclei Day 2 4th instar Day 4 5th instar Day 4 pupa Day 0 adult (male) Day 0 adult (female)
21 38 36 52 53
15.7 2.7 19.9 4.8 53.3 12.8 40.5 10.9b 57.3 14.4b
a b
Significantly different at P = 0.0019. Significantly different at P = 0.0077.
800
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
Fig. 1. (A) Fluctuations of JH titer and JH synthetic activity by CA and the mRNA expression of three types of JH synthetic enzymes in the CC–CA complex in B. mori. The Y-axis shows the relative abundance of mRNA where the maximum mRNA levels during the 4th larval stadium were arbitrarily set at 100. Separate analyses were conducted for each sex during the pupal and adult stages: gray shading, males; solid black, females. The data are from Kinjoh et al. (2007). HCS, head capsule slippage; SP, spinneret pigmentation. (B) Changes in shape and size of the CA of B. mori as a function of developmental stage. The CA were stained with DAPI to visualize the nuclei. Typical results were presented (N = 10–20). IV2, day 2 4th; V4 and V9, day 4 and day 9 5th; P4, day 4 pupa; A0, day 0 adult. Scale bar = 200 mm.
JH. During the adult development, the CA did not synthesize JH (Table 2A; Kinjoh et al., 2007), but the CA diameter continued to increase and reached maximal size by 4 days after pupation (385 mm). The increase in size of the nuclei visualized with DAPI staining of these glands paralleled the CA volumes (Table 2B). The size of day 0 adult male CA and their nuclei was significantly smaller than that of day 0 female CA and nuclei (378 mm versus 416 mm and 41 mm versus 57 mm, respectively) (Table 2 and Fig. 1B), in which only female CA synthesize JH at least for 4 days after adult ecdysis (Kinjoh et al., 2007; Fig. 1A). The sexual dimorphism was not found until the pharate adult stage.
3.2. Spatial expression of mevalonate enzymes and JHAMT in CC–CA complex 3.2.1. 4th instar stadium Since the mRNA expression of all the mevalonate enzymes and JHAMT in the CC–CA complex is high in day 2 and 1 4th instar larvae respectively (Kinjoh et al., 2007; Fig. 1A), we examined the spatial expression patterns of these enzyme RNAs in the CC–CA complex in these two stages: the mevalonate enzymes in day 2 4th and JHAMT in day 1 4th instar stadium. The in situ hybridization results showed that the enzyme mRNAs were detected only in the
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
801
Fig. 2. In situ analysis of JH biosynthetic enzyme mRNA expression in CC–CA complex. Only female glands are presented except for JHAMT, for which both male and female adult glands are shown. The analyses were performed on 10–20 different samples using different individuals, and typical results are presented. Sexual dimorphism was not observed until the pharate adult stage. The insets show the negative controls hybridized with sense RNA probes. (A) Day 2 4th instar stadium. Scale bar = 100 mm. (B) Day 9 5th stadium. Scale bar = 200 mm. (C) Day 0 adult. Scale bar = 200 mm.
CA cells but not in the CC cells, and all occurred evenly over the CA (Fig. 2A). MevPK signal was not detected in either the CA or the CC cells under our conditions described in Section 2, nor when the hybridization temperature was reduced to 38 8C (data not shown). One of the reasons is due to somehow poor penetration of the probe to the tissues. In addition, the low levels of hybridization of HMGR, MevPPD and FPPS3 were expected, as these enzymes were expressed in small amounts in the CC–CA complex (Kinjoh et al., 2007). 3.2.2. 5th instar stadium The mRNA levels of all the mevalonate enzymes begin to increase shortly before the last larval ecdysis, and then decline
to low levels after the ecdysis with some fluctuations, then increase again before pupation (Kinjoh et al., 2007; Fig. 1A). JHAMT expression also occurs shortly before the last larval ecdysis, but shuts down after the ecdysis and becomes undetectable by day 3 5th instar stadium (Shinoda and Itoyama, 2003; Kinjoh et al., 2007; Fig. 1A). Therefore, the in situ hybridization experiments were performed using CC–CA complexes from day 9 5th instar larvae, 1 day before pupal ecdysis. The spatial expressions were essentially the same as those observed in day 2 4th; only CA cells expressed the mevalonate enzymes without any irregular and patchy expressions (Fig. 2B). As we expected from the result of the quantitative PCR (Kinjoh et al., 2007), JHAMT mRNA was not detected in the cells of either
802
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
the CC or CA in this stage (Fig. 2B). In addition, we detected only a weak signal for HMGR and none for MevPK as in the 4th instar stadium for likely the same causes. 3.2.3. Adult stadium Although the mRNA expression of the HMGS type mevalonate genes in the CC–CA complex is high and fluctuating during the pupal stage, the JHAMT gene continues to shut down and the MevK type genes express at quite low levels. Yet all the enzyme mRNAs appear shortly before adult ecdysis except JHAMT in male CC–CA complexes (Kinjoh et al., 2007; Fig. 1A). The location of the pharate and adult CA in B. mori was different from that of the other stages in that it attached to the foregut. The shape of the CA was globular, but that of the CC became flattened to attach to the foregut (Fig. 2C). As in the CA of 4th and 5th instar larvae, all the mevalonate enzymes expressed in the cells of the CA, but not in the CC. In the case of JHAMT, the expression was observed only in female CA as expected from analysis of total RNA of the CC–CA of males and females (Kinjoh et al., 2007; Fig. 1A). All the enzymes expressed evenly in the CA as found in the other stages that we studied (Fig. 2A–C). 4. Discussion 4.1. CA volume and JH synthetic activity The CA of B. mori are attached to the brain by a nerve through the CC as seen in many lepidopteran species (Raabe, 1982). There is only one type of glandular cell in the CA, but there are distinguished by four histological types (Cazal, 1948 as cited in Cassier, 1979 and Tobe and Stay, 1985). The B. mori CA were categorized as a ‘‘large-cell type’’ with large lobed nuclei (Fig. 1B) throughout the development, which are characteristic of Lepidoptera. The JH biosynthetic activity was high during the 4th instar larvae, and then declined after the ecdysis to the last (5th) instar stadium. This activity was correlated roughly with the expression of both the mevalonate enzymes and JHAMT during the 4th instar, and was correlated well with down-regulation of JHAMT expression in the 5th instar stadium (Kinjoh et al., 2007; Fig. 1A). During this period, the average size of the CA and nuclei increased from 126 to 156 mm and from 16 to 20 mm, respectively (Table 2). In addition, the size of developing pupal CA dramatically increased (385 mm), but they were unable to synthesize JH due to the inactivation of the JHAMT gene. Therefore, the volumes of the CA and the nuclei, and the JH biosynthetic activity of the CA are not related in larval and pupal stages in B. mori as reported in another lepidopteran species, M. sexta (Granger et al., 1979). Rather the volumes of the CA and of the nuclei are associated with developmental somatic growth in B. mori. The ultrastructure of CA seems to be more closely related to the JH synthetic activity (see reviews, Sedlak, 1985; Tobe and Stay, 1985). It is generally agreed that the CA actively secreting JH have characteristic smooth endoplasmic reticulum in both Blattodea (ex. Diploptera punctata) and Lepidoptera which includes M. sexta. Since the CA are the neurohemal organs for PTTH (Agui et al., 1980), some of the changes in volume and size of the CA may be due to fluctuations in PTTH. Sexual dimorphism of CA volume is common (Cassier, 1979). Although sexual dimorphism in size and CA activity was not found in the larval and pupal stages of B. mori, the different size of CA and their nuclei and JH synthetic activity became apparent in the pharate adult (Fig. 1; Table 2). Only female CA, which are significantly larger than those of the male, were able to synthesize JH, which was primarily due to the lack of JHAMT expression in the male, as all the mevalonate enzyme mRNAs occurred in both male
and female (Kinjoh et al., 2007; Fig. 2C). It is unknown whether the male CA synthesize JH acid as found in H. cecropia (Dahm et al., 1981). In addition, the role of JH in female adult B. mori is unknown, whereas JH is required for egg maturation in adult female M. sexta (Nijhout and Riddiford, 1974). Allatectomized female B. mori moths mated with allatectomized male moths laid normal fertilized eggs (personal observation). It is of interest to note that male CA were much heavier than female CA in saturniid moth such as Hyalophora cecropia and Philosamia cynthia (Gilbert and Schneiderman, 1961), and the H. cecropia male CA synthesized a 100-fold greater quantity of JH acid in vitro (Dahm et al., 1981). It is unknown whether or not B. mori is an unusual insect in terms of the sexual dimorphism in the JH production in the adult stage, but there is a possibility that B. mori is an exception in lepidopterans probably due to the hundreds of years of domestication resulting in a non-flying adult. 4.2. Expression of JH biosynthetic enzymes in the CA Biosynthesis of JH is considered to be under the control of the expression of the JH biosynthetic enzymes in the CA (Kinjoh et al., 2007). In B. mori, there are three types of expression patterns of the JH biosynthetic enzymes in the CC–CA complexes from 5th to pupal stages: HMGS, MevK, and JHAMT types (Fig. 1A). In the 4th instar larvae, the mRNA expressions of all three types are very similar, which show two peaks that correspond well with the JH biosynthesis by the CA. The expression of mRNAs for both HMGS and MevK type enzymes declines to very low levels by the mid 5th instar with an increase shortly before pupation, whereas JHAMT expression shuts down completely by 3 days after the last larval ecdysis. JHAMT expression continues to be shut down during pupal stage, but only female CC–CA complexes synthesize its mRNA at the time of adult ecdysis causing JH synthesis only in female CA (Kinjoh et al., 2007). Expression of the mRNAs for the MHGS type enzymes continues during pupal stage, whereas the mRNAs for the MevK type enzymes are seen at very low levels. The mRNA expression of both types occurs shortly before the adult ecdysis. Although the mRNA expressions of all three types of enzymes in the CC–CA complex are closely associated with JH synthesis during the 4th instar stadium, JH synthesis is largely dependent upon the JHAMT expression in other stages (Kinjoh et al., 2007; Fig. 1A). The increase in both JH and JH acid titers during the prepupal stage in B. mori (Niimi and Sakurai, 1997; Fig. 1A) seems to be due to the conversion of JH acid to JH by JHAMT in peripheral tissues, such as ovaries and testes, where low but significant levels of JHAMT expression were observed (Shinoda and Itoyama, 2003). All of the above results were based on the total RNA of the CC– CA complexes because of the very small size of the complexes, so there was a possibility that they had not shown accurate developmental expressions within the CA where JH biosynthesis occurred. The results reported in this paper clearly showed that the mRNA fluctuation of the JH synthetic enzymes in the CC–CA complex (Kinjoh et al., 2007) reflected that in the CA, as the CC did not express the mRNAs of these enzymes. In addition, the mRNA expression of all the enzymes we studied occurred evenly in the CA, suggesting that JH is synthesized in all areas of CA. We cannot rule out that the enzymes are utilized in particular areas within the CA. Many factors control JH synthesis by CA, and the regulation by peptide hormones has been extensively studied, but the mode of action is poorly understood (Hoffmann et al., 1999; Elekonich and Horodyski, 2003; Stay and Tobe, 2007; Audsley et al., 2008). In D. punctata, the suppressive action of allatostatin (AST) was rescued by the addition of exogenous farnesoate or mevalonate in vitro (Pratt et al., 1989, 1991); therefore, this
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
result suggests that this peptide acts before the synthesis of isoprenoid and homoisoprenoid units. In addition, AST4 of D. punctata inhibits JHAMT and epoxidase activities in the CA and therefore acts at least partially on JH biosynthetic enzymes (Wang et al., 1994). Sutherland and Feyereisen (1996) later showed that AST acts at the first committed step such as the transfer of 2C units from mitochondria to cytoplasm rather than the inhibition of JH biosynthetic enzymes such as HMGS and HMGR. sNPF is a newly found peptide and in the 4th instar larvae in B. mori, it is synthesized by the CC and acts on the CA to suppress JH production through its G protein-coupled receptor (Yamanaka et al., 2008), but how this peptide prevents JH synthesis is unknown. Further studies are necessary to determine whether or not the inhibitory action of sNPF is on expression of JH synthetic enzymes. 20E is also a primary factor regulating JH synthesis (Gu et al., 1995; Goodman and Granger, 2005), and an apparent action of 20E is to regulate JH biosynthetic enzyme expression in the CA to control JH synthesis (Kaneko, Kinjoh, Kiuchi, and Hiruma, in preparation). Further detailed studies of the humoral control (peptides, 20E) of the JH synthetic enzymes and of the neural control of the CA by the brain–CC complex are necessary to elucidate the complex regulation of JH biosynthesis in the CA. Acknowledgements We thank Dr. Lynn M. Riddiford for her critical reading of the manuscript. We also thank Dr. T. Namiki for the in situ hybridization protocol. This work was supported by the Program for Promotion of Basic Research Activities for Innovative Biosciences (PROBRAIN). References Agui, N., Bollenbacher, W.E., Granger, N.A., Gilbert, L.I., 1980. Corpus allatum is release site for insect prothoracicotropic hormone. Nature 285, 669–670. Audsley, N., Matthews, H.J., Price, N.R., Weaver, R.J., 2008. Allatoregulatory peptides in Lepidoptera, structures, distribution and functions. Journal of Insect Physiology 54, 969–980. Belle´s, X., Martı´n, D., Piulachs, M.D., 2005. The mevalonate pathway and the synthesis of juvenile hormone in insects. Annual Review of Entomology 50, 181–199. Bhaskaran, G., Dahm, K.H., Jones, G.L., Peck, K., Faught, S., 1987. Juvenile hormone acid synthesis and HMG-CoA reductase activity in corpora allata of Manduca sexta prepupae. Insect Biochemistry 17, 933–937. Cassier, P., 1979. The corpora allata in insects. International Review of Cytology 57, 1–73. Cazal, P., 1948. Les glandes endocrines retro-cerebrales des insectes. Bulletin Biologique de la France et de la Belgique, Suppl. 32, 1–227. Couillaud, F., Feyereisen, R., 1991. Assay of HMG-CoA synthase in Diploptera punctata corpora allata. Insect Biochemistry 21, 131–135. Cymborowski, B., Bogus, M., Beckage, N.E., Williams, C.M., Riddiford, L.M., 1982. Juvenile hormone titers and metabolism during starvation-induced supernumerary larval moulting of the tobacco hornworm, Manduca sexta L. Journal of Insect Physiology 28, 129–135. Dahm, K.E., Bhaskaran, G., Peter, M.G., Shirk, P.D., Seshan, K.R., Ro¨ller, H., 1981. The juvenile hormones of Cecropia. In: Sehnal, F., Zabza, A., Menn, J.J., Cymborowski, B. (Eds.), Regulation of Insect Development and Behaviour, Part 1. Wroclaw Technical University Press, Wroclaw, Poland, pp. 183–198. Elekonich, M.M., Horodyski, F.M., 2003. Insect allatotropins belong to a family of structurally-related myoactive peptides present in several invertebrate phyla. Peptides 24, 1623–1632. Feyereisen, R., 1985. Regulation of juvenile hormone titer: synthesis. In: Kerkut, G.A., Gilbert, L.I. (Eds.), Comprehensive Insect Physiology, Biochemistry and Pharmacology, vol. 7. Pergamon Press, Oxford, pp. 391–429. Feyereisen, R., Farnsworth, D.E., 1987. Characterization and regulation of HMG-CoA reductase during a cycle of juvenile hormone synthesis. Molecular and Cellular Endocrinology 53, 227–238. Gilbert, L.I., Schneiderman, H.A., 1961. The content of juvenile hormone and lipid in Lepidoptera: sexual differences and developmental changes. General and Comparative Endocrinology 1, 453–472. Goodman, W.G., Granger, N.A., 2005. The juvenile hormones. In: Gilbert, L.I., Iatrou, K., Gill, S.S. (Eds.), Comprehensive Molecular Insect Science, vol. 3. Elsevier Ltd., Oxford, pp. 319–408.
803
Granger, N.A., Bollenbacher, W.E., Vince, R., Gilbert, L.I., Baehr, J.C., Dray, F., 1979. In vitro biosynthesis of juvenile hormone by the larval corpora allata of Manduca sexta. Molecular and Cellular Endocrinology 16, 1–17. Granger, N.A., Ebersohl, R., Sparks, T.C., 2000. Pharmacological characterization of dopamine receptors in the corpus allatum of Manduca sexta larvae. Insect Biochemistry and Molecular Biology 30, 755–766. Granger, N.A., Sturgis, S.L., Ebersohl, R., Geng, C.X., Sparks, T.C., 1996. Dopaminergic control of corpora allata activity in the larval tobacco hornworm, Manduca sexta. Archives of Insect Biochemistry and Physiology 32, 449–466. Gu, S.-H., Chow, Y.-S., Yin, C.-M., 1995. Developmental regulation of juvenile hormone biosynthesis by the corpora allata of Bombyx mori. Comparative Biochemistry and Physiology 112A, 91–98. Helvig, C., Koener, J.F., Unnithan, G.C., Feyereisen, R., 2004. CYP15A1, the cytochrome P450 that catalyzes epoxidation of methyl farnesoate to juvenile hormone III in cockroach corpora allata. Proceedings of the National Academy of Sciences of the United States of America 101, 4024– 4029. Hoffmann, K.H., Meyering-Vos, M., Lorenz, M.W., 1999. Allatostatins and allatotropins: is the regulation of corpora allata activity their primary function? European Journal of Entomology 96, 255–266. Kinjoh, T., Kaneko, Y., Itoyama, K., Mita, K., Hiruma, K., Shinoda, T., 2007. Control of juvenile hormone biosynthesis in Bombyx mori: cloning of the enzymes in the mevalonate pathway and assessment of their developmental expression in the corpora allata. Insect Biochemistry and Molecular Biology 37, 808– 818. Mane´-Padro´s, D., Cruz, J., Vilaplana, L., Pascual, N., Belle´s, X., Martı´n, D., 2008. The nuclear hormone receptor BgE75 links molting and developmental progression in the direct-developing insect Blattella germanica. Developmental Biology 315, 147–160. Mayoral, J.G., Nouzova, M., Yoshiyama, M., Shinoda, T., Hernandez-Martinez, S., Dolghih, E., Turjanski, A.G., Roitberg, A.E., Priestap, H., Perez, M., Mackenzie, L., Li, Y., Noriega, F.G., 2009. Molecular and functional characterization of a juvenile hormone acid methyltransferase expressed in the corpora allata of mosquitoes. Insect Biochemistry and Molecular Biology 39, 31–37. Minakuchi, C., Namiki, T., Yoshiyama, M., Shinoda, T., 2008. RNAi-mediated knockdown of juvenile hormone acid O-methyltransferase gene causes precocious metamorphosis in the red flour beetle Tribolium castaneum. FEBS Journal 275, 2919–2931. Niimi, S., Sakurai, S., 1997. Development changes in juvenile hormone and juvenile hormone acid titers in the hemolymph and in vitro juvenile hormone synthesis by corpora allata of the silkworm, Bombyx mori. Journal of Insect Physiology 43, 875–884. Nijhout, M.M., Riddiford, L.M., 1974. The control of egg maturation by juvenile hormone in the tobacco hornworm moth, Manduca sexta. Biological Bulletin 146, 377–392. Niwa, R., Matsuda, T., Yoshiyama, T., Namiki, T., Mita, K., Fujimoto, Y., Kataoka, H., 2004. CYP306A1, a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis in the prothoracic glands of Bombyx and Drosophila. Journal of Biological Chemistry 279, 35942–35949. Niwa, R., Niimi, T., Honda, N., Yoshiyama, M., Itoyama, K., Kataoka, H., Shinoda, T., 2008. Juvenile hormone acid O-methyltransferase in Drosophila melanogaster. Insect Biochemistry and Molecular Biology 38, 714–720. Noriega, F.G., 2004. Nutritional regulation of JH synthesis: a mechanism to control reproductive maturation in mosquitoes? Insect Biochemistry and Molecular Biology 34, 687–693. Pittendrigh, C.S., 1965. On the mechanism of entrainment of a circadian rhythm by light cycle. In: Aschoff, J. (Ed.), Circadian Clocks. North Holland, Amsterdam, pp. 276–291. Pratt, G.E., Farnsworth, D.E., Fok, K.F., Siegel, N.R., McCormack, A.L., Shabanowitz, J., Hunt, D.F., Feyereisen, R., 1991. Identity of a second type of allatostatin from cockroach brains: an octadecapeptide amide with a tyrosine-rich address sequence. Proceedings of the National Academy of Sciences of the United States of America 88, 2412–2416. Pratt, G.E., Farnsworth, D.E., Siegel, N.R., Fok, K.F., Feyereisen, R., 1989. Identification of an allatostatin from adult Diploptera punctata. Biochemical Biophysical Research Communications 163, 1243–1247. Raabe, M., 1982. Insect Neurohormones. Plenum Press, NY. Sedlak, B.J., 1985. Structure of endocrine glands. In: Kerkut, G.A., Gilbert, L.I. (Eds.), Comprehensive Insect Physiology Biochemistry and Pharmacology, vol. 7. Pergamon Press, Oxford, pp. 25–60. Sheng, Z., Ma, L., Cao, M.-X., Jiang, R.-J., Li, S., 2008. Juvenile hormone acid methyl transferase is a key regulatory enzyme for juvenile hormone synthesis in the Eri silkworm, Samia cynthica ricini. Archives of Insect Biochemistry and Physiology 69, 143–154. Shinoda, T., Itoyama, K., 2003. Juvenile hormone acid methyltransferase: a key regulatory enzyme for insect metamorphosis. Proceedings of the National Academy of Sciences of the United States of America 100, 11986– 11991. Stay, B., Tobe, S.S., 2007. The role of allatostatins in juvenile hormone synthesis in insects and crustaceans. Annual Review of Entomology 52, 277–299. Sutherland, T.D., Feyereisen, R., 1996. Target of cockroach allatostatin in the pathway of juvenile hormone biosynthesis. Molecular and Cellular Endocrinology 120, 115–123. Tobe, S.S., Stay, B., 1985. Structure and regulation of the corpus allatum. Advances in Insect Physiology 18, 305–432.
804
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
Wang, Z., Ding, Q., Yagi, K.J., Tobe, S.S., 1994. Terminal stages in juvenile hormone biosynthesis in corpora allata of Diploptera punctata: developmental changes in enzyme activity and regulation by allatostatins. Journal of Insect Physiology 40, 217–223. Whisenton, L.R., Bowen, M.F., Granger, N.A., Gilbert, L.I., Bollenbacher, W.E., 1985. Brain-mediated 20-hydroxyecdysone regulation of juvenile hormone synthesis by the corpora allata of the tobacco hornworm, Manduca sexta. General and Comparative Endocrinology 58, 311–318.
Whisenton, L.R., Watson, R.D., Granger, N.A., Bollenbacher, W.E., 1987. Regulation of juvenile hormone biosynthesis by 20-hydroxyecdysone during the fourth larval instar of the tobacco hornworm, Manduca sexta. General and Comparative Endocrinology 66, 62–70. Yamanaka, N., Yamamoto, S., Zitnan, D., Watanabe, K., Kawada, T., Sakate, H., Kaneko, Y., Hiruma, K., Tanaka, Y., Shinoda, T., Kataoka, H., 2008. Neuropeptide receptor transcriptome reveals unidentified neuroendocrine pathways. PLoS One 3 (8), e3048, doi:10.1371/journal.pone.0003048.
Contents lists available at ScienceDirect
Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys
Spatial expression of the mevalonate enzymes involved in juvenile hormone biosynthesis in the corpora allata in Bombyx mori Hiroto Ueda a, Tetsuro Shinoda b, Kiyoshi Hiruma a,c,* a
Faculty of Agriculture and Life Sciences, Hirosaki University, Hirosaki 036-8561, Japan National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8634, Japan c Graduate School of Agricultural Sciences, Iwate University, Morioka 020-8550, Japan b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 8 March 2009 Received in revised form 20 April 2009 Accepted 22 April 2009
The developmental expressions of the mRNA of JH synthetic enzymes have been studied using homogenates of the corpora cardiaca–corpora allata (CC–CA) complexes in Bombyx mori [Kinjoh, T., Kaneko, Y., Itoyama, K., Mita, K., Hiruma, K., Shinoda, T., 2007. Control of juvenile hormone biosynthesis in Bombyx mori: cloning of the enzymes in the mevalonate pathway and assessment of their developmental expression in the corpora allata. Insect Biochemistry and Molecular Biology 37, 808– 818]. The in situ hybridization analyses in the CC–CA complex showed that the distribution of the mRNAs of all the mevalonate enzymes and juvenile hormone (JH) acid O-methyltransferase occurred only in the CA cells, indicating that the fluctuations of the enzyme mRNA amounts in the CC–CA complexes were derived solely from the CA. In addition, the size of the CA and their nuclei was not associated with the JH synthetic activity by the CA until the pharate adult. Only female adult CA synthesized JH in B. mori, and the CA and the nuclei were significantly larger than those of male CA which do not synthesize JH. ß 2009 Elsevier Ltd. All rights reserved.
Keywords: Juvenile hormone Bombyx mori Mevalonate pathway Corpora allata In situ hybridization Enzyme
1. Introduction Insect corpora allata (CA), which are derived from ectoderm (Cassier, 1979), are the site of juvenile hormone (JH) biosynthesis as well as neurohemal organs for neurosecretions such as prothoracicotropic hormone (PTTH) from the brain neurosecretory cells in the Lepidoptera (Agui et al., 1980). The CA synthesize and secrete JH, but do not store JH as intraglandular JH was not detected in Manduca sexta and other species (Granger et al., 1979; see review, Feyereisen, 1985); therefore, the rate and timing of secretion of JH are determined by the rate of the synthesis. JH is a sesquiterpenoid hormone that modulates 20-hydroxyecdysone action during insect development, and the coordinated regulation of JH biosynthesis is one of the major factors in determining the JH titer in the hemolymph that is crucial for normal development. The activity of the CA is under the control of many factors: neuropeptide hormones such as allatropin, allatostatin (Goodman and Granger, 2005; Stay and Tobe, 2007; Audsley et al., 2008) and short neuropeptide F (sNPF) (Yamanaka et al., 2008), catecholamines (Granger et al., 1996, 2000), 20-hydroxyecdysone (20E) (Whisenton et al., 1985, 1987; Gu et al., 1995) and nutrition
* Corresponding author at: Faculty of Agriculture and Life Sciences, Hirosaki University, Bunkyo-machi 3, Hirosaki 036-8561, Japan. Tel.: +81 172 39 3819. E-mail address: [email protected] (K. Hiruma). 0022-1910/$ – see front matter ß 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jinsphys.2009.04.013
(Cymborowski et al., 1982; Noriega, 2004) as well as by nervous connections (Feyereisen, 1985; Tobe and Stay, 1985). JH biosynthesis is also controlled by the expression of JH biosynthetic enzymes (Shinoda and Itoyama, 2003; Kinjoh et al., 2007; Minakuchi et al., 2008), and some of the factors, such as 20E, regulate JH synthesis through the regulation of the expression of these enzymes in the CA (Kaneko, Kinjoh, Kiuchi, and Hiruma, unpublished). Studies on the JH biosynthetic enzymes in the CA are limited. Among the enzymes necessary to synthesize compounds up to farnesyl diphosphate (FPP) (the mevalonate enzymes), only HMGCoA reductase and HMG-CoA synthase are well characterized, but most of the studies utilized non-CA tissues which are not involved in JH biosynthesis (see review, Belle´s et al., 2005) with a few exceptions (Bhaskaran et al., 1987; Feyereisen and Farnsworth, 1987; Couillaud and Feyereisen, 1991; Mane´-Padro´s et al., 2008). Recently, genes for two enzymes have been isolated which are involved in the conversion of FPP to JH: JH acid O-methyltransferase (JHAMT) (Shinoda and Itoyama, 2003; Niwa et al., 2008; Minakuchi et al., 2008; Sheng et al., 2008; Mayoral et al., 2009) and epoxidase (CYP15A1) (Helvig et al., 2004). Although it is important to identify the exact cellular site of the JH biosynthetic enzymes, there are no detailed systematic studies in a single species regarding the localization of these enzymes, in particular, mevalonate enzymes in cephalic organs. In Bombyx mori, all genes encoding enzymes involved in the mevalonate pathway (Kinjoh et al., 2007) and a gene for JHAMT
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
(Shinoda and Itoyama, 2003) have been isolated, and the highest levels of transcripts of these enzymes were found in the CC–CA complex except for FPPS1, which was expressed most highly in the Malpighian tubules although also in the CC–CA complex. The mRNAs of each mevalonate enzyme and JHAMT in the CC–CA complex correlated well with the JH synthesis by the CA (Kinjoh et al., 2007). Indeed the knockout of HMG-CoA reductase with an inhibitor, statin, a specific inhibitor of HMG-CoA reductase, completely prevented the RNA expression of the enzyme and consequently JH synthesis by the CA (Kaneko, Kinjoh, and Hiruma, unpublished). Yet it was not clear whether or not these JH biosynthetic enzymes were synthesized solely by the CA. Due to the minute size of the CC–CA, it is not practical to identify the exact site of enzyme synthesis using extracted RNA. Here we show by in situ hybridization analyses in B. mori that the CA are the site of the JH biosynthetic enzymes and not the CC. 2. Materials and methods 2.1. Insects Larvae of the silkworm, B. mori (Kinshu Showa, F1), were reared on an artificial diet (Silkmate, Nippon Nousan Kogyo, Japan) at 25 8C under a 12L:12D photoperiod. Light-on was designated as 00:00 Arbitrary Zeitgeber Time (AZT) (Pittendrigh, 1965). 2.2. DAPI staining CC–CA complexes were dissected in phosphate buffered saline (PBS: 137 mM NaCl, 8.10 mM Na2HPO4, 1.47 mM KH2PO4, 2.68 mM KCl), and fixed with 4% formaldehyde in PBS for 30 min at room temperature followed by washing in PBS. DAPI (40 ,6-diamidino-2-phenylindole dihydrochloride) (Sigma) staining in PBS was then performed at room temperature for 30 min followed by washing in PBS and then the CC–CA complexes were mounted in 70% glycerol.
799
Table 1 The oligonucleotide primers used for in situ hybridizations. Primers
Sequences (50 –30 )
AACT/forward AACT/reverse HMGS/forward HMGS/reverse HMGR/forward HMGR/reverse MevK/forward MevK/reverse MevPK/forward MevPK/reverse MevPPD/forward MevPPD/reverse IPPI/forward IPPI/reverse FPPS1/forward FPPS1/reverse FPPS2/forward FPPS2/reverse FPPS3/forward FPPS3/reverse JHAMT/forward JHAMT/reverse
ATGGGTTCTTTCCGAGGGAG TTACATTTTTTCAATCATTACAGATGATG ATGGGCGGAAAAGTTGAGAATG TTAATGTTTCCTATCATAAGTACGCCTTC ATGGGAAGTCATCGTAGCCA TTCCCCCACCTACTGTGCC GGAACTGAAGACAATCCACGCGTTCACCCA CACAGGTCCGTGCGCTATGAGACCCGT ATGTCTCCAAAAATTATCTTGTTATTCAGT TCATAAATTAGACACTAATTTTAATATGCTATCCAA TAACTTATTTTCGCCTAATTCGAACAGCCATTCCT TCCATCTGCTACACATCAGCACCCCTTGTTT ATGTTCCTTCAGAGGAGATCAAGC TTATTTTTTATCAACAAATTTTTGTATTTTCTCC ATG TTC TCG ACA AAG AAA AGC TTA G TTA CAC GCT TCG CCT GAA GAT ATGAGTGTATTTAATTGTCTCAAATTTACCC TTAATGTTGCCTATTGTACGTAATATCCA ATGAACACCACATCGATGTTTCTA TTAATAACTTCTCTTGAATATCATATCGA ATGAACAATGCAGATTTATACCGCA TTACATTAAACTTAAACATAATTTTCTCGCGTA
nate decarboxylase; IPPI, isopentenyl diphosphate isomerase; FPPS1, farnesyl diphosphate synthase 1; FPPS2, farnesyl diphosphate synthase 2; FPPS3, farnesyl diphosphate synthase 3; JHAMT, JH acid O-methyltransferase. 3. Results In the CC–CA complex of B. mori, the amounts of mRNA expression of the mevalonate enzymes and JHAMT fluctuate during development (Kinjoh et al., 2007; Fig. 1A), and their expression patterns fall into three different types: HMGS type that includes AACT, HMGS, HMGR, FPPS1 and FPPS3; MevK type that includes MevK, MevPK, MevPPD, IPPI and FPPS2; JHAMT type (Fig. 1A).
2.3. Preparation of probes and in situ hybridization 3.1. Changes in size of CA and nuclei of CA cells during development The coding regions of cDNA of the mevalonate enzymes (except MevK and MevPPD which contain 50 non-coding regions) and JHAMT were obtained using the primers in Table 1 and the cDNA of each enzyme as templates (Kinjoh et al., 2007). Amplification using Ex Taq (Takara) was performed by denaturing at 98 8C for 10 s (94 8C for 30 s, only for the first cycle), annealing at 55 8C (except for FPPS1 in day 2 4th and day 0 adult at 38 8C) for 30 s, followed by extension at 72 8C for 90 s, for 35 cycles. The PCR products were ligated to the pBluescript SK Vector. Digoxigenin-labelled sense and antisense cRNA were prepared by DIG RNA Labelling Kit (Roche). The CC–CA complexes were dissected in PBS and fixed in 4% paraformaldehyde in PBS at 4 8C for 20 min followed by washing in PBST (0.5% Triton X-100 in PBS). The tissues were transferred to PTW (0.1% Tween 20 in PBS), and then they were treated with 5 mg/ ml Protein Kinase K (Nacalai) for 75 s at room temperature before re-fixation in the solution containing 0.2% glutaraldehyde, 0.1% Tween 20 and 4% paraformaldehyde for 20 min at room temperature. Hybridization (50 8C for overnight) and detection were based on the method by Niwa et al. (2004) with alkaline phosphate-conjugated anti-DIG FAB fragments (Roche). After the hybridization and detection, the tissues were mounted in 70% glycerol for microscopic observation. Studied enzymes in this paper and their abbreviations are as follows: AACT, acetoacetyl-CoA thiolase; HMGS, HMG-CoA synthase; HMGR, HMG-CoA reductase; MevK, mevalonate kinase; MevPK, phosphomevalonate kinase; MevPPD, diphosphomevalo-
The volume of B. mori CA, which were determined by the diameter, increased with development. The average diameter of day 2 4th instar larvae was about 126 mm and the relative JH production by the CA was 190 in a comparison with the JH production in day 0 5th instar as 100 (Fig. 1A and Table 2; Kinjoh et al., 2007). The diameters slightly increased during the final (5th) instar larvae (156 mm in day 4 5th), but these CA did not synthesize Table 2 The size of corpora allata (CA) and their nuclei during development. Stage (A) CA Day 2 Day 4 Day 4 Day 0 Day 0
4th instar 5th instar pupa adult (male) adult (female)
No. of CA
Diameter (mm) (mean S.D.)
15 18 15 38 46
126.4 16.2 155.6 20.0 385.2 67.6 377.5 54.2a 415.9 54.8a
Stage
No. of nuclei
Diameter (mm) (mean S.D.)
(B) Nuclei Day 2 4th instar Day 4 5th instar Day 4 pupa Day 0 adult (male) Day 0 adult (female)
21 38 36 52 53
15.7 2.7 19.9 4.8 53.3 12.8 40.5 10.9b 57.3 14.4b
a b
Significantly different at P = 0.0019. Significantly different at P = 0.0077.
800
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
Fig. 1. (A) Fluctuations of JH titer and JH synthetic activity by CA and the mRNA expression of three types of JH synthetic enzymes in the CC–CA complex in B. mori. The Y-axis shows the relative abundance of mRNA where the maximum mRNA levels during the 4th larval stadium were arbitrarily set at 100. Separate analyses were conducted for each sex during the pupal and adult stages: gray shading, males; solid black, females. The data are from Kinjoh et al. (2007). HCS, head capsule slippage; SP, spinneret pigmentation. (B) Changes in shape and size of the CA of B. mori as a function of developmental stage. The CA were stained with DAPI to visualize the nuclei. Typical results were presented (N = 10–20). IV2, day 2 4th; V4 and V9, day 4 and day 9 5th; P4, day 4 pupa; A0, day 0 adult. Scale bar = 200 mm.
JH. During the adult development, the CA did not synthesize JH (Table 2A; Kinjoh et al., 2007), but the CA diameter continued to increase and reached maximal size by 4 days after pupation (385 mm). The increase in size of the nuclei visualized with DAPI staining of these glands paralleled the CA volumes (Table 2B). The size of day 0 adult male CA and their nuclei was significantly smaller than that of day 0 female CA and nuclei (378 mm versus 416 mm and 41 mm versus 57 mm, respectively) (Table 2 and Fig. 1B), in which only female CA synthesize JH at least for 4 days after adult ecdysis (Kinjoh et al., 2007; Fig. 1A). The sexual dimorphism was not found until the pharate adult stage.
3.2. Spatial expression of mevalonate enzymes and JHAMT in CC–CA complex 3.2.1. 4th instar stadium Since the mRNA expression of all the mevalonate enzymes and JHAMT in the CC–CA complex is high in day 2 and 1 4th instar larvae respectively (Kinjoh et al., 2007; Fig. 1A), we examined the spatial expression patterns of these enzyme RNAs in the CC–CA complex in these two stages: the mevalonate enzymes in day 2 4th and JHAMT in day 1 4th instar stadium. The in situ hybridization results showed that the enzyme mRNAs were detected only in the
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
801
Fig. 2. In situ analysis of JH biosynthetic enzyme mRNA expression in CC–CA complex. Only female glands are presented except for JHAMT, for which both male and female adult glands are shown. The analyses were performed on 10–20 different samples using different individuals, and typical results are presented. Sexual dimorphism was not observed until the pharate adult stage. The insets show the negative controls hybridized with sense RNA probes. (A) Day 2 4th instar stadium. Scale bar = 100 mm. (B) Day 9 5th stadium. Scale bar = 200 mm. (C) Day 0 adult. Scale bar = 200 mm.
CA cells but not in the CC cells, and all occurred evenly over the CA (Fig. 2A). MevPK signal was not detected in either the CA or the CC cells under our conditions described in Section 2, nor when the hybridization temperature was reduced to 38 8C (data not shown). One of the reasons is due to somehow poor penetration of the probe to the tissues. In addition, the low levels of hybridization of HMGR, MevPPD and FPPS3 were expected, as these enzymes were expressed in small amounts in the CC–CA complex (Kinjoh et al., 2007). 3.2.2. 5th instar stadium The mRNA levels of all the mevalonate enzymes begin to increase shortly before the last larval ecdysis, and then decline
to low levels after the ecdysis with some fluctuations, then increase again before pupation (Kinjoh et al., 2007; Fig. 1A). JHAMT expression also occurs shortly before the last larval ecdysis, but shuts down after the ecdysis and becomes undetectable by day 3 5th instar stadium (Shinoda and Itoyama, 2003; Kinjoh et al., 2007; Fig. 1A). Therefore, the in situ hybridization experiments were performed using CC–CA complexes from day 9 5th instar larvae, 1 day before pupal ecdysis. The spatial expressions were essentially the same as those observed in day 2 4th; only CA cells expressed the mevalonate enzymes without any irregular and patchy expressions (Fig. 2B). As we expected from the result of the quantitative PCR (Kinjoh et al., 2007), JHAMT mRNA was not detected in the cells of either
802
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
the CC or CA in this stage (Fig. 2B). In addition, we detected only a weak signal for HMGR and none for MevPK as in the 4th instar stadium for likely the same causes. 3.2.3. Adult stadium Although the mRNA expression of the HMGS type mevalonate genes in the CC–CA complex is high and fluctuating during the pupal stage, the JHAMT gene continues to shut down and the MevK type genes express at quite low levels. Yet all the enzyme mRNAs appear shortly before adult ecdysis except JHAMT in male CC–CA complexes (Kinjoh et al., 2007; Fig. 1A). The location of the pharate and adult CA in B. mori was different from that of the other stages in that it attached to the foregut. The shape of the CA was globular, but that of the CC became flattened to attach to the foregut (Fig. 2C). As in the CA of 4th and 5th instar larvae, all the mevalonate enzymes expressed in the cells of the CA, but not in the CC. In the case of JHAMT, the expression was observed only in female CA as expected from analysis of total RNA of the CC–CA of males and females (Kinjoh et al., 2007; Fig. 1A). All the enzymes expressed evenly in the CA as found in the other stages that we studied (Fig. 2A–C). 4. Discussion 4.1. CA volume and JH synthetic activity The CA of B. mori are attached to the brain by a nerve through the CC as seen in many lepidopteran species (Raabe, 1982). There is only one type of glandular cell in the CA, but there are distinguished by four histological types (Cazal, 1948 as cited in Cassier, 1979 and Tobe and Stay, 1985). The B. mori CA were categorized as a ‘‘large-cell type’’ with large lobed nuclei (Fig. 1B) throughout the development, which are characteristic of Lepidoptera. The JH biosynthetic activity was high during the 4th instar larvae, and then declined after the ecdysis to the last (5th) instar stadium. This activity was correlated roughly with the expression of both the mevalonate enzymes and JHAMT during the 4th instar, and was correlated well with down-regulation of JHAMT expression in the 5th instar stadium (Kinjoh et al., 2007; Fig. 1A). During this period, the average size of the CA and nuclei increased from 126 to 156 mm and from 16 to 20 mm, respectively (Table 2). In addition, the size of developing pupal CA dramatically increased (385 mm), but they were unable to synthesize JH due to the inactivation of the JHAMT gene. Therefore, the volumes of the CA and the nuclei, and the JH biosynthetic activity of the CA are not related in larval and pupal stages in B. mori as reported in another lepidopteran species, M. sexta (Granger et al., 1979). Rather the volumes of the CA and of the nuclei are associated with developmental somatic growth in B. mori. The ultrastructure of CA seems to be more closely related to the JH synthetic activity (see reviews, Sedlak, 1985; Tobe and Stay, 1985). It is generally agreed that the CA actively secreting JH have characteristic smooth endoplasmic reticulum in both Blattodea (ex. Diploptera punctata) and Lepidoptera which includes M. sexta. Since the CA are the neurohemal organs for PTTH (Agui et al., 1980), some of the changes in volume and size of the CA may be due to fluctuations in PTTH. Sexual dimorphism of CA volume is common (Cassier, 1979). Although sexual dimorphism in size and CA activity was not found in the larval and pupal stages of B. mori, the different size of CA and their nuclei and JH synthetic activity became apparent in the pharate adult (Fig. 1; Table 2). Only female CA, which are significantly larger than those of the male, were able to synthesize JH, which was primarily due to the lack of JHAMT expression in the male, as all the mevalonate enzyme mRNAs occurred in both male
and female (Kinjoh et al., 2007; Fig. 2C). It is unknown whether the male CA synthesize JH acid as found in H. cecropia (Dahm et al., 1981). In addition, the role of JH in female adult B. mori is unknown, whereas JH is required for egg maturation in adult female M. sexta (Nijhout and Riddiford, 1974). Allatectomized female B. mori moths mated with allatectomized male moths laid normal fertilized eggs (personal observation). It is of interest to note that male CA were much heavier than female CA in saturniid moth such as Hyalophora cecropia and Philosamia cynthia (Gilbert and Schneiderman, 1961), and the H. cecropia male CA synthesized a 100-fold greater quantity of JH acid in vitro (Dahm et al., 1981). It is unknown whether or not B. mori is an unusual insect in terms of the sexual dimorphism in the JH production in the adult stage, but there is a possibility that B. mori is an exception in lepidopterans probably due to the hundreds of years of domestication resulting in a non-flying adult. 4.2. Expression of JH biosynthetic enzymes in the CA Biosynthesis of JH is considered to be under the control of the expression of the JH biosynthetic enzymes in the CA (Kinjoh et al., 2007). In B. mori, there are three types of expression patterns of the JH biosynthetic enzymes in the CC–CA complexes from 5th to pupal stages: HMGS, MevK, and JHAMT types (Fig. 1A). In the 4th instar larvae, the mRNA expressions of all three types are very similar, which show two peaks that correspond well with the JH biosynthesis by the CA. The expression of mRNAs for both HMGS and MevK type enzymes declines to very low levels by the mid 5th instar with an increase shortly before pupation, whereas JHAMT expression shuts down completely by 3 days after the last larval ecdysis. JHAMT expression continues to be shut down during pupal stage, but only female CC–CA complexes synthesize its mRNA at the time of adult ecdysis causing JH synthesis only in female CA (Kinjoh et al., 2007). Expression of the mRNAs for the MHGS type enzymes continues during pupal stage, whereas the mRNAs for the MevK type enzymes are seen at very low levels. The mRNA expression of both types occurs shortly before the adult ecdysis. Although the mRNA expressions of all three types of enzymes in the CC–CA complex are closely associated with JH synthesis during the 4th instar stadium, JH synthesis is largely dependent upon the JHAMT expression in other stages (Kinjoh et al., 2007; Fig. 1A). The increase in both JH and JH acid titers during the prepupal stage in B. mori (Niimi and Sakurai, 1997; Fig. 1A) seems to be due to the conversion of JH acid to JH by JHAMT in peripheral tissues, such as ovaries and testes, where low but significant levels of JHAMT expression were observed (Shinoda and Itoyama, 2003). All of the above results were based on the total RNA of the CC– CA complexes because of the very small size of the complexes, so there was a possibility that they had not shown accurate developmental expressions within the CA where JH biosynthesis occurred. The results reported in this paper clearly showed that the mRNA fluctuation of the JH synthetic enzymes in the CC–CA complex (Kinjoh et al., 2007) reflected that in the CA, as the CC did not express the mRNAs of these enzymes. In addition, the mRNA expression of all the enzymes we studied occurred evenly in the CA, suggesting that JH is synthesized in all areas of CA. We cannot rule out that the enzymes are utilized in particular areas within the CA. Many factors control JH synthesis by CA, and the regulation by peptide hormones has been extensively studied, but the mode of action is poorly understood (Hoffmann et al., 1999; Elekonich and Horodyski, 2003; Stay and Tobe, 2007; Audsley et al., 2008). In D. punctata, the suppressive action of allatostatin (AST) was rescued by the addition of exogenous farnesoate or mevalonate in vitro (Pratt et al., 1989, 1991); therefore, this
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
result suggests that this peptide acts before the synthesis of isoprenoid and homoisoprenoid units. In addition, AST4 of D. punctata inhibits JHAMT and epoxidase activities in the CA and therefore acts at least partially on JH biosynthetic enzymes (Wang et al., 1994). Sutherland and Feyereisen (1996) later showed that AST acts at the first committed step such as the transfer of 2C units from mitochondria to cytoplasm rather than the inhibition of JH biosynthetic enzymes such as HMGS and HMGR. sNPF is a newly found peptide and in the 4th instar larvae in B. mori, it is synthesized by the CC and acts on the CA to suppress JH production through its G protein-coupled receptor (Yamanaka et al., 2008), but how this peptide prevents JH synthesis is unknown. Further studies are necessary to determine whether or not the inhibitory action of sNPF is on expression of JH synthetic enzymes. 20E is also a primary factor regulating JH synthesis (Gu et al., 1995; Goodman and Granger, 2005), and an apparent action of 20E is to regulate JH biosynthetic enzyme expression in the CA to control JH synthesis (Kaneko, Kinjoh, Kiuchi, and Hiruma, in preparation). Further detailed studies of the humoral control (peptides, 20E) of the JH synthetic enzymes and of the neural control of the CA by the brain–CC complex are necessary to elucidate the complex regulation of JH biosynthesis in the CA. Acknowledgements We thank Dr. Lynn M. Riddiford for her critical reading of the manuscript. We also thank Dr. T. Namiki for the in situ hybridization protocol. This work was supported by the Program for Promotion of Basic Research Activities for Innovative Biosciences (PROBRAIN). References Agui, N., Bollenbacher, W.E., Granger, N.A., Gilbert, L.I., 1980. Corpus allatum is release site for insect prothoracicotropic hormone. Nature 285, 669–670. Audsley, N., Matthews, H.J., Price, N.R., Weaver, R.J., 2008. Allatoregulatory peptides in Lepidoptera, structures, distribution and functions. Journal of Insect Physiology 54, 969–980. Belle´s, X., Martı´n, D., Piulachs, M.D., 2005. The mevalonate pathway and the synthesis of juvenile hormone in insects. Annual Review of Entomology 50, 181–199. Bhaskaran, G., Dahm, K.H., Jones, G.L., Peck, K., Faught, S., 1987. Juvenile hormone acid synthesis and HMG-CoA reductase activity in corpora allata of Manduca sexta prepupae. Insect Biochemistry 17, 933–937. Cassier, P., 1979. The corpora allata in insects. International Review of Cytology 57, 1–73. Cazal, P., 1948. Les glandes endocrines retro-cerebrales des insectes. Bulletin Biologique de la France et de la Belgique, Suppl. 32, 1–227. Couillaud, F., Feyereisen, R., 1991. Assay of HMG-CoA synthase in Diploptera punctata corpora allata. Insect Biochemistry 21, 131–135. Cymborowski, B., Bogus, M., Beckage, N.E., Williams, C.M., Riddiford, L.M., 1982. Juvenile hormone titers and metabolism during starvation-induced supernumerary larval moulting of the tobacco hornworm, Manduca sexta L. Journal of Insect Physiology 28, 129–135. Dahm, K.E., Bhaskaran, G., Peter, M.G., Shirk, P.D., Seshan, K.R., Ro¨ller, H., 1981. The juvenile hormones of Cecropia. In: Sehnal, F., Zabza, A., Menn, J.J., Cymborowski, B. (Eds.), Regulation of Insect Development and Behaviour, Part 1. Wroclaw Technical University Press, Wroclaw, Poland, pp. 183–198. Elekonich, M.M., Horodyski, F.M., 2003. Insect allatotropins belong to a family of structurally-related myoactive peptides present in several invertebrate phyla. Peptides 24, 1623–1632. Feyereisen, R., 1985. Regulation of juvenile hormone titer: synthesis. In: Kerkut, G.A., Gilbert, L.I. (Eds.), Comprehensive Insect Physiology, Biochemistry and Pharmacology, vol. 7. Pergamon Press, Oxford, pp. 391–429. Feyereisen, R., Farnsworth, D.E., 1987. Characterization and regulation of HMG-CoA reductase during a cycle of juvenile hormone synthesis. Molecular and Cellular Endocrinology 53, 227–238. Gilbert, L.I., Schneiderman, H.A., 1961. The content of juvenile hormone and lipid in Lepidoptera: sexual differences and developmental changes. General and Comparative Endocrinology 1, 453–472. Goodman, W.G., Granger, N.A., 2005. The juvenile hormones. In: Gilbert, L.I., Iatrou, K., Gill, S.S. (Eds.), Comprehensive Molecular Insect Science, vol. 3. Elsevier Ltd., Oxford, pp. 319–408.
803
Granger, N.A., Bollenbacher, W.E., Vince, R., Gilbert, L.I., Baehr, J.C., Dray, F., 1979. In vitro biosynthesis of juvenile hormone by the larval corpora allata of Manduca sexta. Molecular and Cellular Endocrinology 16, 1–17. Granger, N.A., Ebersohl, R., Sparks, T.C., 2000. Pharmacological characterization of dopamine receptors in the corpus allatum of Manduca sexta larvae. Insect Biochemistry and Molecular Biology 30, 755–766. Granger, N.A., Sturgis, S.L., Ebersohl, R., Geng, C.X., Sparks, T.C., 1996. Dopaminergic control of corpora allata activity in the larval tobacco hornworm, Manduca sexta. Archives of Insect Biochemistry and Physiology 32, 449–466. Gu, S.-H., Chow, Y.-S., Yin, C.-M., 1995. Developmental regulation of juvenile hormone biosynthesis by the corpora allata of Bombyx mori. Comparative Biochemistry and Physiology 112A, 91–98. Helvig, C., Koener, J.F., Unnithan, G.C., Feyereisen, R., 2004. CYP15A1, the cytochrome P450 that catalyzes epoxidation of methyl farnesoate to juvenile hormone III in cockroach corpora allata. Proceedings of the National Academy of Sciences of the United States of America 101, 4024– 4029. Hoffmann, K.H., Meyering-Vos, M., Lorenz, M.W., 1999. Allatostatins and allatotropins: is the regulation of corpora allata activity their primary function? European Journal of Entomology 96, 255–266. Kinjoh, T., Kaneko, Y., Itoyama, K., Mita, K., Hiruma, K., Shinoda, T., 2007. Control of juvenile hormone biosynthesis in Bombyx mori: cloning of the enzymes in the mevalonate pathway and assessment of their developmental expression in the corpora allata. Insect Biochemistry and Molecular Biology 37, 808– 818. Mane´-Padro´s, D., Cruz, J., Vilaplana, L., Pascual, N., Belle´s, X., Martı´n, D., 2008. The nuclear hormone receptor BgE75 links molting and developmental progression in the direct-developing insect Blattella germanica. Developmental Biology 315, 147–160. Mayoral, J.G., Nouzova, M., Yoshiyama, M., Shinoda, T., Hernandez-Martinez, S., Dolghih, E., Turjanski, A.G., Roitberg, A.E., Priestap, H., Perez, M., Mackenzie, L., Li, Y., Noriega, F.G., 2009. Molecular and functional characterization of a juvenile hormone acid methyltransferase expressed in the corpora allata of mosquitoes. Insect Biochemistry and Molecular Biology 39, 31–37. Minakuchi, C., Namiki, T., Yoshiyama, M., Shinoda, T., 2008. RNAi-mediated knockdown of juvenile hormone acid O-methyltransferase gene causes precocious metamorphosis in the red flour beetle Tribolium castaneum. FEBS Journal 275, 2919–2931. Niimi, S., Sakurai, S., 1997. Development changes in juvenile hormone and juvenile hormone acid titers in the hemolymph and in vitro juvenile hormone synthesis by corpora allata of the silkworm, Bombyx mori. Journal of Insect Physiology 43, 875–884. Nijhout, M.M., Riddiford, L.M., 1974. The control of egg maturation by juvenile hormone in the tobacco hornworm moth, Manduca sexta. Biological Bulletin 146, 377–392. Niwa, R., Matsuda, T., Yoshiyama, T., Namiki, T., Mita, K., Fujimoto, Y., Kataoka, H., 2004. CYP306A1, a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis in the prothoracic glands of Bombyx and Drosophila. Journal of Biological Chemistry 279, 35942–35949. Niwa, R., Niimi, T., Honda, N., Yoshiyama, M., Itoyama, K., Kataoka, H., Shinoda, T., 2008. Juvenile hormone acid O-methyltransferase in Drosophila melanogaster. Insect Biochemistry and Molecular Biology 38, 714–720. Noriega, F.G., 2004. Nutritional regulation of JH synthesis: a mechanism to control reproductive maturation in mosquitoes? Insect Biochemistry and Molecular Biology 34, 687–693. Pittendrigh, C.S., 1965. On the mechanism of entrainment of a circadian rhythm by light cycle. In: Aschoff, J. (Ed.), Circadian Clocks. North Holland, Amsterdam, pp. 276–291. Pratt, G.E., Farnsworth, D.E., Fok, K.F., Siegel, N.R., McCormack, A.L., Shabanowitz, J., Hunt, D.F., Feyereisen, R., 1991. Identity of a second type of allatostatin from cockroach brains: an octadecapeptide amide with a tyrosine-rich address sequence. Proceedings of the National Academy of Sciences of the United States of America 88, 2412–2416. Pratt, G.E., Farnsworth, D.E., Siegel, N.R., Fok, K.F., Feyereisen, R., 1989. Identification of an allatostatin from adult Diploptera punctata. Biochemical Biophysical Research Communications 163, 1243–1247. Raabe, M., 1982. Insect Neurohormones. Plenum Press, NY. Sedlak, B.J., 1985. Structure of endocrine glands. In: Kerkut, G.A., Gilbert, L.I. (Eds.), Comprehensive Insect Physiology Biochemistry and Pharmacology, vol. 7. Pergamon Press, Oxford, pp. 25–60. Sheng, Z., Ma, L., Cao, M.-X., Jiang, R.-J., Li, S., 2008. Juvenile hormone acid methyl transferase is a key regulatory enzyme for juvenile hormone synthesis in the Eri silkworm, Samia cynthica ricini. Archives of Insect Biochemistry and Physiology 69, 143–154. Shinoda, T., Itoyama, K., 2003. Juvenile hormone acid methyltransferase: a key regulatory enzyme for insect metamorphosis. Proceedings of the National Academy of Sciences of the United States of America 100, 11986– 11991. Stay, B., Tobe, S.S., 2007. The role of allatostatins in juvenile hormone synthesis in insects and crustaceans. Annual Review of Entomology 52, 277–299. Sutherland, T.D., Feyereisen, R., 1996. Target of cockroach allatostatin in the pathway of juvenile hormone biosynthesis. Molecular and Cellular Endocrinology 120, 115–123. Tobe, S.S., Stay, B., 1985. Structure and regulation of the corpus allatum. Advances in Insect Physiology 18, 305–432.
804
H. Ueda et al. / Journal of Insect Physiology 55 (2009) 798–804
Wang, Z., Ding, Q., Yagi, K.J., Tobe, S.S., 1994. Terminal stages in juvenile hormone biosynthesis in corpora allata of Diploptera punctata: developmental changes in enzyme activity and regulation by allatostatins. Journal of Insect Physiology 40, 217–223. Whisenton, L.R., Bowen, M.F., Granger, N.A., Gilbert, L.I., Bollenbacher, W.E., 1985. Brain-mediated 20-hydroxyecdysone regulation of juvenile hormone synthesis by the corpora allata of the tobacco hornworm, Manduca sexta. General and Comparative Endocrinology 58, 311–318.
Whisenton, L.R., Watson, R.D., Granger, N.A., Bollenbacher, W.E., 1987. Regulation of juvenile hormone biosynthesis by 20-hydroxyecdysone during the fourth larval instar of the tobacco hornworm, Manduca sexta. General and Comparative Endocrinology 66, 62–70. Yamanaka, N., Yamamoto, S., Zitnan, D., Watanabe, K., Kawada, T., Sakate, H., Kaneko, Y., Hiruma, K., Tanaka, Y., Shinoda, T., Kataoka, H., 2008. Neuropeptide receptor transcriptome reveals unidentified neuroendocrine pathways. PLoS One 3 (8), e3048, doi:10.1371/journal.pone.0003048.