Spatial structure and anti-fatigue of polysaccharide from Inonotus obliquus

Journal Pre-proof Spatial structure and anti-fatigue of polysaccharide from Inonotus obliquus

Chun-Jing Zhang, Jian-You Guo, Hao Cheng, L.I. Lin, Ying Liu, Yan Shi, Jing Xu, Hai-Tao Yu PII:

S0141-8130(20)31061-8

DOI:

https://doi.org/10.1016/j.ijbiomac.2020.02.147

Reference:

BIOMAC 14764

To appear in:

International Journal of Biological Macromolecules

Received date:

3 February 2020

Revised date:

10 February 2020

Accepted date:

14 February 2020

Please cite this article as: C.-J. Zhang, J.-Y. Guo, H. Cheng, et al., Spatial structure and anti-fatigue of polysaccharide from Inonotus obliquus, International Journal of Biological Macromolecules(2018), https://doi.org/10.1016/j.ijbiomac.2020.02.147

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2018 Published by Elsevier.

Journal Pre-proof

Spatial structure and anti-fatigue of polysaccharide from Inonotus obliquus

lP

Abstract

re

-p

ro

of

Chun-Jing Zhang1,#, Jian-You Guo2,#, Hao Cheng3, LI Lin4, Ying Liu1, Yan Shi1, Jing Xu1, Hai-Tao Yu5* 1,Department of Biochemistry, Qiqihar Medical University Qiqihar 161006, Heilongjiang, China 2,CAS Key Laboratory of Mental Health, Institute of Psychology, Chinese Academy of Sciences 3,Third Affiliated Hospital, Qiqihar Medical University Qiqihar 161006, Heilongjiang, China 4,Department of Clinical Biochemistry, Qiqihar Medical University Qiqihar 161006, Heilongjiang, China 5, Department of Biology Genetics, Qiqihar Medical University Qiqihar 161006, Heilongjiang, China *Correspondence: Hai-Tao Yu, E-mail: [email protected]. #The two authors contributed equally

The aim of this study was to evaluate the spatial structure and potential

na

antifatigue activity of polysaccharide fractions which was extracted from

Jo ur

Inonotus obliquus. The first polysaccharide fractions of Inonotus obliquus (PIO-1) were obtained after hot-water extraction and purification by DEAE cellulose-52 chromatography. Results of the forced swimming test showed that the doses (50 mg/kg) of PIO-1 could increase the climbing duration and swimming time as well as reduced the immobility time in the PIO treated mice. The fatigue related metabolic parameters showed that PIO-1 decreased the level of blood lactic acid (BLA), urea nitrogen (BUN) and lactic dehydrogenase (LDH). Additionally, PIO-1 significantly decreased the 5-HT concentrations in the mice brain. The results of monosaccharide analysis showed that the molar ratio of mannose, glucose, galactose, xylose and arabinose with the molar ratio of 1.0 : 1.9 : 3.5 : 18.5 : 5.7 . The molecular morphology of the PIO-1 observed under atomic force microscopy (AFM). There were many spherical and heterogeneous clumps existed in the images. Therefore,

Journal Pre-proof current study indicated polysaccharide PIO-1 not only has great potential to postpone physical fatigue but also shown potential to improve mental fatigue.

Keywords: Inonotus obliquus; Polysaccharide; Physical fatigue; Mental fatigue

1. Introduction Inonotus

obliquus,

Phaeoporus

obliquus(Pers.:Fr.)J.Schroet,

is

a

of

mushroom habiting in the cold latitudes of Europe and Asia, which was used

ro

as traditional Chinese medicine for a long history. In the last decade, several studies have reported biological activities of I. obliquus such as anticancer,

-p

antioxidation, anti-inflammatory, antihyperglycemic activities and enhancement

re

of immunity [1-4]. However, the anti-fatigue activity of it is not yet understood in

lP

terms of modern pharmacological concepts.

Polysaccharides, a major class of bioactive molecules derived from

na

microorganisms, animals, or plants, have been regarded as a new sort of natural and effective anti-fatigue substance [5-6]. The polysaccharides from

Jo ur

Millettiae speciosae Champ. Leguminosae, Panax ginseng, Hericium erinaceus were proved to have anti-fatigue activity [7].Previous researches indicated

that

polysaccharides

Inonotus [8].

obliquus

However,

was

little

rich

in

information

oligosaccharides about

the

and

isolation,

characterization and anti-fatigue activity of purified polysaccharides from Inonotus obliquus is currently known. Therefore, current study aims to isolate and characterize the purified Inonotus obliquus polysaccharides (PIO), and specify the anti-fatigue composition of PIO. 2. Materials and methods 2.1. Materials and chemicals The Inonotus obliquus were purchased from a local supplier in Bozhou, China. Glucose, D-mannose, D-galactose, arabinose, xylose, standard substande, 1-phenyl -3-methyl-5 -pyrazolone (PMP) were purchased from

Journal Pre-proof Shanghai McLean biochemical technology Co., Ltd. DEAE-52 cellulose and

of

Sephadex G-100 were purchased from Jiancheng Bioengineering Institute.

ro

Fig. 1 Scheme of the extraction and fractionation of polysaccharides of PIO

2.2 Isolation and purification of PIO

-p

The scheme for the extraction and purification of PIO is illustrated in Fig. 1.

re

The ratio of solid to liquid is 1 g per 25 mL water (100°C), extraction frequency

lP

of 3 times with 1h every time. All of the the supernatant were combined and concentrated under vacuum to a certain volume, and then mixed with 95%

na

ethanol for 12 h to achieve final ethanol percentages of 80%. The precipitate was centrifuged at 3000r for 15 min, and then washed with absolute ethyl

Jo ur

alcohol. Then the precipitate was dissolved in distilled water and freezedried. The obtained PIO deproteinized by the Sevage method with sevage reagent (chloroform:butyl alcohol = 4:1) for 5 times. The supernatant was concentrated and the residuum was dissolved in water and freezedried to obtain PIO. It was dissolved in distilled water and loaded onto a DEAE cellulose-52column (2.5 cm × 50 cm) and then eluted by 0, 0.1, 0.2, 0.4, 0.6 mol/L NaCl at a flow rate of 1.0 mL·min−1 (10 mL per tube). Each tube was checked at 490 nm by the phenol–sulphuric acid method. Three polysaccharide fractions, named as PIO-1, PIO-2 and PIO-3, were obtained (Fig. 2).

Journal Pre-proof

PIO-1

PIO-2

of

PIO-3

ro

Fig. 2 Elution profile of PIO by ion exchange chromatography on a DEAE-52

2.3.1. Animals and groupings

re

2.3. Anti-fatigue activity of PIO

-p

cellulose column.

lP

Forty male Kunming mice (4 weeks old) were used in the study. During the experiment, the Kunming strain mice were housed in a standardized

na

animal room with a controlled temperature of 23 ± 2 °C, relative humidity of 50

water.

Jo ur

± 5% and a cycle of 12/12 hours light/dark and allowed free access to food and

This study was performed in accordance with the Guide for the Care and Use of Laboratory Animals. Care was taken to minimize discomfort, distress, and pain to the animals.

The animals were separated into 4 groups of 10 mice each. Group I (PIO-1), Group II (PIO-2) and Group III (PIO-3) were treated orally (50mg/kg/day respectively which was dissoved in distilled water) for 30 days. The forth group served as control group treated with saline for 30 days. 2.3.2. Forced swimming test After 30 days of gavage, mice were submitted to the forced-swimming test [9]. Briefly, the mice were forced to swim in fresh water (25℃) for 15 min (height of 30 cm) within a 40 cm×15 cm cylinder. Twenty-four hours later, each

Journal Pre-proof mouse was re-exposed to the swimming in a similar condition in a 6 min ‘test session’. The total duration of climbing, swimming and immobility in the last 5 min of the 6 min test session was recorded for each animal. 2.3.3 Analysis of biochemical parameters At the end of the experimental period, the animals were fasted 18 h and then performed the euthanasia by physical method. The blood was collected to be centrifuged and the clear serum separated for analysis of blood lactic acid (BLA), urea nitrogen (BUN) and lactic dehydrogenase (LDH) by using the

of

commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

ro

Brains were used for the assay of 5-HT by Hematoxylin and Eosin (H&E) staining. H&E staining was conducted according to the routine protocol using

-p

Hematoxylin and Eosin Staining Kit (Nanjing Jiancheng Bioengineering

re

Institute, Nanjing, China). Total integrated optical density (IOD), a parameter

lP

representing the expression levels of 5-HT in brains, was determined using a cast-grid microscope together with an image-analysis program [10]. The

na

gastrocnemius muscles were dissected out for the measurement of GRAF1 expression.

Jo ur

2.3.4 Real-time reverse transcription–polymerase chainreaction Total RNA from genioglossus samples was isolated using Trizol Reagent (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturers instructions. The RNA concentration and the RNA purity were assessed at 260 and 280 nm, respectively, using a spectrophotometer (Shanghai Yuabnxi Bioengineering Institute, Shanghai, China). The PCR was performed under the conditions shown in Table 1 and Table 2. Table 1. The specific primer sets. Primer Sequence（5'-3')

Fragmen（bp）

M-β-actin-S

GTGACGTTGACATCCGTAAAGA

287

M-β-actin-A

GTAACAGTCCGCCTAGAAGCAC

Primer

M-gfra1-S

TTGGCAATGGCTCGGATGT

M-gfra1-A

CCAGCGAGACCATCCTTTCC

247

Journal Pre-proof Table 2. PCR conditions

2.4

Variable

Parameter

Pre-incubation

95℃，10min

Cycles（40 times）

95℃，15s→60℃，60s

Annealing

60℃→95℃

Characterization analysis of PIO-1

2.4.1 Chemical composition analysis of PIO-1 The content of total sugar was measured by using the phenol-sulfuric acid

[12].

The

content

of

uronic

acid

was

of

method [11]. The protein content was quantified by using the Bradford method determined

by

using

the

ro

meta-hydroxydiphenyl method [13]. The content of starch was determined by

-p

reaction with iodine-potassium iodide and FeCl3 [14].

2.4.2 Monosaccharide composition analysis of PIO-1 analyzed

re

The monosaccharides were

by high

performance ion

lP

chromatography (HPIC) with method of PMP (1-phenyl-3-methyl-5-pyrazolone) pre-column derivatization. HPIC instrument was equipped with Dionex

na

ICS-5000 ion chromatograph matched with a pulsed amperometric detector. The sample was performed on Agilent Eclipse XDB -C18 chromatographic

Jo ur

column (250 mm x 4.6 mm, 5um) at a flow rate of 0.5 mL/min. The mobile phase was phosphate buffer solution (pH = 6.8) mixed with acetonitrile at a certain volume ratio (80:20) under the condition of isocratic elution. 2.4.3 AFM morphological analysis For AFM sample preparation, PIO-1 were diluted with deionized water (2.5 μg/mL) and a droplet of 2 μL was deposited onto a freshly cleaved mica surface and air-dried under the room temperature condition overnight for further observation. The AFM instrument used was Nanoscope Iva MultiMode (Digital Instruments, Santa Barbara, CA), and the tapping mode was adopted. The probe used was a TEST silicon probe with a coefficient of elasticity of 42 N/m and a tip radius of approximately 10 nm. Particularly, in order to obtain high-quality images,

Journal Pre-proof the scanning rate was less than 1 HZ, and the resolution was 512 × 512, and the scanning angle was 0°. 2.5 Statistical analysis The data are expressed as mean ± SEM. Statistical differences between means were determined by one-way analysis of variance (ANOVA), followed by Dunnett t-test. The values of P < 0.05 were considered as significant.The figures were drawn by GraphPad Prism 7.0 software. 3. Results and discussion

of

3.3. Anti-fatigue activity of PIO

ro

Fatigue is a sensation of extreme physical or mental tiredness resulting from stress and excessive physical or mental effort. Among the theories which

-p

related to the mechanisms of physical fatigue, central mental energy

re

consumption have got most interests. In the present study, not only evaluated

lP

the anti-physical fatigue of PIO by using a forced swimming test along with the determination of related biochemical parameters, but the anti-mental fatigue of

na

PIO as also determined.

3.3.1. Effect of PIO on the modified forced swimming test in mice

Jo ur

Fig. 3 shows the results of modified forced swimming test. PIO-1 increased climbing duration than the control group (Fig. 3 A). No significant changes in climbing behaviour were observed with the treatments of PIO-2 and PIO-3. At the same time, PIO-1 increased swimming time 108.7%. PIO-2 also increases swimming time 51.3%. However the same result did not occur in PIO-3-treated group (Fig. 3 B). There was a subsequent reduction in immobility time with PIO-1 treatment, whereas, same doses of PIO-2 did not reduce immobility significantly. Fig. 3 C shows PIO-1 and PIO-3 significantly decreased the immobility of mice in comparison to the control group (P<0.01, P<0.05).These differences may result from the polysaccharide compositions and structures. AEP-1 was mainly composed of mannose, maltose, galactose, xylose

and

arabinose.

The

results

implied

structure-dependently positive effects on the fatigue.

that

AEP

presented

Journal Pre-proof A

B * ** *

ro

of

C

*

lP

re

-p

**

na

Fig. 3.Effect of polysaccharide fractions on swimming time. All bars represent mean values with vertical lines indicating S.E.M. Number of

Jo ur

animals=10.* p < 0.05 versus control group .* *p < 0.01 versus control group (1—Saline-treated group; 2—PIO-1 - treated group; 3—PIO-2 -treated group and 4—PIO-3 -treated group

3.3.2. Effect of PIO on the blood metabolic parameters BLA is a glycolysis product produced under anaerobic conditions and is the main energy source for intense exercise over a short period. Intracellular lactic acid accumulation lead to fatigue [15,16]. In the sera of the PIO-1-treated mice groups, BLA levels were significantly lower than those in the control group after 1 month of treatment which was 34.8 % less than the control group (Table 3).

Journal Pre-proof Table 3.Effect of PIO on levels of BLA, LDH and BUN in blood BLA(mmol L-1)

Different groups

LDH (U L-1)

BUN (mmol L-1))

Control group

9.36±0.63

242.3±52.1

41.23±2.21

PIO-1 group

6.10± 0.22*

201.5±34.2*

33.54±2.31**

PIO-2 group

8.0 ± 0.21

231.7±54.0

38.50±1.81

PIO-3 group

8.6 ± 0.60

228.5±24.3

37.71 ± 2.70

Values are shown as means ± SEM. The different letters in the same column

of

indicate a statistical difference (*p < 0.05 vs. Control group, **p<0.01 vs.Control group).

ro

LDH is known to be an enzyme catalyzing the reciprocal transformation of

-p

pyruvate and lactic acid. LDH plays an important role in eliminating lactic acid and supplying energy under the conditions of hypoxia [17]. In the present study,

re

when compared with control group after swimming. After PIO-1 treatment, the

lP

level of LDH was remarkably lower than those of the control group (Table 3) (P < 0.05). The elevation of LDH can serve as critical indexes for reflecting the

na

cell damage and the subsequent extent of muscle disruption induced by intense exercise[17]. The results suggested that the supplementation of PIO-1

Jo ur

could mitigate the cell damage and the muscular injury induced by fatigue. BUN concentration reflects that the metabolism level of protein and amino acids [18]. Consequently, the excess production of SUN will reflect the protein decomposition which will attenuate the muscle contraction and induces fatigue. After an exhaustive swimming, SUN level of PIO-1 groups is 33.54±2.31 mmol/L, which reduced significantly by 18.65 % than control group (Table 3) (p < 0.01). The increased BUN levels in serum commonly represents the impairment of the contractive strength of muscle and typical indictors related to fatigue[18].Our result indicated that PIO-1 had a positive effect to decrease that accumulation BUN. 3.3.3. Effect of PIO on the 5-HT concentrations in brain Recent findings suggest that stronger release of 5-HT inhibits rhythmic

Journal Pre-proof activity and motoneuron firing which is responsible for central fatigue [19]. That is the inhibition of 5-HT production in the brain could increase endurance exercise performance [20]. In this study, PIO-1 significantly decreased the 5-HT concentrations in the mice brain (P<0.05) (Fig. 4E). The histological changes of mice brain were also observed by H&E staining and Magnetic resonance imaging (Fig.4 A-D). It has been reported that the levels 5-HT are increased in the brain and hypothalamus after various kinds of exercise in vivo experiment [19].Several clinical studies support the serotonin hypothesis

of

which suggest that fatigue is occurred by increased levels of 5-HT [20]. In this

ro

study, administration of PIO-1 decreased the expression of 5-HT. It indicates

-p

that PIO-1 might also have the potential to improve mental fatigue. A

D

Jo ur

C

na

lP

re

B

E * **

Figure 4. Effect of polysaccharide fractions on 5-HT concentrations in mice

Journal Pre-proof Histological examination on 5-HT concentrations in mice (A:Saline-treated group; B:PIO-1 - treated group; C:PIO-2 -treated group and D:PIO-3 -treated group) H&E staining results; (E)All bars represent mean values with vertical lines indicating S.E.M. Number of animals=10.* *p < 0.01 versus control group (1—Saline-treated group; 2—PIO-1 - treated group; 3—PIO-2 -treated group and 4—PIO-3 -treated group )

3.3.4. Effect of PIO on GRAF1 expression in gastrocnemius muscles To determine the molecular mechanism underlying the anti-fatigue action of PIO, we performed comparative the GRAF1 (guanosine triphosphatase

of

regulator associated with FAK-1) expression in gastrocnemius muscles. Using

ro

real-time reverse transcription (RT)-PCR, clear expression of GRAF1 mRNA was detected in the gastrocnemius muscles of the PIO-1 group. Data were

-p

expressed relative to β-actin mRNA. The levels of GRAF1 expression in PIO-1

re

group (Fig. 5) were higher than in control group (P < 0.01). However, there

lP

were no significant differences in expression of GRAF1 between PIO-2, PIO-3 group and control group (P>0.05) (Fig. 5). GRAF1 is a Rho-specific GTPase

na

activating protein that is expressed predominantly in striated muscle. GRAF1-depleted muscle fibers were either unable to withstand the mechanical

Jo ur

strain or to repair strain-induced lesions [21]. Our result can be proposed that PIO-1 most probably improved fatigue resistance by maintaining higher levels of GRAF1 expression in muscles. Further experiments are required to reveal the mechanisms involved in this action. **

Figure 5. Effect of PIO on GRAF1 expression in gastrocnemius muscles

Journal Pre-proof All bars represent mean values with vertical lines indicating S.E.M. Number of animals=10.* *p < 0.01 versus control group (1—Saline-treated group; 2—PIO-1 - treated group; 3—PIO-2 -treated group and 4—PIO-3 -treated group) 3.4 Characterization analysis of PIO-1 All of the above results proved that PIO-1 could be used as a good source to relieve fatigue. However, PIO-2 and PIO-3 have no anti-fatigue effect compared with control groups. So the further investigation is needed for more

of

details on the structure of PIO-1.

ro

3.4.1 Chemical composition of PIO-1

The content of total sugar in PIO-1 was 73.2%, protein was 1.56% and the

-p

uronic acid was 1.1%. Negative results were found for the reaction with FeCl 3,

re

which indicated that PIO-1 did not contain starch.

lP

3.4.2 Monosaccharide compositionof PIO-1 The monosaccharide compositions of AEP-1 was analyzed by HPLC (Fig.

na

6). According to the retention time and peak area, AEP-1 was mainly composed of mannose, glucose, galactose, xylose and arabinose with the

Jo ur

molar ratio of 1.0 : 1.9 : 3.5 : 18.5 : 5.7. It is well known that biological activities of polysaccharides are closely related to their structural properties, such as monosaccharide composition. The distinct profile of AEP-1, PIO-2 and PIO-3 might be explained by the difference in its structure. This deduction needs to be validated in our further research.

na

lP

re

-p

ro

of

Journal Pre-proof

Jo ur

Fig. 6. Standard monosaccharide mixture(A)and the monosaccharide composition of PIO-1(B): mannose, glucose, galactose, xylose and arabinose with the molar ratio of 1.0 : 1.9 : 3.5 : 18.5 : 5.7

3.4.3 AFM analysis of PIO-1 AFM is a powerful tool to observe the spatial structure and surface morphology of biological macromolecules, which can observe the microscopic morphology of some linear and branched polysaccharides. Fig. 7 exhibited the molecular morphology of the PIO-1 observed under atomic force microscopy. The roughness of PIO-1 is about 0.665nm,which increased the contact area with water molecules, showing a superior

Journal Pre-proof

na

lP

re

-p

ro

of

anti-fatigue activity.

Fig. 7. AFM analysis of PIO-1

Jo ur

4. Conclusions

The polysaccharides PIO-1 from Inonotus obliquus was obtained after hot-water extraction and purification by DEAE cellulose-52 chromatography. The total sugar content was 73.2%. The results of monosaccharide analysis showed that the molar ratio of mannose, glucose, galactose, xylose and arabinose with the molar ratio of 1.0: 1.9 : 3.5 : 18.5 : 5.7. The anti-fatigue experiment indicated polysaccharide PIO-1 not only has great potential to postpone physical fatigue but also shown potential to improve mental fatigue. However, a detailed structural description of PIO-1 is needed in order to expose the relationship between the structure and anti-fatigue activity.

Funding: Supported by Postdoctoral Researcher of Heilongjiang Postdoctoral

Journal Pre-proof Management Office (No.LBH-Q16225) and Qiqihar medical university (No. QY2016LX-01） Conflict of interest: The authors declare no conflict of interest.

References [1].

Kim YO, Park HW, Kim JH, Lee JY, Moon SH, Shin CS. Anti-cancer effect and structural characterization of endo-polysaccharide from cultivated mycelia of Inonotus obliquus. Life Sci 79(2006):72–80.

polysaccharides.

Appl

Microbio

Biotechnol

60

ro

immunomodulating

of

[2]. Wasser SP. Medicinal mushrooms as a source of antitumor and

(2002):258–274.

-p

[3]. Kim YO, Han SB, Lee HW, et al. Immuno-stimulating effect of the

lP

Life Sci 77(2005):2438–2456.

re

endo-polysaccharide produced by submerged culture of Inonotus obliquus.

[4]. Xu HY, Sun JE, Lu ZM, Zhang XM, Dou WF, Xu ZH. Beneficial effects of

na

the ethanol extract from the dry matter of a culture broth of Inonotus obliquus in submerged culture on the antioxidant defence system and

Jo ur

regeneration of pancreatic beta-cells in experimental diabetes in mice. Nat Prod Res. 24(2010):542-53. [5] W. Ni, T. Gao, H. Wang, Y. Du, J. Li, C. Li, L. Wei H. Bi, Anti-fatigue activity of polysaccharides from the fruits of four Tibetan plateau indigenous medicinal plants, J. Ethnopharmacol. 150(2013) 529–535. https:// doi.org/10.1016/j.jep.2013.08.055. [6] H. Cao, S. Ma, H. Guo, X. Cui, S. Wang, X. Zhong, Y. Wu, Zheng, W. H. Wang, J. Yu, L. Ma and C.-C. H, Comparative study on the monosaccharide compositions, antioxidant and hypoglycemic activities in vitro of intracellular and extracellular polysaccharides of liquid fermented Coprinus comatus, Int J Biol Macromol., 2019, 139, 543-549. [7] W. Tan, K.Q. Yu, Y.Y. Liu, M.Z. Ouyang, M.H. Yan, R. Luo, X.S. Zhao, Anti-fatigue activity of polysaccharides extract from Radix Rehmanniae

Journal Pre-proof Preparata, Int. J. Biol. Macromol. 50(2012)59–62. [8]

Han

Y , Nan

S , Fan

J , Chen

Q , Zhang

Y.

Inonotus

obliquus

polysaccharides protect against Alzheimer's disease by regulating Nrf2 signaling and exerting antioxidative and antiapoptotic effects. Int J Biol Macromol. 15(2019)131:769-778. [9] J.F. Cryan, M.E. Page, I. Lucki, Noradrenergic lesions differentially alter th antidepressant-like effects of reboxetine in a modified forced swimming test. Eur. J. Pharmacol. 436(2002)197–205.

response

central in

neurotransmitter

expression

and

stress

ro

changes of

of

[10] L. Bao, X.S. Yao, L. Zhao, Y.Q. Lu, H. Kurihara, Correlation between

mice –a restraint time-course analysis, Neural

-p

Regeneration Res. 3(2008)167–171.

re

[11] M. Dubois, K.A. Gilles, J.K. Hamilton, P.A. Rebers, F. Smith, Colorimetric

lP

method for determination of sugars, Anal. Chem. 28 (1956) 350–356. [12] M.M. Bradford, A rapid and sensitive method for the quantitation of

na

microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72(1976) 248–254.

Jo ur

[13] N. Blumenkrantz, G. Asboe-Hansen, New method for quantitative determination of uronic acids, Anal. Biochem. 54 (1973) 484–489. [14] H.L. Zhang, J.Li, G. Li, D.M. Wang, L.P. Zhu, D.P. Yang, Structural characterization and anti-fatigue activity of polysaccharides from the roots of Morinda officinalis, Int. J. Biol. Macromol. 44(2009)257–261. [15] J.F. Ding, Y.Y. Li, J.J. Xu, X.R. Su, X. Gao, F.P. Yue, Study on effect of jellyfish collagen hydrolysate on anti-fatigue and anti-oxidation, Food Hydrocoll. 25 (2011) 1350–1353. [16] S.P. Cairns, Lactic acid and exercise performance, Sports Med. 36 (2006) 279–291. [17]Q. Zhou, C. Zhang, S. Cheng, B. Wei, X. Liu, S. Ji, Changes in energy metabolism accompanying pitting in blueberries stored at low temperature, Food Chem. 164(2014)493–501.

Journal Pre-proof [18] L. Wang, H.L. Zhang, R. Lu, Y.J. Zhou, R. Ma, J.Q. Lv, The decapeptide CMS001

enhances

swimming

endurance

in

mice,

Peptides.

29(2008)1176-1182. [19] J.F. Perrier, F. Cotel, Serotonergic modulation of spinal motor control, Curr Opin Neurobiol. 33C(2014)1-7. [20] N.K. Stepto, B.B. Shipperd, G. Hyman, B. McInerney, D.B. Pyne, Effects of high-dose large neutral amino acid supplementation on exercise, motor

Physiol Nutr Metab. 36 (2011) 671-681.

of

skill, and mental performance in Australian Rules Football players, Appl

GRAF1

promotes

ferlin-dependent

myoblast

Jo ur

na

lP

re

-p

393(2014):298–311.

ro

[21] K.C. Lenhart, A.L. Becherer, J. Li, X. Xiao, E.M. McNally, C.P. Mack, fusion,

Dev

Biol.

Journal Pre-proof

Author Statement Based on comments and suggestions of reviewers, we have made modification on the revised manuscript. The re-revised manuscript with the correction sections red-marked was attached. A separate document answering every question from the referees was also attached here. Please kindly accept our manuscript entitled “Spatial structure and anti-fatigue of polysaccharide from Inonotus

obliquus” for your review.

of

We should like to submit it for publication in International Journal of

ro

Biological Macromolecules. All other Authors have read the manuscript and

-p

have agreed to submit it in its current form for consideration for publication in the Journal. It is the first time to invent the spatial

re

structure and potential antifatigue activity of polysaccharide fractions

lP

which was extracted from Inonotus obliquus. The manuscript, or any parts of it, have not been and will not be submitted elsewhere for consideration.

Jo ur

na

The authors declare that they have no competing interests.

Journal Pre-proof

Highlights This study evaluated the Spatial structure and physical and mental fatigue activity of polysaccharide fractions extracted from Inonotus obliquus. (1) This researche indicated the information about the isolation, characterization and anti-fatigue activity of purified polysaccharides from Inonotus obliquus. (2) This researches indicated polysaccharide PIO-1 not only have great

of

potential to postpone physical fatigue but also shown potential to improve mental fatigue.

ro

(3) The structural description of PIO-1 showed that the molar ratio of

-p

mannose, glucose, galactose, xylose and arabinose with the molar ratio of 1.0 : 1.9 : 3.5 : 18.5 : 5.7. The total sugar content was 73.2 %. The molecular

re

morphology of the PIO-1 observed under atomic force microscopy

Jo ur

na

lP

(AFM).