Spatio-temporal variations and genetic diversity of Anaplasma spp. in cattle from the North of Tunisia

Accepted Manuscript ¨ Title: Spatio-temporal variations and genetic diversity of Anaplasma spp. in cattle from the North of Tunisia¨113pt plus1fill Authors: Han`ene Belkahia, Mourad Ben Said, Narjesse El Mabrouk, Mariem Saidani, Chayma Cherni, Mariem Ben Hassen, Ali Bouattour, Lilia Messadi PII: DOI: Reference:

S0378-1135(17)30103-7 http://dx.doi.org/doi:10.1016/j.vetmic.2017.08.004 VETMIC 7718

To appear in:

VETMIC

Received date: Revised date: Accepted date:

24-1-2017 4-8-2017 4-8-2017

Please cite this article as: {http://dx.doi.org/ This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

First longitudinal field study reveals spatio-temporal variations and genetic diversity of Anaplasma spp. in cattle from the North of Tunisia

Authors: Hanène Belkahia a, Mourad Ben Said a, Narjesse El Mabrouk a, Mariem Saidani a, Chayma Cherni a, Mariem Ben Hassen a, Ali Bouattour b, Lilia Messadi a,*

a

Service de Microbiologie et Immunologie, Ecole Nationale de Médecine Vétérinaire, Université de La

Manouba, 2020 Sidi Thabet, Tunisie b

Service d’Entomologie Médicale, Institut Pasteur de Tunis, Université Tunis El Manar, 1002 Tunis,

Tunisie

*

Corresponding author:

Pr. Lilia Messadi Service de Microbiologie et Immunologie, Ecole Nationale de Médecine Vétérinaire, 2020 Sidi Thabet, Tunisie Tel: +216 71 552 200 Fax: +216 71 552 441 E-mail: [email protected]

1

Highlights: 

First longitudinal survey of Anaplasma species in Tunisian cattle.



Average prevalence rates were 7, 4.9, 4.7 and 0% in A. centrale, A. bovis, A. marginale and A. phagocytophilum, respectively.



Seasonal and bioclimatic variations of Anaplasma spp. infection and co-infection rates were recorded.



Genotyping of msp4 gene revealed two different variants of A. marginale



Genotyping of 16S rRNA gene revealed two and three different variants of A. centrale and A. bovis, respectively.

2

First longitudinal field study reveals spatio-temporal variations and genetic diversity of Anaplasma spp. in cattle from the North of Tunisia

Abstract In cattle, anaplasmosis is a tick-borne rickettsial disease caused by Anaplasma marginale, A. centrale, A. phagocytophilum, and A. bovis. To date, no information concerning the seasonal dynamics of single and/or mixed infections by different Anaplasma species in bovines are available in Tunisia. In this work, a total of 1035 blood bovine samples were collected in spring (n=367), summer (n=248), autumn (n=244) and winter (n=176) from five different governorates belonging to three bioclimatic zones from the North of Tunisia. Molecular survey of A. marginale, A. centrale and A. bovis in cattle showed that average prevalence rates were 4.7% (minimum 4.1% in autumn and maximum 5.6% in summer), 7% (minimum 3.9% in winter and maximum 10.7% in autumn) and 4.9% (minimum 2.7% in spring and maximum 7.3% in summer), respectively. A. phagocytophilum was not detected in all investigated cattle. Seasonal variations of Anaplasma spp. infection and co-infection rates in overall and/or according to each bioclimatic area were recorded. Molecular characterization of A. marginale msp4 gene indicated a high sequence homology of revealed strains with A. marginale sequences from African countries. Alignment of 16S rRNA A. centrale sequences showed that Tunisian strains were identical to the vaccine strain from several sub-Saharan African and European countries. The comparison of the 16S rRNA sequences of A. bovis variants showed a perfect homology between Tunisian variants isolated from cattle, goats and sheep. These present data are essential to estimate the risk of bovine anaplasmosis in order to develop integrated control policies against multi-species pathogen communities, infecting humans and different animal species, in the country.

Keywords: Anaplasma species; Co-occurrence; Seasonal variation; Bioclimatic distribution; Genetic diversity; Tunisian cattle 3

1. Introduction In Tunisia, cattle are exposed to different health and management problems, caused essentially by several tick-borne pathogens, including protozoan, viral, and bacterial agents (Gharbi et al., 2011). Tick-borne diseases are known to affect directly the financial situation of the farmers and consequently the Tunisian national economy (Gharbi et al., 2011). Among these, bovine anaplasmosis is a tick-borne rickettsial disease caused by Anaplasma marginale, A. centrale, A. phagocytophilum, and A. bovis (Rar and Golovljova, 2011). A. marginale, the most common etiologic agent of bovine anaplasmosis, is endemic worldwide especially in tropical and subtropical areas (Kocan et al., 2003). It mainly affects cattle, causing mild to severe febrile hemolytic anemia. A. centrale is an intraerythrocytic tick-borne rickettsia of cattle that has a different morphology and virulence compared to A. marginale. It can cause asymptomatic infection, or only a mild anemia in most cases (Rar and Golovljova, 2011). A. centrale is used for extensive vaccination of cattle against A. marginale infection in endemic areas (Rar and Golovljova, 2011). A. phagocytophilum is an obligate intracellular parasite that infects granulocytes. It causes tickborne fever in ruminants (Rikihisa, 1991). A. bovis infects circulating monocytes (Liu et al., 2012) and tissue macrophages of domesticated and wild ruminants (Worthington and Bigalke, 2001). The analysis of some risk factors was carried out in cattle in Tunisia. Indeed, molecular prevalence of Anaplasma infection varied according to locality, bioclimatic area, tick infestation, animal breed and type of breeding (Belkahia et al., 2015; M’ghirbi et al., 2016). However, the characterization of seasonal variations in infection epidemiology is essential for evaluating the impact of anaplasmosis and their potential for spreading. But until now, there is no information concerning the seasonal dynamics of the infection and the co-occurrence of different Anaplasma species in Tunisian cattle. From where, this study aimed to provide spatio-temporal data essential to estimate the risk of bovine anaplasmosis in Tunisia. Therefore, the prevalence and the co-occurrence of Anaplasma species in cattle from five different governorates belonging to three bioclimatic zones from the North of Tunisia were estimated according to seasons. 4

2. Materials and methods 2.1. Cattle population and study regions A longitudinal study was carried out in 96 traditional farms located in thirty-two delegations of Northern Tunisia belonging to five governorates (Tunis, Ariana, Bizerte, Beja and Nabeul) and three bioclimatic areas (Lower humid, Sub-humid and Higher semi-arid) (Supplementary files 1 to 9). The climate is Mediterranean in all analyzed regions which is distinguished by a hot summer with little rainy and a mild rainy winter. Randomly selected farms, having less than 30 animals, were periodically treated with external acaricides. Investigated flocks are traditionally managed based on small herds grazing on permanent pastures or bush and animals are housed in traditional shelters and generally exposed to tick bites. Tested cattle have an age ranged between 1 and 13 years and the majority were dairy cattle belonging to local breed. According to seasons, a total of 1035 blood bovine samples were collected in spring (from March to May 2014; n=367), summer (from June to August 2014; n=248), autumn (From September to November 2014; n=244) and winter (From December 2014 to February 2015; n=176) (Supplementary files 1 to 9).

2.2. Blood sampling and DNA extraction Blood samples were collected from the jugular vein in EDTA tubes. DNA was extracted from 300 µl volume of EDTA-preserved whole blood using the Wizard® Genomic DNA purification kit (Promega, Madison, USA) according to the manufacturer’s instructions. DNA yields were determined with a spectrophotometer (Jenway, Genova, Italy) and stored at -20°C until use.

2.3. Single and nested PCR Based on 16S rRNA, PCR using outer primers EE1 and EE2 (Barlough et al., 1996) for Anaplasma spp. detection has been performed as described by Belkahia et al. (2015, Table 1). Positive 16S rRNA samples were used for the identification of A. marginale infection by single PCR based on msp4 gene 5

with the AmargMSP4Fw and AmargMSP4Rev specific primers designed by Torina et al. (2012, Table 1). For A. marginale msp4 genotyping, bovine samples positive to A. marginale were used in a traditional PCR with MSP45 and MSP43 primers as described by de la Fuente et al. (2005, Table 1). A. centrale and A. bovis specific primers (AC1f/AC1r and AB1f/AB1r, respectively) were used in nested PCR for strains detection and characterisation (Kawahara et al., 2006, Table 1). Anaplasma spp. positive samples were also tested by hemi-nested PCR, for the specific detection of A. phagocytophilum, using outer primers EphplgroEL-F and EphplgroEL-R, and inner primers EphplgroEL-F and EphgroEL-R amplifying a partial sequence of the groEL gene (Alberti et al., 2005, Table 1).

2.5. DNA sequencing and data analysis Selected PCR products obtained with primers MSP45/MSP43, AC1f/AC1r and AB1f/AB1r and respectively representative of A. marginale (5 amplicons), A. centrale (16 amplicons) and A. bovis (9 amplicons), were purified and sequenced as earlier described by Belkahia et al. (2015). The DNAMAN program (Version 5.2.2; Lynnon Biosoft, Que., Canada) was used to perform multiple sequence alignment of 16S rRNA and msp4 sequences and to translate nucleotide to aminoacid MSP4 sequences. Similarity searches were conducted by using BLAST (http://blast.ncbi.nlm.nih.gov, Altschul et al., 1997).

2.6. Sequence accession numbers The msp4 partial sequences of A. marginale M1 to M5 isolates have been deposited in the GenBank under accession numbers KY362501 to KY362505. The 16S rRNA partial sequences of A. centrale C1 to C16 isolates have been deposited under GenBank accession numbers KY362530 to KY362545. Finally, 16S rRNA partial sequences of A. bovis B1 to B9 isolates have been deposited under GenBank accession numbers KY362521 to KY362529 (Table 2).

6

2.7. Statistical analyses Exact confidence intervals (CI) for prevalence and co-infection rates at the 95% level were calculated. Comparison of the prevalence of Anaplasma species and co-infections among different delegations, governorates and bioclimatic areas were performed using the χ2 and Fisher’s exact tests, with the Epi Info 6.01 software (CDC, Atlanta). Observed differences were considered to be statistically significant at a 0.05 threshold value.

3. Results 3.1. Spatial distribution and seasonal variation of Anaplasma infections 3.1.1. Anaplasma marginale infection A. marginale prevalence rates were 4.6, 5.6, 4.1 and 4.5%, respectively; in spring, summer, autumn and winter with an average of 4.7% (Figure 1A). The infection of cattle located in the subhumid area begins low (2.9%) during the spring, then increases during the summer (9.4%), reaches its maximum during the autumn (17.5%) and, finally, decreases during the winter season (13.6%). The infection of analyzed animals located in the lower humid and higher semi-arid areas begins low (5.7 and 2.9%, respectively) during the spring, then increases during the summer (6.2 and 4.4%, respectively), decreases during the autumn (1.6 and 1.3%, respectively) and, finally, increases during the winter season (1.9 and 6.5%, respectively). The difference between the seasons in A. marginale infection rate in cattle situated in all bioclimatic areas remains statistically insignificant (Figure 2A).

3.1.2. Anaplasma centrale infection Cattle analyzed during summer and autumn seasons were statistically more infected by A. centrale (8.9 and 10.7 %, respectively) compared to those tested during spring and winter (4.6 and 3.9%, respectively) (P = 0.007). The average infection rate was estimated at 7% (Figure 1A). The infection of cattle located in the sub-humid area begins low (2.9%) during the spring, then increases during the summer (9.4%), reaches its maximum during the autumn (25%) and, finally, decreases 7

during the winter season (13.6%). This difference according to the seasons is statistically significant (P= 0.035). The infection of tested cattle located in the lower humid and higher semi-arid areas begins low (5.7 and 3.8%, respectively) during the spring, then increases during the summer (6.2 and 10.4%, respectively), decreases during the autumn (0 and 5.6%, respectively) and, during the winter season, the infection rate increases in cattle from lower humid zone (1.9%) and decreases even more in animals from higher semi-arid zone (6.5%). The difference of A. centrale infection in these two bioclimatic areas according to the seasons remains statistically insignificant (Figure 2B).

3.1.3. Anaplasma bovis infection A. bovis prevalence rates were 2.7, 7.3, 4.5 and 5.1%, respectively; in spring, summer, autumn and winter with an average of 4.9% (Figure 1A). The infection of cattle located in the sub-humid area begins nil (0%) during the spring, then increases slightly during the summer (3.1%), reaches its maximum, in a significant way (P=0.009), during the autumn (20%) and, finally, decreases slightly during the winter (18.1%). The infection of analyzed animals located in the lower humid and higher semi-arid areas begins low (5.1 and 0.6%, respectively) during the spring, then increases during the summer (6.2 and 8.9%, respectively), decreases during the autumn (0 and 2.4%, respectively) and, finally, increases during the winter season (1.9 and 6.5%, respectively). Only the difference between the seasons in A. bovis infection rate in cattle situated in higher semi-arid area was statistically significant (P=0.002) (Figure 2C).

3.1.4. Anaplasma phagocytophilum infection GroEL hemi-nested PCR failed to detect A. phagocytophilum in all tested cattle, indicating that none of the analysed animals were positive to this zoonotic species during the four seasons.

3.1.5. Co-infections

8

As shown in Figure 1B, for all types of co-infection, the highest rates were observed in the summer but the fluctuation between seasons was not statistically significant. In the sub-humid area, all types of co-infection begin low (0-1.7%) during the spring, then increase during the summer (3.19.4%), reach its maximum during the autumn (15-20%) and finally the co-infection rates decrease during the winter season (9.1-13.6%). Only the difference in A. centrale and A. bovis co-infection rates according to seasons was statistically significant (P=0.002). In the higher semi-arid area, the fluctuation of all possibly types of co-infection rates was statistically insignificant according to season except the A. centrale and A. bovis co-infection pattern which showed a highest co-infection rate in the summer estimated at 8.1% (P=0.015). In lower humid area, all types of co-infections are relatively constant between spring and summer with relatively high rates estimated between 9.7 and 6.2% then decrease during autumn (0%) and, finally, all co-infection rates increase slightly during the winter (1.9%) (Figure 3).

3.2. Molecular characterization of Anaplasma species A. marginale infections were validated by sequencing 805 bp (94.7%) of the msp4 gene from five randomly selected positive cattle samples. Sequences alignment revealed two distinct genotypes (AmBv1 and AmBv2; GenBank accession numbers from KY362501 to KY362504 and KY362505, respectively). AmBv1 was a novel genotype, different from AmBv2 genotype by two substitutions with an identity rate estimated at 99.7% (Table 2). AmBv2 was 100% identical to Isolate F from Italian cattle (GenBank accession number KF739431) (Table 2). Comparing with other Tunisian variants, AmGBv4 and AmGBv7 are the closest variants to AmBv1 and AmBv2 with homology rates ranging from 99.5 to 99.8% and four SNPs representing two non synonymous substitutions (Tables 2 and 3). A. centrale infections were validated by sequencing 383 bp (25.6%) of the 16S rRNA gene from 16 randomly selected positive samples. Alignment of these sequences allowed the identification of two different 16S rRNA gene variants (AcBv1 and AcBv2; GenBank accession numbers from KY362530 9

to KY362540 and from KY362541 to KY362545, respectively) differing by one nucleotide substitution (Table 3). AcBv1 was 100% identical to AcGBv1 genotype isolated from Tunisian cattle (GenBank accession number KM401896). AcBv2 was 100% identical to strain KT5 isolated from cattle located in Uganda (GenBank accession number KU686784) (Table 2). Sequencing of 511 bp (34.2%) of the 16S rRNA gene from nine randomly selected positive cattle samples validated A. bovis infection. Based on nucleotide alignment, 3 different variants were identified (AbBv1, AbBv2 and AbBv3; GenBank accession numbers from KY362521 to KY362527, KY362528 and KY362529, respectively). Two (AbBv2 and AbBv3) out of 3 showed a degree of nucleotide diversity when compared to published sequences and were considered new (Table 2). AbBv1 was 100% identical to AbGGo1, AbGOv1 and AbGBv3 variants (GenBank accession numbers KM285223, KM285224 and KM401904) isolated from Tunisian goats, sheep and cattle (Tables 2 and 3).

4. Discussion This study reports for the first time the seasonal variation of Anaplasma spp. infections in bovines from one of North African countries using molecular methods. This longitudinal investigation confirmed the occurrence of A. marginale, A. centrale and A. bovis in cattle from the North of Tunisia during the four seasons. Infection and co-infection profiles of these Anaplasma species (Figure 1) show that cattle analyzed during the summer season are the most co-infected by different Anaplasma species. This finding suggests that most incriminated tick species are probably common vectors of these three Anaplasma spp. and have essentially a summer activity such as Rhipicephalus and Hyalomma ticks (Bouattour, 2002). The infection profiles of A. marginale, A. centrale and A. bovis and the co-infection profiles by two and three species showed statistically significant differences according to seasons in each bioclimatic area. In the sub-humid zone, infection and co-infection rates reach its maximum in the autumn unlike in other areas (lower humid and higher semi-arid) where these same rates were higher 10

in spring and summer (Figures 2 and 3). This result suggests that one or more common tick species that have a peak of activity in autumn in Tunisia like Ixodes ricinus, Rhipicephalus (Boophilus) annulatus, Dermacentor marginatus, Haemaphysalis punctata and H. sulcata (Bouattour et al., 1999; Bouattour, 2002) can be the vectors of these three Anaplasma species in the sub-humid area. These vectors are probably different from those found in the two other zones (lower humid and higher semiarid) and probably have an optimal infestation activity during the spring and/or the summer (from April to August) in this country such as Rhipicephalus turanicus, R. bursa, R. sanguineus, Hyalomma marginatum marginatum, H. excavatum and H. scupense (Bouattour et al., 1999; Bouattour, 2002). However, most of these species have been proposed previously as vectors of A. marginale worldwide including Rhipicephalus spp., Hyalomma spp., Demacentor spp., Haemaphysalis spp., and Ixodes spp. (de la Fuente et al., 2001; Kocan et al., 2003; de la Fuente et al., 2004; Naranjo et al., 2006). In addition, tick species belonging to Rhipicephalus and Haemaphysalis genera have been considered as vectors of A. centrale and A. bovis. According to Potgieter and van Rensburg (1987), the main biological vector of A. centrale is the multi-host tick species Rhipicephalus simus. More recently, Kawahara et al. (2006) assumed that Haemaphysalis longicornis is a potential vector of A. centrale and Harrus et al. (2011) detected A. bovis in R. turanicus and R. sanguineus. Until now, the vectors of these Anaplasma species are still unknown in Tunisia; thus, further studies are needed to identify the main vectors of these bacteria. Furthermore, A. phagocytophilum was not identified in all cattle investigated throughout the year. It can be postulated that ruminants are not main reservoirs for this zoonotic species in these studied regions, and alternative domestic animals like dogs and horses could act as reservoir hosts in these areas (M’ghirbi et al., 2009; M’ghirbi et al., 2012; Ben Said et al., 2014). This is in agreement with what reported in Italy (0%) (Torina et al., 2008; Zobba et al., 2014) and in other regions from Tunisia with prevalence rates estimated at 0 and 0.6% published by Belkahia et al. (2015) and M’ghirbi et al. (2016), respectively. In contrast, Dahmani et al. (2015) reported a high prevalence rate

11

(71.4%) of A. phagocytophilum infection in Algerian symptomatic cattle that developed hyperthermia, decreased milk production, cough, and (in some animals) distal edema. A. marginale infection in investigated cattle was validated by msp4 gene sequencing. Indicating a low geographic segregation, only two different A. marginale msp4 sequences were isolated from cattle in different Tunisian areas. These two revealed strains (AmBv1 and AmBv2) are very close to AmGBv7 strain which belongs to the African sub-clade included strains from Nigeria, Zimbabwe, Kenya and South Africa (Belkahia et al., 2015). This finding could be explained, in part, by the importation of live cattle and/or the dissemination of Anaplasma spp. infected ticks with migratory birds between these African countries. This finding has been proven in other studies performed in North-American, European and Asiatic countries (Ogden et al., 2008; Kang et al., 2013). The analyses of A. centrale 16S rRNA sequences revealed two different variants identical or very close to AcGBv2 variant (Belkahia et al., 2015) (Table 3). This Tunisian strain is identical to the vaccine strain from several sub-Saharan African and European countries (Lew et al., 2003). Since attenuated live A. centrale vaccines were never employed in Tunisia, it can be presume that this strain was introduced with cattle from countries where this vaccine is licensed (Belkahia et al., 2015). The alignment and the comparison of the 16S rRNA sequences of A. bovis variants showed a perfect homology between Tunisian variants isolated from cattle in this study and from small ruminants (goats and sheep) revealed earlier by Ben Said et al. (2015, Table 3) suggesting the presence of an unique transmission cycle of A. bovis in analyzed regions employing, at least, these three ruminant species and probably common tick species or/and other vectors. Additionally, the low diversity of the 16S rRNA sequences isolated from A. bovis strains found in several Tunisian regions and the absence of clinical signs associated with this infection suggests a small geographical segregation of these Tunisian strains which seem to have a limited pathogenicity in cattle. Similar findings were reported by Jilintai et al. (2009) in Japan and Nair et al. (2013) in India. In summary, this study provides the infection ant the co-occurrence of numerous Anaplasma species of medical and economic importance in cattle from Tunisia. This is the first report describing 12

the seasonal variation of A. marginale, A. centrale and A. bovis infections in bovines located in different bioclimatic zones from Northern Tunisia. Further longitudinal survey in other ruminants are needed and must be compared to these data in order to develop integrated control policies against multi-species pathogen communities, infecting humans and different animal species, in our country.

Competing interests The authors declare that they have no competing interests.

Acknowledgement This study was supported by the research project “PS1.3.023 – RESTUS” funded by the European Neighbourhood and Partnership Instrument (ENPI) - Transboundary Cooperation (TC) Italy-Tunisia 2007-2013, the “Laboratoire d’épidémiologie d’infections enzootiques des herbivores en Tunisie” (LR02AGR03), funded by the Ministry of Higher Education and Scientific Research of Tunisia, and the research project “Epidémiologie de maladies bactériennes à transmission vectorielle des herbivores” (06-680-0029) funded by the Ministry of Agriculture of Tunisia. The authors would like to thank Dr. Leïla Sayeh, Dr. Saber Hdhiri, Dr. Aymen Sahbani, Dr. Tarak Blaïech, Dr. Oussama Mathlouthi, Dr. Said Jaajaa and Dr. Taoufik Ben Hamida and their technicians for their help and facilitating the access to the farmers.

References Alberti, A., Zobba, R., Chessa, B., Addis, M.F., Sparagano, O.A., Pinna Parpaglia, M.L., Cubeddu, T., Pintori, G., Pittau, M., 2005. Equine and canine Anaplasma phagocytophilum strains isolated on the island of Sardinia (Italy) are phylogenetically related to pathogenic strains from the United States. Appl. Environ. Microbiol. 71, 6418–6422.

13

Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Barlough, J., John, E., Madigan, A., DeRock, E., Bigornia, L., 1996. Nested polymerase chain reaction for detection of Ehrlichia equi genomic DNA in horses and ticks (Ixodes pacificus). Vet. Parasitol. 63, 319–329. Belkahia, H., Ben Said, M., Alberti, A., Abdi, K., Issaoui, Z., Hattab, D., Gharbi, M., Messadi, L., 2015. First molecular survey and novel genetic variants' identification of Anaplasma marginale, A. centrale and A. bovis in cattle from Tunisia. Infect. Genet. Evol. 34, 361–371. Ben Said, M., Belkahia, H., Héni, M.M., Bouattour, A., Ghorbel, A., Gharbi, M., Zouari, A., Darghouth, M.A., Messadi, L., 2014. Seroprevalence of Anaplasma phagocytophilum in wellmaintained horses from Northern Tunisia. Trop. Biomed., 31, 432–440. Ben Said, M., Belkahia, H., Karaoud, M., Bousrih, M., Yahiaoui, M., Daaloul-Jedidi, M., Messadi, L., 2015. First molecular survey of Anaplasma bovis in small ruminants from Tunisia. Vet. Microbiol. 179, 322–326. Bouattour, A., 2002. [Dichotomous identification keys of ticks (Acari: Ixodidae), livestock parasites in North Africa]. Arch. Inst. Pasteur Tunis 79, 43–50. Bouattour, A., Darghouth, M.A., Daoud, A., 1999. Distribution and ecology of ticks (Acari: Ixodidae) infesting livestock in Tunisia: an overview of eight years fields collections. Parassitologia, 41, 5– 10. Dahmani, M., Davoust, B., Benterki, M.S., Fenollar, F., Raoult, D., Mediannikov, O., 2015. Development of a new PCR-based assay to detect Anaplasmataceae and the first report of Anaplasma phagocytophilum and Anaplasma platys in cattle from Algeria. Comp. Immunol. Microbiol. Infect. Dis. 39, 39–45.

14

de la Fuente, J., Garcia-Garcia, J.C., Blouin, E.F., Kocan, K.M., 2001. Major surface protein 1a effects tick infection and transmission of the ehrlichial pathogen Anaplasma marginale. Int. J. Parasitol. 31, 1705–1714. de la Fuente, J., Naranjo, V., Ruiz-Fons, F., Vicente, J., Estrada- Peña, A., Almazán, C., Kocan, K.M., Martín, M.P., Gortázar, C., 2004. Prevalence of tick-borne pathogens in ixodid ticks (Acari: Ixodidae) collected from European wild boar (Sus scrofa) and Iberian red deer (Cervus elaphus hispanicus) in central Spain. Eur. J. Wildlife Res. 50, 187–196. de la Fuente, J., Naranjo, V., Ruiz-Fons, F., Höfle, U., Fernández De Mera, I.G., Villanúa, D., Almazán, C., Torina, A., Caracappa, S., Kocan, K.M., Gortázar, C., 2005. Potential vertebrate reservoir hosts and invertebrate vectors of Anaplasma marginale and A. phagocytophilum in central Spain. Vector Borne Zoonotic Dis. 5, 390–401. Gharbi, M., Touay, A., Khayeche, M., Laarif, J., Jedidi, M., Sassi, L., Darghouth, M.A., 2011. Ranking control options for tropical theileriosis in at-risk dairy cattle in Tunisia, using benefitcost analysis. Rev Sci Tech. 30, 763–778. Harrus, S., Perlman-Avrahami, A., Mumcuoglu, K.Y., Morick, D., Eyal, O., Baneth, G., 2011. Molecular detection of Ehrlichia canis, Anaplasma bovis, Anaplasma platys, Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel. Clin. Microbiol. Infect. 17, 459–463. Jilintai, Seino, N., Hayakawa, D., Suzuki, M., Hata, H., Kondo, S., Matsumoto, K.,Yokoyama, N., Inokuma, H., 2009. Molecular survey for Anaplasma bovis and Anaplasma phagocytophilum infection in cattle in a pastureland where sika deer appear in Hokkaido, Japan. Jpn. J. Infect. Dis. 62, 73–75. Kang, J.G., Kim, H.C., Choi, C.Y., Nam, H.Y., Chae, H.Y., Chong, S.T., Klein, T.A., Ko, S., Chae, J.S., 2013. Molecular detection of Anaplasma, Bartonella, and Borrelia species in ticks collected from migratory birds from Hong-do Island, Republic of Korea. Vector Borne Zoonotic Dis. 13, 215–225. 15

Kawahara, M., Rikihisa, Y., Lin, Q., Isogai, E., Tahara, K., Itagaki, A., Hiramitsu, Y., Tajima, T., 2006. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl. Environ. Microbiol. 72, 1102–1109. Kocan, K.M., de la Fuente, J., Guglielmone, A.A., Meléndez, R.D., 2003. Antigens and alternatives for control of Anaplasma marginale infection in cattle. Clin. Microbiol. Rev. 16, 698–712. Kocan, K.M., de la Fuente, J., Blouin, E.F., Coetzee, J.F., Ewing S.A., 2010. The natural history of Anaplasma marginale. Vet. Parasitol. 167, 95–107. Lew, A.E., Gale, K.R., Minchin, C.M., Shkap, V., de Waal, D.T., 2003. Phylogenetic analysis of the erythrocytic Anaplasma species based on 16S rDNA and GroEL (HSP60) sequences of A. marginale, A. centrale, and A. ovis and the specific detection of A. centrale vaccine strain. Vet. Microbiol. 92, 145–160. Liu, Z., Ma, M., Wang, Z., Wang, J., Peng, Y., Li, Y., Guan, G., Luo, J., Yin, H., 2012. Molecular survey and genetic identification of Anaplasma species in goats from central and southern China. Appl. Environ. Microbiol., 78, 464–470. M’ghirbi, Y., Ghorbel, A., Amouri, M., Nebaoui, A., Haddad, S., Bouattour, A., 2009. Clinical, serological, and molecular evidence of ehrlichiosis and anaplasmosis in dogs in Tunisia. Parasitol. Res., 104, 767–774. M’ghirbi, Y., Yaïch, H., Ghorbel, A., Bouattour, A., 2012. Anaplasma phagocytophilum in horses and ticks in Tunisia. Parasit. Vectors 30, 180. M'ghirbi, Y., Bèji, M., Oporto, B., Khrouf, F., Hurtado, A., Bouattour, A., 2016. Anaplasma marginale and A. phagocytophilum in cattle in Tunisia. Parasit. Vectors 9, 556. Nair, A.S., Ravindran, R., Lakshmanan, B., Sreekumar, C., Kumar, S.S., Raju, R., Tresamol, P.V., Vimalkumar, M.B. and Saseendranath, M.R., 2013. Bovine carriers of Anaplasma marginale and Anaplasma bovis in South India. Trop. Biomed. 30, 105–112.

16

Naranjo, V., Ruiz-Fons, F., Höfle, U., Fernandez de Mera, I. G., Villanúa, D., Almazán, C., Torina, A., Caracappa, S., Kocan, K.M., Gortázar, C., de La Fuente, J., 2006. Molecular epidemiology of human and bovine anaplasmosis in southern Europe. Ann. N. Y. Acad. Sci. 1078, 95–99. Ogden, N.H., Lindsay, L.R., Hanincová, K., Barker, I.K., Bigras-Poulin, M., Charron, D.F., Heagy, A., Francis, C.M., O'Callaghan, C.J., Schwartz, I., Thompson, R.A., 2008. Role of migratory birds in introduction and range expansion of Ixodes scapularis ticks and of Borrelia burgdorferi and Anaplasma phagocytophilum in Canada. Appl. Environ. Microbiol. 74, 1780–1790. Potgieter, F., van Rensburg, L., 1987. Tick transmission of Anaplasma centrale. Onderstepoort J. Vet. Res. 54, 5–7. Rar, V., Golovljova, I., 2011. Anaplasma, Ehrlichia, and "Candidatus Neoehrlichia" bacteria: Pathogenicity, biodiversity, and molecular genetic characteristics, a review. Infect. Genet. Evol. 11, 1842–1861. Rikihisa, Y., 1991. The tribe Ehrlichieae and ehrlichial diseases. Clin. Microbiol. Rev. 4, 286–308. Torina, A., Alongi, A., Naranjo, V., Estrada-Peña, A., Vicente, J., Scimeca, S., Marino, A.M., Salina, F., Caracappa, S., de la Fuente, J., 2008. Prevalence and genotypes of Anaplasma species and habitat suitability for ticks in a Mediterranean ecosystem. Appl. Environ. Microbiol. 74, 7578– 7584. Torina, A., Agnone, A., Blanda, V., Alongi, A., D’Agostino, R., Caracappa, S., Marino, A.M.F., Di Marco, V., de la Fuente, J., 2012. Development and validation of two PCR tests for the detection of and differentiation between Anaplasma ovis and Anaplasma marginale. Ticks Tick-borne Dis. 3, 283–287. Worthington, R.W. and Bigalke, R.D., 2001. A review of the infectious diseases of African wild ruminants. Onderstepoort J. Vet. Res. 68, 291–323. Zobba, R., Anfossi, A.G., Pinna Parpaglia, M.L., Dore, G.M., Chessa, B., Spezzigu, A., Rocca, S., Visco, S., Pittau, M., Alberti, A., 2014. Molecular investigation and phylogeny of Anaplasma

17

spp. in Mediterranean ruminants reveal the presence of neutrophil-tropic strains closely related to A. platys. Appl. Environ. Microbiol. 80, 271–280.

18

Figure legends Figure 1 Prevalence (A) and co-infection (B) rates of detected Anaplasma spp. in analyzed cattle according to seasons. Abbreviation: *

: Statistically significant test; Am: Anaplasma marginale; Ac: Anaplasma centrale; Ab: Anaplasma

bovis.

Figure 2 Prevalence rate profiles of Anaplasma marginale (A), A. centrale (B) and A. bovis (C) in tested cattle from each bioclimatic area according to seasons. Abbreviation: *

: Statistically significant test.

Figure 3 Co-infection rate profiles between Anaplasma marginale and A. centrale (A), Anaplasma marginale and A. bovis (B), A. centrale and A. bovis (C), and Anaplasma marginale, A. centrale and A. bovis (D) in tested cattle from each bioclimatic area according to seasons. Abbreviation: *

: Statistically significant test; Am: Anaplasma marginale; Ac: Anaplasma centrale; Ab: Anaplasma

bovis.

19

20

21

22

Table 1 Primers used for detection and/or characterization of Anaplasma species in cattle in the present study. Assay PCR 11 Anaplasma spp. PCR 22 A. bovis A. centrale PCR3 A. marginale PCR4 A. marginale Nested PCR5 A. phagocytophilum

Primer

Sequence 5’ to 3’

Target gene

Amplicon size (bp)

Reference

EE-1 EE-2

TCCTGGCTCAGAACGAACGCTGGCGGC AGTCACTGACCCAACCTTAAATGGCTG

16S rRNA

1433

Barlough et al. (1996)

AB1f AB1r AC1f AC1r

CTCGTAGCTTGCTATGAGAAC TCTCCCGGACTCCAGTCTG CTGCTTTTAATACTGCAGGACTA ATGCAGCACCTGTGTGAGGT

16S rRNA

551

Kawahara et al. (2006)

16S rRNA

426

Kawahara et al. (2006)

AmargMSP4Fw AmargMSP4Rev

CTGAAGGGGGAGTAATGGG GGTAATAGCTGCCAGAGATTCC

msp4

344

Torina et al. (2012)

MSP45 MSP43

GGGAGCTCCTATGAATTACAGAGAATTGTTTAC CCGGATCCTTAGCTGAACAGGAATCTTGC

msp4

852

de la Fuente et al. (2005)

EphplgroEL-F EphplgroEL-R EphplgroEL-F EphgroEL-R

ATGGTATGCAGTTTGATCGC TCTACTCTGTCTTTGCGTTC ATGGTATGCAGTTTGATCGC TTGAGTACAGCAACACCACCGGAA

groEL

624

Alberti et al. (2005)

573

1

: First PCR allowing the detection of all Anaplasma species. : Second PCR allowing the specific detection of A. bovis and A. centrale. 3 : Single PCR allowing the specific detection of A. marginale. 4 : Single PCR allowing the characterization of A. marginale after sequencing of the PCR product using the same primers. 5 : Hemi-nested PCR allowing the specific detection of A. phagocytophilum. 2

23

Table 2 Designation and information about sequencing of Anaplasma spp. genetic variants identified in this study. Anaplasma spp.

Gene

Sequence type

Isolate

Geographical GenBank location (Rn1) accession no.

BLAST analysis

A. marginale

msp4

AmBv1

M1

Bizerte (Bz1)

KY362501

99% A. marginale (KF739431)

M2

Bizerte (Bz3)

KY362502

99% A. marginale (KF739431)

M3

Bizerte (Bz8)

KY362503

99% A. marginale (KF739431)

M4

Bizerte (Bz12) KY362504

99% A. marginale (KF739431)

AmBv2

M5

Nabeul (N6)

KY362505

100% A. marginale (KF739431)

AcBv1

C1

Ariana (A6)

KY362530

100% A. centrale (KM401896)

C2

Bizerte (Bz4)

KY362531

100% A. centrale (KM401896)

C3

Bizerte (Bz6)

KY362532

100% A. centrale (KM401896)

C4

Bizerte (Bz7)

KY362533

100% A. centrale (KM401896)

C5

Bizerte (Bz12) KY362534

100% A. centrale (KM401896)

C6

Bizerte (Bz14) KY362535

100% A. centrale (KM401896)

C7

Bizerte (Bz3)

KY362536

100% A. centrale (KM401896)

C8

Bizerte (Bz5)

KY362537

100% A. centrale (KM401896)

C9

Bizerte (Bz9)

KY362538

100% A. centrale (KM401896)

C10

Bizerte (Bz13) KY362539

100% A. centrale (KM401896)

A. centrale

16S rRNA

24

C11

Nabeul (N15)

KY362540

100% A. centrale (KM401896)

C12

Ariana (A5)

KY362541

100% A. centrale (KU686784)

C13

Nabeul (N16)

KY362542

100% A. centrale (KU686784)

C14

Ariana (A10)

KY362543

100% A. centrale (KU686784)

C15

Bizerte (Bz2)

KY362544

100% A. centrale (KU686784)

C16

Nabeul (N2)

KY362545

100% A. centrale (KU686784)

B1

Bizerte (Bz3)

KY362521

100% A. bovis (KM285223, KM285224, KM401904)

B2

Bizerte (Bz4)

KY362522

100% A. bovis (KM285223, KM285224, KM401904)

B3

Bizerte (Bz7)

KY362523

100% A. bovis (KM285223, KM285224, KM401904)

B4

Bizerte (Bz9)

KY362524

100% A. bovis (KM285223, KM285224, KM401904)

B5

Bizerte (Bz12) KY362525

100% A. bovis (KM285223, KM285224, KM401904)

B6

Bizerte (Bz13) KY362526

100% A. bovis (KM285223, KM285224, KM401904)

B7

Bizerte (Bz14) KY362527

100% A. bovis (KM285223, KM285224, KM401904)

AbBv2

B8

Bizerte (Bz5)

KY362528

99% A. bovis (KM285223, KM285224, KM401904)

AbBv3

B9

Bizerte (Bz6)

KY362529

99% A. bovis (KM285223, KM285224, KM401904)

AcBv2

A. bovis

1

16S rRNA

AbBv1

Rn : Reference number.

25

Table 3 Diversity among nucleotide and amino acid msp4 sequences from Anaplasma marginale (805 bp) and among nucleotide 16S rRNA sequences from Anaplasma centrale (383 bp) and Anaplasma bovis (511 bp) isolated from Tunisian strains. Anaplasma Variant sp. (Gene) A. marginale (msp4) AmGBv 1AmGBv AmGBv 2 AmGBv4 3 AmGBv AmGBv 5 AmGBv 6 AmGBv 7 AmGBv 8 9 AmBv1 AmBv2 A. centrale (16S AcGBv1 rRNA) AcGBv2 AcGBv3 AcGBv4 AcGBv5 AcGBv6 AcBv1 AcBv2 A. bovis

Genbank 1

KJ512166 KJ512167 KJ512168 KJ512169 KJ512170 KJ512171 KJ512172 KJ512173 KJ512174 KY36250 1 KY36250 5 KM40189 6 KM40189 7 KM40189 8 KM40189 9 KM40190 0 KM40190 1 KY36253 0 KY36254 1

Nucleotide positions (amino acid positions) 2

Reference

81

87

148 (50)

206 (69)

227 (76)

242 (81)

270

312

324

354

384 (128)

397 (133)

423

489

564

742 (248)

798

G A * A * * A * A * *

A * * * * * * * G * *

G (G) * * * * * * * A (S) * *

G (S) * * * * * * * A (N) * *

G (R) * * * * * * * * C (T) *

G (S) * * * * * * * * C (T) *

A G G G * G G * * G G

A G G G * G G * * G G

G A A A * A A * * A A

G A * * * * * * A * *

C (S) * * * * * * * G (R) * *

C (A) * * * * * * * G (G) * *

A G G * * G * * G * *

C * * * T * T T T * *

G A A * * A * * A * *

A (I) * C (L) * * * * * * * *

G * A A A A * * A * *

622 T * * A * * * *

793 G T T T T T * T

962 C * T T * * * *

963 C * * * T * * *

971 G * A * * * * *

980 G * * * * C * *

82

83

94

105

166

Belkahia et al. (2015)

This study

Belkahia et al. (2015)

This study

26

(16S rRNA)

AbGBv1 AbGBv2 AbGBv3 AbGGo1 AbGOv1 AbGOv2 AbBv1 AbBv2 AbBv3

KM40190 2 KM40190 3 KM40190 KM28522 4 KM28522 3 KM28522 4 KY36252 5 KY36252 1 KY36252 8 9

G A A A A * A A C

T * * * * * * * G

C * * * * * * A *

T * * * * * * * C

T * A A A * A A A

Belkahia et al. (2015) Ben Said et al. (2015) This study

1

: GenBank accession number. AmBv1 variant was also deposited under accession numbers KY362502- KY362505, AcBv1 variant was also deposited under accession numbers KY362531- KY362540, AcBv2 variant was also deposited under accession numbers KY362541- KY362545, AcBv1 variant was also deposited under accession numbers KY362531- KY362540, AbBv1 variant was also deposited under accession numbers KY362522KY362527. 2 : Numbers represent the nucleotide position starting at translation initiation codon Adenine with respect to the Stillwater 2 strain for Anaplasma marginale from USA (GenBank accession number JN558825), the A. centrale South-African vaccine strain (GenBank accession number AF414868) and the isolate G55 (clone 55) from China for A. bovis (GenBank accession number JN558825). Conserved nucleotide positions relative to the first sequence are indicated with asterisks. Amino acid changes are indicated between parentheses with single letter code. Amino acids: G, Glycine; S, Serine; A, Alanine; I, Isoleucine; L, Leucine; R, Arginine; N, Asparagine; T, Threonine. Nucleotides: T, Thymine; C, Cytosine; G, Guanine; A, Adenine.

27