Spatiotemporal expression pattern of non-clustered protocadherin family members in the developing rat brain

Neuroscience 147 (2007) 996 –1021

SPATIOTEMPORAL EXPRESSION PATTERN OF NON-CLUSTERED PROTOCADHERIN FAMILY MEMBERS IN THE DEVELOPING RAT BRAIN S.-Y. KIM, H. SUN CHUNG, W. SUN* AND H. KIM*

The nervous system is composed of a large variety of distinct groups of neurons which are specifically connected to each other in a precise manner. It has been proposed that topographic neural connections are established through complementary expression of chemoaffinity labels in projecting neurons and their final targets (Sperry, 1963). Cadherin superfamily molecules have been implicated as candidates for the “lock-and-key” components of Sperry’s hypothesis, because of their diversity (at least 100 members), enrichment at neuronal synapses, and their adhesive homophilic affinity (Yagi and Takeichi, 2000). Among the various subfamily of cadherins, the protocadherins (PCDHs) represent the largest subgroup with about 80 members (Tepass et al., 2000; Frank and Kemler, 2002). One unique feature of PCDH family is that more than 50 of these PCDH genes are arranged as three clusters (PCDH␣, PCDH␤, and PCDH␥) on a human chromosome 5q31 (Wu and Maniatis, 1999; Sugino et al., 2000). In addition to these clustered PCDHs, there are growing lists of phylogenetically distinct PCDHs scattered in the genome. Most of them share a conserved cytoplasmic motif and constitute the newly defined subfamily of ␦-PCDHs (Frank and Kemler, 2002; Redies et al., 2005; Vanhalst et al., 2005). Although the expression patterns of many non-clustered PCDHs were only limitedly available, detailed expression patterns of a subset of PCDHs have been analyzed (Hirano et al., 1999; Aoki et al., 2003; Vanhalst et al., 2005). Interestingly, these results suggest that the expressions of PCDHs are observed to the specific neuronal circuits or specific brain regions (Hirano et al., 1999; Aoki et al., 2003; Vanhalst et al., 2005). For instance, the expression pattern of PCDH10 has been shown to be correlated with visual and limbic neuronal circuits (Hirano et al., 1999; Aoki et al., 2003; Muller et al., 2004). The expressions of some PCDHs (PCDH7, PCDH9 and PCDH11) were also reported to be regionally restricted to the specific brain regions, although such neural circuit-dependencies were not clearly explored (Vanhalst et al., 2005). These results suggest that PCDHs play a role as a molecular tag for the recognition of neural circuits (Aoki et al., 2003; Vanhalst et al., 2005). To expand these initial suggestions, here we comparatively examined the expression pattern of 12 different members of non-clustered PCDHs (PCDH1, PCDH7, PCDH8, PCDH9, PCDH10, PCDH11, PCDH15, PCDH17, PCDH18, PCDH19, PCDH20 and PCDH21) in postnatal day 3 (P3) rat brains. Each PCDH exhibited a distinct brain region–specific expression pattern, suggesting that each neuronal population expresses a different

Department of Anatomy, Division of Brain Korea 21, Biomedical Science, Korea University College of Medicine, Anam-Dong, SungbukGu, Seoul 136-705, Korea

Abstract—Protocadherins (PCDHs) consist of the largest subgroup of the cadherin superfamily, and most PCDHs are expressed dominantly in the CNS. Because PCDHs are involved in the homophilic cell– cell adhesion, PCDHs in the nervous system have been suggested to play roles in the formation and maintenance of the synaptic connections. Although many PCDHs (>50) are in tandem arranged as a cluster in a specific chromosome locus, there are also considerable numbers of non-clustered PCDH members (⬃20). In this study, we examined the spatiotemporal distribution of mRNAs for 12 non-clustered PCDHs in rat brain using in situ hybridization. Some of them (PCDH1, PCDH7, PCDH9, PCDH10, PCDH11, PCDH17, and PCDH20) exhibited regiondependent expression pattern in the cerebral cortex during the early postnatal stage (P3), which is a critical period for the establishment of specific synaptic connections: PCDH7 and PCDH20 mRNAs were predominantly expressed in the somatosensory (parietal) and visual (occipital) cortices, whereas PCDH11 and PCDH17 mRNAs were preferentially expressed in the motor (forelimb and hindlimb areas) and auditory (temporal) cortices, and PCDH9 mRNA was highly expressed in the motor and main somatosensory cortices. These PCDHs were also expressed in the specific regions of the connecting thalamic nuclei. These cortical regionalization and thalamic nuclei-specificity appeared to be most distinct in P3 compared with those of embryonic and adult stages. Taken together, these results suggest that PCDHs may play specific roles in the establishment of selective synaptic connections of specific modality of cerebral cortex with other communicating brain regions such as the thalamus. © 2007 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: cell adhesion molecules, cerebral cortex, thalamus, development, in situ hybridization. *Corresponding author. Tel: ⫹82-2-920-6404 (W. Sun), ⫹82-2-9206153 (H. Kim); fax: ⫹82-2-929-5696. E-mail address: [email protected] (W. Sun), kimhyun@korea. ac.kr (H. Kim). Abbreviations: A, auditory (temporal) cortex; AXPC, axial protocadherin; CA1, fields of CA1 of Ammon’s horn in hippocampus; CA3, fields of CA3 of Ammon’s horn in hippocampus; cDNA, complementary DNA; cRNA, complementary RNA; DLG, dorsal lateral geniculate; E, embryonic day; ISH, in situ hybridization; L, lateral area; LD, laterodorsal thalamic nucleus; M, motor (forelimb and hindlimb areas) cortex; Me, medial area; MG, medial geniculate; ML, mediolateral, somatosensory area; M-MLVRT, Moloney murine leukemia virus reverse transcriptase; P, postnatal day; RT-PCR, reverse transcriptase–polymerase chain reaction; PBS, phosphate-buffered saline; PCDH, protocadherin; S1, main somatosensory cortex; S2, associative somatosensory cortex; V, visual cortex; VL, ventrolateral thalamic nucleus; VM, ventromedial thalamic nucleus; VP, ventroposterior thalamic nucleus.

0306-4522/07$30.00⫹0.00 © 2007 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2007.03.052

996

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

repertoire of PCDHs. Especially, several PCDHs were expressed dominantly in the cerebral cortical subregions. We further explored whether the major connecting thalamic nuclei express the same set of PCDHs. Our comprehensive analyses of the spatiotemporal expression of PCDHs support the original notion that they play a significant role in the establishment of specific neural circuits during the early postnatal development.

EXPERIMENTAL PROCEDURES Animals Animals were maintained on a controlled 12-h ligh/dark cycle and killed during the dark cycle. After decapitation, brains were rapidly removed and frozen into the cooled isopentane on dry ice and stored at ⫺70 °C prior to cryostat sectioning and in situ hybridization (ISH) analyses. For the reverse-transcriptase–polymerase chain reaction (RT-PCR) experiments, animals were rapidly decapitated, and brains were removed, sliced by Vibratome, dissected in the neocortex, frozen in liquid nitrogen and stored at ⫺70 °C. All experiments were designed to minimize the number of animals used, and every effort was made to treat animals humanely. All experiments were carried out in accordance with the Animal Care and Use Committee of Korea University and international guidelines on the ethical use of animals.

Preparation of probes For preparation of probes, complementary DNAs (cDNAs) were generated by RT-PCR of total RNA isolated from P1 rat brain. The amplified fragments and PCR primer sets are summarized in Table 1. Whereas primer pairs for most PCDHs were designed based on rat cDNA sequences, PCDH1 and PCDH19 probes were designed from rat genomic DNA sequences. Since some PCDHs (PCDH1, PCDH7, PCDH8, PCDH9, PCDH10, PCDH11

997

and PCDH15) have several isoforms, we used probes which detect all known isoforms. All probes prepared were verified by sequencing the PCR products. Sense and antisense riboprobes were prepared using in vitro transcription system (Promega, Madison, WI, USA) in the presence of [␣-35S] UTP (Amersham Pharmacia Biotech, Piscataway, NJ, USA).

ISH ISH histochemistry was carried out as previously described (Kim et al., 1994), with minor modifications. Fresh-frozen tissues were sagittally or coronally sectioned and adhered onto TESPA-coated glass slides. Sections were fixed in 4% paraformaldehyde, washed with phosphate-buffered saline (PBS), and acetylated with 0.25% acetic anhydrides in 0.1 M triethanolamine/0.9% NaCl (pH 8.0). The sections on each slide were then hybridized overnight with radiolabeled probe (1.2⫻106 cpm) and washed four times with 2⫻ SSC. Following treatment with RNase A (20 ␮g/ml) for 30 min at 37 °C, slides were sequentially rinsed in 2⫻ SSC, 1⫻ SSC, 0.5⫻ SSC, and 0.1⫻ SSC containing 1 mM dithiothreitol for 10 min each at room temperature. Subsequently, sections were washed in 0.1⫻ SSC at 60 °C. After dehydration through an ascending alcohol series and air-drying, the sections along with [14C] standards (ARC 146C, American Radiolabeled Chemicals, St. Louis, MO, USA) were exposed to X-ray film (Biomax MR, Kodak, Rochester, NY, USA). The relative intensity of complementary RNA (cRNA) signals was evaluated by six gradations (⫹⫹⫹⫹, very strong; ⫹⫹⫹, strong; ⫹⫹, moderate; ⫹, light; ⫾, faint; 0, not detectable). Although probes with different specific activities were used and there is no quantitative value for comparisons of different PCDH levels, identical experimental conditions and same criteria were applied for evaluation of relative expression levels. The non-detectable signals were determined by nonspecific signal levels obtained from sense probes. For the cerebral cortical and thalamic subregions, at least two different sections of four animals were measured with Scion image pro-

Table 1. Summary for primers used in this study PCDH name

Primer sequences

PCR product size (bps)

PCDH1

Upper: Lower: Upper: Lower: Upper: Lower: Upper: Lower: Upper: Lower: Upper: Lower: Upper: Lower: Upper: Lower: Upper: Lower: Upper: Lower: Upper: Lower: Upper: Lower:

555

PCDH7 PCDH8 PCDH9 PCDH10 PCDH11 PCDH15 PCDH17 PCDH18 PCDH19 PCDH20 PCDH21

tgacattgctggggatccag ctgtagtcggagtactgctc gggatccaagcggctggac tcggacacttgtaccagg cgcaacggtcaggtcaccta gcggcgtgtcccactgcag tcaccatcatgattgccatc ctgcactctgaggcactga cagcggccttatgagctg gtcggtcttggcggactc atgaaatggtgcgcaaaagc tcagaaacactgtagggatc tcttacatcctggagagatc gctcatttctgtcgatggct ttggagagcaacgccacg ctgctcaccacgttcatgac tatgatttggggcgagattc agctctggcggacatcttg cacctatgtctctatcaatc gtccggatctctttgttgtc gtaacagatgctgatgctgg acatagactctaccttcctatg gattcagaccaaggacaatc ctcttcttctcaaacttttg

Positions

Accession number Rat genomic sequence

670

685–1354

661

1582–2242

NM_022868

553

2438–2990

XM_224429

549

1684–2232

XM_342242

634

2348–2981

XM_228479

900

1130–2029

XM_342124

668

2082–2749

XM_224389

754

2686–3355

XM_227117

626

AY690613

Rat genomic sequence

739

1918–2656

XM_224417

480

2274–2753

XM_346480

998

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

gram (Scion, Frederick, MD, USA), and mean values were taken. Abbreviations are adopted from those of Paxinos et al. (1994).

Expression pattern of non-clustered PCDH members in P3 rat brain

Cytochrome oxidase histochemistry

We analyzed the expression pattern of PCDHs in P3 rat brain, and their mRNA distribution is summarized in Table 2. Relative labeling densities of PCDH signals in different brain regions were estimated mainly by visual inspection. Because each cRNA probe has different length and 35S-UTP incorporation, comparison of signal intensities among PCDH members does not have quantitative value, although the identical experimental conditions and same criteria for their evaluation were applied. For each PCDH, at least two different hybridizations (n⫽4) were carried out and typical autoradiographs were demonstrated. Although the expression patterns of some PCDHs (PCDH7, PCDH8, PCDH10, PCDH11 and PCDH21) in the postnatal brain had previously been reported (Hirano et al., 1999; Yamagata et al., 1999; Yoshida et al., 1999; Nakajima et al., 2001; Aoki et al., 2003; Vanhalst et al., 2005), these PCDHs were also examined in this study for the comparative approaches of their expressions using adjacent sections.

Cytochrome oxidase histochemistry was performed to distinguish thalamic nuclei as described (Zhang and Wong-Riley, 2000). Fixed sections were incubated for 3– 4 h at 37 °C in PBS containing 0.03% cytochrome c (Sigma, St. Louis, MO, USA) and 0.05% DAB (diaminobenzidine), dehydrated, and mounted.

RNA extraction and RT-PCR Total RNAs were extracted from microdissected cerebral cortical regions of P3 rat using RNeasy mini kit (Quiagen, Hilden, Germany). Neocortical regions of the slices were dissected into three parts (medial, mediolateral and lateral) with tungsten needles. For the RT-PCR, first-strand cDNAs were synthesized from 1 ␮g of mRNA template in 20 ␮l reaction buffer containing 200 units of Moloney murine leukemia virus reverse transcriptase (M-MLVRT), 20 units of RNase inhibitor, 0.5 ␮g of random hexamers, 0.5 ␮g of Oligo(dT) 15 primers, 4 ␮l of 10 mM dNTPs and 1⫻ M-MLVRT reaction buffer (Promega). The reaction mixtures were diluted and subjected to PCR amplification. Amplification was carried out for several different cycle numbers (28, 30 or 35 cycles), depending on the primer sets. Each cycle consisted of the following steps: initial denaturation at 94 °C for 3 min, 28 –35 cycles of 94 °C for 30 s, 50 or 56 °C for 30 s, and 72 °C for 30 s and final extension at 72 °C for 5 min. PCR products were electrophoresed on an agarose gel and visualized using ethidium bromide. Relative quantities of GAPDH and PCDH PCR products were determined by Scion image program. The data were represented as an average of six experiments.

Statistical analysis Results were subjected to statistical analysis using the program SPSS-Windows (SPSS, Inc., Chicago, IL, USA). Experiments with two groups were analyzed for differences using the Student’s t-test, with significance determined at P⬍0.05. Experiments with three groups were subjected to statistical analyses using one-way ANOVA (post hoc LSD test), with significance determined at P⬍0.05. Data are expressed as means⫾S.E.M.

RESULTS Diverse spatiotemporal expression pattern of non-clustered PCDH mRNAs in embryonic rat brain The expression pattern of 12 members of non-clustered PCDH family (PCDH1, PCDH7, PCDH8, PCDH9, PCDH10, PCDH11, PCDH15, PCDH17, PCDH18, PCDH19, PCDH20 and PCDH21) in embryonic rat brain was examined by ISH (Fig. 1), whereas three identified non-clustered PCDH family members (PCDH12, PCDH16 and ␮-PCDH) were excluded, because they have been known to be marginally or not expressed in the CNS (Goldberg et al., 2000; Nakajima et al., 2001; Rampon et al., 2005). On embryonic day (E) 18, most PCDHs were expressed predominantly in the nervous system with moderate to marginal signals in the peripheral tissues. However, the expression of PCDH18 was relatively ubiquitous in whole embryo except in the heart and liver as previously reported (Homayouni et al., 2001), and the expressions of PCDH1 and PCDH7 were also detected in the intestine and heart, respectively. On the other hand, PCDH20 and PCDH21 were detected only marginally in this embryonic stage.

PCDH1 PCDH1 (previously called PCDH42) is an ortholog of axial protocadherin (AXPC) in the frog Xenopus laevis and zebrafish (Kuroda et al., 2002). PCDH1 mRNA was widespread throughout the P3 rat brain (Fig. 2A–H). PCDH1 mRNA was highly expressed in the mitral cell layer of olfactory bulb (Fig. 2A), anterior olfactory nucleus (Fig. 2B) and piriform cortex (Fig. 2C). The cerebral cortex exhibited light to moderate level of PCDH1 mRNA across areas and layers (Fig. 2B–G). In the CA1–CA3 field of Ammon’s horn in the hippocampus, strong PCDH1 mRNA expression was observed (Fig. 2D–F). In the amygdaloid complex, strong mRNA expression of PCDH1 was found in the medial nucleus and posterior cortical nuclei (Fig. 2E and F). Strong expression of PCDH1 mRNA was also found in the ventromedial hypothalamic nucleus (Fig. 2E and F). In the brainstem, moderate level of the expression was found in the inferior colliculus (Fig. 2H). PCDH7 PCDH7 was also called BH-PCDH (BH-Pcdh) because of its prominent expression in the brain and heart (Yoshida et al., 1998), and its ortholog is NF-PCDH (NFPC) in Xenopus laevis (Heggem and Bradley, 2003). There are three known isoforms (isoform 7a, 7b, and 7c), and PCDH7a and PCDH7c were persistently expressed in the brain and heart during the development, whereas PCDH7b was elevated in neonatal stage of the brain (Yoshida, 2003). PCDH7 was reported to be expressed in specific brain nuclei and restricted cortical regions (Vanhalst et al., 2005). Using probe which detects all these three isoforms, we observed that the expression of PCDH7 mRNA was faint to moderate in P3 rat brain. In olfactory bulb, PCDH7 signal was found in the mitral cell layer (Fig. 3A). The expression of PCDH7 mRNA in the neocortex was regiondependent: PCDH7 mRNA labeling was denser in the

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

999

Fig. 1. Expression pattern of non-clustered PCDHs in embryonic rats (E18). In situ hybridization was performed using specific probes for PCDH1, PCDH7, PCDH8, PCDH9, PCDH10, PCDH11, PCDH15, PCDH17, PCDH18, PCDH19, PCDH20 and PCDH21 on sagittal sections of E18 embryos. Probes were designed to detect all known isoforms of each PCDH. Experiments were performed in at least triplicate, and typical images are presented. FB, forebrain; Ht, heart; I, intestine; L, liver; SC, spinal cord. Scale bar⫽5 mm.

parietal cortex (area 1) and occipital cortex than in other cortical areas (Fig. 3C–G). In the brainstem, the moderate

level of PCDH7 mRNA was found in the anterior pretectal nucleus, superior colliculus, and inferior colliculus (Fig. 3G

1000

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

and H). In the cerebellar cortex, the expression of PCDH7 mRNA showed alternative clustering pattern in external granule cell layer (Fig. 3H). PCDH8 PCDH8 (paraxial PCDH; PAPC) was identified together with PCDH1 (AXPC) in a screen for genes involved in anterior/posterior polarity of prenotochord at the neurular stage in Xenopus (Yamamoto et al., 1998, 2000; Kuroda et al., 2002). PCDH8 has two isoforms, containing 974 and 1071 amino acids by alternative splicing (Makarenkova et al., 2005). The longer variant (designated isoform1) was predominantly expressed in the brain (Makarenkova et al., 2005), and its mRNA is transiently induced in hippocampal granule cells by seizures (Yamagata et al., 1999). As seen in Fig. 4A, in olfactory bulb, very strong expression of PCDH8 mRNA was observed in the internal plexiform layer and internal granular layer, and dense PCDH8 signal was also noticed in the olfactory ventricle where olfactory neuroblasts are enriched. Strong expression of PCDH8 mRNA was observed in the subventricular zone of caudate putamen (Fig. 4C). In cerebral cortex, PCDH8 mRNA expression exhibited layer specificity: while superficial layers exhibited strong PCDH8 signals, layer 5 showed faint signal (Fig. 4B–G). In the hippocampal formation, strong expression of PCDH8 mRNA was observed in the CA1 field, and in the amygdaloid complex moderate level of PCDH8 was found (Fig. 4D–F). In the diencephalon,

distinct expression was observed in the medial habenular nucleus of epithalamus, ventral lateral geniculate nucleus of thalamus, anterior nucleus of hypothalamus, and arcuate nucleus of hypothalamus (Fig. 4D–F). In the brainstem, moderate level of the expression was found in the anterior pretectal nucleus and superior colliculus (Fig. 4G). PCDH9 PCDH9 mRNA was reported to be expressed in the brain and other tissues of human and mouse (Strehl et al., 1998). PCDH9 mRNA was reported to be expressed in olfactory bulb, subregions of cerebral cortex, hippocampus and caudate putamen (Vanhalst et al., 2005), although its expression pattern in early postnatal brain was not analyzed with detailed description. In the present study, we found that PCDH9 mRNA was expressed moderate to high levels in the P3 rat brain. Dense PCDH9 cRNA labeling was distinct in the mitral cell layer of olfactory bulb (Fig. 5A) and very strong expression was found in the piriform cortex (Fig. 5C). Expression of PCDH9 mRNA in cerebral cortex was dependent on the region: PCDH9 cRNA labeling in parietal cortex (area 1) and occipital cortex was denser, and that in temporal cortex was less dense than in other cortical areas (Fig. 5C–G). Such cortical regionalization was more apparent in the superficial cortical layers. In hippocampal formation, PCDH9 cRNA labeling was strong in the CA3 field and dentate gyrus (Fig. 5D–F).

Abbreviations used in the figures Acb AD AH Amg AON APT Arc AV BL Cbll Ce Cg CM CPu DG DM EPl FL Fr Gl GP Hb HL IC IGr; IOM IPl La LHb LOT LP

accumbens nuclei anterodorsal thalamic nucleus anterior hypothalamic nucleus amygdaloid nuclei anterior olfactory nuclei anterior pretectal nucleus arcuate hypothalamic nucleus anteroventral thalamic nucleus basolateral amygdaloid nucleus cerebellum central amygdaloid nucleus cingulate cortex central medial nucleus caudate putamen dentate gyrus in hippocampus medial hypothalamic nucleus external plexiform layer forelimb area of cortex frontal cortex glomerular layer of olfactory bulb globus pallidus habenular nuclei hindlimb area of cortex inferior colliculus internal granular layer medial nucleus of inferior olive internal plexiform layer lateral amygdaloid nucleus lateral habenular nucleus lateral olfactory nuclei lateral posterior thalamic nucleus

Me MHb Mi MT Oc opt Orb OV Par Par1 Par2 PC Pir PLCo PLMo PV Rt S SC SCh SN STh svz Te TT Tu Ve VLG VMH

medial amygdaloid thalamic nucleus medial habenular nucleus mitral cell layer medial terminal nucleus accessory optic tract occipital cortex optic tract orbital cortex olfactory ventricle parietal cortex parietal cortex (area 1) parietal cortex (area 2) paracentral nucleus piriform cortex posterolateral cortical amygdaloid nucleus posteromedial cortical amygdaloid nucleus paraventricular thalamic nucleus reticular nucleus subiculum of hippocampal formation superior colliculus suprachiasmatic nucleus substantia nigra subthalamic nucleus subventricular zone temporal cortex tenia tecta olfactory tubercle vestibular nucleus ventral lateral geniculate thalamic nucleus ventromedial hypothalamic nucleus

Table 2. Regional labeling densities for nonclustered PCDH cRNA probes in P3 rat brain Region

PCDH7

PCDH8

PCDH9

PCDH10

PCDH11

PCDH15

PCDH17

PCDH18

PCDH19

PCDH20

PCDH21

⫹ ⫹⫹⫹ ⫹ ⫹

⫾ ⫹ ⫾ ⫾

⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹

⫾ ⫹⫹ ⫹ ⫹

⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹⫹

0 ⫹⫹ 0 0

0 ⫹ ⫹ 0

⫾ ⫹ 0 ⫹

⫹ ⫹ ⫾ ⫹

0 ⫹ 0 0

0 ⫹ ⫹ ⫹

0 ⫹⫹⫹⫹ 0 0

⫹⫹ ⫹ ⫹⫹ ⫹⫹ ⫹

⫹ ⫹/⫹⫹ ⫹ ⫹ ⫾/⫹

⫹⫹⫹⫹ ⫹⫹⫹⫹ ⫹⫹⫹⫹ ⫹⫹⫹⫹ ⫾/⫹

⫹⫹ ⫹⫹/⫹⫹⫹ ⫹ ⫹⫹⫹ ⫾/⫹⫹

⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹/⫹⫹⫹

⫹⫹ ⫹/⫹⫹ ⫹⫹ ⫹ ⫾

⫾ ⫾ ⫾ ⫾ ⫾

⫹⫹⫹⫹ ⫹/⫹⫹ ⫹⫹ ⫹ ⫾/⫹⫹⫹⫹

⫹ ⫹ ⫹ ⫹ ⫹

⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫾/⫹

⫾ ⫹ ⫾ ⫹ ⫾

0 0 0 0 ⫹

⫹⫹⫹ ⫹⫹⫹⫹ ⫹

⫹ ⫹ ⫾

⫹⫹⫹⫹ ⫹⫹ ⫹⫹

⫹⫹ ⫹⫹⫹ ⫹⫹⫹

⫹ ⫹ ⫾

⫾ ⫾ ⫾

⫾ 0 ⫾

⫹⫹⫹ ⫹⫹⫹ ⫹⫹

⫾ ⫾ 0

⫹⫹⫹ ⫹⫹⫹ ⫾

⫹ ⫹⫹⫹ ⫹⫹

0 0 0

⫾ ⫹⫹ ⫹⫹⫹ ⫹⫹⫹

⫾ ⫹ ⫹ ⫹

⫹ ⫹⫹ ⫹⫹ ⫹⫹⫹

⫹ ⫹⫹⫹ ⫹⫹ ⫹

⫾ ⫹⫹⫹ ⫹⫹ ⫹

⫾ ⫹ ⫹⫹ ⫹⫹

0 ⫾ ⫾ ⫾

⫹ ⫹⫹ ⫹⫹⫹⫹ ⫹⫹⫹⫹

⫹ ⫾ ⫹⫹ ⫾

0 ⫹⫹ ⫹⫹ ⫹⫹

0 ⫾ 0 ⫾

0 ⫾ 0 0

⫹ ⫾ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹

⫾ ⫾ ⫾ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫾

0 0 ⫾ 0 0 0 0 0 0 ⫹⫹

⫹⫹⫹⫹ ⫾ ⫹⫹⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹⫹ ⫾ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹

⫾ 0 ⫹ ⫹⫹ ⫹⫹ ⫹ ⫾ 0 ⫹ ⫹

⫾ 0 ⫾ ⫹ ⫾ 0 ⫹⫹ 0 0 ⫹⫹

0 0 0 0 0 0 0 0 ⫾ ⫹

⫹⫹ 0 ⫾ ⫹⫹⫹ ⫾ ⫹⫹⫹ ⫹⫹⫹ ⫹ 0 ⫹⫹

0 0 0 0 0 0 0 0 0 0

⫹⫹⫹⫹ ⫾ ⫹ ⫹⫹ ⫹⫹ ⫹ ⫹ ⫾/⫹ ⫹ ⫹⫹

0 0 0 ⫾ 0 0 0 0 0 0

⫾ ⫾ ⫹ 0 0 0 0 0 0 0

⫹ ⫹ ⫹⫹⫹ ⫹

⫾ 0 ⫹ ⫹

⫹⫹ ⫹⫹ ⫹ ⫹⫹

⫹ ⫹⫹⫹ ⫹⫹⫹⫹ ⫹⫹

⫹ ⫹⫹⫹ ⫹⫹ ⫹⫹

⫾ 0 ⫹⫹ ⫾

⫾ 0 ⫹ 0

⫹⫹⫹ ⫹ ⫹⫹⫹ ⫹⫹

⫾ ⫹ ⫹ ⫹

⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹

0 0 0 ⫾

0 0 0 0

⫹ ⫹

⫾ ⫾

⫹⫹⫹ ⫹

⫹⫹⫹ ⫹

0 ⫹⫹⫹

⫾ ⫾

⫾ 0

⫹⫹ ⫹

⫾ ⫾

0 ⫹

0 0

⫾ 0

⫹ ⫹⫹ ⫹

⫹⫹ ⫹⫹ ⫹⫹

⫹⫹ ⫹ ⫹⫹

⫹⫹ ⫹⫹⫹ ⫹⫹⫹

⫹⫹ ⫾ ⫹⫹

⫹⫹ ⫹ ⫾

⫹ ⫹ ⫾

⫹⫹ ⫹ ⫹⫹⫹

⫹ ⫹ ⫾

⫹⫹ ⫹⫹ ⫹⫹

⫾ 0 0

⫾ ⫾ ⫾

1001

Labeling densities are as followings: ⫹⫹⫹⫹, very strong; ⫹⫹⫹, strong; ⫹⫹, moderate; ⫹, light; ⫾, faint; 0, not detectable.

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Olfactory bulb Glomerular-layer Mitral cell layer Internal plexiform layer Internal granular layer Cerebral cortex Frontal cortex (FL/HL) Parietal cortex Temporal cortex Occipital cortex Caudate putamen Hippocampal formation CA1 field of hippocampus CA3 field of hippocampus Dentate gyrus Amygdaloid complex Anterior cortical nucleus Lateral/basolateral nucleus Medial nucleus Posterior cortical nucleus Thalamus Anteroventral nucleus Anteromedial nucleus Anterodorsal nucleus Laterodorsal nucleus Lateroposterior nucleus Ventrolateral nucleus Ventromedial nucleus Ventroposterior nucleus Dorsolatral geniculate nucleus Ventrolateral geniculate nucleus Hypothalamus Anterior hypothalamic nucleus Suprachiasmatic nucleus Ventromedial nucleus Arcuate nucleus Epithalamus Medial habenula Lateral habenula Brainstem Superior colliculus Inferior colliculus Anterior pretectal nucleus

PCDH1

1002

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Fig. 2. Expression of PCDH1 mRNA in the postnatal day 3 rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

Across the amygdaloid complex, the intensity of PCDH9 cRNA labeling was moderate to strong (Fig. 5E and F): strong expression was observed in basolateral amygdaloid nucleus. In the thalamus, strong expression of PCDH9 mRNA was found in the anterodorsal nucleus,

anteroventral nucleus, ventrolateral nucleus (VL), ventroposterior nucleus (VP), dorsal lateral geniculate (DLG) nucleus, ventral lateral geniculate nucleus and intralaminar (centrolateral, paracentral and centromedial) nuclei (Fig. 5D–F). In other diencephalic regions,

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

1003

Fig. 3. Expression of PCDH7 mRNA in the postnatal day 3 rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Clustering pattern of PCDH7 expression in cerebellum is indicated by arrowheads in H. Inset also shows horizontal image. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

PCDH9 cRNA labeling was distinct in the medial habenular nucleus of epithalamus (Fig. 5E and F), and suprachiasmatic (Fig. 5D) and ventromedial nuclei of hypothalamus (Fig. 5E). In the brainstem, strong PCDH9

mRNA expression was observed in the anterior pretectal nucleus, medial terminal nucleus of accessory optic tract (Fig. 5G), inferior colliculus (Fig. 5H), and vestibular nucleus (Fig. 5H).

1004

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Fig. 4. Expression of PCDH8 mRNA in the postnatal day 3 rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

PCDH10 PCDH10 is also called OL-PCDH (OL-PC), because it is highly expressed in specific gray matter area of the olfactory and limbic systems of the mouse brain (Hirano et al.,

1999). The expression of PCDH10 has been relatively well studied in developing mouse and chicken brain: It is expressed in some local circuits of functional systems such as the olfactory system, nigrostriatal projection, olivocer-

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

1005

Fig. 5. Expression of PCDH9 mRNA in the postnatal day 3 rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

ebellar projection and visual system (Hirano et al., 1999; Luckner et al., 2001; Aoki et al., 2003; Muller et al., 2004). Consistently, the distinct expression of PCDH10 mRNA was observed in the nuclei related to the olfactory and limbic systems in the P3 rat brain. In the olfactory bulb,

PCDH10 mRNA was expressed densely in the glomerular layer, mitral cell layer, internal plexiform layer, and internal granular layer (Fig. 6A). Distinct signal of PCDH10 mRNA was found in the telencephalon including olfactory tubercle, cingulate cortex, accumbens nucleus, piriform cortex,

1006

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Fig. 6. Expression of PCDH10 mRNA in the postnatal day 3 rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

lateral/basolateral amygdaloid nuclei, nucleus of lateral olfactory tract, and caudate putamen (Fig. 6C–E). In the diencephalons, moderate to strong expression of PCDH10 mRNA was observed in lateral habenular nucleus of epithalamus, lateral posterior thalamic nucleus, lateral dorsal

thalamic nucleus, midline and intralaminar nuclei of thalamus (paraventricular, centromedial and paracentral nuclei), suprachiasmatic hypothalamic nucleus, ventromedial hypothalamic nucleus and arcuate nucleus (Fig. 6D–G). In the brainstem, very strong expression of PCDH10 mRNA

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

was observed in the medial nucleus of inferior olive, and relatively strong expression was found in the superior colliculus, anterior pretectal nucleus, and substantia nigra (Fig. 6G). The expression of PCDH10 mRNA was also observed in the restricted areas of external granule cell layer, which corroborate the previous report of Luckner et al. (2001). PCDH11 PCDH11 has more than 10 isoforms including PCDH11X and PCDH11Y (Yoshida and Sugano, 1999; Blanco-Arias et al., 2004; Vanhalst et al., 2005), and PCDH11 was reported to be expressed in specific brain nuclei and restricted cortical regions (Vanhalst et al., 2005). In the present study, we observed relatively well-matched brain region-specificity: distinct expression of PCDH11 mRNA was observed in the piriform cortex, zona incerta, subthalamic nucleus, ventromedial thalamic nucleus (VM), posteromedial cortical amygdaloid nucleus, and superior colliculus (Fig. 7E–G). Also, relatively strong expression of PCDH11 mRNA was observed in the mitral cell layer of olfactory bulb (Fig. 7A), anterior olfactory nucleus (Fig. 7B), and olfactory tubercle (Fig. 7C). In the forebrain, PCDH11 mRNA was highly expressed in the superficial layer of frontal (motor area; forelimb and hindlimb area), parietal (area 2) and temporal cortices (Fig. 7B–G). PCDH11 also exhibited restricted expression in the thalamic subregions (ventromedial and ventral lateral geniculate nuclei) (Fig. 7E and F). PCDH15 PCDH15 has been reported to be expressed in the neurosensory epithelia of the eye and ear although the expression in the other brain regions has not been explored. Mutations of PCDH15 are related to both Usher syndrome type 1F (USH1F) and non-syndromic recessive hearing loss (DFNB23) (Ahmed et al., 2003), suggesting the importance of PCDH15 in the CNS development. In P3 rat brain, the labeling of PCDH15 cRNA was very low in comparison to those of other non-clustered PCDH members. Distinct expression was found in the mitral cell layer of olfactory bulb (Fig. 8A), orbital cortex (Fig. 8B), cingulate cortex, olfactory tubercle (Fig. 8C), piriform cortex (Fig. 8D), ventrolateral geniculate thalamic nucleus (Fig. 8E) and superior/inferior colliculi (Fig. 8G and H). PCDH17 PCDH17 was previously called PCDH68 (Frank and Kemler, 2002). At present, little is known about the expression or function of this gene. In olfactory bulb, low level of PCDH17 mRNA was found in the glomerular, mitral cell, internal plexiform, and internal granular layers (Fig. 9A). The region- and layer-dependent expression pattern was observed in the cerebral cortex (Fig. 9B–G): PCDH17 mRNA expression was strong in the cingulate and frontal (motor area; forelimb and hindlimb area) cortices, and low to moderate in the parietal, temporal and occipital cortices.

1007

In caudate putamen, PCDH17 mRNA expression showed rostro-caudal gradient fashion: the signal in rostral part was very strong compared with that in caudal part (Fig. 9C–E), and PCDH17 mRNA was strongly expressed in accumbens nuclei (Fig. 9C). In the amygdaloid complex, very strong signal was observed in the medial and posterolateral/posteromedial cortical amygdaloid nuclei, and moderate level of expression was found in the lateral and basolateral nuclei (Fig. 9E and F). In thalamus, PCDH17 cRNA labeling was dense in some nuclei including laterodorsal, ventrolateral and ventromedial nuclei (Fig. 9E– F). Distinct expression of PCDH17 mRNA was ubiquitously observed in the hypothalamus, with strong expression in the anterior and ventromedial hypothalamic nuclei (Fig. 9D–F). Stripe-patchy pattern of PCDH17 mRNA expression was observed in the cerebellar cortex (Fig. 9H). PCDH18 PCDH18 was identified by a database search for molecules containing conserved cadherin cytoplasmic motifs (Wolverton and Lalande, 2001). PCDH18 mRNA is present in a variety of embryonic tissues, however in adult mice it is primarily expressed in lung and kidney (Homayouni et al., 2001). In the present study, the expression level of PCDH18 mRNA was found to be low generally. PCDH18 mRNA was uniformly expressed across the cortical areas with slightly denser signal in cingulate and orbital cortices (Fig. 10B–G). Moderate level of the expression was observed in the paraventricular thalamic nucleus (Fig. 10D), centromedial thalamic nucleus (Fig. 10E), medial amygdaloid nucleus (Fig. 10E) and external granular layer of the cerebellum (Fig. 10H). PCDH19 PCDH19 was identified by a database search along with PCDH18 (Wolverton and Lalande, 2001) and reported to be expressed in a variety of tissues including brain, heart, kidney, lung and trachea of mouse embryo (Wolverton and Lalande, 2001; Gaitan and Bouchard, 2006). In the cerebral cortex, strong expression of PCDH19 mRNA was observed in layer 4 (Fig. 11B–G). High level of PCDH19 transcripts was found in the CA1–CA3 field of the hippocampus and subiculum (Fig. 11E–G). In the diencephalon, dense labeling of PCDH19 cRNA was localized in the anteroventral thalamic nucleus, suprachiasmatic nucleus and ventromedial hypothalamic nucleus (Fig. 11D–F). In the brain stem, moderate expression was found in the anterior pretectal nucleus and superior/inferior colliculi (Fig. 11G and H). PCDH20 PCDH20 was also called PCDH13, and little is known about its expression in the brain (Imoto et al., 2006). PCDH20 mRNA expression was restricted to specific areas of P3 rat brain. Strong expression was observed in the CA3 field of the hippocampus (Fig. 12D and E) and tenia tecta of the accessory olfactory system (Fig. 12C). A similar level of PCDH20 mRNA expression was

1008

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Fig. 7. Expression of PCDH11 mRNA in the postnatal day 3 rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

found in the dentate gyrus (Fig. 12D and E). In olfactory bulb, a low level of PCDH20 mRNA was expressed in the glomerular layer, mitral cell layer, internal plexiform layer and internal granular layer (Fig. 12A). In cerebral

cortex, PCDH20 showed region-dependent and layerspecific expression pattern (Fig. 12B–G): The expression was observed in layer 4 of parietal and occipital cortex.

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

1009

Fig. 8. Expression of PCDH15 mRNA in the postnatal rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

PCDH21 PCDH21 was also called photoreceptor cadherin (prCAD), because it is highly expressed in the retinal

photoreceptors (Rattner et al., 2001). Later, the expression of PCDH21 was also identified in the olfactory bulb of rat and mouse (Nakajima et al., 2001; Nagai et al., 2005). Consistent with these results, we observed very

1010

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Fig. 9. Expression of PCDH17 mRNA in the postnatal rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Striped pattern of PCDH17 expression in cerebellum is indicated by arrowheads in H. Inset also shows horizontal image. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

strong expression of PCDH21 mRNA in the mitral and external plexiform layers of the olfactory bulb (Fig. 13A). Moderate expression of PCDH21 mRNA was also found in the anterior olfactory nuclei (Fig. 13B) and piriform

cortex (Fig, 13C–E), and low level of expression in other brain regions such as the caudate putamen (Fig. 13C and D), and paraventricular and anterodorsal thalamic nuclei (Fig. 13D–G).

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

1011

Fig. 10. Expression of PCDH18 mRNA in the postnatal rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

Region-dependent and layer-specific expression pattern of PCDH7, PCDH9, PCDH11, PCDH17 and PCDH20 mRNAs in cerebral cortex While examining the distribution of PCDH mRNAs in P3 rat cerebral cortex, we noticed that a subset of PCDHs exhib-

ited region-dependent expression patterns. Therefore, we further examined the cortical region-dependent and layerspecific expression pattern of PCDH7, PCDH9, PCDH11, PCDH17 and PCDH20 (Figs. 14 –17). The cortical regiondominant expression patterns of PCDH7 and PCDH20

1012

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Fig. 11. Expression of PCDH19 mRNA in the postnatal rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

mRNAs were in contrast to those of PCDH11 and PCDH17 mRNAs: PCDH7 and PCDH20 mRNAs were enriched in area 1 of parietal (main somatosensory cortex; S1) and visual (V) cortices, whereas their expressions were weak in area 2 of parietal cortex (associative somatosensory

cortex; S2) and motor (M) cortex. On the other hand, the expressions of PCDH11 and PCDH17 were high in motor (forelimb and hindlimb areas; M) and auditory (temporal; A) cortices, but weak in S1 and V. The cortical expression pattern of PCDH9 mRNA was an intermediate of these two

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

1013

Fig. 12. Expression of PCDH20 mRNA in the postnatal rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

subgroups: PCDH9 was strongly expressed in M and parietal (area 1; S1) cortices, while weak signal was found in area 2 of parietal cortex (S2) and temporal cortex (A) (Fig. 14B).

Next, we asked whether such cortical region-dependencies of PCDH7, PCDH9, PCDH11, PCDH17 and PCDH20 mRNA expressions were also observed in E17 and adult rat brains (Fig. 15). Similar pattern of cortical

1014

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Fig. 13. Expression of PCDH21 mRNA in the postnatal rat brain. (A–H) Coronal sections of the brain in order from rostral to caudal. Scale bar⫽2.5 mm in A; scale bar⫽2.5 mm in H for B–H.

regionalization of PCDH17 expression was seen in E17 and adult brains although its regionalization was marginal compared with that of P3 brain (Fig. 15M–P). On the other hand, cortical regionalization patterns of PCDH7, PCDH9 and PCDH11 were temporarily changed, and their P3 cor-

tical regionalization pattern was not observed in adult brain (Fig. 15A–L). On E17, their regional expression patterns appeared to be less developed (PCDH7) or different from those on P3 especially in the lateral regions (PCDH9 and PCDH11). Cortical region-dependency of PCDH20 ap-

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

1015

Fig. 14. Cerebral cortical region-dependent expression pattern of PCDH7 (A), PCDH9 (B), PCDH11 (C), PCDH17 (D) and PCDH20 mRNAs (E). ISH images obtained from coronal cut serial sections were stacked from rostral to caudal orientation. (F) The boundaries between S1 and S2 (parietal, area 1 and area 2), M (forelimb and hindlimb areas), V (occipital) and auditory (temporal) cortex (A) are indicated in the diagram. RF, rhinal fissure. Scale bar⫽5 mm.

peared also to change during the postnatal development (Fig. 15Q–T): On E17, there was no noticeable regionalized expression of PCDH20, whereas PCDH20 expression in ML (mediolateral; somatosensory area) of P3 was higher than medial (Me) or lateral (L) area. In the adult brain, however, L expressed the highest level of PCDH20 among these regions. Regionalized expression of PCDHs was further verified by RT-PCR (Fig. 16). We obtained same tendencies of regionalized expression of PCDH7 (Fig. 16A), PCDH11 (Fig. 16B), PCDH17 (Fig. 16D) and PCDH20 (Fig. 16E), although PCDH20 expression was not statistically significant. Furthermore, we failed to observe differential expression of PCDH9 by this method (Fig. 16B). Such inconsistency appeared to be due to a difference in the region of analysis: For ISH, we measured signals only in the upper cerebral cortical layers, whereas whole cortical layers were used for RT-PCR analyses. In addition to the cortical region-dependency, these PCDHs also exhibited layer-specific expression patterns (Fig. 17). The expressions of PCDH11 and PCDH20

mRNAs were restricted to the upper layers (layers 2– 4 for PCDH11, and layer 4 for PCDH20) (Fig. 17D and F), whereas those of PCDH7, PCDH9 and PCDH17 mRNAs appeared to extend to the deeper layers (Fig. 17A–C and E). The signal of PCDH7 in the deep layer decreased caudally (Fig. 17A and B). PCDH9 and PCDH17 labelings were less dense in layer 5 and layer 4, respectively (Fig. 17C and E). Thalamic expression pattern of neocortical region-dependent non-clustered PCDHs The cerebral cortex is reciprocally interconnected with thalamic nuclei via corticothalamic and thalamocortical projections in region- and layer-specific manner. Motor cortical areas have major connection with the VL and VM, and somatosensory cortical areas are connected with the VP region. V and A areas are relayed from DLG and medial geniculate (MG) nuclei, respectively. Considering that PCDHs may function in the formation/maturation of the synaptic connections via their homophilic

1016

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Fig. 15. Cerebral cortical regionalization of PCDH7, PCDH9, PCDH11, PCDH17 and PCDH20 mRNAs in E17, P3 and adult rat brains. The boundaries of the Me (medial), the somatosensory (parietal) cortex (ML) and the auditory (temporal) cortex (L) are marked by arrowheads. Right panel shows the quantification of intensities of these three cortical regions [cortical plate of E17 and the upper cortical layers (two to four layers) of P3 and adult]. Data are expressed as mean⫾S.E.M., n⫽4. * P⬍0.05 versus medial part of cerebral cortex, # P⬍0.05 versus mediolateral part of cerebral cortex (ANOVA and LSD post hoc test). Scale bar⫽1.5 mm in Q for E17 images; scale bar⫽1.5 mm in R for P3 images; scale bar⫽1.5 mm in S for adult images.

interactions, we examined whether cortical region-dependent PCDHs exhibit the corresponding expression in their major connecting thalamic nuclei. We excluded PCDH20 from the analyses, however, because the labeling of PCDH20 cRNA was not detectable in most thalamic regions except laterodorsal (LD) thalamic nucleus (Fig. 12D and E). As shown in Fig. 18, all PCDHs

investigated exhibited thalamic nuclei-dependent expression patterns: The intensity of PCDH7 mRNA labeling whose expression was dominant in the somatosensory cortex was also higher in the VP than VL and VM (Fig. 18B and E). The expression of PCDH7 was also strong in the V but weak in A, and stronger labeling of PCDH7 was consistently observed in DLG than in MG

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

1017

Fig. 16. Quantification of the regional differences in the PCDH7 (A), PCDH9 (B), PCDH11 (C), PCDH17 (D), and PCDH20 (E) mRNA expressions among Me, ML, and L areas. Three anatomical regions were micro-dissected from Vibratome-cut slices and total RNAs were extracted from these samples. Representative gel images show the differential expression of PCDHs in these regions. Following RT-PCR, relative amounts of PCDHs were estimated by Scion image program. DATA are shown as mean⫾S.E.M., n⫽6. * P⬍0.05 in comparison to Me and # P⬍0.05 in comparison to ML (ANOVA and LSD post hoc test).

(Fig. 18C–E). A similar relationship was also observed in the expression patterns of PCDH9, PCDH11 and PCDH17 mRNAs (Fig. 18F–T). In comparison of DLG with MG, visual-dominant PCDHs (PCDH7 and PCDH9) exhibited higher expression in DLG than in MG, and the expression of auditory-dominant PCDHs (PCDH11 and PCDH17) was higher in MG than in DLG. Main motor thalamic nuclei connecting cortical regions are subdivided into two nuclei of VL and VM. We found substantial heterogeneity of PCDH expressions in these two subnuclei. However, the expression level in VP was significantly higher (PCDH7 and PCDH9) or lower

(PCDH11 and PCDH17) than that in at least one motorrelaying thalamic nucleus, corresponding to their cortical expression profiles.

DISCUSSION PCDHs are divided into two different subclasses, clustered and non-clustered PCDHs, depending on their chromosomal arrangements. Three clusters of PCDHs (termed PCDH␣, ␤, and ␥ clusters) are arranged in tandem on human chromosome 5q31 (Wu and Maniatis, 1999) and mouse chromosome 18B3 (Sugino et al., 2000). Because

Fig. 17. Cortical layer-specific expression pattern of PCDH7, PCDH9, PCDH11, PCDH17 and PCDH20 mRNAs on coronal sections of the P3 rat brain. The boundaries between the M and the S1 and S2 are indicated by the arrowheads. Laminar patterns were assessed in the dominantly expressing cortical regions (boxed area). The cortical layers are discriminated from the adherent sections of Hoechst staining. WM, white matter. Scale bar⫽2.5 mm in F for A–F; scale bar⫽500 ␮m in F= for A=–F=.

1018

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Fig. 18. Expression pattern of PCDH7, PCDH9, PCDH11 and PCDH17 mRNAs in the P3 rat thalamus. Four autoradiographed images are demonstrated at rostral (left) to caudal (right) levels. Boundaries of each thalamic nucleus were identified by cytochrome oxidase (CO) histochemistry (U–X) and marked by solid lines (somatosensory or visual relay nuclei) or dotted lines (motor or auditory relay nuclei). Average labeling densities for thalamic nuclei (VL, VM, VPN and DLG) are taken from at least two brain sections per animal at different coronal levels. Data are mean⫾S.E.M., n⫽4. * P⬍0.05 versus VL or DLG, # P⬍0.05 versus VM. Scale bar⫽1.5 mm.

the arrangement of PCDH gene cluster is similar to that of Ig or TCR gene clusters, it was initially postulated that clustered PCDHs are regulated by gene rearrangement (Wu and Maniatis, 1999; Yagi, 2003), and that diversified expression of clustered PCDHs might serve as a molecular specifier for the synaptic formation (Suzuki, 2000; Frank and Kemler, 2002). However, it has been proven that such gene rearrangement does not exist. Furthermore, because clustered PCDHs are controlled by the conserved 22 bp consensus sequence element commonly found in the proximal region of each clustered PCDH promoters (Tasic et al., 2002), each member of clustered PCDHs appears to be very similarly expressed in broad brain regions (Frank et al., 2005). Recent studies demonstrated that the individual neurons within the same brain region/neuronal pop-

ulations express distinct combinations of ␣- and ␥-PCDHs (Esumi et al., 2005; Frank et al., 2005; Kaneko et al., 2006), suggesting that clustered PCDHs do not play sufficient roles in the specification of the diverse synaptic connections among different brain regions. Considering the fact that non-clustered PCDHs are regulated by completely different upstream regions because of their scattered gene loci, non-clustered members of PCDHs may be expressed in spatially and temporally restricted brain regions, and they may be involved in the promotion of specific interactions of presynaptic and postsynaptic partners in a variety of brain regions. Our current comparative analysis of the expression patterns of 12 non-clustered PCDHs in the nervous system supports the above notion: Non-clustered PCDHs are differ-

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

entially expressed in specific nuclei, cortical subregions and layers in the postnatal brain, suggesting that each brain region/specific neuronal population appears to express different combinations of non-clustered PCDHs. Previously, the expression pattern of PCDH10 has been shown to be correlated with specific neuronal circuits such as the visual system and limbic system (Hirano et al., 1999; Aoki et al., 2003; Muller et al., 2004). Some ␦-PCDHs (PCDH7, PCDH9 and PCDH11) also exhibited regionally restricted expression in functional subsets of neuroanatomical structures (Vanhalst et al., 2005). Such expression patterns are consistent with the assumption that PCDHs may function as a molecular tag or synaptic specifier for the recognition of specific neuronal circuits. PCDH21 might be another example to support the above idea, because PCDH21 expression is restricted to the olfactory circuits (Nakajima et al., 2001; Nagai et al., 2005). Consequently, our current comparative analyses expand these initial proposals, so that they could be broadly applicable to other non-clustered PCDH family members. In the present study, we especially focused on the cerebral cortical and thalamic expression patterns of five PCDHs (PCDH7, PCDH9, PCDH11, PCDH17 and PCDH20) showing cerebral cortex region-dependent expression pattern. Except for PCDH20, they were also preferentially expressed in the major connecting thalamic nuclei we addressed. PCDH20 (dominantly expressed in the somatosensory and visual modules) was not found to be expressed in most thalamic regions, however, it was expressed in the LD and other communicating brain regions such as the frontal cortex and hippocampal formation, suggesting that cortical expression of PCDH20 might be related to the expression in the other brain regions containing the LD. It should be also noted that there is substantial heterogeneity in the expression of PCDHs within thalamic nuclei connected to the same cortical regions. For example, the expression of PCDH9 was significantly strong in the VL, but weak in VM, although these two thalamic nuclei are all relayed to M. Although the significance of this finding is yet to be clarified, it appears that such differential expressions among subthalamic nuclei may serve as a means to specify the connections between cortex and subthalamic nuclei (Aldes, 1988). Furthermore we cannot exclude the possibility that a subset of PCDHs or their isoforms may function as a repulsive cue, because PCDHs have isoforms produced by alternative splicing mechanisms and they contain isoforms lacking intracellular or extracellular domains, which can function dominant-negatively. For instance, PCDH11 has more than 10 isoforms, and a subset of isoforms lacks intracellular and/or extracellular domains (Vanhalst et al., 2005). More comprehensive analyses of the expression profiles of these isoforms may be required to clarify this issue. Although we did not systematically address other brain regions, there seems to be a tendency of connectiondependent expression patterns. For examples, PCDHs with an expression in mitral cell layer were also expressed in higher order olfactory structures such as olfactory peduncle (anterior olfactory nucleus, AON), piriform cortex

1019

(Pir), olfactory tubercle (Tu), entorhinal cortex (Ent) and some amygdaloid nuclei directly connected with mitral cells. Especially, PCDH21 was distinct in the layer of another connecting neuron, tufted cell. An another example is the expression of PCDH1, PCDH9, PCDH10, PCDH17, PCDH19 and PCDH20 mRNAs in limbic system containing hippocampus proper, subiculum, entorhinal cortex, cingulate cortex, anterior thalamus, hypothalamus and amygdala. Finally, a subset of PCDHs (PCDH10 and PCDH17) showed a noticeable gradient expression pattern in caudate putamen, and these PCDHs were also observed in the substantia nigra. The cortical region- and thalamic nuclei-dependent expressions of PCDH7, PCDH9, PCDH11, PCDH17 and PCDH20 were the most striking at the early postnatal stage (P3). It is known that region-specific and/or graded expression of transcription factors (Hox, Dlx, Pax, Otx, Emx etc.), secretory molecules (Wnt, BMP, fibroblast growth factors, sonic hedgehog, etc.) and guidance cues (Netrins, Slits, Ephrins etc.) is required for the normal patterning of thalamocortical projections (Flanagan and Vanderhaeghen, 1998; Bishop et al., 2000; Mallamaci et al., 2000; Pratt et al., 2000; Fukuchi-Shimogori and Grove, 2001; Hevner et al., 2002; Jones et al., 2002; LopezBendito et al., 2002; Vanderhaeghen and Polleux, 2004; Vanhalst et al., 2005). The region-dependent expressions of abovementioned genes are established during the embryonic period of active neurogenesis, indicating that cerebral cortical arealization has already begun at the embryonic neurogenic period. Classic cadherins are also involved in the early regionalization of the brain, and specific establishment of neuronal circuits: A subset of cadherins (E-cadherin, R-cadherin, cadherin-6, cadherin-8 and cadherin-11) is expressed in a fashion restricted in the early embryonic neuromeric brain (Redies et al., 1993; Ganzler and Redies, 1995; Matsunami and Takeichi, 1995; Kimura et al., 1996), and cerebral cortical region-dependent expression patterns of cadherin-6, cadherin-8 and cadheirn-11 are established by E14.5–15.5 and maintained until postnatal stages in mouse (Suzuki et al., 1997; Miyashita-Lin et al., 1999; Nakagawa et al., 1999). Furthermore, their cortical regionalization is regulated by regionspecific transcription factors such as Emx2 and Pax6 (Bishop et al., 2000). By contrast, the cortical regionalization of non-clustered PCDHs appears to be established perinatally, suggesting that the upstream regulatory machinery constructing the regional expression of PCDHs may be different from that of cadherins. Considering that early postnatal periods are critical for the specific synaptic establishment and maturation after thalamic innervations, PCDHs appear to promote the synaptic maturation and pruning of initial connections among different brain regions, whereas early cortical regionalization may be established independently of the PCDHs. Understanding the precise control mechanisms of the non-clustered PCDH expressions and the elucidation of their roles in the brain may shed light on the critical events specifying brain arealization during postnatal development.

1020

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021

Acknowledgments—This work was supported by the Korea Science and Engineering Foundation grant (M1050000004906J0000-04900) funded by the Korean government. A part of this work was technically supported by the core facility service of 21C Frontier Brain Research Center.

REFERENCES Ahmed ZM, Riazuddin S, Ahmad J, Bernstein SL, Guo Y, Sabar MF, Sieving P, Griffith AJ, Friedman TB, Belyantseva IA, Wilcox ER (2003) PCDH15 is expressed in the neurosensory epithelium of the eye and ear and mutant alleles are responsible for both USH1F and DFNB23. Hum Mol Genet 12:3215–3223. Aldes LD (1988) Thalamic connectivity of rat somatic motor cortex. Brain Res Bull 20:333–348. Aoki E, Kimura R, Suzuki ST, Hirano S (2003) Distribution of OLprotocadherin protein in correlation with specific neural compartments and local circuits in the postnatal mouse brain. Neuroscience 117:593– 614. Bishop KM, Goudreau G, O’Leary DD (2000) Regulation of area identity in the mammalian neocortex by Emx2 and Pax6. Science 288:344 –349. Blanco-Arias P, Sargent CA, Affara NA (2004) Protocadherin X (PCDHX) and Y (PCDHY) genes: multiple mRNA isoforms encoding variant signal peptides and cytoplasmic domains. Mamm Genome 15:41–52. Esumi S, Kakazu N, Taguchi Y, Hirayama T, Sasaki A, Hirabayashi T, Koide T, Kitsukawa T, Hamada S, Yagi T (2005) Monoallelic yet combinatorial expression of variable exons of the protocadherinalpha gene cluster in single neurons. Nat Genet 37:171–176. Flanagan JG, Vanderhaeghen P (1998) The ephrins and Eph receptors in neural development. Annu Rev Neurosci 21:309 –345. Frank M, Ebert M, Shan W, Phillips GR, Arndt K, Colman DR, Kemler R (2005) Differential expression of individual gamma-protocadherins during mouse brain development. Mol Cell Neurosci 29: 603– 616. Frank M, Kemler R (2002) Protocadherins. Curr Opin Cell Biol 14:557–562. Fukuchi-Shimogori T, Grove EA (2001) Neocortex patterning by the secreted signaling molecule FGF8. Science 294:1071–1074. Gaitan Y, Bouchard M (2006) Expression of the delta-protocadherin gene Pcdh19 in the developing mouse embryo. Gene Expr Patterns 6:893– 899. Ganzler SI, Redies C (1995) R-cadherin expression during nucleus formation in chicken forebrain neuromeres. J Neurosci 15: 4157– 4172. Goldberg M, Peshkovsky C, Shifteh A, Al-Awqati Q (2000) mu-Protocadherin, a novel developmentally regulated protocadherin with mucin-like domains. J Biol Chem 275:24622–24629. Heggem MA, Bradley RS (2003) The cytoplasmic domain of Xenopus NF-protocadherin interacts with TAF1/set. Dev Cell 4:419 – 429. Hevner RF, Miyashita-Lin E, Rubenstein JL (2002) Cortical and thalamic axon pathfinding defects in Tbr1, Gbx2, and Pax6 mutant mice: evidence that cortical and thalamic axons interact and guide each other. J Comp Neurol 447:8 –17. Hirano S, Yan Q, Suzuki ST (1999) Expression of a novel protocadherin, OL-protocadherin, in a subset of functional systems of the developing mouse brain. J Neurosci 19:995–1005. Homayouni R, Rice DS, Curran T (2001) Disabled-1 interacts with a novel developmentally regulated protocadherin. Biochem Biophys Res Commun 289:539 –547. Imoto I, Izumi H, Yokoi S, Hosoda H, Shibata T, Hosoda F, Ohki M, Hirohashi S, Inazawa J (2006) Frequent silencing of the candidate tumor suppressor PCDH20 by epigenetic mechanism in non-smallcell lung cancers. Cancer Res 66:4617– 4626. Jones L, Lopez-Bendito G, Gruss P, Stoykova A, Molnar Z (2002) Pax6 is required for the normal development of the forebrain axonal connections. Development 129:5041–5052.

Kaneko R, Kato H, Kawamura Y, Esumi S, Hirayama T, Hirabayashi T, Yagi T (2006) Allelic gene regulation of Pcdh-alpha and Pcdhgamma clusters involving both monoallelic and biallelic expression in single Purkinje cells. J Biol Chem 281:30551–30560. Kim H, Ko JP, Kang UG, Park JB, Kim HL, Lee YH, Kim YS (1994) Electroconvulsive shock reduces inositol 1,4,5-trisphosphate 3-kinase mRNA expression in rat dentate gyrus. J Neurochem 63: 1991–1994. Kimura Y, Matsunami H, Takeichi M (1996) Expression of cadherin-11 delineates boundaries, neuromeres, and nuclei in the developing mouse brain. Dev Dyn 206:455– 462. Kuroda H, Inui M, Sugimoto K, Hayata T, Asashima M (2002) Axial protocadherin is a mediator of prenotochord cell sorting in Xenopus. Dev Biol 244:267–277. Lopez-Bendito G, Chan CH, Mallamaci A, Parnavelas J, Molnar Z (2002) Role of Emx2 in the development of the reciprocal connectivity between cortex and thalamus. J Comp Neurol 451:153–169. Luckner R, Obst-Pernberg K, Hirano S, Suzuki ST, Redies C (2001) Granule cell raphes in the developing mouse cerebellum. Cell Tissue Res 303:159 –172. Makarenkova H, Sugiura H, Yamagata K, Owens G (2005) Alternatively spliced variants of protocadherin 8 exhibit distinct patterns of expression during mouse development. Biochim Biophys Acta 1681:150 –156. Mallamaci A, Muzio L, Chan CH, Parnavelas J, Boncinelli E (2000) Area identity shifts in the early cerebral cortex of Emx2-/- mutant mice. Nat Neurosci 3:679 – 686. Matsunami H, Takeichi M (1995) Fetal brain subdivisions defined by R- and E-cadherin expressions: evidence for the role of cadherin activity in region-specific, cell-cell adhesion. Dev Biol 172: 466 – 478. Miyashita-Lin EM, Hevner R, Wassarman KM, Martinez S, Rubenstein JL (1999) Early neocortical regionalization in the absence of thalamic innervation. Science 285:906 –909. Muller K, Hirano S, Puelles L, Redies C (2004) OL-protocadherin expression in the visual system of the chicken embryo. J Comp Neurol 470:240 –255. Nagai Y, Sano H, Yokoi M (2005) Transgenic expression of Cre recombinase in mitral/tufted cells of the olfactory bulb. Genesis 43:12–16. Nakagawa Y, Johnson JE, O’Leary DD (1999) Graded and areal expression patterns of regulatory genes and cadherins in embryonic neocortex independent of thalamocortical input. J Neurosci 19:10877–10885. Nakajima D, Nakayama M, Kikuno R, Hirosawa M, Nagase T, Ohara O (2001) Identification of three novel non-classical cadherin genes through comprehensive analysis of large cDNAs. Brain Res Mol Brain Res 94:85–95. Pratt T, Vitalis T, Warren N, Edgar JM, Mason JO, Price DJ (2000) A role for Pax6 in the normal development of dorsal thalamus and its cortical connections. Development 127:5167–5178. Rampon C, Prandini MH, Bouillot S, Pointu H, Tillet E, Frank R, Vernet M, Huber P (2005) Protocadherin 12 (VE-cadherin 2) is expressed in endothelial, trophoblast, and mesangial cells. Exp Cell Res 302:48 – 60. Rattner A, Smallwood PM, Williams J, Cooke C, Savchenko A, Lyubarsky A, Pugh EN, Nathans J (2001) A photoreceptor-specific cadherin is essential for the structural integrity of the outer segment and for photoreceptor survival. Neuron 32:775–786. Redies C, Engelhart K, Takeichi M (1993) Differential expression of Nand R-cadherin in functional neuronal systems and other structures of the developing chicken brain. J Comp Neurol 333: 398 – 416. Redies C, Vanhalst K, Roy F (2005) delta-Protocadherins: unique structures and functions. Cell Mol Life Sci 62:2840 –2852. Sperry RW (1963) Chemoaffinity in the orderly growth of nerve fiber patterns and connections. Proc Natl Acad Sci U S A 50:703–710.

S.-Y. Kim et al. / Neuroscience 147 (2007) 996 –1021 Strehl S, Glatt K, Liu QM, Glatt H, Lalande M (1998) Characterization of two novel protocadherins (PCDH8 and PCDH9) localized on human chromosome 13 and mouse chromosome 14. Genomics 53:81– 89. Sugino H, Hamada S, Yasuda R, Tuji A, Matsuda Y, Fujita M, Yagi T (2000) Genomic organization of the family of CNR cadherin genes in mice and humans. Genomics 63:75– 87. Suzuki SC, Inoue T, Kimura Y, Tanaka T, Takeichi M (1997) Neuronal circuits are subdivided by differential expression of type-II classic cadherins in postnatal mouse brains. Mol Cell Neurosci 9: 433– 447. Suzuki ST (2000) Recent progress in protocadherin research. Exp Cell Res 261:13–18. Tasic B, Nabholz CE, Baldwin KK, Kim Y, Rueckert EH, Ribich SA, Cramer P, Wu Q, Axel R, Maniatis T (2002) Promoter choice determines splice site selection in protocadherin alpha and gamma pre-mRNA splicing. Mol Cell 10:21–33. Tepass U, Truong K, Godt D, Ikura M, Peifer M (2000) Cadherins in embryonic and neural morphogenesis. Nat Rev Mol Cell Biol 1:91–100. Vanderhaeghen P, Polleux F (2004) Developmental mechanisms patterning thalamocortical projections: intrinsic, extrinsic and in between. Trends Neurosci 27:384 –391. Vanhalst K, Kools P, Staes K, van Roy F, Redies C (2005) deltaProtocadherins: a gene family expressed differentially in the mouse brain. Cell Mol Life Sci 62:1247–1259. Wolverton T, Lalande M (2001) Identification and characterization of three members of a novel subclass of protocadherins. Genomics 76:66 –72. Wu Q, Maniatis T (1999) A striking organization of a large family of human neural cadherin-like cell adhesion genes. Cell 97:779 –790. Yagi T (2003) Diversity of the cadherin-related neuronal receptor/ protocadherin family and possible DNA rearrangement in the brain. Genes Cells 8:1– 8.

1021

Yagi T, Takeichi M (2000) Cadherin superfamily genes: functions, genomic organization, and neurologic diversity. Genes Dev 14: 1169 –1180. Yamagata K, Andreasson KI, Sugiura H, Maru E, Dominique M, Irie Y, Miki N, Hayashi Y, Yoshioka M, Kaneko K, Kato H, Worley PF (1999) Arcadlin is a neural activity-regulated cadherin involved in long term potentiation. J Biol Chem 274:19473–11979. Yamamoto A, Amacher SL, Kim SH, Geissert D, Kimmel CB, De Robertis EM (1998) Zebrafish paraxial protocadherin is a downstream target of spadetail involved in morphogenesis of gastrula mesoderm. Development 125:3389 –3397. Yamamoto A, Kemp C, Bachiller D, Geissert D, De Robertis EM (2000) Mouse paraxial protocadherin is expressed in trunk mesoderm and is not essential for mouse development. Genesis 27:49 –57. Yoshida K (2003) Fibroblast cell shape and adhesion in vitro is altered by overexpression of the 7a and 7b isoforms of protocadherin 7, but not the 7c isoform. Cell Mol Biol Lett 8:735–741. Yoshida K, Sugano S (1999) Identification of a novel protocadherin gene (PCDH11) on the human XY homology region in Xq21.3. Genomics 62:540 –543. Yoshida K, Watanabe M, Kato H, Dutta A, Sugano S (1999) BHprotocadherin-c, a member of the cadherin superfamily, interacts with protein phosphatase 1 alpha through its intracellular domain. FEBS Lett 460:93–98. Yoshida K, Yoshitomo-Nakagawa K, Seki N, Sasaki M, Sugano S (1998) Cloning, expression analysis, and chromosomal localization of BH-protocadherin (PCDH7), a novel member of the cadherin superfamily. Genomics 49:458 – 461. Zhang C, Wong-Riley MT (2000) Synthesis and degradation of cytochrome oxidase subunit mRNAs in neurons: differential biogenomic regulation by neuronal activity. J Neurosci Res 60: 338 –344.

(Accepted 15 March 2007) (Available online 5 July 2007)