Specialised population of Claviceps purpurea from salt marsh Spartina species

Mycol. Res. 106 (2) : 210–214 (February 2002).

# The British Mycological Society

210

DOI : 10.1017\S095375620100538X Printed in the United Kingdom.

Specialised population of Claviceps purpurea from salt marsh Spartina species

Sylvie PAZB OUTOVA; 1*, Alan F. RAYBOULD2, Ales) HONZA; TKO1 and Rena! ta KOLI; NSKA; 1 " Institute of Microbiology CAS, VıT den\ skaT 1083, 142 20 Prague 4, Czech Republic. # Centre for Ecology and Hydrology, Winfrith Technology Centre, Dorchester, DT2 8ZD, UK. E-mail : pazouto!biomed.cas.cz Received 25 April 2001 ; accepted 20 September 2001.

The Claviceps purpurea population colonising British Spartina salt marsh stands is characterised by unusually long cylindrical conidia (average 9n5–12 µm) and sclerotia floating on the water surface. RAPD, AFLP and rDNA comparison defined these isolates as the third genetically distinct homogenous population (G3) of C. purpurea. The same morphological and genetical markers were found also in S. alterniflora isolates from Spartina from the USA. All G3 isolates belonged to a chemotype producing ergocristine and ergocryptine. In phylogenetic trees based on rDNA and AFLP, a G1 population from fields and meadows appeared as the sister clade to the one formed by G3 (Spartina) and G2 (wet and shady habitats), both with floating sclerotia and elongated conidia. British stands of S. anglica were probably colonised by isolates introduced from America, rather than by isolates from species of neighbouring biotopes.

INTRODUCTION Claviceps purpurea has the widest host range of any ergot fungus (Loveless 1971, Brewer & Loveless 1977). Attempts to classify intraspecific variability of C. purpurea have concentrated on finding host-specific groups (Barger 1931) or defining chemotypes (formerly called chemoraces) based on the alkaloids produced (Kobel & Sanglier 1978). Studies of RAPD patterns of C. purpurea isolates (Jungehu$ lsing & Tudzynski 1997) showed two distinct clades, one consisting of English isolates from Molinia and Dactylis and Belgian isolates from Holcus, the other encompassing isolates from cereals and land grasses. Our study (Paz) outova! et al. 2000) revealed three groups : G1 from fields and open meadows ; G2 from shady or wet habitats which is also a chemotype producing ergosine and ergocristine ; and G3 represented by two British isolates from Spartina anglica where ergocryptine and ergocristine was found in both specimens (Paz) outova! et al. 2000). Moreover, both the isolates shared with G2 the floating ability of sclerotia as well as cylindrical shape of conidia. G1 and G2 were identical with clades of Jungehu$ lsing & Tudzynski (1997). Spartina anglica evolved on the south coast of England at the end of the nineteenth century by chromosome doubling in a hybrid between S. maritima

* Corresponding author.

(a native species) and S. alterniflora (an accidental introduction from the USA) (Marchant 1963, Raybould et al. 1991, Ferris, King & Gray 1997). S. anglica quickly colonised salt marshes in southern England and was introduced elsewhere in the British Isles to stabilise mud flats (Gray, Marshall & Raybould 1991). Beginning in the 1960s, throughout the British Isles there has been a rapid and extensive colonisation of S. anglica swards by C. purpurea (Hubbard 1970, Raybould, Gray & Clarke 1998). The 60–70 year lag before S. anglica became infected with C. purpurea raises the question of whether a new strain of ergot evolved to infect S. anglica, or whether the lag was due to restricted dispersal of suitable inoculum from ergot from other Spartina species. We have analysed RAPD and AFLP patterns, rDNA sequences, alkaloid profiles and conidial morphology of more C. purpurea isolates from salt marsh Spartina species and from representative isolates of groups G1 and G2 with three main objectives: (1) study variation among isolates from Spartina species; (2) establish the origin of ergot infections of S. anglica, and (3) further investigate the relationship of the Spartina isolates to the other main populations of C. purpurea. MATERIALS AND METHODS Study material Sclerotia were collected from Spartina alterniflora from the USA, S. anglica populations on the south, west and

S. Paz) outova! and others

211

Table 1. The origin and properties of Claviceps isolates used in the study. Isolate No.

Host

Collected

Origin

Eco RI site

Sclerotia floating

G1 134 205 455

Phalaris tuberosa Festuca arundinacea Secale cereale

1995 1996 1998

Victoria, Australia Lauderdale, AL, USA Warthe, Usedom, Germany

j j j

k k k

G2 232 434

Poa annua Dactylis glomerata

1996 1998

Les) na! , Czech Republic Phillipsreut, Germany

k k

j j

G3 481 510–511 513 535 538 500–503 562–564 567–568

Spartina anglica S. anglica S. anglica S. anglica S. alterniflora S. alterniflora S. anglica S. anglica

1998 1998 1998 1999 1999 1998 1999 1999

Lincegrove Marsh, UK Skeffling, UK Newtown Harbour, UK Marchwood, UK Marchwood, UK Southriver, NJ, USA Dovey, Wales, UK Stour, Essex, UK

j j j j j j j j

j j j j j j j j

Representatives of the populations were deposited in the CCF (Culture Collection of Fungi, Department of Botany, Faculty of Sciences, Charles University, Prague, Czech Republic) under the following accession nos : 205\G1, CCF 3145 ; 232\G2, CCF 3148 ; 510\G3, CCF 3149.

east coasts of England, and from the S. alterniflora stand at Marchwood in Southampton Water (Table 1). The Marchwood stand is the last remnant of that involved in the origin of S. anglica. Isolates T5a, W3, W15, W12, W9, and T8 were first used in the study of Jungehu$ lsing & Tudzynski (1997), strain Pepty 695\s was described in Maier, Erge & Gro$ ger (1980), and the remaining isolates were characterised in Paz) outova! et al. (2000)

Cultivations, DNA extraction, RAPD analyses, microscopy and alkaloid analyses The procedures described in Paz) outova! et al. (2000), Paz) outova! (2001) and Flieger, Wurst & Shelby (1997) were employed. RAPD patterns were generated using primer 257 (CGTGATGTCAGTGATGC).

AFLP The AFLP’s were generated as described by Zeller et al. (2000) and Vos et al. (1995). 100 ng of genomic DNA digested by Eco RI and Mse I was ligated to adapters, preamplified using primers Eco RI-core (CTCGTAGACTGCGTACCAATTC) and Mse I-core (GACGATGAGTCCTGAGTAA) and amplified with final amplification primer pairs Eco RIjGG\Mse IjCT and Eco RIjTT\Mse IjAC. Eco RI primers were end-labelled with γ$$P and fragments were separated in 6 % polyacrylamide gel (Long Ranger FMC, Rockland, ME). Gels were dried and exposed to autoradiography film. Bands on scanned autoradiograph image were scored using Cross Checker 2n91 fingerprint analysis software (J. B. Buntjer, 1999, Wageningen University and Research Centre, The Netherlands). The binary matrix was analysed using Treecon 1n3b (van de Peer & de Wachter 1997). A similarity matrix was calculated

using the formula of Nei & Li (1979) and relatedness of the isolates was evaluated by UPGMA (Sneath & Sokal 1973). Bootstrap analysis was conducted using 500 bootstrap iterations.

rDNA analysis Amplification of the region containing ITS1-5n8S rDNA-ITS2 was achieved using primers ITS1 and ITS4 (White et al. 1990) under the conditions described in Paz) outova! et al. (2000). Amplified fragments were purified with Wizard DNA Clean-up System (Promega, Madison, WI) according to the manufacturer protocol with the following modification : DNA was eluted from the minicolumn at room temperature and not at 65 mC. Custom sequencing was performed at Microsynth (Balgach, Switzerland). Sequences from isolates 434 (G2) and 511 (G3) were deposited in EMBL Nucleotide Sequence Database under the accession Nos AJ311950 and AJ311951, respectively. BioEdit version 4n7.1 (Tom Hall, Department of Microbiology, North Carolina State University, Raleigh, NC 27695) was used to generate alignments. Maximum parsimony analysis was carried out with the programs Seqboot (with 500 iterations), Dnapars (with jumble option set to 20), and Consense, from the package PHYLIP 3n573c (Felsenstein 1989). Decay values (Bremer 1988) were acquired using SEPAL Version 1n2 (Salisbury 1999).

RESULTS Samples of sclerotia were collected from Spartina anglica in Wales, Essex and Yorkshire and at four locations in the Southampton region. In Marchwood, the sampling was done also on the last remnants of introduced S. alterniflora (Marchant 1967) (Table 1). In agreement with Loveless (1971), we found long cylin-

Claviceps purpurea population from Spartina

212

Table 2. Alkaloid content and conidial size in the samples of sclerotia from saltmarsh Spartina species. Average conidia size (µm)a

% of total area of HPLC peaksb

Host

Year Location

Length

Width

Alkaloids (= DW)

S. S. S. S. S. S. S. S. S. S.

1998 1995 1995 1998 1998 1998 1999 1999 1999 1999

10n3 12n2 10n9 11n0 10n3 10n7 11n6 11n7 9n4 10n0

4n9 3n1 3n3 3n3 4n1 3n3 3n5 3n6 3n8 3n5

6n5 1n9 4n1 3n0 1n9 3n9 6n9 6n3 3n9 3n9

alterniflora anglica anglica anglica anglica anglica alterniflora anglica anglica anglica a b

Southriver, NJ, USA Arne Peninsula, Poole Harbour Humber estuary, Skeffling, Yorkshire Humber estuary, Skeffling, Yorkshire Newtown Harbour, Isle of Wight Lincegrove Marsh, Hampshire Marchwood, Hampshire Marchwood, Hampshire Stour estuary, Essex Dovey estuary, Wales

Ergocryptine

Ergocristine

39n0 64n8 41n2 43n9 46n5 54n1 63n0 64n1 95n5 43n7

52n0 31n2 49n4 54n4 41n0 39n3 32n0 27n5 0n4 56n1

Standard deviations were in the range 15–20 % of the mean. The remaining area of the HPLC peaks consisted of impurities and traces of ergosine and\or ergotamine, each under 3 %. (a)

G1

G2

0.7

G3

0.6

0.5

0.4

0.3

0.2

0.1

kbp 1.45 B C

0.78

71

A B

0.50

81

0.37 93

ì (b)

455

205

232

481

kbp

82 100

1.45

97

76

73 65

90

65 77

0.50

ì

1

2

3

4

5

6

7

8

9

10 11

Fig. 1. RAPD patterns of Claviceps purpurea with primer 257. (a) Population specific patterns ; A, band shared by all C. purpurea isolates ; B, bands shared by G2 and G3 group ; C, band shared by the G1 and G3 groups. (b) RAPD patterns of British and American isolates from Spartina. 1, 568 ; 2, 562 ; 3, 538 ; 4, 535 ; 5, 513 ; 6, 510 ; 7, 511 ; 8, 481 ; 9, 503 ; 10, 502 ;11, 501. Lanes 1–8 contain British isolates ; lanes 9–11 contain American isolates. λ – size standard (λ DNA digested with Bgl I).

drical conidia on the surface of all sclerotia (Table 2). Alkaloid analyses (Table 2) confirmed that the Spartina isolates (G3) constitute a chemotype with a distinct alkaloid composition of ergocristine and ergocryptine. The sclerotia were capable of floating on water for several days. Restriction of the amplified ITS1-5n8SITS2 fragment confirmed the presence of a conserved EcoRI site in all isolates.

89

“Floaters”

78

0.78

368 358 338 Pepty 695/s 207 483 152 220 479 445 222 G1 205 450 W3 455 151 W15 373 436 208 T5a 137 513 568 UK G3 511 500 480 W12 236 503 523 T8 505 G2 233 232 389 507 506 W9

Fig. 2. UPGMA tree of Claviceps purpurea populations based on AFLP analysis. Clades with less than 60 % bootstrap support were collapsed to polytomies.

RAPD patterns of the Spartina isolates were distinct from both the G1 and G2 groups (Fig. 1a), although they shared a species-specific amplicon A, two bands with G2 and one band with G1. RAPD profiles of both British and American isolates were uniform (Fig. 1b). From 145 scored AFLP fragments, two were found in all C. purpurea isolates. One fragment in common was found for G1 and G2, as well as for G1 and G3 (Spartina isolates). On the other hand, the G2 and G3 groups shared three bands. Patterns of G3 British isolates were almost identical. In a phylogram based on AFLP data (Fig. 2), the G1 group appears as variable clade without any significant subgrouping, as was earlier observed with RAPD-based data (Paz) outova! et

S. Paz) outova! and others

213 C. sulcata

Pepty 695/s G1

134 G1 75 511 G3

1 95 3

U57669 G2 86 2 434 G2

Fig. 3. Maximum parsimony tree based on ITS1-5n8S-ITS2 sequences. Maximum parsimony analysis yielded a single tree of 13 steps. Only 7 sites informative for parsimony were present due to the high homology of the sequences. Bootstrap support levels are shown over the branches, Bremer decay values are given under the branches. Claviceps sulcata (a GenBank accession No. AJ133403) was used as the outgroup species (Paz) outova! 2001).

al. 2000). G2 and G3 form sister clade. On G3 clade, American isolate is on ancestral position to British group. Similar relationships were found also using the comparison of rDNA sequences, where G1 isolates were ancestral to G3 and G2 (Fig. 3). DISCUSSION The isolates from Spartina stands from salt marshes on Atlantic coasts represent a habitat-specialised group. From the rDNA- and AFLP-based phylograms it may be inferred that a group of isolates with floating sclerotia arose from ‘ field and meadows ’ ancestors of recent variable group G1 which later separated into G3 and G2 (the latter in addition lost conserved Eco RI site in 5n8S rDNA). Taking into account the small number of shared bands between the three groups, the hypothesis that G3 arose by hybridisation of G1 and G2 is improbable. In addition to genetical markers, the G2 and G3 groups share some phenotypic similarities. Both have elongated or cylindrical conidia, different from the oval ones typical for G1 (Loveless 1974, Paz) outova! et al. 2000). For both groups, ergocristine is the major alkaloid. White et al. (2000) observed intercellular air spaces in the sclerotia from American S. alterniflora. Sta$ ger (1922) found air spaces in floating sclerotia from grasses growing in continental wet habitats (most probably G2 isolates), which again supports a common ancestry of these two groups. Recently, we obtained an isolate from Glyceria fluitans growing in the pond near ‘ Panska! ska! la ’ (a geological nature reserve with a complex of regular basalt columns near Kamenicky! SB enov, Czech Republic), which, contrary to our expectations, had RAPD pattern and conidial size typical of G1. The alkaloid mixture found in its sclerotia (ergosine 29n3 %, ergo-

cornine 28n6 %, ergocryptine 31n7 %) was also quite common in G1 isolates (Paz) outova! et al. 2000). However, its sclerotia floated on water. This may prove that the floating ability marker still persists in G1 populations. White et al. (2000) reported three differences between the rDNA sequence of an isolate from S. alterniflora and the one from Dactylis glomerata. They supposed that similarity of rDNA is maintained by gene flow between the populations. However, during the course of our collections we found only three locations where G1 and G2 occurred together ; this suggests that the populations are effectively separated by their habitats. Moreover, rDNA sequences of two related tropical species, C. fusiformis and C. sulcata, are 97n6 % and 99 % identical to the rDNA sequence of C. purpurea G1 isolates (AJ133401) and the rDNA of Canadian species C. grohii from Carex is 95n5 % identical. High similarity of the rDNA suggests recent divergence inside this group (Paz) outova! 2001). Both G2 and G3 sclerotia contain ergocristine. However, in G3 it is combined with ergocryptine, another alkaloid of the ergotoxine group, whereas in G2 ergocristine and ergosine (from the ergotamine group), sometimes with traces of ergocryptine, were found (Paz) outova! et al. 2000). Eleuterius & Meyers (1974) described C. purpurea isolates colonizing Spartina stands from salt marshes on the American Atlantic coast whose sclerotia contained ergocryptine, ergocryptinine, and lysergylvalyl-methylester (LMV). This result differs from our G3 analyses where ergocristine was found but no LMV. We noted that LMV is indistinguishable from ergocristine on TLC with the most often used solvent mixture methanol : chloroform (8 : 2), but well separated by our HPLC method. Therefore it is possible that ergocristine was either misidentified or overlooked in the older study. The ergot infection of S. anglica evidently originated by the spread of inoculum from C. purpurea on other Spartina salt marsh species, rather than from isolates infecting neighbouring grasses of different genera (e.g. Phragmites australis), which would belong to the G2 group. However, we cannot be sure as to the precise origin(s) of the S. anglica infestation, but C. purpurea is very rare or absent from S. maritima in Britain. This, along with the lag between the evolution of S. anglica and the appearance and rapid spread of specific C. purpurea, suggests S. anglica became infected by the long distance dispersal of sclerotia. Indeed, sclerotia from S. alterniflora from the east coast of the USA may have been introduced via shipping ballast in the same way as seed or rhizomes of S. alterniflora were introduced into Britain nearly 200 years ago. The survival of C. purpurea in salt marshes probably requires a high degree of physiological specialisation. Continuous selection pressure against isolates from other biotopes may maintain the internal homogeneity of the Spartina group.

Claviceps purpurea population from Spartina A C K N O W L E D G E M E N TS This project was supported by the Czech Grant Agency (grant No. 522\99\0517) and a Ministry of Education Grant Project (COST 835n30). Sclerotia from Spartina alterniflora from Southriver, NJ were kindly supplied by Russell A. Duncan (Department of Plant Pathology, Cook College, Rutgers University, NJ). Ms. Sue Brown collected sclerotia from Skeffling.

REFERENCES Barger, G. (1931) Ergot and Ergotism. Gurney & Jackson, London. Bremer, K. (1988) The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42 : 795–803. Brewer, J. & Loveless, A. R. (1977) Ergot of Pennisetum macrourum in South Africa. Kirkia 10 : 589–600. Eleuterius, L. N. & Meyers, C. P. (1974) Claviceps purpurea on Spartina in coastal marshes. Mycologia 66 : 978–986. Felsenstein, J. (1989) PHYLIP – Phylogeny Inference Package (Version 3.2). Cladistics 5 : 164–166. Ferris, C., King, R. A. & Gray, A. J. (1997) Molecular evidence for the maternal parentage in the hybrid origin of Spartina anglica C. E. Hubbard. Molecular Ecology 6 : 185–187. Flieger, M., Wurst, M. & Shelby, R. (1997) Ergot alkaloids – sources, structures and analytical methods. Folia Microbiologica 42 : 3–30. Gray, A. J., Marshall, D. F. & Raybould, A. F. (1991) A century of evolution in Spartina anglica. Advances in Ecological Research 21 : 1–62. Hubbard, J. C. E. (1970) Effects of cutting and seed production in Spartina anglica. Journal of Ecology 58 : 329–334. Jungehu$ lsing, U. & Tudzynski, P. (1997) Analysis of genetic diversity in Claviceps purpurea by RAPD markers. Mycological Research 101 : 1–6. Kobel, H. & Sanglier, J. J. (1978) Formation of ergotoxine alkaloids by fermentation and attempts to control their biosynthesis. In Antibiotics and other Secondary Metabolites : biosynthesis and production (R. Hu$ tter, T. Leisinger, J. Nu$ esch & W. Wehrli, eds) : 233–242. [FEMS Symposium No. 5.] Academic Press, New York. Loveless, A. R. (1971) Conidial evidence for host restriction in C. purpurea. Transactions of the British Mycological Society 56 : 419–434. Maier, W., Erge, D. & Gro$ ger D. (1980) Mutational biosynthesis in a strain of Claviceps purpurea. Planta medica 40 : 104–108.

214 Marchant, C. J. (1963) Corrected chromosome numbers for Spartina itownsendii and its parent species. Nature 199 : 929. Nei, M. & Li, W.-H. (1979) Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences, USA 76 : 5269–5273. Paz) outova! , S. (2001) The phylogeny and evolution of the genus Claviceps. Mycological Research 105 : 275–283. Paz) outova! , S., Ols) ovska! , J., Linka, M., Kolı! nska! , R. & Flieger, M. (2000) Claviceps purpurea populations, chemoraces and habitat specialization. Applied and Environmental Microbiology 66 : 5419–5425. Raybould, A. F., Gray, A. J. & Clarke, R. T. (1998) The long-term epidemic of Claviceps purpurea on Spartina anglica in Poole Habour : pattern of infection, effects on seed production and the role of Fusarium heterosporum. New Phytologist 138 : 497–505. Raybould, A. F., Gray, A. J., Lawrence, M. J. & Marshall, D. F. (1991) The evolution of Spartina anglica (Gramineae) : origin and genetic variation. Biological Journal of the Linnean Society 43 : 111–126. Salisbury, B. A. (1999) Strongest evidence : maximum apparent phylogenetic signal as a new cladistic optimality criterion. Cladistics 48 : 137–149. Sneath, P. H. A. & Sokal, R. R. (1973) Numerical Taxonomy. W.H. Freeman, San Francisco. Sta$ ger, R. (1922) Beitra$ ge zur Verbreitungsbiologie der ClavicepsSklerotien. Zentralblatt fuW r Bakteriologie, Parasitenkunde und Infektionskrankheiten, Abteilung II 56 : 329–339. van de Peer, Y. & de Wachter, R. (1997) Construction of evolutionary distance trees with TREECON for Windows : accounting for variation in nucleotide substitution rate among sites. Computer Applications in Biosciences 13 : 227–230. Vos, P., Bleeker, M., Reijans, M., Lee, T., van de Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M. & Zabeau, M. (1995) AFLP : a new technique for DNA fingerprinting. Nucleic Acids Research 23 : 4407–4414. White, J. F., Sullivan, R., Moy, M., Patel, R. & Duncan, R. (2000) An overview of problems in the classification of plant-parasitic Clavicipitaceae. Studies in Mycology 45 : 95–10. White, T. J., Bruns, T., Lee, S. & Taylor, J. W. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols : a guide to methods and applications (M. A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White, eds) : 315–322. Academic Press, San Diego. Zeller, K. A., Jurgenson, J. E., El-Assiuty, E. M. & Leslie, J. F. (2000) Isozyme and AFLP from Cephalosporium maydis in Egypt. Phytoparasitica 28 : 121–130. Corresponding Editor : Z.-C. Chen