Speciation of Phlebotomus sandflies of the subgenus Larroussius coincided with the late Miocene-Pliocene aridification of the Mediterranean subregion

Biological Journal of the Linnean Society (2000) 70: 189–219. With 10 figures doi:10.1006/bijl.1999.0393, available online at http://idealibrary.com on

Speciation of Phlebotomus sandflies of the subgenus Larroussius coincided with the late Miocene-Pliocene aridification of the Mediterranean subregion S. ESSEGHIR∗ AND P. D. READY Molecular Systematics Laboratory, Department of Entomology, Natural History Museum, Cromwell Road, London SW7 5BD R. BEN-ISMAIL Laboratoire d’Epide´miologie et d’Ecologie Parasitaire, Institut Pasteur de Tunis, 1002 TunisBelve´de`re, Tunisia Received 6 December 1998; accepted for publication 7 July 1999

The phylogeny and mode of speciation of Mediterranean Phlebotomus of the subgenus Larroussius were inferred by comparative sequence analyses of a fragment of mitochondrial DNA (Cytochrome b) and of a nuclear gene (Elongation factor alpha). The molecular phylogenies were congruent basally, where their clades matched the species complexes defined by a few genitalic characters of each sex. Reticulate evolution was suggested for the most derived species complex (Phlebotomus perniciosus): the molecular phylogenies were incongruent, and mitochondrial-marker distribution was consistent with introgressive hybridizations not between sister species but between species whose ranges now overlap or abut. By considering the molecular phylogenies, the mitochondrial molecular clock and the ecological niches of the species, as well as the historical biogeography and palaeoecology of the Mediterranean subregion, we propose that the derived lineages arose from a sequential series of speciation events associated with habitat shifts promoted by progressive aridification. This ‘taxon pulse’-like speciation occurred in the Pliocene, later than previously proposed in a vicariance hypothesis that invoked only tectonic events, but too early for Pleistocene Iceage refugia to have played any role other than the isolation of geographical races. Speciation occurred before the proposed divergence of members of the Leishmania donovani complex and this helped to rule out any vector-parasite co-speciation or co-cladogenesis.  2000 The Linnean Society of London

ADDITIONAL KEYWORDS:—Psychodidae – phylogeny – cytochrome b – Elongation factor alpha – Leishmania infantum – Leishmania speciation – co-evolution. ∗ Corresponding author. Present address: Department of Biology, Imperial College of Science, Technology & Medicine, London SW7 2AZ. E-mail: [email protected] 0024–4066/00/060189+31 $35.00/0

189

 2000 The Linnean Society of London

190

S. ESSEGHIR ET AL. CONTENTS

Introduction . . . . . . . . . . . . . . . Phylogenetic relationships of sandflies . . . . . Vector–parasite evolutionary relationships . . . Historical biogeography of Mediterranean Larroussius Material and methods . . . . . . . . . . . Sandflies characterized . . . . . . . . . . DNA extraction, amplification and sequencing . . Phylogenetic analyses . . . . . . . . . . Results . . . . . . . . . . . . . . . . EF-a phylogeny of Larroussius species . . . . . Phylogeography of sandfly Cyt b haplotypes . . . Molecular clocks . . . . . . . . . . . . Taxon-area cladograms . . . . . . . . . Co-cladogenesis of Larroussius and Leishmania . . . Discussion . . . . . . . . . . . . . . . Species boundaries and phylogeography . . . . Evolution of Mediterranean Larroussius . . . . . Sandfly–Leishmania evolutionary relationships . . . Acknowledgements . . . . . . . . . . . . References . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . .

190 192 193 196 197 197 197 198 198 198 200 204 206 207 209 209 211 215 216 216

INTRODUCTION

The blood-feeding females of phlebotomine sandflies (Diptera: Psychodidae, Phlebotominae) are the only known natural vectors of protozoa of the genus Leishmania Ross (Kinetoplastida: Trypanosomatidae) (Killick-Kendrick, 1990), which are the parasitic causative agents of mammalian leishmaniasis. However, there have been few studies of sandfly phylogeny (Galati, 1995; Rispail & Le´ger, 1998a,b) or of the dating of speciation events (Esseghir et al., 1997), even though vector-parasite co-evolution has often been proposed, e.g. Killick-Kendrick (1985). All Old World (OW) vectors of Leishmania are classified in the genus Phlebotomus Rondani & Berte´, and we aim in this paper to infer the historical biogeography in the Mediterranean subregion of one of its subgenera, Larroussius Nitzulescu, in order to investigate patterns of co-association between vectors and parasites. In most cases, each Leishmania species is associated with a zoonosis that involves a relatively wide taxonomic range of mammalian reservoir hosts but a smaller number of more closely-related sandfly vectors, and so it has been argued that the specificity of transmission cycles has arisen primarily from sandfly-Leishmania coevolution (Lainson & Shaw, 1987). Killick-Kendrick (1985, 1990) reviewed the association between certain subgenera of Phlebotomus (characterized by morphology) and Leishmania species (characterized mainly by isoenzymes), which is particularly noticeable in the Mediterranean subregion (Fig. 1). Thus, species of Larroussius are the only proven vectors of Leishmania infantum Nicolle (of the L. donovani complex) in southern Europe, northern Africa and south-west Asia, where this parasite is transmitted from its reservoir hosts (domestic dogs and wild foxes) to humans, who may then develop visceral or cutaneous leishmaniasis. The other Leishmania species frequently found naturally in and around the Mediterranean subregion are associated with human cutaneous leishmaniasis and belong to two strictly OW species complexes: Leishmania major Yakimoff & Schokhor (of the L. major complex) is transmitted from

SPECIATION OF PHLEBOTOMUS SANDFLIES

191

Sandfly subgenus (vectors)

Leishmania species (parasites)

Euphlebotomus

L. donovani is ental P. ori bbi) (P. to

Med. Larroussius

New World sandflies

Old World sandflies

Larroussius

P. lo ngip es P. pe difer

Adlerius

L. infantum

L. aethiopica

Phlebotomus

L. major

Paraphlebotomus

L. tropica

Lutzom

Lutzomyia

yia long

ipalpis

vansi omyia e

Lutz

L. infantum chagasi (= L. chagasi)

Verrucarum

proven vectors suspected vectors

Figure 1. Vector-parasite associations relevant to the current study. Verrucarum is an informal subgeneric grouping of American Lutzomyia species.

wild rodent reservoir hosts to humans only by sandflies of the subgenus Phlebotomus; and Leishmania tropica Wright and the closely-related Leishmania killicki Rioux, Lanotte & Pratlong (of the L. tropica complex) are transmitted only by members of the subgenus Paraphlebotomus Theodor (Killick-Kendrick, 1990; Rioux et al., 1990). Few would dispute the epidemiological significance of these associations, but studies of the sandfly-Leishmania ‘evolutionary fit’ (Killick-Kendrick, 1985) have not distinguished between co-association, co-evolution and co-speciation (Page & Hafner, 1996; Poulin, 1998). The construction of well-supported phylogenies of vectors and

192

S. ESSEGHIR ET AL.

parasites is a first step towards addressing co-evolutionary scenarios. New, molecular phylogenies of Larroussius are presented in the current paper. Phylogenetic relationships of sandflies There have been only two extensive cladistic analyses to infer phylogenetic relationships among members of different phlebotomine genera, and both were based on adult morphological characters. Galati (1995) manually constructed Hennigian cladograms, using the subfamily Bruchomyiinae as an outgroup. The emphasis was on New World (NW) groups, but the genus Phlebotomus was judged to be monophyletic and placed in the tribe Phlebotomini along with (among others) Lutzomyia Franc¸a, which contains all the NW vectors of Leishmania. No extant or fossil species of any phlebotomine genus has been found in both hemispheres (Lewis, 1982). In his doctoral thesis Rispail (1990) used numerical analyses, both phenetic (with dendrograms constructed using Jaccard’s similarity index and clustering by median linkage) and parsimony (PHYLIP), to infer the phylogenetic relationships among OW sandflies (Rispail & Le´ger, 1991, 1998b). The genus Phlebotomus was found to be monophyletic and the subgenus Larroussius always clustered with the subgenera Adlerius Nitzulescu and Transphlebotomus Artemiev. Of the species classified in these subgenera (Seccombe et al., 1993; Gebre-Michael & Lane, 1996), 14 out of 18 Adlerius, 1 out of 2 Transphlebotomus and 22 out of 30 Larroussius were analysed (Rispail & Le´ger, 1998a,b), and all were grouped in a derived clade by Wagner parsimony analyses of up to 63 characters from 85 Phlebotomus species. Larroussius was found to be paraphyletic: Adlerius and Transphlebotomus were united with two species of Larroussius on one branch of an unresolved trichotomy, which was the sister-group to the east African Phlebotomus (Larroussius) guggisbergi Kirk & Lewis. The sister clade to LarroussiusTransphlebotomus-Adlerius contained only the subgenera Synphlebotomus Theodor and Paraphlebotomus (Rispail & Le´ger, 1998a), which was used as an outgroup in the present study. Rispail estimated no branch support and gave no synapomorphies for most branches relating Larroussius species, only listing the character states analysed (Rispail, 1990; Rispail & Le´ger, 1998a,b). However, he did map the absence-presence of a common spermathecal duct on to the phylogenetic tree for 85 species of Phlebotomus, thereby showing that the presence of a common duct in the female was the single synapomorphy characterizing a derived clade containing Phlebotomus major Annandale and 6 similar species referred to as the major group by Le´ger & Pesson (1987). We recognize this clade as one of four species complexes of Larroussius with representatives in the Mediterranean subregion (Table 1). Of these, the P. perniciosus complex has not previously been recognized as an informal taxonomic group, and so it is important to note that Phlebotomus langeroni Nitzulescu and Phlebotomus tobbi Adler & Theodor were both originally described (informally and formally, respectively) as varieties of Phlebotomus perniciosus Newstead, while Phlebotomus longicuspis Nitzulescu and Phlebotomus orientalis Parrot were both originally described as varieties of Phlebotomus langeroni (Seccombe et al., 1993). Each of our species complexes is a natural group of morphologically similar species or subspecies, many of which have allopatric ranges and were originally described as varieties (Seccombe et al., 1993; Table 1). The P. major complex alone is characterized by a discrete common spermathecal duct in the female and a

SPECIATION OF PHLEBOTOMUS SANDFLIES

193

relatively long aedeagus (or intromittent organ) in the male (Rioux et al., 1974; Le´ger & Pesson, 1987). Only the P. ariasi complex has markedly dilated individual spermathecal ducts and a broad aedeagus; all subspecies of P. perfiliewi have a broadtipped aedeagus; and the P. perniciosus complex is characterized by distinctive dilatations at the bases of the individual spermathecal ducts and a (multi-)pointed aedeagus (Perfil’ev, 1966; Rioux et al., 1974; Le´ger et al., 1983; Killick-Kendrick et al., 1994). Cladistic analyses of morphological characters (Rispail, 1990) failed to retrieve the P. perniciosus complex as a monophyletic group, placing P. langeroni and P. tobbi with the subgenera Transphlebotomus and Adlerius and the others with the distinctive P. major complex. This is counter-intuitive and helped to prompt our molecular studies. Recently, Depaquit et al. (1998) reported a molecular phylogeny of large subunit ribosomal DNA sequences of nine phlebotomine species and, although the branch support was weak, concluded that the genus Phlebotomus (represented by five species) is paraphyletic. However, this does not affect the hypotheses in the present report, because their representatives of Phlebotomus (one species) and Paraphlebotomus (two species) formed a clade basal to that of Larroussius (two species), and the genus Phlebotomus was not polyphyletic. Vector–parasite evolutionary relationships The traditional, parasitological approach to describing evolutionary relationships between human parasites and their hosts relies heavily on intuitive interpretations of existing epidemiological associations. In contrast, a phylogenetic approach allied to the dating of speciation events provides an historical perspective (Poulin, 1998). Strict co-speciation, or co-cladogenesis, of Larroussius–Leishmania is unlikely to have occurred (Fig. 1): Phlebotomus (Larroussius) longipes Parrot & Martin and the morphologically similar Phlebotomus (La.) pedifer Lewis, Mutinga & Ashford are the natural vectors of Leishmania aethiopica Bray, Ashford & Bray (Killick-Kendrick, 1990; Rioux et al., 1990), but this is not the sister-species of the Leishmania donovani complex (or group) with which most Larroussius vectors are associated, and which contains Leishmania donovani (Laveran & Mesnil) and L. infantum (Rioux et al., 1990). Furthermore, members of the L. donovani complex are transmitted by sandflies belonging not only to the Larroussius–Transphlebotomus–Adlerius clade but also to the subgenus Euphlebotomus Theodor (Killick-Kendrick, 1990), which is not the sister-group according to Rispail & Le´ger (1998a). The testing of co-evolutionary hypotheses benefits from well-supported phylogenies complemented by a timescale of speciation. There are more data for Leishmania than for Phlebotomus. Most phylogenies based on nuclear DNA sequences are congruent in placing the L. donovani complex as the sister group to the L. aethiopica, L. major and L. tropica complexes (Piarroux et al., 1995; Croan et al., 1997; Noyes et al., 1997). Genetic distances based on the small subunit ribosomal and dihydrofolate reductase genes (Fernandes et al., 1993) are consistent with the divergence of this group of species complexes before the start of the Miocene epoch, some 23 million years ago (Mya). A cladistic analysis of the extensive isoenzyme data recognized the monophyly of these four species complexes, but placed the L. donovani and L. tropica complexes as sister groups (Thomaz-Soccol et al., 1993). Genetic distances based on the isoenzyme data have been used to date the divergence of L. donovani from L. infantum

P. orientalis

P. tobbi

P. longicuspis

P. langeroni

P. perniciosus

P. (La.) perniciosus complex:

P. p. perfiliewi

P. (La.) perfiliewi complex:

P. ariasi P. ariasi-like

T51, T52 (F) Sp12, Sp13 (C) T61, T62 (F) Egp1, Egp2 (C) T34, T35 (F) T54 (F) T57 (F) Gr10, Gr11 (F) C12, C13 (C) ET18, ET19 (F)

T40, T41 (F) T91, T92 (F) PF5 (C)

AR3, AR5 (F) AR4 (F)

C2, C7 (F)

P. (La.) ariasi complex:

P. neglectus-like

Code (∗)

NE1, NE2 (C) Gr13, Gr16 (C)

Genitalia

P. neglectus

P. (La.) major complex:

Larroussius subgenus

Taxa

Central Asia to East Europe: P. major (India, Nepal, Pakistan), P. smirnovi (=wui) (China), P. notus (Afghanistan), P. wenyoni (Iran, Iraq), P. syriacus (Middle East, Turkey, Caucasus, Crimea) and P. neglectus (Albania, Italy, [Sardinia], Yugoslavia, Greece).

Species range

Kheniguet Edhan, Tunisia Murcia, Spain Kerkoue`ne, Tunisia El Agamy, Egypt Felta, Tunisia Goubellat, Tunisia Tebaba, Tunisia Vari, Attiki, Greece Corfu, Greece Near Metemma, Ethiopia

Tebaba, Tunisia Sejnane, Tunisia Corfu, Greece

Albania, Cyprus, Greece, Sicily, Iran, Iraq, Palestine, Lebanon, Syria, Turkey and south former U.S.S.R. Ethiopia, Sudan, Chad, Niger, Kenya, Rwanda, Uganda, Saudi Arabia and Yemen.

Maghreb and Spain.

Maghreb to Central Asia: P. p. perfiliewi (Crimea, Balkans, Italy, Malta, Maghreb), P. p. galilaeus (Cyprus, Israel, Turkey) and P. p. transcaucasicus (south-west former U.S.S.R, Iran, Iraq). South-west Asia, Mediterranean sub-region, Maghreb and sub-Saharan Africa: Maghreb and western Europe eastwards to the Balkans. Littoral of North Africa and Spain.

West Europe and Maghreb: P. ariasi (North-west Italy, France, Spain, Portugal, Ce´vennes, Provence, France Maghreb) and P. chadlii (Maghreb). Bir El Euch, Tunisia

Fode`le, Crete, Greece

Corfu, Greece Vari, Attiki, Greece

Locality

continued

T 1. Taxonomy and distribution of sandfly populations studied. The genitalia are figured with their anterior ends uppermost, and with the paired female spermathecae on the left (Only those of the P. major complex have an obvious common duct) and the male aedeagus (one of the pair) on the right. Figures of female and male genitalia were scanned, respectively, from Le´ger et al. (1983) and Rioux et al. (1974). ∗ Codes refer to individual specimens from colonies (C) or the field (F)

194 S. ESSEGHIR ET AL.

P. (Pa.) sergenti P. (Pa.) chabaudi

Paraphlebotomus subgenus

P. (P.) papatasi P. (P.) duboscqi P. (P.) bergeroti

Phlebotomus subgenus

Taxa

Genitalia

T33 (F) T36, T37 (F)

T83, T84 (F) K3, K4 (C) Et20 (F)

Code (∗)

Bazma, Tozeur, Tunisia Ile de Kerkenna, Tunisia

Felta, Sidi Bouzid, Tunisia Kenya Near Metemma, Ethiopia

Locality

T 1. continued

Mediterranean sub-region up to India and Afghanistan. Maghreb and Spain.

Mediterranean sub-region up to India and Afghanistan. Sub-Saharan Africa North and sub-Saharan Africa, Arabia.

Species range

SPECIATION OF PHLEBOTOMUS SANDFLIES 195

196

S. ESSEGHIR ET AL.

to the late Pliocene, 2.0–1.5 Mya (Moreno et al., 1986). Amongst all these OW parasites of humans, only L. infantum also occurs in the NW, most probably having been recently introduced there, and the NW isolates are conveniently named L. infantum chagasi (Killick-Kendrick, 1990). In contrast, previous proposals concerning the speciation of Mediterranean Larroussius have been supported not by a resolved phylogeny and molecular-clock datings—there is no relevant fossil record (Lewis, 1982)—but by a general hypothesis of vicariance associated with tectonic activities 20.0–15.0 Mya (Le´ger & Pesson, 1987; Marchais, 1992).

Historical biogeography of Mediterranean Larroussius Allopatric speciation within each species complex of Larroussius is suggested by the small overlaps in the ranges of most taxa, with the exception of P. perniciosus, P. langeroni and P. longicuspis in Spain and the Maghreb (Table 1). Based on a dispersalist scenario, the members of each complex would have come to occupy their current ranges through active or passive dispersal across pre-existing geographical or ecological barriers; while, based on a vicariance scenario, the continuous range of an ancestral form would have been split by vicariant geological or climatic events (Avise, 1994). We follow Avise (1994: 326) in believing that “Except for purposes of organizing thought, it is probably unwise to dichotomize dispersalist versus vicariance scenarios too strongly, because both factors probably have played a role in many instances”. Our approach to interpreting the biogeographical history of Mediterranean Larroussius has been to produce well-supported molecular phylogenies and then to use them in two ways. Firstly, a cladistic biogeographical study was performed, by comparing a sandfly taxon area cladogram with both a general (or faunal) area cladogram (based on centres of endemism) and a geological area cladogram, for which the recent report of de Jong (1998) was invaluable. Finding little congruence between the sandfly and other area cladograms, we then constructed a history based on the molecular dating of speciation events, the palaeoecology of the region, and the current ecological biogeography of its sandflies. As mentioned, there is no fossil record for Larroussius (Lewis, 1982) and phylogenetic analyses of morphological characters (Rispail & Le´ger, 1998a) did not group species in well-supported terminal clades. Consequently, we decided to generate two independent, molecular data sets to help resolve phylogenetic relationships. One was for a relatively slowly evolving single-copy nuclear gene, Elongation factor alpha (EF-a) (Cho et al., 1995; Danforth & Ji, 1998). The second was for a mitochondrial gene, Cytochrome b (Cyt b), which was known to be phylogenetically informative for Phlebotomus species and to be useful for dating speciation events because of its clock-like rate of nucleotide substitution (Esseghir et al., 1997). Cyt b was also likely to be a marker for introgressive hybridizations, as shown for Lutzomyia (Marcondes et al., 1997), because of the non-recombining, maternal mode of inheritance of the mitochondrial genome in most higher eukaryotes (Avise, 1994).

SPECIATION OF PHLEBOTOMUS SANDFLIES

197

MATERIAL AND METHODS

Sandflies characterized Forty sandflies from 23 populations (five countries) were individually characterized by DNA sequencing (Table 1), including 2–3 species from each of the subgenera Paraphlebotomus and Phlebotomus to serve as outgroups (Rispail & Le´ger, 1998a). Within Larroussius, the sub-Saharan P. orientalis was characterized in addition to 7–9 of the 13 species or subspecies recorded from the Mediterranean subregion (Table 1). At least one member of each morphological species complex was represented, as were all the widespread species (usually by two or more geographical populations). Some taxa were definitely not characterized, namely Phlebotomus perfiliewi galilaeus Theodor and Phlebotomus perfiliewi transcaucasicus Perfil’ev (the two eastern subspecies of Phlebotomus perfiliewi Parrot), Phlebotomus kandelakii Shchurenkova (an unplaced species from Lebanon, Turkey, and further east), and Phlebotomus mariae Rioux, Croset, Le´ger & Bailly-Choumara (another unplaced species, collected infrequently from Morocco). Two taxa may have been represented, based on distinctive Cyt b sequences: (1) females from Tunisia were identified as Phlebotomus ariasi-like, because only the male of Phlebotomus chadlii Rioux, Juminer & Gibily has been described and morphologically distinguished from Phlebotomus ariasi Tonnoir, which is sympatric in north-west Africa; (2) two males were identified as Phlebotomus neglectus-like, because only females of Phlebotomus neglectus can be separated morphologically from the parapatric Phlebotomus syriacus Adler & Theodor (Le´ger & Pesson, 1987; Seccombe et al., 1993).

DNA extraction, amplification and sequencing General procedures for DNA extraction and amplification by the polymerase chain reaction (PCR) followed Esseghir et al. (1997). The last two-thirds of Cyt b was amplified as two overlapping fragments: c. 500 base pairs (bp) with the primer pair CB1 (5′TATGTACTACCATGAGGACAAATATC3′) (Simon et al., 1994) and CB3-R3A (5′GCTATTACTCC (T/C) CCTAACTT (A/G)TT3′) (Esseghir et al., 1997), and c. 550 bp with the primer pair CB3-PDR (5′CA (T/C)ATTCAACC (A/ T) GAATGATA3′) and NIN-PDR (5′GGTA (C/T) (A/T) TTGCCTCGA (T/A) TTCG (T/A) TTATGA3′) (Esseghir et al., 1997). Following denaturation at 94°C for 3 min and addition of 1 unit of Taq polymerase (Promega) at 80°C for a ‘hot start’, PCR consisted of 5 cycles of denaturation at 94°C for 30 sec., annealing at 40°C for 30 sec and extension at 72°C for 1 min, followed by 30 similar cycles but with annealing at 44°C, and a final extension at 72°C for 10 min, all on an OmniGene thermal cycler (Hybaid). Primers for insect EF-a genes (Dr Ben Normark, pers. comm.) were used to amplify a fragment of c. 900 bp from P. langeroni genomic DNA, and after alignment of the resulting sequence with those of published EF-a genes (available in GenBank), a novel primer pair was designed specifically to amplify a c. 800 bp fragment of a sandfly EF-a gene. The primers EF-SE (5′ TGAGCGTCAGCGTGGTATC3′) and EF-SE2 (5′CGGGTGGTTCAGTACGATGA3′) (nucleotide positions 2257–2275 and 3093–3112, respectively, in EF-1a of Drosophila melanogaster; GenBank accession no. X06869) were used with the

198

S. ESSEGHIR ET AL.

“hot start” procedure given above, except that the annealing temperatures were 50°C for the first 5 cycles and 55°C for the last 30 cycles. Procedures for PCR-product purification with glassmilk (Geneclean II, BIO 101 Inc), cycle sequencing with Thermosequenase (Amersham), sequence reading and editing with ABI 373/377 systems, and sequence alignments of Cyt b are given by Esseghir et al. (1997).

Phylogenetic analyses Phylogenetic analyses of the sequence data were cladistic (using maximum parsimony) and statistical (using the Neighbour-joining method with estimates of genetic distance, and a maximum-likelihood method based on a probabilistic model). All were conducted with PAUP∗ version 4.0b2, authorized by D. L. Swofford (1998). Within PAUP∗4.0b2, Farris successive weighting was used to resolve polytomies resulting from alternative, most parsimonious trees produced by branch-and-bound searches using equally weighted characters, and branch support was assessed by bootstrap analysis. Also within PAUP∗4.0b2, maximum likelihood analyses were carried out using the model of Felsenstein for EF-a and the model of Hasegawa, Kishino & Yano for Cyt b. Neighbour-joining trees were constructed with Kimura two-parameter distances for EF-a and with Tamura-Nei distances for Cyt b. The absolute genetic distances (pairwise dissimilarity) and Tamura-Nei distances given by PAUP∗4.0b2 were also used for estimating molecular-clock rates of sequence divergence.

RESULTS

EF-a phylogeny of Larroussius species PCR amplification was successful for species of the subgenus Larroussius but not for those of the subgenera Phlebotomus and Paraphlebotomus (GenBank accession numbers AF160801–AF160810). The aligned 720-bp DNA sequences had most similarity (81–82%) to a coding region of the two EF-a genes of Drosophila melanogaster, as identified by a BLAST search of GenBank (NCBI: http://www2.ncbi.nlm.nih.gov/ cgi-bin/genbank). All PCR products produced with the primer-pair EF-SE/EF-SE2 were of the same size (759 bp, without any intron), there were only third-position, synonymous substitutions among the sequences of these products, and there was no sequence polymorphism within taxa or populations except between P. neglectus and P. neglectus-like lineages and between P. ariasi and P. ariasi-like lineages (Table 2). These observations strongly favour an amplification by our primer-pair of an intronless, single-copy gene sequence from an orthologous locus in all species. There is at least 18% DNA sequence divergence between paralogous EF-a genes in insects, but the phylogenetic relationships among genes isolated from different insects and labelled EF-1a or EF-2a are ambiguous (Danforth & Ji, 1998) and, therefore, it would be misleading to number the Phlebotomus gene. Nucleotide composition was homogeneous among the 10 Larroussius sequences, markedly so for the entire sequences (A: 21–22%, T: 22–23%, C: 23–24%, G: 30–31%) and less so for the

SPECIATION OF PHLEBOTOMUS SANDFLIES

199

T 2. Mean absolute genetic distances between pairs of taxa for 717 bp of mitochondrial Cyt b (above diagonal) and 720 bp of nuclear EF-a (below diagonal); ND=not done Taxa

1

2

3

4

5

6

7

8

9

1 P. neglectus 2 P. neglectus-like 3 P. ariasi 4 P. ariasi-like 5 P. p. perfiliewi Tunisia 6 P. p. perfiliewi Corfu 7 P. orientalis 8 P. perniciosus Tunisia 9 P. perniciosus Spain 10 P. longicuspis 11 P. langeroni 12 P. tobbi 13 P. bergeroti 14 P. papatasi 15 P. duboscqi 16 P. sergenti 17 P. chabaudi

– 0.006 0.075 0.079 0.070 0.070 0.077 0.073 0.073 0.080 0.075 0.072 ND ND ND ND ND

0.026 – 0.073 0.077 0.069 0.069 0.073 0.072 0.072 0.079 0.073 0.070 ND ND ND ND ND

0.132 0.140 – 0.018 0.062 0.062 0.062 0.065 0.065 0.062 0.059 0.062 ND ND ND ND ND

0.134 0.143 0.033 – 0.069 0.069 0.073 0.072 0.072 0.070 0.066 0.069 ND ND ND ND ND

0.120 0.125 0.107 0.106 – 0.000 0.044 0.029 0.029 0.036 0.027 0.034 ND ND ND ND ND

0.119 0.118 0.115 0.115 0.048 – 0.044 0.029 0.029 0.036 0.027 0.034 ND ND ND ND ND

0.143 0.147 0.126 0.129 0.108 0.101 – 0.027 0.027 0.025 0.027 0.022 ND ND ND ND ND

0.133 0.132 0.114 0.115 0.059 0.071 0.099 – 0.000 0.026 0.016 0.025 ND ND ND ND ND

0.133 0.135 0.103 0.104 0.078 0.072 0.082 0.034 – 0.026 0.016 0.025 ND ND ND ND ND

Taxa

10

11

12

13

14

15

16

17

1 P. neglectus 2 P. neglectus-like 3 P. ariasi 4 P. ariasi-like 5 P. p. perfiliewi Tunisia 6 P. p. perfiliewi Corfu 7 P. orientalis 8 P. perniciosus Tunisia 9 P. perniciosus Spain 10 P. longicuspis 11 P. langeroni 12 P. tobbi 13 P. bergeroti 14 P. papatasi 15 P. duboscqi 16 P. sergenti 17 P. chabaudi

0.126 0.131 0.100 0.100 0.073 0.078 0.094 0.057 0.040 – 0.018 0.025 ND ND ND ND ND

0.124 0.127 0.117 0.115 0.102 0.102 0.110 0.088 0.069 0.076 – 0.020 ND ND ND ND ND

0.130 0.133 0.107 0.109 0.086 0.085 0.100 0.071 0.060 0.061 0.077 – ND ND ND ND ND

0.166 0.170 0.156 0.153 0.164 0.163 0.172 0.157 0.148 0.156 0.155 0.154 – ND ND ND ND

0.165 0.170 0.161 0.163 0.163 0.161 0.170 0.159 0.149 0.147 0.152 0.154 0.037 – ND ND ND

0.157 0.163 0.163 0.170 0.169 0.171 0.184 0.171 0.170 0.161 0.169 0.168 0.136 0.133 – ND ND

0.246 0.244 0.139 0.153 0.201 0.195 0.185 0.183 0.177 0.184 0.194 0.193 0.188 0.179 0.193 – ND

0.194 0.190 0.178 0.179 0.178 0.192 0.193 0.184 0.179 0.177 0.186 0.185 0.183 0.188 0.169 0.188 –

polymorphic third positions in the codons (A: 7.5–10.0%, T: 26.7–29.3%, C: 26.4–30.8%, G: 32.5–35.8%). Among the 96 variable characters, 77 were informative in maximum parsimony (MP) analyses, which recognized a monophyletic ingroup only if sequences of P. neglectus sensu lato were made the outgroup. The three most parsimonious trees given by a branch-and-bound search (with equal character weighting) had 145 steps (Rescaled consistency index (RC)=0.55) and bootstrap analysis gave strong support to the basal branching of P. ariasi s.l. sequences followed by the P. p. perfiliewi sequences (Fig. 2). The strict consensus of the three shortest trees did not resolve relationships within the P. perniciosus complex, merely grouping P. longicuspis, P. orientalis and P. tobbi (Fig. 10B). However, 1–3 rounds of successive approximations weighting with RC did select one of the most parsimonious trees, and the topology of the tree was conserved at each round (Fig. 10A). Maximum likelihood (ML) and Neighbour-joining (NJ) phylogenetic analyses gave

S. ESSEGHIR ET AL.

200

P. orientalis P. tobbi

P. longicuspis

53

P. perniciosus

P. p. perfiliewi 75 P. langeroni 99

100

P. ariasi

100

P. neglectus-like P. ariasi-like P. neglectus

Figure 2. Unrooted, 50% majority-rule consensus tree of Larroussius EF-a sequences, as given by a bootstrap analysis with the branch-and-bound search option of the maximum parsimony algorithms of PAUP∗4.0b2 (Swofford, 1998). The numbers are the percentage bootstrap support for each branch based on 1000 replicate searches.

the same tree. It had the topology of the consensus tree obtained with unweighted MP; and, the branching order of species complexes was that of Figure 2. Phylogeography of sandfly Cyt b haplotypes PCR amplification of the two Cyt b-containing fragments was successful for all Phlebotomus species tested, and 30 variant sequences (or haplotypes) were characterized from 13–15 species (GenBank accession numbers AF161188–AF161217). The last 717 nucleotides of Cyt b were aligned, excluding the putative stop signal (TAA or T). Larroussius species and P. (Pa.) sergenti had one amino acid fewer than the other species, and the resulting three nucleotide gaps were treated as “missing data”. The nucleotide composition for all haplotypes and codon positions was A: 30.1–32.6%, T: 38.1–44.4%, C: 15.3–21.2%, G:9.5–10.6%, but it was more homogeneous within Larroussius (A: 30.1–32.6%, T: 40.6–44.4%, C: 15.3–18.4%, G:9.5–10.4%). Most nucleotide haplotypes from the same Larroussius species differed pairwise by <1%, but absolute genetic distances (Table 2) were greater between some geographical populations of P. neglectus s.l. (2.6% between Crete and mainland Greece), P. ariasi s.l. (3.3% between France and Tunisia), P. p. perfiliewi (4.8% between Corfu and Tunisia) and P. perniciosus (3.4% between Spain and Tunisia).

SPECIATION OF PHLEBOTOMUS SANDFLIES

201

Nucleotide sequences were translated using the mitochondrial genetic code of D. melanogaster given by MacVector version 3.5 (International Biotechnologies Inc.). Using branch-and-bound searches with equal character weighting, MP analysis of all 16 Larroussius and five outgroup amino acid haplotypes (one from each of three species of the subgenus Phlebotomus and two species of the subgenus Paraphlebotomus; see Table 1) produced 60 most parsimonious trees (tree length=95; 48 variable characters, of which 36 were parsimony informative). The strict consensus tree did not resolve relationships within the monophyletic Larroussius, but 1–3 rounds of reweighting by the maximum values of RC placed P. ariasi s.l. as basal in Larroussius (strict consensus of 24 trees). The MP analysis of the amino acid alignment was then twice repeated, with either the sequences of Phlebotomus or Paraphlebotomus deleted. With or without reweighting by RC, in the former case there was no resolution of relationships within Larroussius but, with only Phlebotomus subgenus species as the outgroup, the branching order was P. neglectus s.l., P. ariasi s.l., P. p. perfiliewi followed by the P. perniciosus complex (consensus of six trees; tree length= 64; 39 variable characters, of which 34 were parsimony informative). We conclude that this favours accepting P. neglectus s.l. as basal in Larroussius. A consensus nucleotide sequence was formed for each species lineage that contained haplotypes differing by <1.0% (with polymorphic characters represented by IUPAC single-letter codes). Using branch-and-bound searches with equal character weighting, MP analysis of all 12 Larroussius and five outgroup consensus haplotypes (one from each of three species of the subgenus Phlebotomus and two species of the subgenus Paraphlebotomus) produced five most parsimonious trees (tree length=690; RC=0.288; 268 variable characters, of which 207 were parsimony informative). The strict consensus tree did not resolve relationships within the monophyletic Larroussius, but a single tree with better resolution was produced after 1–3 rounds of reweighting by the maximum values of RC. The branching order was P. neglectus s.l., P. ariasi s.l., P. p. perfiliewi and the P. perniciosus complex, within which P. orientalis branched off first, followed by two clades uniting P. langeroni with P. tobbi and P. perniciosus with P. longicuspis (Fig. 3). ML and NJ analyses of these consensus nucleotide sequences confirmed the monophyly of the subgenus Larroussius and the monophyly and branching order of the species complexes of P. major and P. ariasi, but failed to resolve the relationships within the P. perniciosus complex (both analyses) or to separate the P. perfiliewi and P. perniciosus complexes (ML). Further MP analyses with branch-and-bound searches were carried out for all 25 individual haplotypes of Larroussius, after deleting the haplotypes of Phlebotomus and Paraphlebotomus. With the six haplotypes of P. neglectus s.l. as the outgroup, a strict consensus of the 21 most parsimonious trees showed the following branching order of species clades: P. ariasi s.l., P. p. perfiliewi, and then P. orientalis before a polytomy involving the other members of the P. perniciosus complex; and, the geographical lineages of each species remained clustered in a single clade (tree length=393; RC=0.506; 200 variable characters, of which 184 were parsimony informative). One to three rounds of successive approximations weighting (with maximum RC indices) produced a better resolved terminal clade: in the strict consensus of six trees there was modest bootstrap support for uniting P. perniciosus with P. longicuspis in a sister clade to P. tobbi (Fig. 4). With the 3 haplotypes of P. ariasi s.l. as the outgroup, the same series of MP analyses placed P. neglectus s.l. as the basal branch followed by exactly the same branching order as shown in Figure 4. This tree topology was

S. ESSEGHIR ET AL.

202

P. perniciosus Spain P. perniciosus Tunisia

P. tobbi P. langeroni

P. longicuspis

P. orientalis

P. p. perfiliewi (Corfu)

P. ariasi-like P. p. perfiliewi Tunisia P. ariasi P. neglectus-like

P. (Pa.) chabaudi

P. (Pa.) sergenti

P. (P.) duboscqi

Outgroup

P. neglectus

P. (P.) bergeroti P. (P.) papatasi

Figure 3. Single most parsimonious tree for the consensus Cyt b haplotypes of all Phlebotomus species, as given by a branch-and-bound search with equal character weighting followed by 1–3 rounds of successive approximations weighting (with the rescaled consistency index), using the maximum parsimony algorithms of PAUP∗4.0b2, P. papatasi, P. bergeroti, P. duboscqi, P. chabaudi and P. sergenti were designated as the outgroup for the searches, but an unrooted consensus tree is figured.

also maintained for each of the outgroup selections if the weighting of transversions : transitions was changed from 1:1 to 2:1. Therefore, in conclusion, either P. neglectus s.l. or P. ariasi s.l. were accepted as the basal branch within Larroussius, but we conclude that the former should occupy this position because it branched first when species of the subgenera Phlebotomus and Paraphlebotomus were made the outgroup. In a total evidence approach, and with P. neglectus s.l. as outgroup, the same branching order of species complexes was obtained from a MP analysis (using branch-and-bound searches with equal character weighting) of the combined data

SPECIATION OF PHLEBOTOMUS SANDFLIES

83

A 100

1

65 95 84 89

65

100 100

96 100 15

100

100 9

100 100

91 95 73 100

B

4

Gr11

3

Gr10

0

C13

2

C14

18

T51, 52

Tunisia Spain

Corfu

203

P. tobbi

Greece (m*)

P. perniciosus

7

Sp12, 13

17

T34, 35, 54, 57 Tunisia

1

T61, 62

Tunisia Egypt

P. langeroni

2

Egp1, 2

1

ET18

Ethiopia

P. orientalis

2

ET19

2

T40

2

T41 T91

Tunisia

P. p. perfiliewi

3 2

T92

18

PF1

2

AR3

0

AR5

14

AR4

0

Gr13

1

Gr16

2

NE1

1

NE2

1

C2

1

C7

T51, 52 Sp12, 13 T34, 35, 54, 57 T61, 62 Egp1, 2 C14 C13 Gr11 Gr10 ET18 ET19

P. longicuspis

Corfu France

P. ariasi

Tunisia

P. ariasi-like

Crete P. neglectus Greece (m*) Corfu

P. neglectus-like

P. perniciosus P. longicuspis P. langeroni

P. tobbi

P. orientalis

Figure 4. Maximum parsimony analyses of all Larroussius Cyt b haplotypes, with branch-and-bound searches and P. neglectus and P. neglectus-like designated as the outgroup. A, strict consensus cladogram of six equally parsimonious trees after 1–3 rounds of successive approximations weighting (with the rescaled consistency index). The number in bold above each branch is the percentage bootstrap support for the 50% majority-rule tree given by 1000 replicate branch-and-bound searches. The number below each branch is the inferred number of apomorphic differences between lineages. B, with equal character weighting, the strict consensus cladogram of 21 equally parsimonious trees was the same as above, except for the clade containing all the members of the P. perniciosus complex. Only the latter is figured. ∗ m=mainland Greece.

S. ESSEGHIR ET AL.

204

0.3 Mean genetic distance between pairs of species

2.64% per Myr

2.26% per Myr

0.2

0.1 1.57% per Myr 1.34% per Myr

0

2

4 6 8 10 Millions of years (Myr) ago

12

Figure 5. Molecular clock for Phlebotomus Cyt b (717 bp). Tamura-Nei (T-N) and absolute pairwise sequence divergences (= genetic distances) were plotted against the dates of haplotype lineage divergences proposed by Esseghir et al. (1997): 10.0 and 6.0 Mya as the earliest and latest dates bracketing the formation of the Sahara desert, which separated the sub-Saharan lineage of P. duboscqi from those of P. papatasi and P. bergeroti; and, 2.8 and 1.8 Mya as the dates bracketing the intense period of aridification that separated the lineages of P. papatasi and P. bergeroti. Rates of sequence divergence are 2.64% per Myr (latest date of separation) and 1.57% per Myr (earliest date of separation) for TN genetic distances, and the equivalent figures for absolute genetic distances (italicized) were 2.26% and 1.34% per Myr respectively.

set of EF-a and consensus Cyt b sequences of Larroussius, but the strict consensus of the five shortest trees did not resolve relationships within the P. perniciosus complex. Members of the P. perniciosus complex were excluded one at a time from each gene data set, and the MP analysis repeated each time. However, no changes were observed in the branching order or taxon groupings, suggesting that no single taxon is responsible for the incongruence of the gene phylogenies, which place P. orientalis either at the crown (EF-a) or the base (Cyt b) of the P. perniciosus complex (Fig. 9).

Molecular clocks Genetic distances (absolute and Tamura-Nei) were determined between every pair of Cyt b nucleotide haplotypes, and then mean genetic distances were calculated between monophyletic lineages that differed by >1.0% and represented a species or an intra-specific, geographical population (Table 2). The mean genetic distances between the lineages found in members of the subgenus Phlebotomus were plotted against the earliest and latest datings of the vicariance speciation events proposed by Esseghir et al. (1997), namely the formation of the Sahara desert 10.0–6.0 Mya for the first lineage split (involving the comparisons of P. duboscqi versus P. papatasi and P. duboscqi versus P. bergeroti) and the intensification of the aridification of East Africa 2.8–1.8 Mya for the second lineage split (involving P. papatasi versus P. bergeroti) (Fig. 5). The rate of absolute (and Tamura-Nei) pairwise sequence divergence was 2.26% (2.64%) per Myr if the two vicariance events occurred, respectively, as late

SPECIATION OF PHLEBOTOMUS SANDFLIES

205

T 3. Maxima, minima, and means of the mean absolute genetic distances between the mtDNA haplotypes of pairs of taxa (based on 717 bp of Cyt b), and the minimum (∗) and maximum (∗∗) times of divergence (Mya) of the haplotype lineages estimated, respectively, with a maximum rate of sequence divergence of 2.3%/million years and a minimum rate of 1.34%/million years (see Fig. 5). Cyt b lineage comparisons P. neglectus s.l. versus all other species P. ariasi s.l. versus the more derived species complexes P. p. perfiliewi versus the P. perniciosus complex Species-pairs within P. perniciosus complex

Max. of mean distances Min. of mean distances /Min. divergence∗(Mya) /Min. divergence∗(Mya) /Max. divergence∗∗(Mya) /Max. divergence∗∗(Mya)

Mean of mean distances /Min. divergence∗(Mya) /Max. divergence∗∗(Mya)

14.50%/6.30/10.82

11.85%/5.15/8.84

13.13%/5.71/9.79

12.75%/5.54/9.52

10.00%/4.35/7.46

11.14%/4.84/8.31

10.50%/4.57/7.84

6.50%/2.83/4.85

8.45%/3.67/6.31

11.00%/4.78/8.21

4.0%/1.74/2.99

7.45%/3.24/5.56

as 6.0 Mya and 1.8 Mya, or 1.34% (1.57%) per Myr if they occurred, respectively, as early as 10.0 Mya and 2.8 Mya. The faster absolute rate of Cyt b divergence is the same (to one decimal place) as that of the average rate of mtDNA divergence calculated for a range of insects (Brower, 1994), and therefore this rate of 2.3% per Myr was chosen as the maximum for dating speciation events within Larroussius (Table 3). The dates of speciation within the P. perniciosus complex (Table 3) were not concordant with the branching order in any of the most parsimonious Cyt b trees, and one explanation for this is that mitochondrial introgression has occurred (see Discussion). The lack of EF-a sequences for the species of the subgenus Phlebotomus prevented us using the same approach to estimate rates of divergence in this nuclear gene. Therefore, we investigated relationships between nuclear and mitochondrial rates of sequence divergence (and possible introgression) by plotting the mean absolute genetic distances between EF-a DNA sequences of pairs of Larroussius species lineages against the corresponding values for Cyt b (Fig. 6). (The differences between absolute and Kimura-2 or Tamura-Nei estimates of genetic distance were very small.) There was a statistically significant, linear relationship between the two genetic distances for most species lineages, except for comparisons involving P. (La.) langeroni or P. (La.) orientalis (Fig. 6; y=−1.4684e−2+0.689x). The failure of the regression line to pass through a 0.0, 0.0 origin is consistent with the isolation of populations after the splitting of mtDNA lineages and with some actual data points (with geographical populations of P. p. perfiliewi and P. perniciosus showing sequence divergence for Cyt b but not for EF-a). These findings can be explained in two ways: either P. orientalis and P. langeroni lineages have a different rate of EF-a and/or Cytb sequence divergence compared to the other Larroussius lineages; or, these two species have acquired by introgressive hybridization the EF-a loci or mitochondrial lineages of species that are not included in this study. To explore the first explanation, we projected the number of transitions or transversions between each pair of species lineages against the corresponding absolute genetic distance (Figs 7, 8). This was established for both gene sequences, and for Cyt b included species of the subgenera Phlebotomus and Paraphlebotomus. The positive slopes of the statistically significant linear regressions suggest that none of the EF-a or Cyt b sequences has reached its site saturation limit, and the distribution of the

S. ESSEGHIR ET AL.

Mean absolute genetic distances between EF-alpha DNA sequences of pairs of species

206

0.08

0.06

0.04

0.02

0.00

0.05

0.10

0.15

Mean absolute genetic distances between Cyt b DNA sequences of pairs of species

Figure 6. Relationship between the rates of nuclear DNA and mitochondrial DNA sequence divergence. Mean absolute genetic distances between EF-a sequences were projected against the corresponding values of Cyt b sequences for the same pair of Larroussius species. (Η) P. orientalis versus P. langeroni; (Ο) all other comparisons with P. orientalis; (Ε) all other comparisons with P. langeroni; (Φ) all other species’ comparisons, with which the regression line was calculated.

data points involving P. langeroni and P. orientalis does not suggest an unusual rate of sequence divergence in either of the genes isolated from these species (Figs 7, 8). For all species except P. langeroni and P. orientalis, approximate estimates of the maximum and minimum absolute pairwise divergence rates of EF-a nucleotide sequences were made by constraining the regression of EF-a on Cyt b genetic distances to pass through 0.0, 0.0. In this way, the maximum and minimum divergence rates (and slopes) were, respectively, 1.61% per Myr (0.70) and 1.12% per Myr (0.52) if the rate for Cyt b is 2.3% per Myr.

Taxon area cladograms Area cladograms of Larroussius species were constructed with resolved gene trees and then compared with general (or faunal) and geological area cladograms (Fig. 9). The general area cladogram and its circum-Mediterranean centres of endemism came from de Jong (1998), while the geological area cladogram is modified from de Jong (1998) to include the east of the Mediterranean subregion according to Oosterbroek & Arntzen (1992). The EF-a and Cyt b trees are not congruent for the derived P. perniciosus complex, and so the centre of endemism encompassed by the range of each species (Seccombe et al., 1993) has been placed against the respective branch on the EF-a tree and specifically framed so that the full Cyt b area cladogram can be traced.

SPECIATION OF PHLEBOTOMUS SANDFLIES

207

Number of transitions between EF-alpha sequences for pairs of species

40 A

30

20

10

0

0.02

0.04

0.06

0.08

Absolute distances between EF-alpha sequences for pairs of species

Number of transversions between EF-alpha sequences for pairs of species

30 B

20

10

0

0.02

0.04

0.06

0.08

Absolute distances between EF-alpha sequences for pairs of species

Figure 7. The relationship between the number of (A) transitions or (B) tranversions and the absolute genetic distance between the EF-a DNA sequences of pairs of Larroussius species. Symbols as for Fig. 6, and with the unshaded diamond arrowed. The regression line was calculated with the data points shown as unshaded squares.

There was no strict or near-strict congruence between the Larroussius and other area cladograms. Co-cladogenesis of Larroussius and Leishmania Several zymodemes (= isoenzyme strains) of L. infantum have been isolated from Mediterranean Larroussius species, and in Figure 10 the parasite associations have

S. ESSEGHIR ET AL.

208

80 Number of transitions between Cyt b sequences for pairs of species

A

60

40

20

0

0.05

0.10

0.15

0.20

0.25

Absolute distances between Cyt b sequences for pairs of species

Number of transversions between Cyt b sequences for pairs of species

80 B

60

40

20

0

0.05

0.10

0.15

0.20

0.25

Absolute distances between Cyt b sequences for pairs of species

Figure 8. The relationship between the number of (A) transitions or (B) tranversions and the absolute genetic distance between the Cyt b DNA sequences of pairs of Phlebotomus species. Symbols as for Fig. 6, and with the unshaded diamond arrowed. The regression line was calculated with the data points shown as unshaded squares.

been traced on the vector phylogeny inferred by the MP analysis of the EF-a gene (The tree is the product of 1–3 rounds of successive approximations weighting (SAW) with P. neglectus and P. neglectus-like designated as the outgroup). The zymodemes have Montpellier (MON) codes (Rioux et al., 1990; Martin-Sanchez et al., 1996). There was no strict or near-strict co-cladogenesis.

SPECIATION OF PHLEBOTOMUS SANDFLIES Larroussius species area cladogram based on Cyt b DNA sequences

Larroussius species area cladogram based on EF-α DNA sequences

P. perniciosus

sub-Saharan Africa

P. orientalis

P. longicuspis

ATL + TELL + IB

P. longicuspis

P. tobbi

P. tobbi

BALK + ANAT + CAUC

P. langeroni

ATL + TELL + SARD + CORS + IB + PYR + PAL + SIC + ALPS

P. perniciosus

P. orientalis

ATL + TELL + IB

P. langeroni

ATL + TELL + SARD + BALK + ANAT + CAUC + APEN ATL + TELL + IB + PYR + PAL + ALPS

P. p. perfiliewi

P. p. perfiliewi P. ariasi P. ariasi-like P. neglectus P. neglectus-like General (fauna) area cladogram (de Jong, 1998)

209

ATL TELL CORS

BALK + ANAT + APEN

P. ariasi P. ariasi-like P. neglectus P. neglectus-like

Geological area cladograms

ATL TELL CORS

SARD BALK

SARD EAST-MED

ANAT

IB PAL PYR

CAUC IB PAL

SIC ALPS

PYR SIC

APEN

ALPS APEN

Figure 9. Larroussius species area cladograms based on resolved gene trees. The EF-a and Cyt b trees are not congruent for the derived P. perniciosus complex, and so the centre of endemism encompassed by the range of each species (Seccombe et al., 1993) has been placed against the respective branch on the EF-a and specifically framed so that the Cyt b area cladogram can be traced. The circumMediterranean centres of endemism are those defined by de Jong (1998): ATL=Atlas; TELL=Tell Atlas; CORS=Corsica; SARD=Sardinia; BALK=Balkans; ANAT=Anatolia; CAUC=Caucasus; IB=Iberia; PAL=Palaearctic region; PYR=Pyre´ne´es; SIC=Sicily; ALPS=Alps; APEN=Apennines. The geological area cladogram is modified from de Jong (1998) to include the east of the Mediterranean subregion according to Oosterbroek & Arntzen (1992).

DISCUSSION

Species boundaries and phylogeography The basal branch of the Cyt b tree was formed either by the haplotypes of P. neglectus s.l. or of P. ariasi s.l., depending on whether amino acid or nucleotide sequences were used and on the composition of the outgroup. In most cases, P. neglectus s.l. branched first, and then the nuclear and mitochondrial DNA phylogenies were strictly congruent basally (Fig. 9). Each of the main branches was always composed of just one of the proposed morphospecies complexes of Larroussius (Table 1); in other words, lineage sorting was found to be complete between the more basal clades. Unlike the morphological phylogeny of Rispail & Le´ger (1998a), each molecular phylogeny places P.

S. ESSEGHIR ET AL.

210

Zymodene of L. infantum

3

P. longicuspis

70

P. tobbi

6 89

P. perniciosus

B

77

Strict consensus prior to SAW

8

7 97 2

15 100 11 4

34

16 100

10 5

2

P. langeroni

P. orientalis P. longicuspis

P. tobbi

P. perniciosus

1 1 1

24

28

29

105

190

186

P. langeroni P. p. perfiliewi

33

28 1

24

1

24

Sequential cladogenesis of more arid-adapted species

8

P. orientalis

P. ariasi-like 9 3

29

P. ariasi P. neglectus 1

100

A

2

P. neglectus-like

EF-α tree of Larroussius with SAW

proven vector of L. donovani proven vector of L. infantum suspected vector of L. infantum

humid/ sub-humid

humid/sub-humid/ semi-arid

sub-humid/ semi-arid

semi-arid/ arid

Figure 10. Ecological and parasite associations of Mediterranean Larroussius species. A, bioclimatic zones and zymodemes (= isoenzyme strains) of Leishmania infantum (found in proven or suspected vectors), are associated with a Phlebotomus species phylogeny inferred by maximum parsimony analysis of 720 bp of the EF-a gene. The tree is the product of 1–3 rounds of successive approximations weighting (SAW) with P. neglectus and P. neglectus-like designated as the outgroup. The zymodemes are Montpellier (MON) codes (Rioux et al., 1990; Martin-Sanchez et al., 1996). Vector status follows Killick-Kendrick (1990). B, strict consensus of the variable part of the three most parsimonious trees prior to SAW.

perniciosus in a single derived clade along with the genitalically similar P. langeroni, P. longicuspis, P. orientalis and P. tobbi. Most morphospecies of Larroussius were characterized by a single nuclear DNA genotype (EF-a) and a clade of mitochondrial haplotypes (Cyt b) genetically distant from its sister lineage (Figs 2, 3), indicating that these taxa are reproductively-isolated biological species. Only the P. neglectus-like males from Crete and the P. ariasi-like female from Tunisia differed from their other populations in EFa genotype as well as in mitochondrial lineage, and the Tunisian fly may be the undescribed female of P. chadlii. Maternal inheritance, absence of gene-pool homogenization by recombination, and stochastic lineage losses tend to create, even within local populations of a biological species, mtDNA lineages that are more divergent than those of nuclear genes (Avise, 1994). This is illustrated by the regression of EF-a genetic distance on that of Cyt b, which does not pass through 0.0, 0.0 but cuts the EF-a origin at a positive value for Cyt b (Fig. 6). Sometimes, this characteristic of mtDNA can produce a marked

SPECIATION OF PHLEBOTOMUS SANDFLIES

211

discordance between its genealogies and the branching order of a species tree, which is more dependent on the isolation of geographical populations. However, mtDNA lineages are similar to the species that carry them in that they often show more geographical divergence following vicariance events, which sometimes lead to allopatric speciation. We found two examples of such incipient speciation: the Tunisian mitochondrial lineages of P. p. perfiliewi and P. perniciosus also occur in Italy (Esseghir et al., 1997) and may be markers for geographical races (or phylogenetic species) distinct from those in Greece and Spain, respectively, although neither of the intraspecific populations showed any EF-a sequence divergence or morphological differences. The sharing of the same mtDNA lineage by Tunisian and Italian populations indicates that dispersal as well as vicariance should be considered when investigating biogeography (see next section). Although the numbers of individuals used in the current study may seem small, other studies have confirmed the low levels of polymorphism in these two genes within most geographical populations of Larroussius (Esseghir et al., 1997; P. D. Ready & B. Pesson, unpublished observations). While it is clear that lineage sorting is complete between the more basal clades of Larroussius, the same cannot be said for the species within the derived P. perniciosus complex. Phlebotomus orientalis and P. perniciosus had different phylogenetic positions in the phylogenies of EF-a and Cyt b. Also, Phlebotomus langeroni and P. orientalis showed a marked difference in the relative rates of divergence of the two gene sequences when compared with the other morphospecies in the P. perniciosus complex or with P. p. perfiliewi, but not when compared with the members of the other Larroussius species complexes (Fig. 6). In contrast, both genes of P. langeroni and P. orientalis did not differ significantly in base composition or rates of transition and transversion when compared with those of any other species within or outside the P. perniciosus complex (Figs 7, 8). These findings make it unlikely that either gene has a mode of molecular evolution in P. langeroni and P. orientalis differing markedly from that in the other Phlebotomus species. We suggest that a more likely explanation for the incongruent gene phylogenies and for the aberrant relative rates of gene divergence are past introgressive hybridizations, so that none of these three species now contains its original combination of EF-a and Cyt b genes. mtDNA introgression is the more likely (because of the absence of dilution through recombination during back-crossing), and this has been reported for wild populations of three sympatric neotropical sandfly species (Marcondes et al., 1997). The contrasting positions of P. orientalis in the molecular phylogenies suggests that it acquired its mtDNA genome from one of the nine other Larroussius species restricted to the Afrotropical region (Seccombe et al., 1993; Gebre-Michael & Lane, 1996), many of which fit morphologically into the P. perniciosus complex based on the descriptions of Killick-Kendrick et al. (1994). If they do belong to the derived P. perniciosus complex, then this favours an Eurasian origin of the subgenus. Evolution of Mediterranean Larroussius Previous proposals concerning the speciation of Mediterranean Larroussius were supported not by a resolved phylogeny but by a general hypothesis of vicariance associated with tectonic activities 20.0–15.0 Mya. (Le´ger & Pesson, 1987; Marchais, 1992). The Cyt b molecular clock now shows that speciation occurred later than this: 10.8–3.0 Mya at the lower, less-likely rate of sequence divergence (1.34% per Myr); and 6.3–1.7 Mya at the upper rate of sequence divergence, which equals the

212

S. ESSEGHIR ET AL.

average rate for insect mtDNA (2.3% per Myr; Brower, 1994) (The ranges are based on the maximum and minimum mean absolute genetic distances between pairs of species; Table 3). It should be remembered that the Cyt b clock gives the dates of divergence of mtDNA lineages, and that these will often pre-date speciation events (Avise & Walker, 1998), because the bioclimatic barriers intensified with time (de Menocal, 1995) and populations are usually isolated after the splitting of mtDNA lineages (Avise, 1994). Consequently, the upper bounds estimated for Larroussius are unlikely extremes. By considering the two gene phylogenies, the dates of mtDNA lineage divergence given by a Cyt b molecular clock running at 2.3% per Myr, the regional geology and palaeoecology, and the current ecological biogeography of the species studied, we conclude that most speciation of Mediterranean Larroussius was dependent not on tectonic vicariance events but on palaeoecological changes, and that faunal turnover and dispersal (through inter-continental landbridges) has determined many of the present-day ranges. Our account of the historical biogeography of Mediterranean Larroussius includes only brief references to the geological evolution of the region, because this has been reviewed very recently by de Jong (1998). Also, an important point is that all major tectonic rearrangements of landmasses in the Mediterranean subregion had already occurred by the beginning of the Pliocene epoch (c. 5.4 Mya; Steininger & Rogl, 1984) and, therefore, tectonic vicariance events can only be invoked for the divergences of the lineages of P. neglectus s.l. and P. ariasi s.l. (Table 3). Consistent with this dating of Larroussius evolution is the absence of any near-strict congruence between the sandfly taxon area cladogram and the general and geological area cladograms (Fig. 9). It is noteworthy that the general (or faunal) taxon area cladogram of de Jong (1998) was based on groups whose species are considered to have low dispersal abilities and high endemicity and, therefore, it can be concluded that this is not the case for many widespread species of Mediterranean Larroussius. de Jong (1998) used five cladistic biogeography methods to test the congruence of the taxon area cladograms of ten endemic Mediterranean groups of animals. Each method produced a different general area cladogram, and only Brooks Parsimony analysis gave a general area cladogram that was “fully compatible” with the geological area cladogram and corresponded roughly to the general area cladogram for the Mediterranean proposed by Oosterbroek & Arntzen (1992). The two reports are complementary, as the earlier analysis does not include North Africa and de Jong’s does not fully consider the eastern Mediterranean. The geological area cladogram of de Jong (1998) related regions of endemism isolated before the Pliocene. Thus, at the beginning of the Miocene (23.2 Mya), the Tethys and Paratethys seas were linked and formed a barrier that isolated western Europe, Eurasia and Africa. Then, c. 18–17 Mya, the collision of the AfricanArabian and Eurasian tectonic plates led to the first closure of the Tethys, at its eastern end, which was followed by faunal migration—mostly out of Africa for large mammals (Steininger & Rogl, 1984). The first branch on the general and geological area cladograms involves Africa (Fig. 9), and so a vicariance interpretation would include (c. 14 Mya) the reopening of the Tethys to the Indo-Pacific seaway (Steininger & Rogl, 1984). In contrast, a dispersalist hypothesis might invoke migration across the Tethys at an earlier date, as Africa approached Eurasia. The next series of major geological vicariance events started c. 12–11 Mya, when the eastern passage of the Tethys gradually closed and permitted faunal dispersal, mostly from Eurasia

SPECIATION OF PHLEBOTOMUS SANDFLIES

213

to Africa (via Sinai) (Steininger & Rogl, 1984) and from western Asia to eastern Europe (Behrensmeyer et al., 1992; Blondel & Mourer-Chauvire, 1998). At about the same time, Corsica and Sardinia also became isolated from southern Europe, and the Tyrrhenian Basin started to develop. By the end of the Miocene epoch (5.5–4.9 Mya) these tectonic activities completed the fragmentation of the Paratethys sea (eventually giving rise to the Caspian and Black Seas) and produced a Mediterranean Sea close to the present form (Steininger & Rogl, 1984; de Jong, 1998). Only the P. major and P. ariasi complexes could possibly have diverged following any of the tectonic vicariance events described so far, if one accepts a rate of 2.3% per Myr for the Cyt b clock. Even so, we suggest that these two lineages are more likely to have arisen later (based on the later divergence times of species lineages compared to those of mtDNA), during and shortly after the Messinian salinity crisis at the very end of the Miocene. This was the next and last of the major tectonic events in the Mediterranean Basin: compression of the North African and Iberian plates led to the closure of the Strait of Gibraltar and substantial drying of the landlocked Mediterranean Sea, some 5.6–4.9 Mya (de Jong, 1998) or 6.0–5.5 Mya. (Steininger & Rogl, 1984), and it was followed by faunal dispersal from north Africa to both Iberia and south-west Asia (Azzaroli & Guazzone, 1980). The P. major and P. ariasi complexes were found to be basal to the other species complexes of Larroussius and their ranges are allopatric. The former is mainly Asiatic: P. neglectus extends furthest west, but not into the western Mediterranean Basin (Table 1). All this suggests a west Asian origin for this complex, probably by vicariance when the Mediterranean Sea dried to produce an extensive arid barrier between more humid, forested regions in western Europe and the Middle East; the palaeoecology of the surrounding areas indicates that aridification occurred—savannas and open woodland were widespread, interrupted by pockets of montane forest (Behrensmeyer et al., 1992). Early in the Pliocene (4.9 or 5.5 Mya), connections were re-established between the Mediterranean Sea and the Atlantic (at the Strait of Gibraltar) and between the Red Sea and the Indo-Pacific Seaway (at the Aden Strait), thereby leaving only one inter-continental landbridge (at Sinai) (Steininger & Rogl, 1984). At this time the P. ariasi lineage may have become isolated in Iberia/south-west Europe, where it is currently most abundant and widespread (Table 1; Seccombe et al., 1993). Speciation within the western Mediterranean lineages, allopatric to the P. major complex, can then be associated with habitat shifts (from humid forests to more open ecotopes), generated by increasing aridity (Behrensmeyer et al., 1992; Table 3). Such stepwise or sequential cladogenesis conforms to the ‘taxon pulse’ model of speciation (Erwin, 1981). The P. ariasi complex was the first to branch off, and it is found only in western Europe and the western Maghreb of north Africa, where it is most abundant in the humid and subhumid bioclimatic zones, often in oak forests at higher altitudes (Dedet et al., 1984; Rioux et al., 1984; Rioux, 1995; A. Ftaiti & R. Ben-Ismail, unpublished observations in Tunisia). The next lineage to branch off was the P. perfiliewi complex, with a distribution centred on the eastern Mediterranean and predominating in humid to semi-arid bioclimatic zones (loc. cit.), as P. p. perfiliewi in the eastern Maghreb through Italy to the Balkans, and as P. p. galilaeus and P. p. transcaucasicus eastwards into south-west Asia (Seccombe et al., 1993). Later stages of speciation involved the P. perniciosus complex. Incongruence of molecular phylogenies of this derived complex suggests reticulate evolution following a radiation, with mitochondrial genomes providing markers for past introgressive

214

S. ESSEGHIR ET AL.

hybridizations between sympatric or parapatric pairs of species (P. perniciosus/P. longicuspis in the western Mediterranean, and P. orientalis/P. sp. in eastern Africa) rather than between the sister species inferred from the EF-a tree. Members of the P. perniciosus complex now predominate in semi-arid and arid bioclimatic zones and display traces of an allopatric distribution pattern (which overlays the allopatric patterns of the other Larroussius complexes). Only P. perniciosus is found in France, Switzerland and Italy (where it is sympatric with P. ariasi and, in Italy alone, with P. p. perfiliewi, and outnumbers both of them at lower altitudes and in the sub-humid/semi-arid bioclimatic zones). P. tobbi is sympatric with P. perniciosus in the northern Balkans, before replacing it further east (but remaining sympatric with P. perfiliewi subspecies). P. langeroni replaces P. tobbi from Egypt to southern Spain. In north-west Africa, P. perniciosus and P. longicuspis predominate in semi-arid and arid bioclimates (and P. p. perfiliewi and P. ariasi/chadlii are found mostly in the subhumid and humid zones) (Rioux & Golvan, 1969; Seccombe et al., 1993; Dedet et al., 1984; Rioux et al., 1984; Rioux, 1995; A. Ftaiti & R. Ben-Ismail, unpublished observations in Tunisia). Based on the Cyt b clock, speciation within the P. perniciosus complex coincided with a period of more intense aridification in the Mediterranean subregion, exemplified by the growth of ice sheets in the northern hemisphere from c. 2.8 Mya (Behrensmeyer et al., 1992; de Menocal, 1995). One putative vicariance event involved the Maghrebian P. longicuspis and the sub-Saharan (Sahelian) P. orientalis, which appear as sister species in the EF-a phylogeny as well as in the morphological phylogeny of Rispail & Le´ger (1998a). The Milankovitch climatic cycles are believed to have generated most of the ecological changes in the northern hemisphere in the past 1.7 Myr, during the Pleistocene and Holocene epochs. They promoted the spread of forests during the inter-glacial periods, followed by invasions of steppe-like vegetation during glacial phases, with the climate changes being less intense on the southern side of the Mediterranean Basin (Behrensmeyer et al., 1992). Allopatric speciation of Larroussius is certainly suggested by the current ranges of the members of each species complex, but all speciation undoubtedly occurred before the Pleistocene (Table 3) and, therefore, Ice Age refugia (Hewitt, 1996) played no primary role in speciation. By this reasoning, Pleistocene refugia were possible centres of origin of intraspecific races of Larroussius, as they were for birds (Avise & Walker, 1998). The current ranges of Larroussius species could well be misleading for any analysis of allopatric speciation, because they undoubtedly changed during the climate cycles of the Plio-Pleistocene. Phlebotomus species require hot summers and mild winters (Lewis, 1982; Ready & Croset, 1980) and would only have survived in the most southerly regions of Spain, Italy and Greece during the Ice Ages. Certainly, the gene phylogenies do not unambiguously support the traditional treatment of P. perniciosus and P. tobbi as sister taxa, and so sympatry limited to the northern Balkans might reflect range expansions from the most recent Ice Age refugia, in the last 10 Kyr (Shackleton et al., 1984; Hewitt, 1996), rather than secondary contact following vicariance speciation. Judging by the shared Cyt b lineages of Tunisian and Italian populations of P. p. perfiliewi or P. perniciosus (Esseghir et al., 1997), marine barriers have sometimes been passable, and migration may have been more frequently wind-assisted (by the southerly Sirocco) than human-assisted. Otherwise one would have expected to find some mitochondrial haplotypes shared by Italy and Corfu

SPECIATION OF PHLEBOTOMUS SANDFLIES

215

(between which the haplotypes of P. p. perfiliewi differ by 4.8%) or the Maghreb and Spain (between which the haplotypes of P. perniciosus differ by 3.4%). Sandfly–Leishmania evolutionary relationships Fahrenholz’s rule is followed when there is total congruence of parasite and host phylogenies (Poulin, 1998). Our molecular phylogenies of Larroussius allow us to reject an hypothesis of strict co-cladogenesis between Leishmania and Phlebotomus species: the two most notorious vectors of L. donovani (causative agent of epidemic visceral leishmaniasis) are P. (Eu.) argentipes in the Indian subcontinent and P. (La.) orientalis in Sudan and Kenya (Killick-Kendrick, 1990), and yet we now know that P. orientalis belongs to one of the most derived lineages of Larroussius, rather than the basal lineage as would be necessary for co-cladogenesis. Additional evidence for rejecting Fahrenholz’s rule was set out in the introduction. Proven vectors of L. infantum in the Mediterranean subregion belong only to the subgenus Larroussius (Killick-Kendrick, 1990) but, as with other sandfly-Leishmania co-associations, there is no analytical support for co-cladogenesis between individual sandfly species and parasite strains. Our Larroussius phylogenies and Cyt b molecular clock provide no support for co-cladogenesis of Mediterranean Larroussius species, which arose 10.8–1.7 Mya, and the isoenzyme strains of L. infantum, which are much younger if L. donovani diverged only 2.0–1.5 Mya as inferred by Moreno et al. (1986). Within the subregion, all Larroussius species and most L. infantum strains (often dermatropic in humans) have limited distributions but there is no evidence for specific, geographical relationships. On the contrary, sandflies from different lineages have often been found naturally infected with the same isoenzyme strain (= zymodeme) of parasites (Fig. 10), sometimes when collected together, e.g. P. ariasi and P. perniciosus (Guilvard et al., 1996). Furthermore, the one L. infantum zymodeme found throughout the Mediterranean subregion (MON-1, routinely associated with human and canine visceral leishmaniasis) has been isolated from representatives of all our Larroussius complexes (References: Killick-Kendrick, 1990). The occurrence of one parasite species in more than one host species can result from the continuation of gene flow between the parasite populations of different hosts (vector and/or mammalian reservoir hosts), from the absence of parasite speciation following host speciations, or from host switching and the colonization of new hosts (Combes, 1991; Poulin, 1998) and, consequently, a statistical approach is often necessary to detect traces of co-evolutionary patterns (Page & Hafner, 1996). For L. infantum, however, there have been relatively few isolations of zymodemes from the midguts of wild-caught Larroussius and so it would be premature to perform a complete congruence analysis of the vector and parasite phylogenies. However, the mapping of L. infantum zymodemes on to the Larroussius phylogeny (given by EFa) does make it clear that little co-cladogenesis is likely to have occurred (Fig. 10). Therefore, parasitologists should be wary of drawing co-evolutionary conclusions based on epidemiological associations of these vectors and parasites. This failure to observe specific, natural associations between different L. infantum strains and Larroussius species might result from parasite flagellar ligands (lipophosphoglycans) that, compared with those of L. major, have a broader range of compatibilities with sandfly midgut receptors (Pimenta et al., 1994), enough to permit the natural transmission of strain MON-1 (as “L. infantum chagasi”) by Lutzomyia

216

S. ESSEGHIR ET AL.

longipalpis (Lutz & Neiva) and Lutzomyia evansi (Nunez-Tovar) in Latin America (Montoya & Lane, 1996), where the parasite was probably recently introduced from the Old World (Killick-Kendrick, 1990). Therefore, the specific association of L. infantum with the subgenus Larroussius in the Mediterranean subregion should be explained in terms not only of compatibility but also of frequency of encounters, these being favoured by the overlapping ecological niches (Rioux & Golvan, 1969; Rioux et al., 1984; Rioux, 1995) and behavioural traits of the vectors. For example, many Larroussius are known to feed on canids, which are often the reservoir hosts of L. infantum (Killick-Kendrick, 1990). However, before concluding that the ‘encounter filter’ is more important than the ‘compatibility filter’ (sensu Combes, 1991) for limiting Larroussius-L. infantum relationships, mention should be made of the findings of Molina (1991), who demonstrated for Spanish isolates of L. infantum zymodeme MON-1 higher experimental infection rates in Spanish populations of P. perniciosus than in Italian populations. Some degree of adaptation of a clonal protozoan to regional vector populations is not unexpected (and P. perniciosus does have a distinctive Spanish lineage), but we can find no report that co-evolution has progressed far enough to prevent a single isoenzyme strain of L. infantum from being transmitted by any Larroussius species, and in this case a “generalist” parasite strategy (sensu Combes, 1991) cannot be rejected. In conclusion, our phylogenetic analyses have enabled us to reject an hypothesis of strict co-cladogenesis of Larroussius with strains of the L. donovani complex. This reinforces the need for process-based explanations of the strong association between Larroussius and L. infantum in the Mediterranean subregion, instead of relying on descriptive co-evolutionary labels.

ACKNOWLEDGEMENTS

We are grateful to Ben Normark for initial information on EF-a primers, and to numerous colleagues for specimens: Bahira E1 Sawaf (Egypt), Teshome GebreMichael (Ethiopia), Byron Chaniotis and Eleni Dotsika (Greece), Eseqiel Martinez Ortega (Spain), Bob Killick-Kendrick (Greece, Kenya), and Ali Ftaiti and the health services in Tunisia. We are indebted to Jo Testa, Julia Bartley and Ian Ridgers for technical assistance in the Natural History Museum. This work was supported by a TDR/WHO Research Training Grant and a British Council (Tunis) fellowship, both to S.E., and by EU/DGXII grant TS3∗CT93–0253.

REFERENCES

Avise JC. 1994. Molecular markers, natural history and evolution New York: Chapman & Hall. Advise JC, Walker D. 1998. Pleistocene phylogeographic effects on avian populations and the speciation process. Proceedings of the Royal Society of London, series B 265: 457–463. Azzaroli A, Guazzone G. 1980. Terrestrial mammals and land connections in the Mediterranean before and during the Messinian. Palaeogeography, Palaeoclimatology, Palaeoecology 29: 155–167. Behrensmeyer AK, Damuth JD, DiMichele WA, Potts R, Sues H-D, Wing SL. 1992. Terrestrial ecosystems through time: evolutionary paleoecology of terrestrial plants and animals. Chicago: University of Chicago Press. Blondel J, Mourer-Chauvire C. 1998. Evolution and history of the western Palaearctic avifauna. TREE 13: 488–492.

SPECIATION OF PHLEBOTOMUS SANDFLIES

217

Brower AVZ. 1994. Rapid morphological radiation and convergence among races of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proceedings of the National Academy of Sciences USA 91: 6491–6495. Cho S, Mitchell A, Regier JC, Mitter C, Poole RW, Friedlander TP, Zhao S. 1995. A highly conserved nuclear gene for low-level phylogenetics: elongation factor 1-alpha recovers morphologybased tree for heliothine moths. Molecular Biology and Evolution 12: 650–656. Combes C. 1991. Evolution of parasite life cycles. In: Parasite-Host associations: Coexistence or Conflict? Toft CA, Aeschlimann A, Bolis L. Oxford: Oxford Science Publications, 69–82. Croan DG, Morrison DA, Ellis JT. 1997. Evolution of the genus Leishmania revealed by comparison of DNA and RNA polymerase gene sequences. Molecular and Biochemical Parasitology 89: 149–159. Danforth BN, Ji S. 1998. Elongation factor-la occurs as two copies in bees: implications for phylogenetic analysis of EF-1a sequences in insects. Molecular Biology and Evolution 15: 225–235. Dedet J-P, Addadi K, Belazzoug S. 1984. Les phle´botomes (Diptera, Psychodidae) d’Alge´rie. Cahiers O.R.S.T.O.M., se´rie Entomologie me´dicale et Parasitologie 22: 99–127. de Jong H. 1998. In search of historical biogeographic patterns in the western Mediterranean terrestrial fauna. Biological Journal of the Linnean Society 65: 99–164. de Menocal PB. 1995. Plio-Pleistocene African climate. Science 270: 53–59. Depaquit J, Perrotey S, Lecointre G, Tillier A, Tillier S, Ferte´ H, Kaltenbach M, Le´ger N. 1998. Syste´matique mole´culaire des Phlebotominae: e´tude pilote. Paraphylie du genre Phlebotomus. Comptes Rendues de l’Academie des Sciences Paris, Sciences de la Vie 321: 849–855. Erwin TL. 1981. Taxon pulses, vicariance, and dispersal: an evolutionary synthesis illustrated by carabid beetles. In: Vicariance biogeography: a critique (ed. Nelson G, Rosen DE). New York: Columbia University Press, 159–196. Esseghir S, Ready PD, Killick-Kendrick R, Ismail RB. 1997. Mitochondrial haplotypes and phylogeography of Phlebotomus vectors of Leishmania major. Insect Molecular Biology 6: 211–225. Fernandes AP, Nelson K, Beverley SM. 1993. Evolution of nuclear ribosomal RNAs in kinetoplastid protozoa: perspectives on the age and origins of parasitism. Proceedings of the National Academy of Sciences USA 90: 11608–11612. Galati BEA. 1995. Phylogenetic systematics of Phlebotominae (Diptera, Psychodidae) with emphasis on American groups. Boletin de la Direccion de Malariologia y Saneamiento 35 (Suppl. 1): 133–142. Gebre-Michael T, Lane RP. 1996. A new sandfly species, Phlebotomus (Larroussius) ashfordi (Diptera, Psychodidae) from Ethiopia, previously confused with P. (L.) aculeatus. Annals of Tropical Medicine and Parasitology 90: 523–531. Guilvard E, Gallego M, Moreno G, Fisa R, Rispail P, Pratlong F, Ortega EM, Gallego J, Rioux JA. 1996. Natural infection of Phlebotomus ariasi and Phlebotomus perniciosus (Diptera-Psychodidae) by Leishmania infantum (Kinetoplastida-Trypanosomatidae) in Catalonia (Spain). Parasite 3: 191–192. Hewitt GM. 1996. Some genetic consequences of ice ages, and their role in divergnce and speciation. Biological Journal of the Linnean Society 58: 247–276. Killick-Kendrick R. 1985. Some epidemiological consequences of the evolutionary fit between leishmaniae and their phlebotomine vectors. Bulletin de la Socie´te´ de Pathologie Exotique 78: 747–55. Killick-Kendrick R. 1990. Phlebotomine vectors of the leishmaniases: a review. Medical and Veterinary Entomology 4: 1–24. Killick-Kendrick R, Tang Y, Killick-Kendrick M, Johnson RN, Ngumbi PM, Sang DK, Lawyer PG. 1994. Phlebotomine sandflies of Kenya (Diptera: Psychodidae). III. The identification and distribution of species of the subgenus Larroussius. Annals of Tropical Medicine and Parasitology 88: 183–196. Lainson R, Shaw JJ. 1987. Evolution, classification and geographical distribution. In: Peters W, Killick-Kendrick R, eds. The leishmaniases in Biology, and Medicine, vol. 1 (Biology and Epidemiology) London: Academic Press, 1–120. Le´ger N, Pesson B. 1987. Sur la taxonomie et la repartition ge´ographique de Phlebotomus (Adlerius) chinensis s.l. et de P. (Larroussius) major s.l. (Psychodidae, Diptera). Statut des espe`ces pre´sentes en Gre`ce. Bulletin de la Socie´te´ de Pathologie Exotique 80: 252–260. Le´ger N, Pesson B, Madulo-Leblond G, Abonnenc E. 1983. Sur la diffe´renciation des femelles du sous-genre Larroussius Nitzulescu, 1931 (Diptera, Phlebotomidae) de la re´gion mediterrane´enne. Annales de Parasitologie Humaine et Comparee 58: 611–623. Lewis DJ. 1982. A taxonomic review of the genus Phlebotomus (Diptera: Psychodidae). Bulletin of the British Museum of Natural History (Entomology) 45: 121–209. Marchais R. 1992. Spe´ciation et vicariance chez les Larroussius du groupe perniciosus (Diptera: Psychodidae). Reims: Doctorat de l’Universite´ de Reims.

218

S. ESSEGHIR ET AL.

Marcondes CB, Day JD, Ready PD. 1997. Introgression between Lutzomyia intermedia and both Lu. neivaı´ and Lu. whitmani, and their roles as vectors of Leishmania braziliensis. Transactions of the Royal Society of Tropical Medicine and Hygiene 91: 725–726. Martin-Sanchez J, Martinez FR, Salinas Martinez de Lecea JM, Sanchez Rabasco C, Acedo Sancez C, Sanchiz Marin MC, Delgado Florencio V, Morillas Marquez F. 1996. Leishmania infantum Nicole, 1908 from southern Spain: characterization of the strains from human visceral and cutaneous leishmaniasis and from sandflies: with a numerical analysis of the isoenzymatic data. Systematic Parasitology 33: 177–182. Molina R. 1991. Experimental infections of a Phlebotomus perniciosus colony using different procedures. Parasitologia 33 (Suppl. 1): 425–429. Montoya J, Lane RP. 1996. The host preference of the sandfly Lutzomyia evansi, a new vector of visceral leishmaniasis in Colombia. Bulletin of Entomological Research 86: 43–50. Moreno G, Rioux JA, Lanotte G, Pratlong F, Serres E. 1986. Le complexe Leishmania donovani s.l. In: Rioux JA, ed. Leishmania. Taxonomie et phyloge´ne`se. Applications ´eco-e´pide´miologiques. Montpellier: Colloques Internationaux CNRS/INSERM. Noyes HA, Arana BA, Chance ML, Maingon R. 1997. The Leishmania hertigi (Kinetoplastida; Trypanosomatidae) complex and the lizard Leishmania: their classification and evidence for a neotropical origin of the Leishmania-Endotrypanum clade. Journal of Eukaryotic Microbiology 44: 511–517. Oosterbroek P, Arntzen JW. 1992. Area-cladograms of circum-Mediterranean taxa in relation to Mediterranean palaeogeography. Journal of Biogeography 19: 3–20. Page RDM, Hafner MS. 1996. Molecular phylogenies and host-parasite cospeciation: gophers and lice as a model system. In: Harvey PH, Leigh Brown AJ, Maynard Smith J, Nee S, eds. New Uses for New Phylogenies Oxford: Oxford University Press. Perfil’ev PP. 1966. Fauna of U.S.S.R. Diptera: Phlebotomidae (sandflies) Moscow: Nauka (In Russian). English translation from Russian, Jerusalem: Isreal Program for Scientific Translation. 1968. Piarroux R, Fontes M, Perasso R, Gambarelli F, Joblet C, Dumon H, Quilici M. 1995. Phylogenetic relationships between Old World Leishmania strains revealed by analysis of a repetitive DNA sequence. Molecular and Biochemical Parasitology 73: 249–252. Pimenta PFP, Saraiva EMB, Rowton E, Modi GB, Garraway LA, Beverly SM, Turco SJ, Sacks DL. 1994. Evidence that the vectorial competence of phlebotomine sand flies for different species of Leishmania is controlled by structural polymorphisms in the surface lipophosphoglycan. Proceedings of the National Academy of Sciences USA 91: 9155–9159. Poulin R. 1998. Evolutionary ecology of parasites. From individuals to communities London: Chapman & Hall. Ready PD, Croset H. 1980. Diapause and laboratory breeding of Phlebotomus perniciosus Newstead and Phlebotomus ariasi Tonnoir (Diptera: Psychodidae) from southern France. Bulletin of Entomological Research 70: 511–523. Rioux JA. 1995. Analyse e´coe´pide´miologique du risque leishmanien au Sahara Atlantique Marocain. Rapport de mission. Ministe`re de la Sante´ du Maroc, Rabat. Rioux JA, Croset H, Le´ger N, Bailly-Choumara H. 1974. Phlebotomus (Larrousius) mariae n. sp. (Diptera, Psychodidae). Annales de Parasitologie Humaine et Compare´e 49: 91–101. Rioux JA, Golvan Y. 1969. Epide´miologie des leishmanioses dans le sud de la France Paris: Monographie INSERM, No. 37. Rioux JA, Lanotte G, Serres E, Pratlong F, Bastien P, Pe´rie`res J. 1990. Taxonomy of Leishmania. Use of isoenzymes. Suggestions for a new classification. Annales de Parasitologie Humaine et Compare´e 65: 111–125. Rioux JA, Rispail P, Lanotte G, Lepart J. 1984. Relations Phle´botomes-bioclimats en e´cologie des leishmanioses. Corollaires e´pide´miologique. L’exemple du Maroc. Bulletin de la Socie´te´ Botanique de France 131: 549–557. Rispail P. 1990. Approche phe´ne´tique et cladistique du genre Phlebotomus Rondani et Berte´, 1940 (Diptera: Psychodidae). Apport des caracte`res morphologiques imaginaux Montpellier: Doctorat de l’Universite´ de Montpellier (II). Rispail P, Le´ger N. 1991. Application of numerical taxonomic methods on Phlebotominae. Parasitologia 33 (Suppl. 1): 485–492. Rispail P, Le´ger N. 1998a. Numerical taxonomy of Old World Phlebotominae (Diptera: Psychodidae). 1. Considerations of morphlogical characters in the genus Phlebotomus Rondani & Berte´ 1840. Memo´rias do Instituto Oswaldo Cruz 93: 773–785. Rispail P, Le´ger N. 1998b. Numerical taxonomy of Old World Phlebotominae (Diptera: Psychodidae). 2. Restatement of classification upon subgeneric morphological characters. Memo´rias do Instituto Oswaldo Cruz 93: 787–793.

SPECIATION OF PHLEBOTOMUS SANDFLIES

219

Seccombe AK, Ready PD, Huddleston LM. 1993. A catalogue of Old World phlebotomine sandflies (Diptera: Psychodidae, Phlebotominae). Occasional Papers on Systematic Entomology 8: 1–57. Shackleton JC, Andel THV, Runnels CN. 1984. Coastal paleogeography of the central and western Mediterranean during the last 125,000 years and its archaeological implications. Journal of Field Archaeology 11: 307–314. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P. 1994. Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: 651–701. Steininger FF, Rogl F. 1984. Paleogeography and palinspastic reconstruction of the Neogene of the Mediterranean and Paratethys. In: Dixon JE, Robertson AFH, eds. The Geological Evolution of the Eastern Mediterranean. Oxford: Blackwell Scientific Publications. Swofford DL. 1998. PAUP: phylogenetic analysis using parsimony Versions PAUP∗4.0d (56–58). Washington DC: Smithsonian Institution Press. Thomaz-Soccol V, Lanotte G, Rioux JA, Pratlong F, Martini-Dumas A, Serres E. 1993. Monophyletic origin of the genus Leishmania Ross, 1903. Annales de Parasitologie Humaine et Comparee´ 68: 107–108.