Species delimitation and biogeography of a southern hemisphere liverwort clade, Frullania subgenus Microfrullania (Frullaniaceae, Marchantiophyta)

Accepted Manuscript Species delimitation and biogeography of a southern hemisphere liverwort clade, Frullania subgenus Microfrullania (Frullaniaceae, Marchantiophyta) Benjamin E. Carter, Juan Larraín, Alžběta Manukjanová, Blanka Shaw, A. Jonathan Shaw, Jochen Heinrichs, Peter de Lange, Monica Suleiman, Louis Thouvenot, Matt von Konrat PII: DOI: Reference:

S1055-7903(16)30264-0 http://dx.doi.org/10.1016/j.ympev.2016.10.002 YMPEV 5642

To appear in:

Molecular Phylogenetics and Evolution

Received Date: Revised Date: Accepted Date:

20 May 2016 27 September 2016 5 October 2016

Please cite this article as: Carter, B.E., Larraín, J., Manukjanová, A., Shaw, B., Jonathan Shaw, A., Heinrichs, J., Lange, P.d., Suleiman, M., Thouvenot, L., Konrat, M.v., Species delimitation and biogeography of a southern hemisphere liverwort clade, Frullania subgenus Microfrullania (Frullaniaceae, Marchantiophyta), Molecular Phylogenetics and Evolution (2016), doi: http://dx.doi.org/10.1016/j.ympev.2016.10.002

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Species delimitation and biogeography of a southern hemisphere liverwort clade, Frullania subgenus Microfrullania (Frullaniaceae, Marchantiophyta)

Benjamin E. Cartera,b,*, Juan Larraínc,d, Alžběta Manukjanováe, Blanka Shawa, A. Jonathan Shawa, Jochen Heinrichsf, Peter de Langeg, Monica Suleimanh, Louis Thouvenoti & Matt von Konratc

a Department of Biology, Duke University, 139 Biological Sciences Building., Box 90338, Durham, North Carolina 27708, U. S. A. b Current address: Department of Biological Sciences, San Jose State University, One Washington Square, San Jose, CA 95192 c Science & Education, The Field Museum, 1400 South Lake Shore Drive, Chicago, IL 60605-2496, U.S.A. d Current address: Instituto de Biología, Facultad de Ciencias, Pontificia Universidad Católica de Valparaíso, Campus Curauma, Av. Universidad 330, Curauma, Valparaíso, Chile e Department of Botany, Faculty of Science, University of South Bohemia, Branišovská 31, CZ-370 05 České Budějovice, Czech Republic. f Department of Biology I and Geobio-Center, Ludwig Maximilian University, Menzinger Str. 67, 80638 Munich, Germany. g Science & Policy Group, Department of Conservation, Private Bag 68908, Newton, Auckland 1145, New Zealand h Institute for Tropical Biology and Conservation, University Malaysia Sabah, Jalan UMS, 88400 Kota Kinabalu, Malaysia. i 11 Rue Saint Léon, 66000 Perpignan, France

* author for correspondence: Department of Biological Sciences, San Jose State University, One Washington Square, San Jose, CA 95192, [email protected]

Abstract Frullania subgenus Microfrullania is a clade of ca. 15 liverwort species occurring in Australasia, Malesia, and southern South America. We used combined nuclear and chloroplast sequence data from 265 ingroup accessions to test species circumscriptions and estimate the biogeographic history of the subgenus. With dense infra-specific sampling, we document an important role of long-distance dispersal in establishing phylogeographic patterns of extant species. At deeper time scales, a combination of phylogenetic analyses, divergence time estimation and ancestral range estimation were used to reject vicariance and to document the role of long-distance dispersal in explaining the evolution and biogeography of the clade across the southern Hemisphere. A backbone phylogeny for the subgenus is proposed, providing insight into evolution of morphological patterns and establishing the basis for an improved sectional classification of species within Microfrullania. Several species complexes are identified, the presence of two undescribed but genetically and morphologically distinct species is noted, and previously neglected names are discussed.

Keywords Gondwanaland, long distance dispersal, divergence time estimation, ancestral range reconstruction, species delimitation, diversification

1. Introduction

Trans-oceanic dispersal is relatively common among bryophytes. This has been demonstrated through population genetic studies within species with intercontinental ranges, as well as phylogenetic analyses containing sister species separated by large geographic distances (reviewed by Devos & Vanderpoorten, 2009; Heinrichs et al., 2009; Vanderpoorten et al., 2010). The number of dated phylogenetic studies investigating widely disjunct bryophyte distributions remains relatively small (reviewed by Villarreal & Renner 2014), however these have generally rejected the hypothesis of vicariance even when topologies and current distributions are consistent with ancient geological events, for example the opening of the north Atlantic (Huttunen et al. 2008) or the breakup of Gondwanaland (Sun et al. 2014).

Long distance dispersal plays a dual role in the diversification process. It can impede diversification by maintaining a cohesive gene pool across wide geographic distances; alternatively it can facilitate diversification through founder event speciation. Both of these scenarios have been demonstrated in Northern Hemisphere bryophytes. In Sphagnum L., microsatellite data demonstrate that multiple species with North American/East Asian disjunctions have detectable gene flow between continents (Shaw et al., 2014, 2015). Likewise S. palustre L. populations on the Azores are not isolated from European populations (Stenøien et al., 2014). Trans-atlantic gene flow was also demonstrated in Sphagnum by Szövényi et al. (2008). The contrasting pattern, long distance dispersal followed by genetic isolation, has also been demonstrated. This has been documented for island endemic lineages in Macaronesian populations of the liverworts Frullania Raddi (Heinrichs et al., 2010) and Leptoscyphus Mitt. (Devos & Vanderpoorten, 2009) and in the moss Mitthyridium H.Rob. on tropical Pacific islands (Wall, 2005). The number of studies addressing long distance dispersal in southern hemisphere bryophytes is less than in the northern hemisphere, but results of those studies have been revealing. For example, Sun et al. (2014) demonstrated numerous dispersal events and associated diversification in the liverwort family Schistochilaceae across South America, southern Africa and Australasia over the last 80 million years. Across a shallower time scale, Muñoz et al. (2004) demonstrated that bryophyte floristic similarities across sub-Antarctic islands are more strongly predicted by prevailing winds than by geographic distance, thus highlighting the importance of wind dispersal in southern hemisphere distributions. Similarly, Vanderpoorten et al. (2010) noted that prevailing winds may underlie repeated southern hemisphere bryophyte disjunctions that were previously attributed to the breakup of Gondwana. In the present study, we investigate species circumscriptions and the role of long distance dispersal in the evolution of the primarily southern hemisphere lineage Frullania subg. Microfrullania (R.M.Schust.) R.M.Schust. The genus as a whole is nearly cosmopolitan and includes more than 2000 published binomials (Yuzawa, 1991; von Konrat et al., 2010), with the number of accepted names being significantly lower than that number but still fluctuating as a result of ongoing revisionary work (Schuster, 1992; Gradstein et al., 2001; Söderström et al., 2016). Within Frullania, subgenus Microfrullania is a taxonomically challenging and poorly understood group of species with a distribution including southern South America, Australasia, Oceania and extending north throughout Melanesia to Malesia, and with an outlying population on the Tristan da Cunha Archipelago in the South Atlantic (Fig. 1). The subgenus is characterized by its small size, with the leafy shoots of some species less than 100 µm wide, remotely and obliquely inserted lobules, and spores with conspicuous protuberances lacking secondary

branches and deposits (Hentschel et al., 2009) (Fig. 2.). Approximately 15 species are currently recognized, although more than 45 published names are applicable to taxa in the subgenus and many of these have been taxonomically confusing. For example, F. congesta (Hook.f. & Taylor) Gottsche et al. was historically synonymized under F. rostrata (Hook.f. & Taylor) Gottsche et al., but the two are now placed in entirely different subgenera (von Konrat et al., 2006a; Hentschel et al. 2009). Similarly, the genus Neohattoria Kamim. was included by some investigators within F. subg. Microfrullania, but Asakawa et al. (1979) and Larraín et al. (2015) provided evidence that it should be placed within a separate family, the Jubulaceae. The monophyly of F. subg. Microfrullania, as currently understood, has been demonstrated previously in a genus-wide molecular phylogeny undertaken by Hentschel et al. (2009). Here, we assemble a phylogenetic hypothesis for F. subg. Microfrullania. We use dense within-species sampling to confirm monophyly of the subgenus, test morphological circumscriptions and geographical distributions, and use the dense sampling across the entire geographic range of the subgenus to investigate the role of long distance dispersal, within and among species, in shaping the current distribution across the southern hemisphere.

2. Methods

2.1 Data collection

For the primary analysis, a total of 968 new sequences from 265 specimens were generated for this study, with data from the internal transcribed spacer (ITS) 1 and 2, and the chloroplast markers trnG and trnL-F. The study also included an additional six sequences representing three specimens from Genbank. Genbank accession numbers and voucher details are provided in Appendix 1. Ingroup accessions were chosen to maximize the geographical and morphological coverage within Frullania subg. Microfrullania, and outgroup taxa were selected using the topology from Hentschel et al. (2009) to identify close relatives of F. subg. Microfrullania. DNA extraction, amplification and sequencing followed the methods provided by Shaw et al. (2003), with ITS1 and ITS2 amplified and sequenced separately. ITS primers were modified from Shaw et al. (2003) to perform more efficiently within F. subg. Microfrullania. Primers used for ITS1 were 18S_F: GGTGAAGTTTTCGGATCGCG and 5.8S_R: TGCGTTCTTCATCGTTGC; for ITS2 the primers used were 5.8S_F: ACTCTCAGCAACGGATA and

26S_R: AGATTTTCAAGCTGGGCT. Vouchers for all new sequences are deposited at DUKE, AK or F, with duplicates at BORH, NOU or CONC. Specimens representing Frullania sect. Microfrullania (F. chevalieri (R.M. Schust.) R.M. Schust., F. neocaledonica J.J. Engel and F. parhamii (R.M.Schust.) R.M.Schust. ex von Konrat, L.Söderstr. et A.Hagborg ) formed a single clade in our analyses (see below), but the three species were not resolved within the clade. To further explore species boundaries within this complex, five anonymous loci were developed. Next generation sequence data from five members of the clade were generated using Illumina paired-end reads. Raw data were processed using the Stacks pipeline (Catchen et al., 2011), and contigs found across all five accessions were retained. From these, MsatCommander (Faircloth, 2008; Untergasser et al., 2012) was used to generate primers around microsatellites. These primers were used to sequence the microsatellite regions. The microsatellites were then removed and the remaining flanking regions were subjected to phylogenetic analyses as described below. For this dataset, a subset of 35 specimens from the F. chevalieri complex in the larger analysis were used to represent the morphological and geographical distribution of the clade (Appendix 2). ITS1 and ITS2 were included in these analyses and the trees were rooted using F. species B as an outgroup.

2.2 Phylogenetic analyses Sequences were initially aligned using MUSCLE (Edgar 2004) and then manually corrected using MESQUITE (Madison and Madison, 2008). Outgroup sequences from ITS1 could not be aligned with the ingroup and so were excluded from the dataset. Lacking portions of sequences were coded as missing, and ambiguous positions were removed prior to analysis. Separate chloroplast and nuclear topologies were generated with Maximum Likelihood analyses to test for congruence between the two datasets. Congruence among supported nodes (Bootstrap >70%) was verified by eye and the datasets were subsequently concatenated. PartitionFinder (Lanfear et al., 2012) was used to determine an optimal partitioning scheme and nucleotide substitution models for the combined dataset, and the analyses were subsequently run with two partitions (ITS, chloroplast) with each partition employing the GTR+I+G model. For the matrix of anonymous loci, an unpartitioned scheme employing GTR+I+G was used. Maximum Likelihood analysis with 100 bootstrap replicates was executed for both datasets with RaxML (Stamatakis, 2014) using the GTR+I+G model. Bayesian inference was conducted using MrBayes (Huelsenbeck and Ronquist, 2001) and consisted of two independent searches, each employing four

chains. The analysis ran for 107 generations with sampling every 1000 generations. Stationarity was checked using Tracer v1.3 (Rambaut and Drummond, 2003) and posterior probability values were generated from trees after excluding a burn-in of the first 20% of trees.

2.3 Divergence time estimation

Divergence times were estimated using published substitution rates for ITS and chloroplast markers. Separate chloroplast and nuclear rates were obtained from previous studies employing molecular dating in bryophytes (Huttunen et al., 2008; Villarreal and Renner, 2014). The substitution rate used for ITS was 1.4×10-2 (standard deviation 5×10-3) substitutions/site/million years and for the chloroplast (trnG, trnL-F) partition we used 5×10-4 (standard deviation 1×10-4). Divergence dates for the phylogeny were estimated using BEAST. This analysis employed a subset of the data including a single representative for each taxon. Dates for the topology from the analysis of the larger dataset were estimated with an uncorrelated lognormal relaxed clock. The dataset was divided into a chloroplast and nuclear partition. Substitutions were modeled separately for each partition using the general time reversible model with rate variation among sites, four rate categories and the gamma shape parameter. The MCMC chains were run for 40 million generations and parameters were sampled every 104 generations. Results were inspected using Tracer version 1.4 to confirm stationarity and the acceptable mixing of sampled parameters. Trees were summarized with Tree Annotator (Drummond et al., 2012) after excluding the first 25% of samples.

2.4 Historical biogeographic estimation

Geographic range evolution within F. subg. Microfrullania was estimated using the R package BioGeoBEARS (Matzke 2013). We used the DEC (dispersal-extinction-cladogenesis) model utilized by LaGrange (Ree and Smith, 2008) and also a likelihood implementation of DIVA (Ronquist, 1997) referred to as DIVAlike. In addition to the standard DEC and DIVAlike models, BioGeoBEARS also adds an additional parameter (j) to both models. In a cladogenesis event, the j parameter is the rate of founder event speciation in which one daughter species occupies an area unoccupied by either the ancestor or the other daughter. The parameter therefore allows for the incorporation of

founder event speciation into the standard DEC and DIVAlike models. We implemented both the standard DEC and DIVAlike models as well as DEC+j and DIVAlike+j in order to ascertain the effects of different models on the estimation of the biogeographic history of F. subg. Microfrullania. For the biogeographic coding, we parsed the area currently occupied by F. subg. Microfrullania into six regions modified slightly from Takhtajan’s (1986) floristic regions: southern South America, including the Tristan da Cunha archipelago in the south Atlantic (Takhtajan’s regions 33+34), New Zealand, including nearby islands (35), Australia (29, in part), Tasmania (29, in part), New Caledonia and Fiji (19+22), and Malesia, defined here as the region including Malaysia and the Philippines to Papua New Guinea (18). Taxa were coded as present or absent in each of these areas based on verified voucher specimens.

3. Results

3.1 Sequencing results

Aligned lengths for the four loci used in the full analysis were: ITS1 (981), ITS2 (748), trnG (797), trnLF (688). Among ingroup accessions, the number of parsimony informative sites for each locus was ITS1 (363), ITS2 (193), trnG (118) and trnLF (78). The dataset included 964 out of a possible 1076 (four loci from 269 accessions) sequences. Within ITS1, an approximately 350 base indel was found to be present within F. magellanica F. Weber & Nees, F. fertilis De Not. and F. truncatistyla von Konrat, Hentschel, Heinrichs & Braggins, but absent in the remaining species. For the analysis of the F. chevalieri complex, the number of parsimony informative sites within the ingroup were 33 and 15 for ITS1 and ITS2, respectively. For the anonymous loci, the aligned lengths (after excluding microsatellite regions) and number of informative sites were: mf_0676 (231,19), mf_1329 (382, 18), mf_0006 (378,9), mf_0987 (350,14), mf_1601 (332,30). The anonymous loci dataset included 156 out of a possible 180 (5 loci from 36 accessions) sequences.

3.2 Phylogenetic analyses

The phylogenetic analyses of the full dataset yielded a topology with strong support throughout the deeper nodes, with the exception of the node representing the relationship among F. truncatistyla, F. fertilis + F. magellanica, and

the large clade sister to these two (Fig. 3, Supplementary Fig. 1). Posterior probability support for that node was 0.92. With the exception of the F. chevalieri complex, all of the currently recognized species appear to be monophyletic with strong support. Several morphologically circumscribed species contain multiple supported clades within them. Specimens representing F. microscopica Pearson formed two supported sister clades that are morphologically distinct (F. microscopica and F. species A in Fig. 3, Supplementary Fig. 1). The type specimen for the name F. microscopica is unambiguously assigned to one of these and the other sister clade comprising “F. species A” will be formally described in a forthcoming manuscript. Specimens representing F. magellanica formed three supported clades. The type of F. magellanica can be placed morphologically in one of the three clades and we use the name F. fertilis to accommodate the two remaining sister clades. The widespread F. rostrata has been wellsampled in this study and contains two deep clades. These correspond to F. rostrata and what we recognize as a new species, “F. species B”, which is supported by a re-evaluation of the morphology, including previously overlooked characters. The subclades observed for these two taxa mostly correspond to geography. For example, the south Australian and Tasmanian populations, which are also clearly recognizable morphologically by typically large styli and large underleaves, form a clade nested within the rest of the F. rostrata vouchers (Supplementary Fig. 1). The F. junghuhniana Gottsche complex is represented in this study by 19 accessions. These represent the breadth of morphological diversity observed throughout its range, which comprises much of Malesia and Melanesia. We found strong phylogenetic structure throughout the clade, but it does not correspond to current morphological concepts of the complex. Extensive sampling is still needed to resolve the phylogenetic relationships among some of the existing species names, and we refer here to the group provisionally as “Frullania junghuhniana complex”. The F. chevalieri complex includes F. chevalieri, a common species in New Caledonia and Fiji and extending south to New Zealand, the New Caledonia endemic F. neocaledonica, and the Fiji endemic F. parhamii. The analyses of the full dataset resolved the complex as monophyletic but did not recover any phylogenetic structure corresponding to the three morphologically circumscribed species (Supplementary Fig. 1). The clade contained two unsupported subclades but these did not correspond to either morphological or biogeographic differences. The subsequent analysis including ITS and five anonymous loci recovered several supported clades (Fig. 4). In this analysis the representatives of F. neocaledonica remain unambiguously polyphyletic among accessions of F. chevalieri from New Caledonia. Nested within the New Caledonian accessions, all the Fijian accessions form a

single unsupported clade. This in turn forms two supported subclades, one made up of F. chevalieri accessions and the other consisting of all the F. parhamii accessions.

3.3 Divergence time estimation

The crown age for F. subgenus Microfrullania was estimated here as 49.9 (95% CI: 32.4-70.8) Mya (Table 2). Diversification among extant South American species is estimated from 8.9-17.3 (5.3-25.3) Mya (Fig. 5, nodes 9 and 10). Among the Australasian species, diversification among primarily New Caledonian lineages (Fig. 5, node 7 and descendants thereof) is estimated to have occurred within the last 16.6 (10.8-23.6) Mya, while the diversification centered in New Zealand occurred earlier.

3.4 Historical biogeographic estimation

The four models used for biogeographic estimation yielded generally similar results (Fig. 5). Of the 14 nodes in the ingroup, ten yielded identical reconstructions across all four models. The four nodes with inconsistent reconstructions (nodes 2, 5, 6, 11) were the result of one or more models selecting a distribution of two geographic areas while the others selected a single area. For these nodes, the narrower ranges were predicted by DIVAlike model and/or those employing the j parameter, while the broader ranges were reconstructed by DEC and/or those without the j parameter. The ancestral area for the root of the tree was identified as New Zealand plus South America by all four models. At the three deepest nodes, New Zealand was always selected, either alone or in conjunction with South America, but none of the models selected South America alone for any of the deep nodes. Earliest divergences were among New Zealand and South American lineages. This was followed by divergence and colonization into Australia, Tasmania and New Caledonia. Following this, diversification took place within the New Caledonian lineage which also further colonized Malesia and recolonized New Zealand.

4. Discussion

4.1 Phylogeny and taxon delimitation

4.1.1 General patterns and sectional circumscriptions

Based on the analyses presented here and concurrent examination of voucher specimens, we tentatively recognize 15 species within subgenus Microfrullania (Fig. 3). A full taxonomic revision of the group will be published separately. Some of the species are morphologically well-defined and narrowly distributed, for example F. microcaulis Gola and F. lobulata (Hook.) Dumort endemic to extreme southern Chile, the New Zealand endemic F. knightbridgei von Konrat & de Lange, and the New Caledonia endemics F. microscopica, F. species A, F. scalaris S.Hatt. and F. pseudomeyeniana S.Hatt. Four complexes include genetically well supported but morphologically difficult or geographically widespread species. These are the F. rostrata complex, the F. magellanica complex, the F. junghuhniana complex and the F. chevalieri complex. Each is discussed separately below. The circumscription of Frullania subg. Microfrullania has a complicated history. The subgenus as currently circumscribed includes two historically recognized genera, Amphijubula and Schusterella, that have been variously treated as segregate genera, as subgenera within Frullania, or as sections within Frullania subg. Microfrullania (reviewed by von Konrat et al., 2006b, 2011). Hentschel et al. (2009), in a molecular phylogenetic analysis of the entire genus, confirmed the monophyly of F. subg. Microfrullania with strong support based on the inclusion of six representatives. Our analysis, which includes a more comprehensive sampling of taxa within the subgenus, including the type species from the type localities, further substantiates the recognition of F. subg. Microfrullania as a natural evolutionary group. The genus Neohattoria has been recently resolved as a member of the Jubulaceae rather than the Frullaniaceae (Larraín et al., 2015), however some species that were earlier placed in Neohattoria (Schuster 1970) belong to F. subg. Microfrullania (Hentschel et al., 2009). Sectional placement within F. subg. Microfrullania has had an equally long and complicated history (Verdoorn, 1930; Hattori et al., 1972; Hattori, 1982; Schuster, 1992; von Konrat et al., 2006b, 2011). The results presented here, with generally strong backbone support throughout the clade, demonstrate monophyly of earlier classification schemes, with the exception of F. sect. Amphijubula. Hattori (1976) designated Frullania junghuhniana as the type of F. sect. Regulares S.Hatt., which represents a natural group including F. scalaris and F. pseudomeyeniana. There have been no prior sectional classifications for the Frullania rostrata complex, the F. magellanica complex, or for F. toropuku and F.

knightbridgei, but these will be evaluated together with the remainder of F. subgenus Microfrullania in a forthcoming taxonomic revision. Von Konrat et al. (2011) defined F. sect. Amphijubula as comprising F. lobulata, F. microcaulis and F. truncatistyla. However, our analyses demonstrate the paraphyly of F. sect. Amphijubula. It consists of the two earliest-diverging lineages within the subgenus (Fig. 1), suggesting that morphological features previously considered synapomorphic for the section may in fact be pleisiomorphic for F. subgenus Microfrullania.

4.1.2 The F. junghuhniana complex

Morphological variability within the F. junghuhniana complex has resulted in the description of 16 names, although only three are accepted in recent interpretations: F. junghuhniana sensu stricto, F. junghuhniana var. tenella (Sande Lac.) Grolle & S.Hatt. and F. junghuhniana var. bisexualis S.Hatt. (e.g. Verdoorn, 1930; Hattori, 1973, 1974, 1975a, 1975b, 1976; Hattori and Mizutani, 1982). Representatives from the complex have been reported from Sumatra, Borneo, Java, the Philippines, New Guinea, the Solomon Islands, and New Caledonia (Hattori and Mizutani, 1982), and here we report an extension of the distribution to Fiji. The clade corresponds to F. sect. Regulares, originally proposed by Verdoorn (1930) with Frullania junghuhniana as the type. Our sampling is limited to Papua New Guinea, Borneo and Fiji with 19 accessions representing the group. After intensive searching we could not find true F. junghuhniana in New Caledonia to add to our sampling. The analyses resolve the complex as monophyletic, but did little to resolve putative taxa within the complex. We found multiple deep clades with strong support, however these do not completely correspond to previously described morphological circumscriptions. Morphological investigation within this species complex is ongoing, but is limited by a relatively small number of recent collections from which DNA extractions could be made. Pending further study, we recognize only F. junghuhniana in the broad sense, while acknowledging that future efforts will most likely uncover additional diversity warranting formal taxonomic recognition within the group. For example, the Fijian clade sister to the Borneo and New Guinean populations has, in addition to a widely separated distribution, a distinctive lobule morphology that is diagnostic; it may represent a new species. Based on our revised understanding of morphological differences between the F. rostrata and F. junghuhniana complexes, the previous report of F. junghuhniana by Campbell (1997) for New Zealand can be rejected. We found there to be extensive confusion between F. junghuhniana s.l. and the F. rostrata complex in herbaria. Specimens labeled as F. junghuhniana from northwest

Australia, New Zealand and the Kermadec Islands correspond to F. species B, and so far no specimens have been seen that can verify the existence of F. junghuniana in those regions. Sister to the F. junghuhniana complex is a clade comprising two species endemic to New Caledonia, F. scalaris and F. pseudomeyeniana. These two are very similar to one another morphologically, yet consistent morphological differences are present. Frullania scalaris has squarrose stem-leaves and a perianth with up to eight keels, whereas F. pseudomeyeniana has flat stem-leaves and a perianth with up to six keels. The latter was previously known only from the type material (Hattori, 1986). With three accessions representing F. pseudomeyeniana, we found it to be monophyletic and, as suspected by Hattori (1986), sister to F. scalaris.

4.1.3 The F. chevalieri complex The F. chevalieri complex, together with F. microscopica s.l. constitutes F. sect. Microfrullania as defined by Schuster (1970, 1992). The complex, which is monophyletic in our analyses, was thought to be endemic to Fiji and New Caledonia until recently, but is now known from northern New Zealand as well (von Konrat, 2006b). Sister to the F. chevalieri complex, F. microscopica s.l. is morphologically distinct due to a hyaline, spinulose leaf margin that is unique in the subgenus. This characteristic led Schuster (1970) to place the taxon in its own section, Spiniferae. Within F. microscopica s.l., we found two morphologically distinct and strongly supported clades, both endemic to New Caledonia. The type of F. microscopica, characterized by long ciliate lobe margins, can be assigned morphologically to one of these clades. In contrast, the other clade (F. species A) exhibits entire leaf margins. Because they are sympatric, morphologically distinct and reciprocally monophyletic, we recognize them as distinct species and will formally describe F. species A in a future publication. Within the F. chevalieri complex, F. chevalieri has been recently revised (von Konrat et al., 2006b) but, before fieldwork for this study, F. parhamii and F. neocaledonica were known only from type material. It is noteworthy to mention that the types of F. microscopica, F. chevalieri and F. neocaledonica all come from a single mixed collection, Compton 616 (BM!), from Mt. Mou, New Caledonia. Schuster (1970) provided minimal differences in distinguishing between F. neocaledonica and F. chevalieri, with the former described solely by the greener coloration, and the presence of subtle papillae on the leaf lobe surface. In contrast, Frullania parhamii is usually easily recognized morphologically by the presence of a well developed, hyaline border of 2–3 cells on the leaf lobes, although several populations of F. chevalieri from New Caledonia have a weakly hyaline margin.

Both the subgenus-wide dataset and the dataset of anonymous loci demonstrated the polyphyly of F. neocaledonica accessions among those of F. chevalieri. Morphological differences between these two are subtle and we therefore interpret F. neocaledonica as a morphological variant of F. chevalieri. The inclusion of F. parhamii within F. chevalieri is less straightforward. Morphologically, these two are quite distinct and can be distinguished in the field by the prominent hyaline margin in F. parhamii. In our smaller dataset of anonymous loci, all accessions of F. parhamii formed a supported clade, with this clade sister to the other Fijian F. chevalieri accessions. A strict monophyletic species concept would require lumping the two to prevent the non-monophyly of F. chevalieri. However, the phylogenetic pattern is also consistent with a hypothesis that F. parhamii is only very recently diverged from F. chevalieri and has not been separated for sufficient time to achieve the reciprocal monophyly of the two. This hypothesis is consistent with the generally very short branch lengths within the F. chevalieri complex relative to other species and complexes throughout the subgenus. Given the ambiguity of the molecular data, we retain these two names here until a more thorough morphological investigation is completed in a forthcoming monograph of the species complex.

4.1.4 The F. rostrata complex

Until recently, the only representative of F. subg. Microfrullania from eastern Australia, New Zealand and the surrounding islands was F. rostrata. Von Konrat et al. (2012, 2013) described two morphologically similar species, F. toropuku and F. knightbridgei, from New Zealand. The results presented here support the monophyly of each of these three species as well as uncovering a sister species to Frullania rostrata, here designated as F. species B, that will be described in a forthcoming paper. Our extensive geographic sampling for this study confirms earlier findings that F. toropuku and F. knightbridgei are relatively uncommon New Zealand endemics. Frullania rostrata and F. species B were found to be much more widespread and to exhibit geographic phylogenetic structure within species. Both occur in northern New Zealand and eastern Australia; F. rostrata extends further to the south and occurs in both southeastern Australia (Victoria) and Tasmania as well as southern New Zealand. In contrast, F. species B is seemingly rare from these southern areas where it appears to be restricted lowland or coastal areas. Aside from Australia, F. species B also extends to the Kermadec Islands and New Caledonia. Herbarium material of this new species has previously been identified as both F. rostrata and F. junghuhniana (e.g., Campbell, 1997;

Glenny, 1998). Morphological study of these two species is ongoing and detailed discussion of the morphological separation of the two will be provided when the species is formally described.

4.1.5 The F. magellanica complex

The Frullania magellanica species complex from southern South America and neighboring islands has been subject of contrasting interpretations and confusion. In the treatment of Frullania for his Brunswick Peninsula flora, Engel (1978) introduced a broad taxonomic concept of F. magellanica, merging F. fertilis with the former taxon. This may have been due to earlier confusion instigated by Clark & Palm (1961). Their paper provided a description and illustrations of a typical phenotype of F. fertilis, but under the name F. magellanica. The confusion was subsequently clarified by Hässel de Menéndez (1983) who provided a thorough description and clear illustrations of the type of F. magellanica. She also listed a number of differences between this taxon and F. fertilis. Our results indicate two deep and supported clades within the species complex that are sympatric in southern South America. These correspond morphologically to F. magellanica and F. fertilis as defined by Hässel de Menéndez (1983). The F. fertilis clade is further divided into two supported although not very deep clades, one containing typical F. fertilis phenotypes (i.e. with entire, incurved, cucullate leaf lobe margins, rounded lobes, ligulate styli, and underleaves 2–3 times wider than the stem), and the other containing phenotypes that might be confused with typical F. magellanica (i.e. lobe margins more or less flat, styli ovate to ligulate, and underleaves 1–2 times wider than the stem). We have thoroughly investigated the morphology, including spore surface ultrastructure, and have not been able to find any consistent trait that would allow us to recognize these two clades morphologically. We recognize two species, F. magellanica and F. fertilis, but suggest that F. fertilis warrants further ecological, genetic and morphological study to determine whether the species actually comprises two evolutionarily distinct lineages. Frullania magellanica and F. fertilis, as defined here, are sympatric in continental Chile (and along the adjacent Argentinian border) from central Chile to Cape Horn, including the Juan Fernández Islands (Herzog, 1942). Frullania fertilis additionally grows in the Falkland and South Georgia Islands (Hässel de Menéndez and Rubies, 2009). The studied populations of F. magellanica ssp. tristaniana (S.W. Arnell) Váňa & J.J. Engel from Gough Island are nested within the F. magellanica s.s. clade (Fig. 1) and we do not recognize that taxon.

4.2 Biogeographic patterns among species

The divergence time estimates (Fig. 5) provide evidence for a Cenozoic diversification of F. subg. Microfrullania. This finding is consistent with several fossils from Eocene Baltic and Rovno amber deposits that were assigned to either F. subg. Microfrullania or F. subg. Thyopsiella (Grolle and Meister, 2004; Heinrichs et al., 2012a, 2012b; Mamontov et al., 2015). These fossils have an age of ca. 35-48 Mya (Standke 1998, 2008) and indicate a split of the subgenera in the Eocene, or earlier. The extensive within-species sampling in this study provided several examples of recent long distance dispersal and establishment within species. This is demonstrated by the occurrence of small populations of F. chevalieri in northern New Zealand, F. species B on New Caledonia (nested within an otherwise Australian clade) and F. magellanica on the Tristan da Cunha archipelago. In each case, accessions from the outlying populations are nested within accessions from another population more than 1000 km away. This provides clear evidence for the important role of long distance dispersal in establishing and maintaining species distributions. At a deeper time scale, all of the biogeographic models employed here converged on an ancestor of Microfrullania that occurred in South America and New Zealand approximately 43-50Mya. However, given the clear dispersal ability in extant taxa, the lack of Southern Hemispheric Frullania fossils, and the drastic climatic changes in the Southern Hemisphere during the Paleogene including the glaciation of the Antarctic landmass (McLoughlin, 2001), we are not able to confidently estimate the deeper biogeographic history of F. subg. Microfrullania (Meseguer et al., 2015). It is possible that members of subg. Microfrullania occurred in Antarctica during the Eocene, and that current distribution patterns are in part the result of climate-driven extinction processes. We also cannot exclude the possibility that members of subg. Microfrullania once occurred in the Northern Hemisphere, as proposed by Grolle & Meister (2004) based on Paleogene amber fossils. We note, however, the taxonomic position of these fossils is difficult to confirm given uncertainty associated with the assignment of many extant species to sections or subgenera (Hentschel et al., 2009). While the early divergent lineages within subg. Microfrullania currently occupy both South America and New Zealand, later diverging lineages occupy New Zealand, Australia and Tasmania. The northern extent of the range, including New Caledonia, Fiji and the Malay Archipelago, has been colonized most recently, an estimated 16-24 Mya. The timing of these events is not coincident with the breakup of Gondwanaland and therefore likely

relies on long distance dispersal. Extensive long distance dispersal, in opposing directions, has been inferred for the Schistochilaceae, a liverwort clade with a similar geographic distribution (Sun et al., 2014). Analyses from that study demonstrated numerous dispersal events among New Zealand, South America, southern Africa, Australia, Tasmania and Melanesia. Sun et al. (2014) hypothesized that the distribution of Schistochilaceae over the last 80My tracked the southern Beech forests (see Knapp et al., 2005) with which they are currently ecologically allied. Microfrullania lacks a similar ecological analog with a strong fossil record, however given the strong dispersal capability demonstrated in this study, it would also have presumably been able to track appropriate habitat as changes in global climate pushed wet Antarctic forests northward from the Cretaceous to the present (Kooyman et al., 2014). The biogeographic models employed for this study all inferred continuous occupation of New Zealand through the Oligocene (26-38Mya), at which point New Zealand was mostly submerged (Cooper and Cooper, 1995). There has been debate as to whether New Zealand was entirely submerged, although several taxa with strong fossil records (Gibbs, 2006; Lee et al., 2012) suggest strongly that it was not. Extinctions and dispersal could plausibly explain the biogeographic history of Microfrullania even with a complete Oligocene submergence, however the most parsimonious explanation is that the lineage continuously occupied New Zealand throughout the Oligocene.

4.3 Phylogeographic structure within the F. rostrata complex

Most species in Microfrullania are narrowly distributed. The two common and geographically widespread species, F. species B and F. rostrata, exhibit contrasting phylogeographic patterns across their ranges. Frullania species B occurs primarily in New Zealand and central- to north-eastern Australia, with outlying populations on the Kermadec Islands and on New Caledonia. We found a clade endemic to New Zealand, another endemic to Australia, a clade with roughly equal numbers of accessions from both, a fourth clade with 14 accessions from New Zealand, a single Australian accession and all the Kermadec Island accessions, and finally a clade of Australian and New Caledonian accessions. This indicates a high degree of dispersal between New Zealand and Australia and suggests that there may be justification for splitting F. species B pending further morphological and ecological study. We also can reject the hypothesis that the Kermadec Islands functioned as a stepping stone between New Zealand and New

Caledonia. The results presented here indicate that the Kermadec Islands were colonized from New Zealand and that New Caledonian populations are not related to these, and in fact likely arrived via Australia. Frullania rostrata has a similar, but more southern distribution. It occurs in eastern Australia, New Zealand and Tasmania. The structure in this species forms a grade with most of the early diverging accessions from New Zealand and central-eastern Australia. All of the Tasmanian accessions fall within a distal clade that also includes the two southeastern Australian accessions included in the analysis. This lack of geographical structure in this species, and the general lack of support for deeper nodes is consistent with a lack of genetic isolation between populations in New Zealand and those in Australia, however the extension into southeastern Australia and Tasmania appears to have been relatively recent and isolated.

4.4 Conclusions

Our study adds to growing evidence that we may misinterpret global diversity if we rely exclusively on morphology based taxonomy. Integrative studies on liverworts considering extensive, population level molecular datasets consistently identify species that have not yet been described or were lumped into morphologically and ecologically variable binomials (Fuselier et al., 2009; Kreier et al., 2010; Aranda et al., 2014; Bakalin & Vilnet, 2014; Heinrichs et al., 2015). Several earlier molecular studies supported narrow species concepts in Frullania (Bombosch, et al. 2010; Ramaiya et al., 2010; Heinrichs et al., 2010; von Konrat et al., 2012). Accordingly, the present study conforms with an emerging trend in Frullania taxonomy toward narrower species concepts. By employing extensive withinspecies sampling of the southern hemisphere Frullania subg. Microfrullania, we were able to simultaneously clarify species circumscriptions, uncover new species, and estimate the biogeographic history of the group. We highlight an important role for long distance dispersal in causing deep divergences as well as influencing phylogeographic structure within the current species distributions. Dense sampling indicates that there is strong evidence for recent or ongoing diversification on New Caledonia that has led to taxonomic confusion. The limited sampling from the southeast Asian islands suggests that this region may harbor much greater diversity than is currently recognized and future work should focus there.

Acknowledgements

We thank A. Hagborg (The Field Museum) and L. Söderström (Norwegian University of Science and Technology) and the Early Land Plants Today (ELPT) project for access to nomenclatural data. Support from the Biodiversity Synthesis Center of the Encyclopedia of Life provided important funding to help foster international initiatives. The Biodiversity Heritage Library is acknowledged for the facility they provide that has greatly accelerated our effort. The generous support by the NSF (Awards No. 1145898, 1146168, and 0531730) and the German Research Foundation (grant HE 3584/2) is gratefully acknowledged. We also recognize the support of the Museum Collection Spending Fund, administered by The Field Museum, as well as curatorial support provided by Y. Rodriguez, L. Kawasaki and A. Balla (The Field Museum). We are grateful to the following Iwi (tribes) for permission and support for collecting in New Zealand: Ngati Kuri, Ngati Porou, Rongomaiwahine, Ngati Kahungunu, Ngai-teRangi, Ngati Ranginui, Ngati Whatua, Ngati Maniopoto, and Tuwharetoa/Ngati Rangi. Sabah Biodiversity Centre, Malaysia, and the Presidents of the Assemblées of Provinces Nord and Province Sud provided access and permits in Borneo and New Caledonia, respectively. The following individuals from Australia, New Zealand, Fiji and New Caledonia provided critical help with logistical support in the field, access to permits and collecting sites, and obtaining specimens: G.M. Crowcroft, T.J.P. de Lange, F.J.T. de Lange, J.R. Rolfe, J.E. Braggins, D.A. Norton, D.J. Blanchon, A.J. Townsend, B.Lett, T. Trsnki, R.O. Gardner, M.Renner, T. Pócs, M. Tuiwawa, M. Tabua, A. Naikatini, J. Cassan, D. Garnier, S. Meresse, F. Avril, C. Sandoz, C. Beaufrere, V. Hequet, J. Muzinger, T. Duval, R. Franquet, T. Ibanez, H. Geraux, D. Marini, M. Thibaud, P. Birnbaum, C. Isnard, J. Fambart-Tinel, D. M. Poveu, J. Whala Windi, C. Hatjopoulos, M. Farino, F. Bealo, P. Moenou, G. Teimpoueme, M. Wangueme, F. Wangueme, J. Hiandodimat, A.D. Popani, J. Mériot, P. Nekoiroiro, J.-N. Lepeu, I. Fabre, F. Tron, E. Hibou, G.P. Hibou, I. Boya, A. Phale, P. Menuteaux, P. Coultrie, E. Thouvenot, I. Letocart, and D. Letocart. Finally, we thank the curators and staff of the herbaria at AK, CANB, CHR, F, FH, G, L, MPN, NICH, NY, S, and WTU.

References

Aranda, S.C., Gradstein, S.R., Patiño, J., Laenen, B., Désamoré, A., Patiño, J., Vanderpoorten, A. 2014. Phylogeny, classification and species delimitation in the liverwort genus Odontoschisma (Cephaloziaceae). Taxon 63: 1008– 1025.

Asakawa, Y., Tokunaga, N., Toyota, M., Takemoto, T., Hattori, S., Mizutani, M., Suire, C.1979. Chemosystematics of bryophytes II. The distribution of terpenoids in Hepaticae and Anthocerotae. J. Hattori Bot. Lab. 46:67–76.

Bakalin, V.A & Vilnet, A.A. 2014. Two new species of the liverwort genus Hygrobiella Spruce (Marchantiophyta) described from the North Pacific based on integrative taxonomy. Plant. Systemat. Evol. 300: 2277–2291.

Bombosch, A., Wieneke, A., Busch, A., Jonas, R., Kreier, H.-P., Shaw, B., Shaw, A.J., Heinrichs, J., 2010. Narrow species concepts in the Frullania dilatata-appalachiana-eboracensis complex (Porellales, Jungermanniopsida): evidence from nuclear and chloroplast DNA markers. Plant Systemat. Evol. 290: 151–158.

Campbell, E.O. 1997 Some additions and alterations to the liverwort and hornwort flora of the Kermadec Islands. New Zealand Bot. Soc. Newsl. 49: 8–9.

Catchen, J., Amores, A., Hohenlohe, P., Cresko, W., Postlethwait, J. 2011. Stacks: building and genotyping loci de novo from short-read sequences. G3: Genes, Genomes, Genetics 1:171–182.

Clark, L., Palm, C. 1961. Frullania magellanica. Bryologist 64: 76–80.

Cooper, A., Cooper, R.A. 1995. The Oligocene Bottleneck and New Zealand biota– genetic record of past environmental crisis. Proc. R. Soc. Lond. B. 261:293–302.

Devos, N., Vanderpoorten A. 2009. Range disjunctions, speciation and morphological transformation rates in the liverwort genus Leptoscyphus. Evolution 63:779–792.

Drummond A.J, Suchard, M.A., Xie, D., Rambaut, A. 2012. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 29: 1969–1973.

Edgar, R.C. 2004. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5, 113.

Engel, J. 1978. A taxonomic and phytogeographic study of Brunswick Peninsula (Strait of Magellan) Hepaticae and Anthocerotae. Fieldiana 41:1–319.

Faircloth, B.C. 2008. MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol. Ecol. Resources 8:92–94.

Fuselier, L., Davison, P.G., Clements, M., Shaw, B., Devos, N., Heinrichs, J., Hentschel, J., Sabovljevic, M., Szövenyi, P., Schütte, S., Hofbauer, W. & Shaw, A.J. 2009. Phylogeographic analyses reveal distinct lineages of Metzgeria furcata and M. conjugata (Metzgeriaceae) in Europe and North America. Biol. J. Linnean Soc. 98: 745– 756.

Gibbs G. 2006. Ghosts of Gondwana – the history of life in New Zealand. Nelson, NZ, Craig Potton Publishing. 232pp.

Glenny, D. 1998. A revised checklist of New Zealand liverworts and hornworts. Tuhinga 10: 119–149.

Gradstein, S.R., Churchill, S.P., Salazar-Allen, N. 2001. Guide to the bryophytes of tropical America. The New York Botanical Garden Press, New York.

Grolle, R., Meister, K. 2004.The liverworts in Baltic and Bitterfeld amber. Weissdorn, Jena.

Hässel de Menéndez, G.G. 1983. Patagonian bryophytes 9. Frullania magellanica Web. et Nees and F. sprengelii Steph. Lindbergia 9: 93–98.

Hässel de Menéndez, G.G., Rubies, M. 2009. Catalogue of the Marchantiophyta and Anthocerotophyta from Chile, Argentina and Uruguay. Nova Hedwigia 134: 1–672.

Hattori, S. 1973. Notes on Asiatic species of the genus Frullania, Hepaticae, IV. J. Hattori Bot. Lab. 37: 121–152.

Hattori, S. 1974. Notes on Asiatic species of the genus Frullania, Hepaticae, VI. J. Hattori Bot. Lab. 38: 223–274.

Hattori, S. 1975a. Notes on Asiatic species of the genus Frullania, Hepaticae, VII. J. Hattori Bot. Lab. 39: 277–313.

Hattori, S. 1975b. Notes on Asiatic species of the genus Frullania, Hepaticae, VIII. Bull. Nat. Sci. Mus. Ser. B (Bot.), 1 (4): 141–163.

Hattori, S. 1976. Notes on Asiatic species of the genus Frullania, Hepaticae, X. J. Hattori Bot. Lab. 40: 461–507.

Hattori, S., Mizutani, M. 1982. A status of Amphijubula (Hepaticae) with special reference to the seta anatomy. J. Hattori Bot. Lab. 52: 441–448.

Heinrichs, J., Hentschel, J., Feldberg, K., Bombosch, A., Schneider, H. 2009. Biogeography and taxonomy of disjunctly distributed bryophytes. J. Systemat. Evol. 47:497–508.

Heinrichs J., Hentschel, J., Bombosch A., Fiebig, A., Reise J., Edelmann, M., Kreier H.-P., Schäfer-Verwimp, A., Caspari, S., Schmidt, A.R., Zhu, R.-L., von Konrat, M., Shaw, B., Shaw A.J. 2010. One species or at least eight? Delimitation and distribution of Frullania tamarisci (L.) Dumort. s. l. (Jungermanniopsida, Porellales) inferred from nuclear and chloroplast DNA markers. Mol. Phylogenet. Evol. 56: 1105–1114.

Heinrichs, J., von Konrat, M., Grabenhorst, H., Schmidt, A.R. 2012a. The sporophyte of the Paleogene liverwort Frullania varians Caspary. Fossil Record 15: 115–120.

Heinrichs, J., Reiner-Drehwald, M.E., Feldberg, K., von Konrat, M., Hentschel, J., Vana, J., Grimaldi, D.A., Nascimbene, P.C., Schmidt, A.R. 2012b. The leafy liverwort Frullania (Jungermanniopsida) in the Cretaceous amber forests of Myanmar. Rev. Palaeobot Palyno. 169:21–28.

Heinrichs, J., Feldberg, K., Bechteler, J., Scheben, A., Czumaj, A., Pócs, T., Schneider, H., Schäfer-Verwimp, A., 2015. Integrative taxonomy of Lepidolejeunea (Jungermanniopsida, Porellales) – ocelli allow the recognition of two neglected species. Taxon 64: 216–228.

Hentschel J., von Konrat M., Pócs T., Schäfer-Verwimp A., Shaw A.J., Schneider H., Heinrichs J. 2009. Molecular insights into the phylogeny and subgeneric classification of Frullania Raddi (Frullaniaceae, Porellales). Mol. Phylogenet. Evol. 52: 142–156.

Herzog, T. 1942. Die foliosen Lebermoose der Juan Fernandez-Inseln und der Osterinsel. In: Skottsberg, C. (Ed.). The Natural History of Juan Fernandez and Easter Island, vol. 2. Almqvist and Wiksells Boktryckeri, Uppsala. pp. 697–752.

Huelsenbeck, J.P., Ronquist, F.R., 2001. MrBayes: Bayesian inference of phylogeny. Biometrics 17: 754–755.

Huttunen, S., Hedenäs, L., Ignatov, M.S., Devos, N., Vanderpoorten, A., 2008. Origin and evolution of the northern hemisphere disjunction in the moss genus Homalothecium Brachytheciaceae). Am. J. Bot. 95: 720–730.

Knapp, M., Stöckler, K., Havell, D., Delsuc, F., Sebastiani, F., Lockhart, P.J. 2005. Relaxed molecular clock provides evidence for long distance dispersal of Nothofagus (Southern Beech). Plos Biol. 3e14:38–43

Kreier, H.-P., Feldberg, K., Mahr, F., Bombosch, A., Schmidt, A.R., Zhu, R.-L., von Konrat, M., Shaw, B., Shaw, A.J., Heinrichs, J. 2010. Phylogeny of the leafy liverwort Ptilidium: cryptic speciation and shared haplotypes between the northern and southern hemispheres. Mol. Phylogenet. Evol. 57: 1260–1267.

Kooyman, R.M., Wilf, P., Barreda, V.D., Carpenter, R.J., Jordan, G.J., Sniderman, J.M.K., Allen, A., Brodribb, T.J., Field, T.S., Laffan, S.W., Lusk, C.H., Rossetto, M., Weston, P.H. 2014. Paleo-Antarctic rainforest into the modern old world tropics: the rich past and threatened future of the “southern wet forest survivors”. Am. J.Bot. 101: 2121– 2135.

Larraín, J., Carter, B., Shaw, B., Hentschel, J., Strozier, L.S., Furuki, T., Heinrichs, J., Crandall-Stotler, B., Engel, J., von Konrat, M. 2015. The resurrection of Neohattoria Kamim. (Jubulaceae, Marchantiophyta): a six decade systematic conflict resolved through a molecular perspective. PhytoKeys 50: 101–122.

Lanfear, R., Calcott, B., Ho, S.Y.W., Guindon, S. 2012. PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analysis. Mol. Biol. Evol. 29:1695–1701.

Lee DE, Conran JG, Lindqvist JK, Bannister JM, Mildenhall DC (2012) New Zealand Eocene, Oligocene and Miocene macrofossil and pollen records and modern plant distributions in the Southern Hemisphere. Bot. Rev. 78: 235–260.

Maddison, W.P., Maddison, D.R., 2008. Mesquite: A Modular System for Evolutionary Analysis. Version 2.5. .

Mamontov, J.S., Heinrichs, J., Schäfer-Verwimp, A., Ignatov, M.S., Perkovsky, E.E. 2015. Hepatics from Rovno amber (Ukraine), 4. Frullania riclefgrollei, sp. nov. Rev. Palaeobot. Palyno. 223:31–36.

Matzke, N. J. 2013. Probabilistic historical biogeography: new models for founder-event speciation, imperfect detection, and fossils allow improved accuracy and model-testing. Front. Biogeogr. 5:242–248.

McLoughlin, S. 2001. The breakup history of Gondwana and its impact on pre-Cenozoic floristic provincialism. Aust. Syst. Bot. 49: 271–300.

Meseguer, A.A., Lobo, J.M., Ree, R., Beerling, D.J., Sanmartin, I., 2015. Integrating fossils, phylogenies, and niche models into biogeography to reveal ancient evolutionary history: the case of Hypericum (Hypericaceae). Syst. Biol. 64: 215–232.

Muñoz, J., Felicísimo, A.M., Cabezas, F., Burgaz, A.R., Martínez, I. 2004. Wind as a long-distance dispersal vehicle in the southern hemisphere. Science 304:1144–1147.

Rambaut, A., Drummond, A.J. 2007. Tracer v1.4. .

Ree, R., Smith, S.A. 2008. Maximum likelihood inference of geographic range evolution by dispersal, extinction and cladogenesis. Syst. Biol. 57:4–14.

Ronquist, F. 1997. Dispersal-vicariance analysis: a new approach to the quantification of historical biogeography. Syst. Biol. 46:195–203

Schuster, R.M. 1970. Studies on antipodal Hepaticae, III. Jubulopsis Schuster, Neohattoria Kamimura and Amphijubula Schuster. J. Hattori Bot. Lab. 33: 266–304.

Schuster, R.M. 1992. The Hepaticae and Anthocerotae of North America, east of the hundredth meridian. vol. 5. Field Museum of Natural History, Chicago, IL.

Shaw, A.J., Cox, C.J., Boles, S. 2003. Polarity of peatmoss (Sphagnum) evolution: who says bryophytes have no roots? Am. J. Bot. 90:1777–1787.

Shaw, A.J., Golinski, G.K. , Clark, E.G., Shaw, B., Stenoien, H.K., Flatberg, K.I. 2014. Intercontinental genetic structure in the amphi-Pacific peatmoss Sphagnum miyabeanum (Bryophyta: Sphagnaceae). Biol. J. o Linn. Soc. 111:17–37.

Shaw, A.J., Shaw, B., Stenoien, H.K., Golinski, G.K., Hassel, K., Flatberg, K.I. 2015. Pleistocene survival, regional genetic structure and interspecific gene flow among three northern peat-mosses: Sphagnum inexspectatum, S. orientale, and S. miyabeanum. J. Biogeogr. 42:364–376.

Söderström L, Hagborg A, von Konrat M, Bartholomew-Began S, Bell D, Briscoe L, Brown E, Cargill DC, Costa DP, Crandall-Stotler BJ, Cooper ED, Dauphin G, Engel JJ, Feldberg K, Glenny D, Gradstein SR, He X, Heinrichs J, Hentschel J, Ilkiu-Borges AL, Katagiri T, Konstantinova NA, Larraín J, Long DG, Nebel M, Pócs T, Felisa Puche F, Reiner-Drehwald E, Renner MAM, Sass-Gyarmati A, Schäfer-Verwimp A, Moragues JGS, Stotler RE, Sukkharak P, Thiers BM, Uribe J, Váňa J, Villarreal JC, Wigginton M, Zhang L, Zhu R-L. 2016. World checklist of hornworts and liverworts. PhytoKeys 59: 1–821.

Stamatakis, A. 2014. RAxML Version 8: A tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies. Bioinformatics 2014:1–2.

Standke, G. 1998. Tertiärprofile der Samländischen Bernsteinküste bei Rauschen. Schriftenreihe für Geowissenschaften 7:93–133.

Standke, G. 2008. Bitterfelder Bernstein gleich Baltischer Bernstein? – Eine geologische Raum-Zeit-Betrachtung und genetische Schlussfolgerungen. Excurs.f. und Veröfftl. DGG 236: 11–33.

Stenøien, H.K., Hassel, K., Segreto, R., Rosalina, G.R., Karlin, E.F., Shaw, A.J., Flatberg, K.I. 2014. High morphological diversity in remote island populations of the peat moss Sphagnum palustre: glacial refugium, adaptive radiation or just plasticity? Bryologist 117:95–109.

Sun, Y., He, X., Glenny, D. 2014. Transantarctic disjunctions in Schistochilaceae (Marchantiophyta) explained by early extinction events, post-Gondwanan radiations and palaeoclimatic changes. Mol. Phylogenet. Evol. 76:189– 201.

Szövényi, P., Terracciano, S., Ricca, M., Shaw, A.J. 2008. Recent divergence, intercontinental dispersal and shared polymorphisms are shaping the genetic structure of amphi-Atlantic peatmoss populations. Mol. Ecol. 17:5364–5377.

Takhtajan, A. 1986. Floristic regions of the world. University of California Press, Berkeley.

Untergasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B.C., Remm M., Rozen S.G. 2012. Primer3 - new capabilities and interfaces. Nucleic Acids Res. 40:e115.

Vanderpoorten, A., Gradstein, S.R. , Carine, M.A., Devos, N. 2010. The ghosts of Gondwana and Laurasia in modern liverwort distributions. Biol. Rev. 85:471–487.

Verdoorn, F. 1930. Die Frullaniaceae der Indomalesischen Inseln (De Frullaniaceis VII). Ann. Bryol., suppl. 1: 1– 187.

Villarreal, J.C., Renner, S.S. 2014. A review of molecular-clock calibrations and substitution rates in liverworts, mosses, and hornworts, and a timeframe for a taxonomically cleaned-up genus Nothoceros. Mol. Phylogenet. Evol. 78:25–35.

von Konrat M., Braggins J. E., Asakawa Y. & Toyota M. 2006a. Recognition of Frullania congesta: a case study to present a species concept and a synthesis of signicant taxonomic characters for the large liverwort genus Frullania (Frullaniaceae). J. Hattori Bot. Lab. 100: 553–576

von Konrat, M., Braggins, J. E., Asakawa, Y., Toyota, M. 2006b. Frullania chevalieri (Jubulaceae) in New Zealand, with a reassessment of Schusterella. Bryologist 109: 141–156.

von Konrat, M., Hentschel, J., Heinrichs, J., Braggins, J.E., Pócs, T. 2010. Forty-one degrees below and sixty years in the dark: Frullania sect. Inconditum, a new section of Australasian Frullania species including F. colliculosa, sp. nov. and F. hodgsoniae, nom. and stat. nov. Nova Hedwigia 91:471–500.

von Konrat M., Hentschel, J., Heinrichs, J., Braggins J.E. 2011. Deep Southern Hemisphere Connections: A Revision of Frullania sect. Amphijubula. Bryologist 114: 52–66.

von Konrat M., de Lange, P., Greif, M., Strozier, L., Hentschel, J., Heinrichs, J. 2012. Frullania knightbridgei, a new liverwort (Frullaniaceae, Marchantiophyta) species from the deep south of Aotearoa-New Zealand based on an integrated evidence-based approach. PhytoKeys 8: 13–36.

von Konrat, M., de Lange, P., Larraín, J., Hentschel, J., Carter, B.E., Shaw, A.J., Shaw, B. 2013. A small world: Uncovering hidden diversity in Frullania- a new species from Aotearoa-New Zealand. 2013. Polish Bot. J. 58: 437– 447.

Wall, D.P. 2005. Origin and rapid diversification of a tropical moss. Evolution 59:1413–1424.

Yuzawa, Y. 1991. A monograph of subgen. Chonanthelia of gen. Frullania (Hepaticae) of the world. J. Hattori Bot. Lab. 70:181–291.

Figure Captions

Figure 1. Geographic distribution of Frullania subgenus Microfrullania. Figure 2. Morphological features of Frullania rostrata, typical of Frullania subg. Microfrullania. 1, Festoon habit; 2, Ventral view of stem; 3, Median cells of leaf-lobe, including oil-bodies 1–3 per cell, small and subequally thickened hyaline walls, 4, Ventral view of leaf-lobule, stylus and stem underleaf; 5, Ventral view of 3-keeled perianth; 6, Epidermal cell layer of the capsule wall; 7, Elaters, surface irregularly rugose-granulate; 8, Perianth beak with a smooth mouth but the inner beak surface densely covered with large single-celled protuberances; 9, Pigmented inner layer of the capsule wall; 10, Multiple spore rosettes; 11, Single rosette; bearing a ring of ca. 9–10

1 =c. 10 cm; 2 = 500 µm; 3 = 15 µm; 4, 6, 9 = 50 µm; 5 = 200 µm; 7 = 10 µm; 8 = 20 µm; 10 = 5 µm; 11 = 2 µm. Photo credits. 1. J.E. Braggins. 2–11. M. von Konrat.

Figure 3. Summary of 50% majority rule consensus tree based on a Bayesian analysis of ITS1, ITS2, trnL-F and trnG. Solid branches have greater than 95% posterior probability and greater than 80% ML Bootstrap support. The number of accessions within each collapsed clade is indicated by the number next to the taxon name. Pie charts indicate the geographic origins of the accessions within the collapsed clades.

Figure 4. 50% majority rule consensus tree of the F. chevalieri complex (i.e. subgenus Microfrullania section Microfrullania) based on a Bayesian analysis of ITS1, ITS2 and five anonymous loci. Thickened branches have greater than 95% posterior probability support.

Figure 5. Divergence date estimates and estimations of ancestral geographic distributions. Gray bars represent 95% Confidence Intervals for the divergence date estimates based on published substitution rates (see also Table 2). Upper Confidence interval bounds for nodes 1 and 2 are 70.8 and 58.9Mya, respectively. At each node, biogeographic reconstructions correspond to four separate models: (clockwise from upper left) DEC, DEC+j, DIVAlike +j, DIVAlike.

Table 1. Primer pairs for the anonymous loci developed to provide additional data in resolving the F. chevalieri complex

mf_0676F

AGCTGAGCCAAATCCAC

mf_0676R

GTTTGTCAGTCCATGCCGTGAAAG

mf_0006F

GCGAACGAAACAATCAAC

mf_0006R

GTTTCTAGAGATGCAGGACCGC

mf_0987F

GTTTGTGGTCGTTTCTCCTCCTG

mf_0987R

TCCATCTTCCGGTATAGGTGC

mf_1601F

GCAAGCAACGTGAACTAGC

mf_1601R

GTTTGAAATGGACGAAGCCTTGGG

mf_1329F

GCACAGTGTCACCAAATGC

mf_1329R

GTTTCTGTGATCGACCCGTTCTC

Table 2. Node ages estimated from published substitution rates. Node numbers correspond to Fig 3. Node 0, not shown in Fig.3, is the stem age of Microfrullania. Each estimate is followed by the 95% Confidence Interval.

Node

Published Rates

0

55.2 (36.1-78.2)

1

49.9 (32.4-70.8)

2

41.5 (26.6-58.9)

3

33.5 (21.1-47.3)

4

24.8 (15.4-35.7)

5

18.8 (12.1-26.7)

6

17.5 (11.3-24.8)

7

16.6 (10.8-23.6)

8

15.3 (9.8-21.8)

9

17.3 (10.5-25.3)

10

8.9 (5.3-13.2)

11

12.0 (7.1-17.6)

12

8.9 (5.3-12.9)

13

4.2 (2.2-6.4)

14

6.9 (4.0-10.3)

*Graphical Abstract (for review)

F. inflata F. asagrayana Phylogeny & Biogeography of Frullania subgenus Microfrullania F. nisquallensis

Outgroup (Northern Hemisphere)

F. franciscana

F. lobulata (n=10) F. microcaulis (n=7) F. truncatistyla (n=2) F. magellanica (n=19) F. fertilis (n=34) F. knightbridgei (n=1) F. toropuku (n=3) F. rostrata (n=44) F. species B (n=43)

Geographic Regions

F. chevalieri complex (n=62)

South America Tristan da Cunha Is. New Zealand Kermadec Is. Australia Tasmania New Caledonia Fiji Papua New Guinea Borneo

F. microscopica (n=5) F. species A (n=7) F. junghuhniana complex (n=19) F. pseudomeyeniana (n=3)

0.03 substitutions/site

F. scalaris (n=7) 0.03

*Highlights (for review)

Frullania subg. Microfrullania is monophyletic and has multiple undescribed taxa Dispersal explains genetic structure across extant southern hemisphere clades Vicariance is rejected in explaining historical biogeography of the subgenus

Figure1

Widespread Australasian species

Widespread South American species

Narrowly distributed species

Equator Equator

F. toropuku F. truncatistyla

Fiji New Caledonia Kermadec Is.

30S

30S Tristan da Cunha Is.

F. chevalieri F. species B F. rostrata F. junghuhniana 60S

New Zealand endemics

Southern South America

60S

F. magellanica

New Caledonia endemics F. microscopica F. species A F. scalaris F. pseudomeyeniana Southern South America endemics F. fertilis F. microcaulis F. lobulata

Figure2

Figure3

F. inflata F. asagrayana Outgroup (Northern Hemisphere)

F. nisquallensis F. franciscana

F. lobulata (n=10) F. microcaulis (n=7) F. truncatistyla (n=2) F. magellanica (n=19) F. fertilis (n=34) F. knightbridgei (n=1) F. toropuku (n=3) F. rostrata (n=44) F. species B (n=43)

Geographic Regions

F. chevalieri complex (n=62)

South America Tristan da Cunha Is. New Zealand Kermadec Is. Australia Tasmania New Caledonia Fiji Papua New Guinea Borneo

F. microscopica (n=5) F. species A (n=7) F. junghuhniana complex (n=19) F. pseudomeyeniana (n=3)

0.03 substitutions/site

F. scalaris (n=7) 0.03

Figure4

D005 F. chevalieri NC D235 F. chevalieri NC 20

D239 F. chevalieri NC D241 F. chevalieri NC

1000 km

D233 F. chevalieri NC D218 F. chevalieri NC

0

D227 F. chevalieri NC D363 F. chevalieri NC

-20

Fiji

D275 F. neocaledonica NC D358 F. chevalieri NC

New Caledonia

F314 F. chevalieri NC D240 F. chevalieri NC

-40

D368 F. chevalieri NC F374 F. chevalieri NC D276 F. chevalieri NC

-60

D214 F. chevalieri NC 100

120

140

160

D359 F. chevalieri NC

180

D387 F. parhamii FI D389 F. parhamii FI

1 Fijian clade 2 F. parhamii clade

F298 F. parhamii FI

2

D390 F. parhamii FI D395 F. parhamii FI

1

NC: New Caledonia FI: Fiji

F296 F. parhamii FI D388 F. chevalieri FI D392 F. chevalieri FI D393 F. chevalieri FI

0.006 subs./site

F301 F. chevalieri FI D223 F. chevalieri NC D246 F. chevalieri NC D221 F. neocaledonica NC D226 F. chevalieri NC D229 F. chevalieri NC D220 F. neocaledonica NC D057 F. chevalieri NC F380 F. neocaledonica NC D012 F. species B NC (Outgroup) 0.0060

Figure5

9

S S S S ZS ZS 1 ZS ZS ZS ZS Z Z

2

S S 10 S S ZS ZS 3 ZS ZS Z Z Z Z

Z

New Zealand

N

New Caledonia/Fiji

S

Southern South America

A

Australia

T

Tasmania

I

Southeast Asian Islands

4

ZNZN ZN Z

ZN New Zealand + New Caledonia/Fiji

50

40 40.0

6

N N N N

ZS New Zealand + S. America

50.0

ZN ZN 11 Z Z

ZN ZN 5 Z Z

N N N N 30

30.0

20

20.0

N N N N 12

N N 13 N N

7 8

N N 14 N N

10

10.0

F. lobulata

S

F. microcaulis

S

F. truncatistyla

Z

F. magellanica

S

F. fertilis

S

F. knightbridgei

Z

F. toropuku

Z

F. sp. B

Z

A

N

F. rostrata

Z

A

T

F. microscopica

N

F. sp. A

N

F. chevalieri s.l.

N

F. scalaris

N

Z

F. pseudomeyeniana

N

F. junghuhniana s.l.

I

0.0 ZS Mya 0 Mya

N