- Email: [email protected]
Specific amplification of deleted mitochondrial DNA from a myopathic patient and analysis of deleted region with S1 nuclease
Biochimica el Biophysica Acta, 1009(1989) 151-155
151
Elsevier BBAEXP92000
Specific amplification of deleted rrfitochondfial DNA from a rnyopathic patient and analysis of deleted region with nudease T o m o k o T a n a k a - Y a m a r n o t o ~, M a s a s h i T a n a k a ~, Kinji O h n o ~, W a t a r u Sato ~, $atoshi Horai 2 and Takayuld Ozawa I Department of Biomedical Chemistry. Faculty of Medicine. University of Nagoya. Nagoya and " Leboratory of Human Genetics. National Institute of Genetics, Shizuoka (Japan)
(Received 12 May 1989)
Key words: Mitochondrlalmyopathy:mitochondrialDNA: S~ nuclease:Polymerasechain reaction: Heteroduplex: O~Jgonucleotideprimer Heteropiasmy of the normal-sized and the deleted mitochondrial ger.ome has been observed in mitocbondrial myopathy. The deleted region of the genome in the skeletal muscle of a patient was analyzed both by the convenfiona| Southern blot method and by the nove| method of emp|oying the combination of polymerase chain reaction and $1 nudease digestion. The results obtained by these methods were compared. Southern hybridization using various mitocbondrial DNA fragments localized the deletion from at least position 9020 to 14 955, but regions of uncertainty of I kb remained on both ends of the deletion. Using the polymenLse chain reaction, a fragment from the deleted genome was specifica||y amplified by choosing a pair of primers surrounding the deletion, and two fragments adjacent to the starting and end of the deletion were amplified from the normal-sized genome. S I nuclease analysis of the heteroduplexes formed among these fragments demonstrated that the deletion extended from positions 8650 4- 50 to 15660 4- 60. This method does not require radioisotopes and, moreover, can determine the deleted region within 5 h, in contrast to the 2 days required by the conventional Southern blot analysis. These results indicate that the novel method is faster and more accurate than the conventional method for the determination of the deleted region of genome.
Introduction
The human mitochondrial genome is a closed circular DNA of 16 569 bp which codes for two rRNAs, 22 tRNAs and 13 mRNAs for subunits of complexes of the oxidative phosphorylation system [1], mtDNA is exclusively maternally inherited [2], and is reported to be highly prone to deleterious mutations [3]. It is proposed that mtDNA mutation is an important contributor to aging and degenerative diseases [4]. Some neuromuscular diseases have been proved to be associated with mutations of mtDNA. Heteroplasmy of normal-sized and deleted mtDNA has been observed in patients with chronic progressive external ophthalmoplegia [5]. The sizes of deletions in the reported cases of mitochondrial myopathy were between 2-7 kb and
Abbreviations:mtDNA,mitochondrialDNA; PCR, polymerasechain reaction. Correspondence: T. Ozawa, Department of Biomedical Chemistry, Faculty of Medicine, Universityof Nagoya,65 Tsuruma-cho,Showaku, Nagoya466, Japan.
the deleted mtDNAs were present in proportions ranging from 18~ to 79~ [5-8]. Although most patients had different deleted regions of mtDNA, even in one family [5], several reported patients had deletions apparently identical in location. This finding suggests that there may be 'mutagenic hot-spots' on the mitochondrial genome that are more prone to deletion than other regioas of mtDNA. In order to elucidate the mechanism of the deletion of mtDNA, it is necessary to localize the putative hot-spots in the genomes among many patients with mitochondrial myopathy and to determine the nucleotide sequence in the spot. For this purpose, we have developed a simple, precise and fast method for localization of the deleted region using the combination of PCR and S 1 nuclease digestion (the PCR plus S~ method). Materials and Methods' Patient. A 26-year-old Japanese male had exterp~! oph~halmoplegia since age 21. Histochemistry of the biopsied skeletal muscle showed ragged-red fibers, sug-
0167-4781/89/$03.50 © 1989 ElsevierSciencePublishersB.V.(BiomedicalDivision)
152 TABLE I
Synthesized primers used for PCR Primer a
Sequence 5' ~ 3'
Complementary site b
L 568 L 820 L 962 Lll08 L1451
CAAACACTTAGTTAACAGCT TTCATGCCCATCGTCCTAGA GCATCAGGAGTATCAATCAC ATAACATTCACAGCCACAGA CTATTAAACCCATATAACCT
5681 8201 9621 11081 14511
to to to to to
5 700 8 220 9640 11100 14530
H 60 H1136 H1338 H1479 H1619
AAACATTTTCAGTGTATTGC TATCTTTACTATAAAAGCTA TCTTGTTCATTGTTAAGGTT GGAGGTCGATGAATGAGTGG ACTTGCTTGTAAGCATGGG
620 11380 13400 14810 16209
to to to to to
601 !1361 13381 14791 16191
a Primers L568-L1451 are used for amplification of the light strand of mtDNA and H60-HI619 are used for amplification of the heavy strand of mtDNA. b Numbering of mtDNA is according to Anderson et al. [1].
gesting mitochondrial abnormality. His parents were normal. Southern blot analysis. Total DNA was extracted from 5 mg of the frozen muscle. 50 ng of the total DNA were digested with 3 units of restriction enzymes from Takara Shuzo, Kyoto, Japan and separated electrophoretically on 0.6~; horizontal agarose slab gels. Size standards employed were lambda phage DNA digested with HindIII and phage X174 DNA digested with HaeIII from Nippon Gene, Toyama, Japan. DNA in the gels was denatured and transferred onto GeneScreen Plus membranes from Du Pont-New England Nuclear. Hybridization was carried out as described previously [51. Probes for mtDNA, mtDNA was prepared from a placenta as described essentially by Drouin [9]. 27 fragments of mtDNA obtained by digestion with appropriate restriction enzymes were cloned into pUCI9 vectors (Horai et al., unpublished data). The whole mtDNA and the cloned fragments, labeled with [a32p]dCTP using a Multiprime Labeling System from Amersham, were used as probes. Conditions for PCR. Fragments of mtDNA were amplified from 10 ng of the total DNA in 100/~i of reaction mixture containing 200 ~M of each dNTP, 1 ~M of each primer (shown in Table I), 2.5 units of Taq DNA polymerase from Perldn-Elmer Cetus, and PCR buffer comprising 50 mM KCI/10 mM Tris-HCI (pH 8.3)/1.5 mM MgCI2/0.01% gelatin. The reaction was carried out for a total of 30 cycles with the use of a Thermal Cycler supplied by Perkin-Elmer Cetus. The cycle times were as follows: denaturation, 15 s at 94 ° C; primer extension, 60 s at 72°C; annealing, 15 s at 45°C. Primers for PCR were synthesized using a Shimadzu model NS-1 DNA synthesizer or an Applied Biosystems model 380B DNA synthesizer and purified with NENSORB Prep Cartridge from Du Pont-NEN.
Heteroduplex formation. Two mtDNA fragments (500 ng each) amplified with PCR were mixed and precipitated with ethanol. The pellet was dissolved in 100/~! of 10 mM Tris-HC! (pH 7.5)/7 mM MgCl2/60 mM NaCl and denatured at 95°C for 10 min. For heteroduplex formation the samples were cooled down to 25 °C at 1 C ° / s in the Thermal Cycler. S~ nuclease digestion. The mixture after heteroduplex formation was precipitated with ethanol. The pellet was dissolved in 20/~! of the St nuclease reaction mixture [10] comprising 50 mM sodium acetate/1 mM zinc acetate/250 mM NaCI/50 ;tg/ml bovine serum albumin, and 5 units of S t nuclease from Takara Shuzo was added. The mixture was incubated at 37 °C for 20 rain. The reaction was stopped by addition of EDTA to a final concentration of 5 mM. The digested fragments were separated by electrophoresis on 2~ agarose gels and detected fluorographically after staining with ethidium bromide. Results
Southern blot analysis of the patient's skeletal muscle DNA digested with Pst l using the whole length of mtDNA as the probe showed that this patient had two species of mtDNA (Fig. 1). This enzyme cleaves the normal-sized mtDNA into two fragments of 14.5 kb and 2.1 kb (lane C). An abnormal band of 7.5 kb, consistent with a 7 kb deletion, was observed in the patient (lane P). The deleted mtDNA was present in a population of about 30~ of the total mtDNA in the patient. Analysis showed that for the normal-sized
C P
14.5 7.5
2.1
Fig. 1. Sol, them blot analysis of the patient's muscle m t D N A using the whole human m t D N A as the probe, m t D N A is digested with Pstl, producing two fragments of 14.5 kb and 2.1 kb in a normal control (C). in the patient (P), an extra band of 7.5 kb is seen.
153 mtDNA present in a population of 70% of the total mtDNA, there was no small deletion compared with the control (data not shown). To localize the deletion in the mutant mtDNA, we a~a[yzed patient DNA by the Southern blot method using the cloned mtDNA fragments as the probes (Fig. 2). Probe 1, cover/ng the region between positions 8005 and 9020, hybridized to the 7.5 kb fragment (derived from the deleted mtDNA) and to the 2.1 kb fragment (derived from the normal-sized mtDNA). Probes 2, 3 and 4, covering the region between positions 9020 and 14955, hybridized to the 14.5 kb fragment of the normal-sized mtDNA, but they did not hybridize to the 7.5 kb fragment. Probe 5, covering 14955-16048, hybridized to the 7.5 kb fragment. The result indicates that the deletion extended from at least position 9020 to position 14 955, with lower and upper limits of 8005 and 16048. Uncertain regions of 1 kb remained on both ends of the deletion. The deleted region included the genes for subunits 3 a n d / o r 2 of cytochrome c oxidase (CO3 arid possibly CO2), one or two subunits of ATPase (ATPase subunit 6 and possibly subunit 8), four subunits of NADH-ubiquinone oxidoreductase (ND4L, ND4, ND5 and ND6) and five or six tRNAs. In order to examine the region of the deletion by PCR, we tried to amplify fragments from the deleted mtDNA using various pairs of primers surrounding the deleted region. The results are summarized in Table It. Under this PCR condition, fragments larger than 4 kb cannot be amplified. Using the pri~,ers L820 and H60, the distance between which is 9.0 kb, we amplified a fragment of 2.0 kb, consistent with a 7.0 kb deletion. Similarly, using the primers L568 and H1619, the distance between which is 10.5 kb, we amplified a fragment of 3.3 kb, consistent with a 7.2 kb deletion.
1
2
3
4
5
•9 1 4 . 5 ,11 7 . 5
,~ 2.1 Fig. 2. Hybridization patterns of various mtDNA fragments to the patient's muscle mtDNA digested with Pstl. Probe number is indicated in each lane. The coveting region of each probe is: 1, 8005-9020; 2, 9020-13957; 3, 13051-13957; 4, 13957-15047; 5, 14955-16048. Probes 2, 3 and 4 did not hybridize to the abnormal fragment of 7.5 kb, but probes 1 and 5 did.
TABLE H
Size of the fragment amplified with various combinatw~ of the, primers The PCR conditions are described in Materials and Methods. Combination of primers
Distance between two primers (kb)
Size of amplified fragment (kb)
Calculated size of deleiion (kb)
L 5 6 8 + H 60 L 8 2 0 + H 60 L 962 + H 60 L I I 0 8 + H 60 L 568 + H1619 L 568 + H1479 L 568+ H1338
11.5 9.0 7.6 6.1 10.5 9.1 7.7
n.a.a 2.0 n.a. n.a. 3.3 n.a. n.a.
_ 7.0 7.2 -
a Could not be amplified.
However, no fragments were amplified using other primers, namely L962, Ll108, H1479 or H1338, suggesting that the deleted mtDNAs lost their complementary sites of these primers. These results indicate that the size of deletion was approx. 7 kb and that it extended from at least position 9621 to position 14 810 with lower and upper limits of 8201 and 16 209. The deleted region determined by using the different pairs of primers alone was less accurate than that determined by the Southern blot method. Tn~,~,foi~, we further analyzed the deleted region using the PCR plus S~ method, the principle of which is schematically shown in Fig. 3. Fragment A-B, which includes the starting point of the deletion, is amplified from the normal-sized mtDNA, and fragment A-D, which includes both ends of the deletion, is amplified from the mutant mtDNA. These fragments are mixed and subjected to heteroduplex formation. The complementary region of the heteroduplex formed between fragments A - D and A - B as well as the homoduplexes formed from the self-reannealing of each fragment are protected against S~ nuclease. The size of the complementary region of the heteroduplex indicates the distance between point A and the starting point of the deletion (asterisks in the figure) in the mutant mtDNA. Similarly, the end-point of the deletion can be determined by St nuclease analysis of the heteroduplex formed from fragments C - D and A-D. Fig. 4 shows the electrophoretic patterns of fragments before and after the $1 nuclease digestion. For determination of the starting point of the deletion, a fragment of 3.2 kb (position 8201-11380) which was amplified from the normal-sized mtDNA using the primers L820 and H1136 was mi.,(~d with a fragment of 1.9 kb which was amplified from ~.he deleted mtDNA using the primers L820 and H60 (Fig. 4, lane 1). Then these fragments were subjected to heteroduplex formation. It is essential to cool down the mixture quickly in order to obtain a sufficient amount of heteroduplexes.
154 Normal-s i zed mtDNA A B
1
C
3
2
4
Amplification A
'
B
C "q3.1
Deleted mtDNA
"~1.9
A
r
.91.7
O
-41.0 '.....
"'A'""-.... ""'"i" ..............'" ""b'"......'" "40.55
-90.45 Heteroduplex formation~ B C
n A
e ~
D
O
Ae-1~e-~-D
Fig. 4. Electrophoretic patterns of PCR-amplified mtDNA fragments after heteroduplex formaaon and S i nuclease digestion. Two bands in lane 1 indicate fragments A-B (3.1 kb) and A - D (1.9 kb), amplified using the pairs of primers L820 and H1136 and of primers L820 and H60, respectively. A band with the size of 0.45 kb appeared aL'tc: S nuclease digestion. The size of the band indicates the distance from the position of primer L820 to the beginning point of the deletion. Fragments C - D (1.7 kb) and A - D (1.0 kb) in lane 3 are amplified using the pairs of primers L1451 and H1619 and of primers L820 and H1619, respectively. The band with the size of 0.55 kb is shown in lane 4. The size indicates the distance from the end-point of the deletion to the position of primer H1619.
Sx nuclease digestion A A
D •
•
D
Fig. 3. Schematic presentation of the PCR plus St method. Open box indicates the region of the deletion in mutant DNA. Three fragments, A-B, C - D and A-D, are amplified with each pair of the appropriate primers. The asterisk indicates the crossover point of the deletion. The fragments A-B and A - D are mixed and a heteroduplex is formed. Only the part from point A to the asterisk is complementary and is protected against S t nuclease digestion. The fragments C - D and A - D are subjected to the same procedure for defining the other end of the deletion.
sized mtDNA using the primers of L1451 and H1619 was mixed with a 1.0 kb fragment which was amplified from the deleted mtDNA using the primers of L820 and H1619 (Fig. 4, lane 3). A fragment of 0.55 + 0.06 kb appeared after the S~ nuclease digestion (lane 4). Since the primer H1619 starts at position 16 209, the end-point of the deletion should be located at position 15 660 _+ 60 within the cytochrome b gene. Fig. 5 summarizes the results obtained by three methods to determine the deletion: the Southern blot analysis using various cloned fragments of mtDNA, the
After the S] nuclease digestion, a fragment of 0.45 _+0.05 kb appeared (lane 2), assuming the error in estimation of the fragment size to be less than 10%. Since the primer L820 starts at position 8201, the start point of the deletion should be located at position 8650 _+ 50 bp within the ATPase subunit 6 gene. To determine the end-point of the deletion, a 1.7 kb fragment (position 14511-16209) which was amplified from the normal-
ATPasell/l;
I.Sfill
I.II20
I'U3 NIl3
I.'lfi2
itl;0
A
I. I I Oil
I. 14.5 I
~_.
(-_
H 1131;
fl 13311 111479
(.-.
I
(._ H II;1!1
I
,005
B
NI)I;
'1020
14955
9fi21
14810
I 8201
11;041!
I 1fi20'l
c Fig. 5. Schematic presentation of the deleted region of the patient's mtDNA determined by three methods: (A) the Southern blot analysis using various probes. (B) the PCR using various primers, and (C) the PCR plus St method. Arrows indicate positions of the primers used in this paper. The certain extents of the deleted region of the patient's mutant DNA are indicated by the shadowed boxes. The uncertain extents of the deleted r ~ o n are indicated by the open boxes. Corresponding nucleotide numbers appear below each region. 12 S and 16 S, 12 S and 16 S rRNAs, ND, NADH dehydrogense subunits; CO, cytochrome c oxidase subunits; Cyt b, cytochrome b.
155 PCR using various primers, and the PCR plus S~ method, it is clear that the PCR plus S~ method is most accurate to determine the deleted region. Discussion
As summarized in Fig. 5, among three methods tested here, the PCR plus S t method can determine the deleted region of mtDNA more precisely than the other methods, and i.s useful to determine the nucleotide sequence at the point of mutation. The Southern blot analysis (F:igs. 1 and 2) showed that the deletion starts from the gene for either cytochrome c oxidase, subunit 2, tRNALys, ATPase subunit 8 or ATPase subunit 6 and that it ends at the gene for either cytochrome b, tRNA-Thr or tRNA-Pro. In contrast, using the PCR plus S, method (Fig. 3), it became clear that the deletion starts within the ATPase subunit 6 gene and ends within the cytochrome b gene (Figs. 4 and 5). In the Southern blot analysis, the region of uncertainty at each end of the deletion cannot be narrowed by less than the length of the probe used, about 1 kb here. In the PCR plus S, method, the deleted region can be determined within + 60 bp. Because the experimental error in estimation of electrophoresed fragments depends on the sizes of fragments obtained after S, nuclease digestion, the accuracy in determination of the deleted regions can be improved by choosing appropriate pairs of primers so that smaller fragments are obtained after S~ nuclease digestion. The present method is simple, because we can selectively and directly amplify fragments from the deleted mtDNA or from the normal-sized mtDNA without separating the two populations. For this purpose, we have chosen appropriate pairs of primers and adjusted the length of extension time in PCR. The PCR plus S~ method has the following advantages over the Southern blot method. Firstly, this method requires no radioisotopes, and can be performed in ordinary clinical laboratories. Secondly, the new method is fast. Using the Southern blot method, it takes at least a couple of days to determine the deleted region. Using the new method, we can complete the analysis of the deleted region within 5 h: 2 h for amplification, 1 h for heteroduplex formation, 20 min for S~ nuclease digestion, and 1 h for electrophoresis and detection. Thirdly, this method is so sensitive that total DNA extraCted from only 5 mg of muscle tissue is sufficient for the determination of the deleted region of
mtDNA. Therefore, this method is of value especially when only a small amount of clinically biopsied sample is available. In conclusion, the PCR plus S method reported here is a more precise, simple and ~ast method than the Southern blot method for detection of the hot-spots of deletion in the mitochondrial genome of patients with mitochondrial cytopathy~ Furthermore, this method will facilitate the uaderstanding of the mechanism of mtDNA deletion in these disorders. Acknow|edgem~nts We thank Prefessor Matean Everson of the Language Center, University of Nagoya, for his suggestions on language and style. Oligonucieotides were synthesized at the Laboratory of Biomolecular Analysis, Faculty of Medicine and at the Center for Gene Research, University of Nagoya. This work was supported in part by the Grants-in-Aid for General Scientific Research (62570128) to M.T. and for Scientific Research on Priority Areas (Bioenergetics, 63617002) to T.O. from the Ministry of Education, Science and Culture, Japan, and by Grant 88-02-39 from National Center for Nervous, Mental and Muscular Disorders of the Ministry of Health and Welfare, Japan, to T.O. References 1 Anderson, S., Bankier, A.T., Barrell, B.G.. De Bruijn, M.H.L., Coulson, A.R., Drouin, ,L, Eperson, i.C., Nierlich, D.P., Roe. B.A., Sanger, F., Schreier, P.H., Smith, A.J.H., Staden, R. and Young, I.G, (1981) Nature 290, 457-465. 2 Giles, R.E., Blanc, H,, Cann, H.M. and Walalce, D.C. (1980) Proc. Natl. Acad. Sci. USA 77. 6715-6719. 3 Neckelmann, N., Li, K.. Wade, R.P., Shuster, R. and Wallace, D.C. (1987) Proc. Natl. Acad. Sci. USA 84, 7580-7584. 4 Linnane, A.W., Marzuki, S.. Ozawa, T. and Tanaka, M. ~1989) Lancet i, 642-645. 50zawa, T., Yoneda, M., Tanaka, M., Ghno, K., Sato, W., Suzuki, H., Nishikimi, M., Yamamoto. M., Nonaka, !. and Horai, S. (1988) Biochem. Biophys. Res. Commun. 154. 1240-1247. 6 Holt, 13, Harding, A.E. and Morgan-Hughes, J.A. (1988) Nature 331,717-719. 7 Zeviani, M., Moraes, C.T., DiMauro. S., Nakase, H., Boniila, E., Schon, E.A. and Rowland, L.P. (1988) Neurology 38. 1339-1346. 8 Wallace, D.C. (1989) Trends Genet. 5, 9-13. 9 Drouin, J. (1980) J. Mol. Biol. 140, 15-34. 10 Taber,S. (1987) Current Protocols in Molecular Biology (Ausubel. F,M.. Brent, R.. Kingston. R.E., Moore, D.D.. Seidman, J.G., Smith, J.A. and Struhi, K., eds.), Vol. 1, 3.12.2, John Wiley & Sons, New York.
151
Elsevier BBAEXP92000
Specific amplification of deleted rrfitochondfial DNA from a rnyopathic patient and analysis of deleted region with nudease T o m o k o T a n a k a - Y a m a r n o t o ~, M a s a s h i T a n a k a ~, Kinji O h n o ~, W a t a r u Sato ~, $atoshi Horai 2 and Takayuld Ozawa I Department of Biomedical Chemistry. Faculty of Medicine. University of Nagoya. Nagoya and " Leboratory of Human Genetics. National Institute of Genetics, Shizuoka (Japan)
(Received 12 May 1989)
Key words: Mitochondrlalmyopathy:mitochondrialDNA: S~ nuclease:Polymerasechain reaction: Heteroduplex: O~Jgonucleotideprimer Heteropiasmy of the normal-sized and the deleted mitochondrial ger.ome has been observed in mitocbondrial myopathy. The deleted region of the genome in the skeletal muscle of a patient was analyzed both by the convenfiona| Southern blot method and by the nove| method of emp|oying the combination of polymerase chain reaction and $1 nudease digestion. The results obtained by these methods were compared. Southern hybridization using various mitocbondrial DNA fragments localized the deletion from at least position 9020 to 14 955, but regions of uncertainty of I kb remained on both ends of the deletion. Using the polymenLse chain reaction, a fragment from the deleted genome was specifica||y amplified by choosing a pair of primers surrounding the deletion, and two fragments adjacent to the starting and end of the deletion were amplified from the normal-sized genome. S I nuclease analysis of the heteroduplexes formed among these fragments demonstrated that the deletion extended from positions 8650 4- 50 to 15660 4- 60. This method does not require radioisotopes and, moreover, can determine the deleted region within 5 h, in contrast to the 2 days required by the conventional Southern blot analysis. These results indicate that the novel method is faster and more accurate than the conventional method for the determination of the deleted region of genome.
Introduction
The human mitochondrial genome is a closed circular DNA of 16 569 bp which codes for two rRNAs, 22 tRNAs and 13 mRNAs for subunits of complexes of the oxidative phosphorylation system [1], mtDNA is exclusively maternally inherited [2], and is reported to be highly prone to deleterious mutations [3]. It is proposed that mtDNA mutation is an important contributor to aging and degenerative diseases [4]. Some neuromuscular diseases have been proved to be associated with mutations of mtDNA. Heteroplasmy of normal-sized and deleted mtDNA has been observed in patients with chronic progressive external ophthalmoplegia [5]. The sizes of deletions in the reported cases of mitochondrial myopathy were between 2-7 kb and
Abbreviations:mtDNA,mitochondrialDNA; PCR, polymerasechain reaction. Correspondence: T. Ozawa, Department of Biomedical Chemistry, Faculty of Medicine, Universityof Nagoya,65 Tsuruma-cho,Showaku, Nagoya466, Japan.
the deleted mtDNAs were present in proportions ranging from 18~ to 79~ [5-8]. Although most patients had different deleted regions of mtDNA, even in one family [5], several reported patients had deletions apparently identical in location. This finding suggests that there may be 'mutagenic hot-spots' on the mitochondrial genome that are more prone to deletion than other regioas of mtDNA. In order to elucidate the mechanism of the deletion of mtDNA, it is necessary to localize the putative hot-spots in the genomes among many patients with mitochondrial myopathy and to determine the nucleotide sequence in the spot. For this purpose, we have developed a simple, precise and fast method for localization of the deleted region using the combination of PCR and S 1 nuclease digestion (the PCR plus S~ method). Materials and Methods' Patient. A 26-year-old Japanese male had exterp~! oph~halmoplegia since age 21. Histochemistry of the biopsied skeletal muscle showed ragged-red fibers, sug-
0167-4781/89/$03.50 © 1989 ElsevierSciencePublishersB.V.(BiomedicalDivision)
152 TABLE I
Synthesized primers used for PCR Primer a
Sequence 5' ~ 3'
Complementary site b
L 568 L 820 L 962 Lll08 L1451
CAAACACTTAGTTAACAGCT TTCATGCCCATCGTCCTAGA GCATCAGGAGTATCAATCAC ATAACATTCACAGCCACAGA CTATTAAACCCATATAACCT
5681 8201 9621 11081 14511
to to to to to
5 700 8 220 9640 11100 14530
H 60 H1136 H1338 H1479 H1619
AAACATTTTCAGTGTATTGC TATCTTTACTATAAAAGCTA TCTTGTTCATTGTTAAGGTT GGAGGTCGATGAATGAGTGG ACTTGCTTGTAAGCATGGG
620 11380 13400 14810 16209
to to to to to
601 !1361 13381 14791 16191
a Primers L568-L1451 are used for amplification of the light strand of mtDNA and H60-HI619 are used for amplification of the heavy strand of mtDNA. b Numbering of mtDNA is according to Anderson et al. [1].
gesting mitochondrial abnormality. His parents were normal. Southern blot analysis. Total DNA was extracted from 5 mg of the frozen muscle. 50 ng of the total DNA were digested with 3 units of restriction enzymes from Takara Shuzo, Kyoto, Japan and separated electrophoretically on 0.6~; horizontal agarose slab gels. Size standards employed were lambda phage DNA digested with HindIII and phage X174 DNA digested with HaeIII from Nippon Gene, Toyama, Japan. DNA in the gels was denatured and transferred onto GeneScreen Plus membranes from Du Pont-New England Nuclear. Hybridization was carried out as described previously [51. Probes for mtDNA, mtDNA was prepared from a placenta as described essentially by Drouin [9]. 27 fragments of mtDNA obtained by digestion with appropriate restriction enzymes were cloned into pUCI9 vectors (Horai et al., unpublished data). The whole mtDNA and the cloned fragments, labeled with [a32p]dCTP using a Multiprime Labeling System from Amersham, were used as probes. Conditions for PCR. Fragments of mtDNA were amplified from 10 ng of the total DNA in 100/~i of reaction mixture containing 200 ~M of each dNTP, 1 ~M of each primer (shown in Table I), 2.5 units of Taq DNA polymerase from Perldn-Elmer Cetus, and PCR buffer comprising 50 mM KCI/10 mM Tris-HCI (pH 8.3)/1.5 mM MgCI2/0.01% gelatin. The reaction was carried out for a total of 30 cycles with the use of a Thermal Cycler supplied by Perkin-Elmer Cetus. The cycle times were as follows: denaturation, 15 s at 94 ° C; primer extension, 60 s at 72°C; annealing, 15 s at 45°C. Primers for PCR were synthesized using a Shimadzu model NS-1 DNA synthesizer or an Applied Biosystems model 380B DNA synthesizer and purified with NENSORB Prep Cartridge from Du Pont-NEN.
Heteroduplex formation. Two mtDNA fragments (500 ng each) amplified with PCR were mixed and precipitated with ethanol. The pellet was dissolved in 100/~! of 10 mM Tris-HC! (pH 7.5)/7 mM MgCl2/60 mM NaCl and denatured at 95°C for 10 min. For heteroduplex formation the samples were cooled down to 25 °C at 1 C ° / s in the Thermal Cycler. S~ nuclease digestion. The mixture after heteroduplex formation was precipitated with ethanol. The pellet was dissolved in 20/~! of the St nuclease reaction mixture [10] comprising 50 mM sodium acetate/1 mM zinc acetate/250 mM NaCI/50 ;tg/ml bovine serum albumin, and 5 units of S t nuclease from Takara Shuzo was added. The mixture was incubated at 37 °C for 20 rain. The reaction was stopped by addition of EDTA to a final concentration of 5 mM. The digested fragments were separated by electrophoresis on 2~ agarose gels and detected fluorographically after staining with ethidium bromide. Results
Southern blot analysis of the patient's skeletal muscle DNA digested with Pst l using the whole length of mtDNA as the probe showed that this patient had two species of mtDNA (Fig. 1). This enzyme cleaves the normal-sized mtDNA into two fragments of 14.5 kb and 2.1 kb (lane C). An abnormal band of 7.5 kb, consistent with a 7 kb deletion, was observed in the patient (lane P). The deleted mtDNA was present in a population of about 30~ of the total mtDNA in the patient. Analysis showed that for the normal-sized
C P
14.5 7.5
2.1
Fig. 1. Sol, them blot analysis of the patient's muscle m t D N A using the whole human m t D N A as the probe, m t D N A is digested with Pstl, producing two fragments of 14.5 kb and 2.1 kb in a normal control (C). in the patient (P), an extra band of 7.5 kb is seen.
153 mtDNA present in a population of 70% of the total mtDNA, there was no small deletion compared with the control (data not shown). To localize the deletion in the mutant mtDNA, we a~a[yzed patient DNA by the Southern blot method using the cloned mtDNA fragments as the probes (Fig. 2). Probe 1, cover/ng the region between positions 8005 and 9020, hybridized to the 7.5 kb fragment (derived from the deleted mtDNA) and to the 2.1 kb fragment (derived from the normal-sized mtDNA). Probes 2, 3 and 4, covering the region between positions 9020 and 14955, hybridized to the 14.5 kb fragment of the normal-sized mtDNA, but they did not hybridize to the 7.5 kb fragment. Probe 5, covering 14955-16048, hybridized to the 7.5 kb fragment. The result indicates that the deletion extended from at least position 9020 to position 14 955, with lower and upper limits of 8005 and 16048. Uncertain regions of 1 kb remained on both ends of the deletion. The deleted region included the genes for subunits 3 a n d / o r 2 of cytochrome c oxidase (CO3 arid possibly CO2), one or two subunits of ATPase (ATPase subunit 6 and possibly subunit 8), four subunits of NADH-ubiquinone oxidoreductase (ND4L, ND4, ND5 and ND6) and five or six tRNAs. In order to examine the region of the deletion by PCR, we tried to amplify fragments from the deleted mtDNA using various pairs of primers surrounding the deleted region. The results are summarized in Table It. Under this PCR condition, fragments larger than 4 kb cannot be amplified. Using the pri~,ers L820 and H60, the distance between which is 9.0 kb, we amplified a fragment of 2.0 kb, consistent with a 7.0 kb deletion. Similarly, using the primers L568 and H1619, the distance between which is 10.5 kb, we amplified a fragment of 3.3 kb, consistent with a 7.2 kb deletion.
1
2
3
4
5
•9 1 4 . 5 ,11 7 . 5
,~ 2.1 Fig. 2. Hybridization patterns of various mtDNA fragments to the patient's muscle mtDNA digested with Pstl. Probe number is indicated in each lane. The coveting region of each probe is: 1, 8005-9020; 2, 9020-13957; 3, 13051-13957; 4, 13957-15047; 5, 14955-16048. Probes 2, 3 and 4 did not hybridize to the abnormal fragment of 7.5 kb, but probes 1 and 5 did.
TABLE H
Size of the fragment amplified with various combinatw~ of the, primers The PCR conditions are described in Materials and Methods. Combination of primers
Distance between two primers (kb)
Size of amplified fragment (kb)
Calculated size of deleiion (kb)
L 5 6 8 + H 60 L 8 2 0 + H 60 L 962 + H 60 L I I 0 8 + H 60 L 568 + H1619 L 568 + H1479 L 568+ H1338
11.5 9.0 7.6 6.1 10.5 9.1 7.7
n.a.a 2.0 n.a. n.a. 3.3 n.a. n.a.
_ 7.0 7.2 -
a Could not be amplified.
However, no fragments were amplified using other primers, namely L962, Ll108, H1479 or H1338, suggesting that the deleted mtDNAs lost their complementary sites of these primers. These results indicate that the size of deletion was approx. 7 kb and that it extended from at least position 9621 to position 14 810 with lower and upper limits of 8201 and 16 209. The deleted region determined by using the different pairs of primers alone was less accurate than that determined by the Southern blot method. Tn~,~,foi~, we further analyzed the deleted region using the PCR plus S~ method, the principle of which is schematically shown in Fig. 3. Fragment A-B, which includes the starting point of the deletion, is amplified from the normal-sized mtDNA, and fragment A-D, which includes both ends of the deletion, is amplified from the mutant mtDNA. These fragments are mixed and subjected to heteroduplex formation. The complementary region of the heteroduplex formed between fragments A - D and A - B as well as the homoduplexes formed from the self-reannealing of each fragment are protected against S~ nuclease. The size of the complementary region of the heteroduplex indicates the distance between point A and the starting point of the deletion (asterisks in the figure) in the mutant mtDNA. Similarly, the end-point of the deletion can be determined by St nuclease analysis of the heteroduplex formed from fragments C - D and A-D. Fig. 4 shows the electrophoretic patterns of fragments before and after the $1 nuclease digestion. For determination of the starting point of the deletion, a fragment of 3.2 kb (position 8201-11380) which was amplified from the normal-sized mtDNA using the primers L820 and H1136 was mi.,(~d with a fragment of 1.9 kb which was amplified from ~.he deleted mtDNA using the primers L820 and H60 (Fig. 4, lane 1). Then these fragments were subjected to heteroduplex formation. It is essential to cool down the mixture quickly in order to obtain a sufficient amount of heteroduplexes.
154 Normal-s i zed mtDNA A B
1
C
3
2
4
Amplification A
'
B
C "q3.1
Deleted mtDNA
"~1.9
A
r
.91.7
O
-41.0 '.....
"'A'""-.... ""'"i" ..............'" ""b'"......'" "40.55
-90.45 Heteroduplex formation~ B C
n A
e ~
D
O
Ae-1~e-~-D
Fig. 4. Electrophoretic patterns of PCR-amplified mtDNA fragments after heteroduplex formaaon and S i nuclease digestion. Two bands in lane 1 indicate fragments A-B (3.1 kb) and A - D (1.9 kb), amplified using the pairs of primers L820 and H1136 and of primers L820 and H60, respectively. A band with the size of 0.45 kb appeared aL'tc: S nuclease digestion. The size of the band indicates the distance from the position of primer L820 to the beginning point of the deletion. Fragments C - D (1.7 kb) and A - D (1.0 kb) in lane 3 are amplified using the pairs of primers L1451 and H1619 and of primers L820 and H1619, respectively. The band with the size of 0.55 kb is shown in lane 4. The size indicates the distance from the end-point of the deletion to the position of primer H1619.
Sx nuclease digestion A A
D •
•
D
Fig. 3. Schematic presentation of the PCR plus St method. Open box indicates the region of the deletion in mutant DNA. Three fragments, A-B, C - D and A-D, are amplified with each pair of the appropriate primers. The asterisk indicates the crossover point of the deletion. The fragments A-B and A - D are mixed and a heteroduplex is formed. Only the part from point A to the asterisk is complementary and is protected against S t nuclease digestion. The fragments C - D and A - D are subjected to the same procedure for defining the other end of the deletion.
sized mtDNA using the primers of L1451 and H1619 was mixed with a 1.0 kb fragment which was amplified from the deleted mtDNA using the primers of L820 and H1619 (Fig. 4, lane 3). A fragment of 0.55 + 0.06 kb appeared after the S~ nuclease digestion (lane 4). Since the primer H1619 starts at position 16 209, the end-point of the deletion should be located at position 15 660 _+ 60 within the cytochrome b gene. Fig. 5 summarizes the results obtained by three methods to determine the deletion: the Southern blot analysis using various cloned fragments of mtDNA, the
After the S] nuclease digestion, a fragment of 0.45 _+0.05 kb appeared (lane 2), assuming the error in estimation of the fragment size to be less than 10%. Since the primer L820 starts at position 8201, the start point of the deletion should be located at position 8650 _+ 50 bp within the ATPase subunit 6 gene. To determine the end-point of the deletion, a 1.7 kb fragment (position 14511-16209) which was amplified from the normal-
ATPasell/l;
I.Sfill
I.II20
I'U3 NIl3
I.'lfi2
itl;0
A
I. I I Oil
I. 14.5 I
~_.
(-_
H 1131;
fl 13311 111479
(.-.
I
(._ H II;1!1
I
,005
B
NI)I;
'1020
14955
9fi21
14810
I 8201
11;041!
I 1fi20'l
c Fig. 5. Schematic presentation of the deleted region of the patient's mtDNA determined by three methods: (A) the Southern blot analysis using various probes. (B) the PCR using various primers, and (C) the PCR plus St method. Arrows indicate positions of the primers used in this paper. The certain extents of the deleted region of the patient's mutant DNA are indicated by the shadowed boxes. The uncertain extents of the deleted r ~ o n are indicated by the open boxes. Corresponding nucleotide numbers appear below each region. 12 S and 16 S, 12 S and 16 S rRNAs, ND, NADH dehydrogense subunits; CO, cytochrome c oxidase subunits; Cyt b, cytochrome b.
155 PCR using various primers, and the PCR plus S~ method, it is clear that the PCR plus S~ method is most accurate to determine the deleted region. Discussion
As summarized in Fig. 5, among three methods tested here, the PCR plus S t method can determine the deleted region of mtDNA more precisely than the other methods, and i.s useful to determine the nucleotide sequence at the point of mutation. The Southern blot analysis (F:igs. 1 and 2) showed that the deletion starts from the gene for either cytochrome c oxidase, subunit 2, tRNALys, ATPase subunit 8 or ATPase subunit 6 and that it ends at the gene for either cytochrome b, tRNA-Thr or tRNA-Pro. In contrast, using the PCR plus S, method (Fig. 3), it became clear that the deletion starts within the ATPase subunit 6 gene and ends within the cytochrome b gene (Figs. 4 and 5). In the Southern blot analysis, the region of uncertainty at each end of the deletion cannot be narrowed by less than the length of the probe used, about 1 kb here. In the PCR plus S, method, the deleted region can be determined within + 60 bp. Because the experimental error in estimation of electrophoresed fragments depends on the sizes of fragments obtained after S, nuclease digestion, the accuracy in determination of the deleted regions can be improved by choosing appropriate pairs of primers so that smaller fragments are obtained after S~ nuclease digestion. The present method is simple, because we can selectively and directly amplify fragments from the deleted mtDNA or from the normal-sized mtDNA without separating the two populations. For this purpose, we have chosen appropriate pairs of primers and adjusted the length of extension time in PCR. The PCR plus S~ method has the following advantages over the Southern blot method. Firstly, this method requires no radioisotopes, and can be performed in ordinary clinical laboratories. Secondly, the new method is fast. Using the Southern blot method, it takes at least a couple of days to determine the deleted region. Using the new method, we can complete the analysis of the deleted region within 5 h: 2 h for amplification, 1 h for heteroduplex formation, 20 min for S~ nuclease digestion, and 1 h for electrophoresis and detection. Thirdly, this method is so sensitive that total DNA extraCted from only 5 mg of muscle tissue is sufficient for the determination of the deleted region of
mtDNA. Therefore, this method is of value especially when only a small amount of clinically biopsied sample is available. In conclusion, the PCR plus S method reported here is a more precise, simple and ~ast method than the Southern blot method for detection of the hot-spots of deletion in the mitochondrial genome of patients with mitochondrial cytopathy~ Furthermore, this method will facilitate the uaderstanding of the mechanism of mtDNA deletion in these disorders. Acknow|edgem~nts We thank Prefessor Matean Everson of the Language Center, University of Nagoya, for his suggestions on language and style. Oligonucieotides were synthesized at the Laboratory of Biomolecular Analysis, Faculty of Medicine and at the Center for Gene Research, University of Nagoya. This work was supported in part by the Grants-in-Aid for General Scientific Research (62570128) to M.T. and for Scientific Research on Priority Areas (Bioenergetics, 63617002) to T.O. from the Ministry of Education, Science and Culture, Japan, and by Grant 88-02-39 from National Center for Nervous, Mental and Muscular Disorders of the Ministry of Health and Welfare, Japan, to T.O. References 1 Anderson, S., Bankier, A.T., Barrell, B.G.. De Bruijn, M.H.L., Coulson, A.R., Drouin, ,L, Eperson, i.C., Nierlich, D.P., Roe. B.A., Sanger, F., Schreier, P.H., Smith, A.J.H., Staden, R. and Young, I.G, (1981) Nature 290, 457-465. 2 Giles, R.E., Blanc, H,, Cann, H.M. and Walalce, D.C. (1980) Proc. Natl. Acad. Sci. USA 77. 6715-6719. 3 Neckelmann, N., Li, K.. Wade, R.P., Shuster, R. and Wallace, D.C. (1987) Proc. Natl. Acad. Sci. USA 84, 7580-7584. 4 Linnane, A.W., Marzuki, S.. Ozawa, T. and Tanaka, M. ~1989) Lancet i, 642-645. 50zawa, T., Yoneda, M., Tanaka, M., Ghno, K., Sato, W., Suzuki, H., Nishikimi, M., Yamamoto. M., Nonaka, !. and Horai, S. (1988) Biochem. Biophys. Res. Commun. 154. 1240-1247. 6 Holt, 13, Harding, A.E. and Morgan-Hughes, J.A. (1988) Nature 331,717-719. 7 Zeviani, M., Moraes, C.T., DiMauro. S., Nakase, H., Boniila, E., Schon, E.A. and Rowland, L.P. (1988) Neurology 38. 1339-1346. 8 Wallace, D.C. (1989) Trends Genet. 5, 9-13. 9 Drouin, J. (1980) J. Mol. Biol. 140, 15-34. 10 Taber,S. (1987) Current Protocols in Molecular Biology (Ausubel. F,M.. Brent, R.. Kingston. R.E., Moore, D.D.. Seidman, J.G., Smith, J.A. and Struhi, K., eds.), Vol. 1, 3.12.2, John Wiley & Sons, New York.