- Email: [email protected]
Specific expression of Olpiwi1 and Olpiwi2 in medaka (Oryzias latipes) germ cells
Biochemical and Biophysical Research Communications 418 (2012) 592–597
Contents lists available at SciVerse ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Specific expression of Olpiwi1 and Olpiwi2 in medaka (Oryzias latipes) germ cells Haobin Zhao a,b,c,⇑, Jundan Duan a, Nana Cheng a, Yoshitaka Nagahama b,c a
Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Huazhong Normal University, Wuhan 430079, Hubei, China Japan Society for the Promotion of Science, Tokyo 102-8471, Japan c National Institute for Basic Biology, Okazaki, Aichi 444-8585, Japan b
a r t i c l e
i n f o
Article history: Received 5 December 2011 Available online 20 December 2011 Keywords: Olpiwi1 Olpiwi2 Germ cell Oryzias latipes Primordial germ cell
a b s t r a c t Piwi is necessary for germ stem cell survival in Drosophila and homologues have been identified in a diverse range of organisms. Here, we identify and characterize two homologous genes of piwi, Olpiwi1 and Olpiwi2, in the model fish medaka (Oryzias latipes). Olpiwi1 is similar to Ziwi in zebrafish or Miwi in the mouse, and Olpiwi2 is similar to Zili in zebrafish or Mili in the mouse. Moreover, Olpiwi2 mRNA is produced from two different chromosomes. RT-PCR showed expression of Olpiwi1 and Olpiwi2 predominantly in the gonads. In situ hybridization revealed germ cell-specific expression of Olpiwi1 and Olpiwi2 throughout the development of oocytes from oogonia to mature oocytes in the ovary, and from spermatogonia to spermatocytes in the testes of adults. RT-PCR and whole mount in situ hybridization showed that both Olpiwi1 and Olpiwi2 were maternally deposited in the embryo. Olpiwi1 and Olpiwi2 were detected in primordial germ cells during embryonic development. These results suggest that both Olpiwi1 and Olpiwi2 are germ cell specific, and may play important roles in germ cell development and gametogenesis in this model species. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Piwi proteins of the Argonaute family are defined by the presence of the domains PAZ and Piwi [1,2]. The three types of Piwi proteins identified in Drosophila are Piwi, Aubergine and Ago3; both Piwi and Aubergine are germ cell-specific in the fly. A loss of Piwi results in a loss of germ stem cells, and over-expression of piwi induces over-proliferation of germ stem cells. Piwi is necessary for the self-renewal of germ line stem cells in both males and females [3–5]. Mutation of Aubergine causes male sterility and maternal lethality [6]. Homologues of Piwi have been identified in a number of diverse organisms. A study using antisense RNA has shown that Prg1 and Prg2, two Piwi homologues in Caenorhabditis elegans, are important for germ cell maintenance [4]. Four Piwi proteins exist in humans and three have been identified in the mouse (Mus musculus): MIWI (Piwil1), MILI (Piwil2) and MIWI2 (Piwil4). MIWI and MILI are restricted to germ lineages [7] and knockout of MIWI or MILI leads to male sterility by blocking the process of spermatogenesis [8–10]. Mutation of MIWI2 causes a loss of germ cells [11].
The Piwi homologues Ziwi and Zili were identified in zebrafish (Danio rerio), and both of them are pivotal for germ cells [12–14]. Ziwi, Piwi like 1 of zebrafish, is co-expressed with Vasa in germ cells during embryogenesis [12,13]. Loss of Ziwi causes a loss of germ cells as a result of apoptosis during larval development; reducing Ziwi results in abnormal apoptosis of germ cells in adults [13]. Zili, Piwi like 2 of zebrafish, is required for germ cell differentiation and meiosis [14]. Medaka (Oryzias latipes) is an important model fish for developmental biology because of its transparent embryology, short generation span, easy maintenance in the laboratory, available genome sequence, and well-established embryonic stem cells [15] and germ stem cells [16]. Here, we clone and characterize two piwi-like genes, Olpiwi1 (GenBank ID: EU413991) and Olpiwi2 (GenBank ID: EU413992) in medaka using RT-PCR and in situ hybridization. We found that both Olpiwi1 and Olpiwi2 were specifically expressed in primordial and adult germ cells.
2. Materials and methods 2.1. Fish
⇑ Corresponding author at: Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Huazhong Normal University, Wuhan 430079, Hubei, China. Fax: +86 27 67861936. E-mail addresses: [email protected], [email protected] (H. Zhao). 0006-291X/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2011.12.062
Outbred himedaka (Oryzias latipes) were maintained under an artificial photoperiod (light:dark) of 14L:10D at 26 °C. Spontaneously spawned eggs were collected and incubated at an ambient temperature of 26 °C.
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597
2.2. Isolation of Olpiwil1 and Olpiwil2 By searching the genome database of medaka (http:// www.ensembl.org/Oryzias_latipes/), we found three ensemble sequences similar to piwi-like genes: ENSORLG00000013695 and ENSORLG00000017696 on chromosome 9, and ENSORLG0000001 3656 on chromosome 13 named piwi1, piwi2a and piwi2b, respectively. We cloned partial sequences of the three putative piwi homologues by RT-PCR from the testes with the primers piwi1F (ATGTCTGGTCGGGCTCGTGC), piwi1R (TCACAGGTAGAAGAGGTAG TTGTCC); piwi2aF (AAGCTGGGGTCAAAGGAGCCT), piwi2aR (ATGATTCCGTCCCACCAGCCT); and piwi2bF (TCATTTCTGGCCACATCCT CCTAGTGCC), piwi2bR (TGATCGAGAACTGTTCCCGCTGGGA). Genespecific primers were designed on the fragments to obtain the whole length of the cDNAs by rapid amplification of cDNA ends (RACE). Total RNA from testis tissue was extracted using RNeasy (Qiagen, Hilden, Germany) and cDNA was synthesized according to the manual of the SMART™ RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA). The gene specific primers for 50 RACE were piwi1-5-1 TTGCGTCCGATCTGTTGCATTTCCAG (1st) and piwi1-5-2 TTGGTGGCAGTTCATTTGTCAGGGTG (2nd); piwi2a5-1 TCTGAGTTGGGAGGCAACACCTTCGT (1st) and piwi2a-5-2 TGAGATTGACCACGTCGCAGAGTTGAAC (2nd); piwi2b-5-1 TTGGCACCAGTAGCAAAGGAGGAGGA (1st) and piwi2b-5-2 TCCTTCCAGCGC TTTCGTACAGTCCT (2nd). The gene specific primers for 30 -RACE were piwi1-3-1 TGGAAGCGTCTCACCAACCCACTACA (1st), and piwi1-3-2 GCTCCATGCCAGTACGCTCACAAGCT (2nd); piwi2a-3-1 AAGCTGGGGTCAAAGGAGCCTCCA (1st), and piwi2a-3-2 CGATGAG CATGAGGTTTGGCATGATG (2nd); piwi2b-3-1 TGCCTCAAATGCCCC GTCCCTTCCCA (1st), and piwi2b-3-2 AAGATTGTGGTTTACCGAGAT GGCGTGT (2nd). Sequences were assembled by Lasergene (DNAStar, Madison, WI, USA) and examined against the GenBank database. 2.3. Detection of Olpiwi1 and Olpiwi2 in embryos and adult tissues by RT-PCR The total RNA of tissue from the brain, gill, heart, liver, intestine, kidney, spleen, ovaries and testes was extracted using the RNeasy kit and reverse-transcribed to cDNA using the Omniscript kit (Qiagen), as per the manufacturer’s protocols and after treatment with DNase I (Invitrogen, Carlsbad, CA, USA). The RT-PCR was performed in a reaction volume of 25 ll with the following program: 94 °C for 5 min; 30 cycles of 94 °C for 15 s, 60 °C for 15 s, 72 °C for 2.5 min for Olpiwi1 (1 min for Olpiwi2); and 72 °C for 7 min. The 2568 bp fragment of Olpiwi1 and the 383 bp of Olpiwi2 were amplified with
593
primers piwi1F, piwi1R and piwi2aF, piwi2aR. The 322 bp sequence of b-actin was also amplified as an internal control by RTPCR with the primers OlBAF (CACACCTTCTACAATGAGCTG) and OlBAR (ACCTCATGAAGATCCTCCTGACGG). 2.4. In situ hybridization In situ hybridization on paraffin sections of adult gonads and whole embryos was carried out according to protocols described elsewhere [17]. Sense and antisense digoxigenin-labeled RNA probes were synthesized using the DIG RNA labeling kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions from the plasmid pGEMTeasy (Promega, Madison, WI, USA) into which the 30 -end of Olpiwi1 or Olpiwi2 was subcloned. The developmental stage of oocytes and embryos was determined according to published criteria [18,19]. 3. Results 3.1. Isolation of Olpiwi1 and Olpiwi2 The full length of Olpiwi1 (GenBank ID: EU413991) is 2900 bp mapped to chromosome 9 with 19 exons containing an open reading frame (ORF) of 2568 bp that encodes a protein of 855 amino acids (aa). The full sequences of piwi2a and piwi2b were the same after sequence assemblage. Hence, the two sequences were named Olpiwi2. Olpiwi2 (GenBank ID: EU413992) is 3441 bp in full, containing an ORF of 3105 bp that encodes 1034 aa. Interestingly, Olpiwi2 is mapped to chromosome 9 with 13 exons of 1707 bp, and chromosome 13 with 11 exons of 1687 bp, linked with a sequence of 21 bp, AGAGATCCAACCCTGGAGGCA (Fig. 1, Table S1). The sequence of Olpiwi2 was confirmed with RT-PCR products using the primers at the beginning and the end of ORF at chromosome 9 and chromosome 13 (Fig. 1). A product of 896 bp using the primers piwi2a-3-2 and piwi2b-5-2 was sequenced and perfectly matches the assemblage sequence of Olpiwi2 (Fig. 1, Fig. S2). The 21 bp linkage sequence was unable to be mapped properly to the genome, possibly because the entire genome sequence for medaka remains unfinished and the variety of fish we used (himedaka) is different from the variety (HdrR) used by the species’ genome project. The deduced proteins of Olpiwi1 and Olpiwi2 have a typical PAZ domain and Piwi domain (Fig. S1). Phylogenetic analysis revealed that Olpiwi1 is most similar to Ziwi (GenBank ID: AAL57170), Miwi (GenBank ID: AAL31014) and HIWI (GenBank ID: AAC97371); Olpi-
Fig. 1. (A) The draft structure of Olpiwi2 mRNA shows the two regions at chromosome 9 and 13, start codon (ATG) and stop codon (TGA), and the positions and directions of the primers used for RT-PCR. (B) RT-PCR results of Olpiwi2 by different primers whose positions are shown above the lanes, the sizes of the markers are shown beside the gel document. (C) The partial sequencing result of the RT-PCR product (1033:1928, piwi2a-3-2 and piwi2b-5-2) highlights the linkage sequence of 21 bp in gray. (D) Expression of Olpiwi1 and Olpiwi2 during embryonic development as determined by RT-PCR.
594
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597
in the granules. Olpiwi2 signals were also strong in the granules in the germ cells of the testes (Fig. 2B). 3.3. Expression of Olpiwi1 during embryogenesis
Fig. 2. Expression of Olpiwi1 and Olpiwi2 in medaka (A) checked by RT-PCR in various tissues and (B) in the gonads. (a) Adult ovarian section hybridized with Olpiwi1. (b) Adult ovarian section hybridized with Olpiwi2. (c and c0 ) Olpiwi1 in adult testis under different magnification. (d and d0 ) Olpiwi2 in adult testis under different magnification. Sg, spermatogonia; Ce, spermatocytes at early stage; Cl, spermatocytes at later stage. Oo, oogonia; I, II, III, IV, V, VI, oocytes in diplotene at stage I, II, III, IV, V, VI, respectively. Bar, 50 lm.
wi2 is most similar to Piwil2 (Zili) in zebrafish (GenBank ID: ABM46842), Mili (GenBank ID: BAA93706), and PIWIL2 in humans (GenBank ID: BAC81342).
3.2. Expression pattern of Olpiwi1 and Olpiwi2 mRNA in adult tissue We checked the expression of Olpiwi1 and Olpiwi2 in different tissues using RT-PCR. The expression of Olpiwi1 could be clearly seen in the ovary, testes and intestine and was weakly visible in the heart and spleen (Fig. 2A). Olpiwi2 could be seen in all tissues (brain, gill, heart, liver, kidney, spleen, intestine, ovary and testes) (Fig. 2A). However, both Olpiwi1 and Olpiwi2 were expressed most strongly in the gonads of both sexes (Fig. 2A). These findings are different from the expression patterns of ziwi and zili, which are specific to the gonads of zebrafish [12–14]. In situ hybridization of Olpiwi1 and Olpiwi2 showed strong expression of Olpiwi1 and Olpiwi2 in the germ cells of male and female gonads (Fig. 2B). In the ovary, Olpiwi1 expression was very strong in the oogonia and oocytes at stage I to III. Faint expression was detected in stage IV–VI oocytes; no signal was seen in somatic cells. Signals in the oocytes occurred mostly in the cytoplasm and were strong in some granules. In the testes, strong Olpiwi1 signals were found in germ cells such as the spermatogonia and spermatocytes; signals were also strong in some granules (Fig. 2B). Similar to Olpiwi1, positive Olpiwi2 signals were only found in oocytes of the ovary and in the spermatogonia and spermatocytes of the testes, and not in somatic cells. Olpiwi2 signals were detected predominantly in oocyte cytoplasm and signals were strong
RT-PCR results showed Olpiwi1 mRNA is maternally deposited in embryos. Embryos showed strong expression of Olpiwi1from the 4-cell stage to gastrula stage. Signals became weak commencing 1-day post fertilization (dpf) but were maintained throughout all embryonic stages until hatching (Fig. 1D). Whole mount in situ hybridization of Olpiwi1 was performed for embryos at various stages (Fig. 3). Strong Olpiwi1 signals could be detected in the cytoplasm of zygotes (data not shown) and were distributed to all blastomeres of embryos from the 4-cell stage to blastula (Fig. 3A and B). The signals of Olpiwi1 at gastrula became stronger in the embryonic shield cells than other regions (Fig. 3C). After neurulation, signals of Olpiwi1 were detected in the brain and cells scattered beside the posterior embryonic trunk (Fig. 3D). Cells located in the posterior trunk exhibiting Olpiwi1 signals moved to the region between the 3rd and 5th somite and formed two clusters beside the embryonic trunk from 2 dpf (Fig. 3E). These cells were large in size and round in shape, a character of primordial germ cells (PGCs) (Fig. 3E and E0 ). Olpiwi1 signals were continuously expressed in the gonads till hatching (Fig. 3F and F0 ). A similar expression pattern in the PGCs has been found for olvas, the vasa-like gene in medaka [17,20]. Olvas signals scattered beside the posterior embryonic body at 2 dpf (Fig. 3G) and were continuously detectable in the gonad (Fig. 3H). Similar to ziwi in zebrafish [12], Olpiwi1 signals were detectable in the fin buds and eyes of medaka embryos (data not shown). 3.4. Expression of Olpiwi2 during embryogenesis Olpiwi2 was detected by RT-PCR in embryos from early stages until hatching. The expression of Olpiwi2 was strong in embryos from the 4-cell stage to gastrula, and then became weak and consistent throughout embryogenesis. However, Olpiwi2 expression was lower than Olpiwi1 expression in embryos after 2 dpf (Fig. 1D). Olpiwi2 expression was also observed by whole mount in situ hybridization (Fig. 4). Olpiwi2 was distributed throughout all blastomeres at early stages (e.g. 4-cell stage) (Fig. 4A). However, Olpiwi2 expression became stronger in central cells than outer cells at the 24–32-cells stage (Fig. 4B). This pattern reveals the early commencement and asymmetric expression of embryonic Olpiwi2 and is in accordance with the observation that the transition from maternal to zygotic transcription is uncoupled from the midblastula stage in medaka [21]. Olpiwi2 was expressed in all cells at the blastula stage (Fig. 4C). During gastrulation Olpiwi2 signals were obvious in cells of the embryonic shield (Fig. 4D). After neurulation the signals became very weak and even undetectable in embryos at 1 dpf (Fig. 4E). However, the two clusters of cells expressing Olpiwi2 could be seen in the gonad region at 2 dpf (Fig. 4F). Cells expressing Olpiwi2 were also large and round (Fig. 4F). Olpiwi2 signals were maintained in the gonads until hatching (Fig. 4G and G0 ). In contrast to Olpiwi1, Olpiwi2 was detected in the gonads only during embryonic development. 4. Discussion We identified two homologues of Piwi (Olpiwi1 and Olpiwi2) in medaka and confirmed germ cell-specific expression of Olpiwi1 and Olpiwi2 in adult gonads and PGCs. These findings are similar to data for Ziwi and Zili in zebrafish [12–14]. Ziwi and Zili can be detected in PGCs and adult male and female germ cells where they are located in granules [13,14]. Following a different pattern to that
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597
595
Fig. 3. Expression of Olpiwi1 during embryonic development by whole mount in situ hybridization. (A) stage 4, 4-cell, (B) stage 11, blastula, (C) stage 14, gastrula, (D) stage 18, 1 dpf; the arrow points to the signals in the head; the arrow heads point to the signals beside the posterior embryonic trunk. (E and E0 ) Stage 23, 2 dpf; (E0 ) is the counterpart of box region of (E) in high magnification; the arrow points to the signal in the brain, the arrow heads point to signals in primordial germ cells. (F and F0 ) Stage 36, 6 dpf, (F0 ) is the counterpart of box region of (F) in high magnification; arrow head points to the signal in the gonad. (G and H) In situ hybridization with Olvas probe. (G) Stage 19, 1 dpf; (H) stage 36, 6 dpf; the arrow heads point to the signals of Olvas in germ cells.
in zebrafish, both Olpiwi1 and Olpiwi2 mRNAs are maternally supplied (in zebrafish Ziwi but not Zili mRNA is maternally deposited) [13,14]. Interestingly, Olpiwi2 mRNA is transcribed from two different chromosomes as confirmed by sequence blast and RT-PCR with specific primers in two different exons located in two different chromosomes. The actual mechanism of the splicing of Olpiwi2 remains unclear. This phenomenon has been shown in the human acyl-CoA cholesterol acyltransferase-1 (ACAT-1) gene whose 4.3 kb ACAT-1 mRNA is produced from two different chromosomes [22]. It is very interesting and needs much more efforts to study how two chromosomes produce one mRNA. Besides expression in germ cells, Olpiwi1 and Olpiwi2 are also expressed in other tissues including that of the heart, intestine and spleen. Similarly, human Hiwi and PIWIL2 are expressed in germ cells, hematopoietic stem cells, normal and abnormal gastric tissues and tissues of the small intestine, prostate, liver, kidney, heart, skeletal muscle, breast and brain [23–27]. The ubiquitous expression of Olpiwi1 and Olpiwi2 in adult tissues may reflect the importance of Olpiwi1 and Olpiwi2 because Piwi proteins are stem
cell proteins [26–29]. For example, Piwi functions in maintaining the regenerative ability of stem cells in planaria [28,29]. Loss of Ziwi or Zili leads to a progressive loss of germ cells due to apoptosis during larval development in Ziwi/ fish or due to the inability of germ cells to differentiate in Zili/ fish [13,14]. Mutations in Miwi and Mili do not appear to affect the maintenance of mitotic germ cells, but do result in meiotic defects in mice [8,9]. Miwi2 seems to be essential for germ line stem cell maintenance in mice [11]. Those expressions of Olpiwi1 and Olpiwi2 correlate with germ cell development reveals that Olpiwi1 and Olpiwi2 may play important roles in the development, maintenance and differentiation of germ cells in medaka. Piwi proteins associate with piRNAs (small RNAs especially interact with Piwis) in transcriptional and posttranscriptional gene silencing under piRNA guidance [1,2]. Piwi plays a major role in silencing transposons and protecting the genomes of germ cells [1,2,10,11,13,30]. Mili mutants lose DNA methylation in transposons resulting in increased transposon activation [30]. Ziwi and Zili also bind with piRNAs [13,14]. In general, Ziwi binds antisense piRNAs, while Zili binds ‘sense’ piRNAs [14]. Based on these relation-
596
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597
Fig. 4. Expression of Olpiwi2 during embryonic development by whole mount in situ hybridization. (A) Stage 4, 4-cell, (B) stage 7, (C) stage 11, blastula, (D) stage 16, gastrula, (E) stage 18, 1 dpf, (F) stage 23, 2 dpf, (G and G0 ) stage 39, 0 dph (day post hatching); G0 is the counterpart of box region of G in high magnification. Arrows point to the signals of Olpiwi2 in the gonads.
ships we posit that Olpiwi1 and Olpiwi2 function by binding with piRNAs in medaka. Acknowledgments The authors thank Guijun Guan, Yasushi Shibata and Aya Suzuki for advice and help. This work was supported by National Natural Science Foundation of China (Grant # 31140053), Open Fund of Hubei Key Laboratory of Genetic Regulation and Integrated Biology and Japan Society for the Promotion of Science. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2011.12.062. References [1] C.R. Faehnle, L. Joshua-Tor, Argonautes confront new small RNAs, Curr. Opin. Chem. Biol. 11 (2007) 569–577. [2] L. Peters, G. Meister, Argonaute proteins: mediators of RNA silencing, Mol. Cell 26 (2007) 611–623. [3] H. Lin, A.C. Spradling, A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary, Development 124 (1997) 2463–2476. [4] D.N. Cox, A. Chao, J. Baker, L. Chang, D. Qiao, H. Lin, A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell selfrenewal, Genes Dev. 12 (1998) 3715–3727.
[5] D.N. Cox, A. Chao, H. Lin, Piwi encodes a nucleoplasmic factor whose activity modulates the number and division rate of germline stem cells, Development 127 (2000) 503–514. [6] A. Schmidt, G. Palumbo, M.P. Bozzetti, P. Tritto, S. Pimpinelli, U. Schafer, Genetic and molecular characterization of sting, a gene involved in crystal formation and meiotic drive in the male germ line of Drosophila melanogaster, Genetics 151 (1999) 749–760. [7] S. Kuramochi-Miyagawa, T. Kimura, K. Yomogida, A. Kuroiwa, Y. Tadokoro, Y. Fujita, M. Sato, Y. Matsuda, T. Nakano, Two mouse piwi-related genes: miwi and mili, Mech. Dev. 108 (2001) 121–133. [8] W. Deng, H. Lin, Miwi, a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis, Dev. Cell 2 (2002) 819–830. [9] S. Kuramochi-Miyagawa, T. Kimura, T.W. Ijiri, T. Isobe, N. Asada, Y. Fujita, M. Ikawa, N. Iwai, M. Okabe, W. Deng, et al., Mili, a mammalian member of piwi family gene, is essential for spermatogenesis, Development 131 (2004) 839– 849. [10] S.T. Grivna, B. Pyhtila, H. Lin, MIWI associates with translational machinery and Piwi-interacting RNAs (piRNAs) in regulating spermatogenesis, Proc. Natl. Acad. Sci. USA 103 (2006) 13415–13420. [11] M.A. Carmell, A. Girard, H.J.G. van de Kant, D.G. de Rooij, G.J. Hannon, Miwi2 is essential for spermatogenesis and repression of transposons in the mouse male germline, Dev. Cell 12 (2007) 503–514. [12] C.H. Tan, T.C. Lee, S.D. Weeraratne, V. Korzh, T.M. Lim, Z. Gong, Ziwi, the zebrafish homologue of the Drosophila Piwi co-localization with vasa at the embryonic genital ridge and gonad-specific expression in the adults, Mech. Dev. 119 (2002) S221–S224. [13] S. Houwing, L.M. Kamminga, E. Berezikov, D. Cronembold, A. Girard, H. van den Elst, D.V. Filippov, H. Blaser, E. Raz, C.B. Moens, R.H.A. Plasterk, G.J. Hannon, B.W. Draper, R.F. Ketting, A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in zebrafish, Cell 129 (2007) 69–82. [14] S. Houwing, E. Berezikov, R.F. Ketting, Zili is required for germ cell differentiation and meiosis in zebrafish, EMBO J. 27 (2008) 2702–2711. [15] Y. Hong, C. Winkler, M. Schartl, Pluripotency and differentiation of embryonic stem cell lines from the medakafish (Oryzias latipes), Mech. Dev. 60 (1996) 33– 44.
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597 [16] Y. Hong, T. Liu, H. Zhao, H. Xu, W. Wang, et al., Establishment of a normal medakafish spermatogonial cell line capable of sperm production in vitro, Proc. Natl. Acad. Sci. USA 101 (2004) 8011–8016. [17] A. Shinomiya, M. Tanaka, T. Kobayashi, Y. Nagahama, S. Hamaguchi, The vasalike gene, olvas, identifies the migration path of primordial germ cells during embryonic body formation stage in the medaka, Oryzias latipes, Dev. Growth Differ. 42 (2000) 317–326. [18] T. Iwamatsu, Stages of normal development in the medaka Oryzias latipes, Zool. Sci. 11 (1994) 825–839. [19] T. Iwamatsu, T. Ohta, E. Oshima, N. Sakai, Oogenesis in the medaka Oryzias latipes: stages of oocytes development, Zool. Sci. 5 (1988) 353–373. [20] M. Tanaka, M. Kinoshita, D. Kobayashi, Y. Nagahama, Establishment of medaka (Oryzias latipes) transgenic lines with the expression of green fluorescent protein fluorescence exclusively in germ cells: a useful model to monitor germ cells in a live vertebrate, Proc. Natl. Acad. Sci. USA 98 (2001) 2544–2549. [21] M. Kraeussling, T.U. Wagner, M. Schartl, Highly asynchronous and asymmetric cleavage divisions accompany early transcriptional activity in pre-blastula medaka embryos, PLoS ONE 6 (2011) e21741, doi:10.1371/journal. pone.0021741. [22] B.L. Li, X.L. Li, Z.J. Duan, O. Lee, S. Lin, Z.M. Ma, C.C. Chang, X.Y. Yang, J.P. Park, T.K. Mohandas, W. Noll, L. Chan, T.Y. Chang, Human acyl-CoA:cholesterol acyltransferase-1 (ACAT-1) gene organization evidence that the 4.3-kilobase ACAT-1 mRNA is produced from two different chromosomes, J. Biol. Chem. 274 (1999) 11060–11071.
597
[23] A.K. Sharma, M.C. Nelson, J.E. Brandt, M. Wessman, N. Mahmud, K.P. Weller, R. Hoffman, Human CD34(+) stem cells express the hiwi gene, a human homologue of the Drosophila gene piwi, Blood 97 (2001) 426–434. [24] D. Qiao, A.M. Zeeman, W. Deng, L.H. Looijenga, H. Lin, Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas, Oncogene 21 (2002) 3988–3999. [25] X. Liu, Y. Sun, J. Guo, H. Ma, J. Li, B. Dong, G. Jin, J. Zhang, J. Wu, L. Meng, C. Shou, Expression of hiwi gene in human gastric cancer was associated with proliferation of cancer cells, Int. J. Cancer 118 (2006) 1922–1929. [26] J.H. Lee, D. Schütte, G. Wulf, L. Füzesi, H.-J. Radzun, S. Schweyer, W. Engel, K. Nayernia, Stem-cell protein Piwil2 is widely expressed in tumors and inhibits apoptosis through activation of Stat3/Bcl-XL pathway, Hum. Mol. Genet. 15 (2006) 201–211. [27] L. Chen, R. Shen, Y. Ye, X.-A. Pu, X. Liu, et al., Precancerous stem cells have the potential for both benign and malignant differentiation, PLoS ONE 2 (2007) e293, doi:10.1371/journal.pone.0000293. [28] P.W. Reddien, N.J. Oviedo, J.R. Jennings, J.C. Jenkin, A.S. Alvarado, SMEDWI-2 is a PIWI-like protein that regulates planarian stem cells, Science 310 (2005) 1327–1330. [29] L. Rossi, A. Salvetti, A. Lena, R. Batistoni, P. Deri, C. Pugliesi, E. Loreti, V. Gremigni, DjPiwi-1, a member of the PAZ-Piwi gene family, defines a subpopulation of planarian stem cells, Dev. Genes Evol. 216 (2006) 335–346. [30] A.A. Aravin, R. Sachidanandam, A. Girard, K. Fejes-Toth, G.J. Hannon, Developmentally regulated piRNA clusters implicate MILI in transposon control, Science 316 (2007) 744–747.
Contents lists available at SciVerse ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Specific expression of Olpiwi1 and Olpiwi2 in medaka (Oryzias latipes) germ cells Haobin Zhao a,b,c,⇑, Jundan Duan a, Nana Cheng a, Yoshitaka Nagahama b,c a
Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Huazhong Normal University, Wuhan 430079, Hubei, China Japan Society for the Promotion of Science, Tokyo 102-8471, Japan c National Institute for Basic Biology, Okazaki, Aichi 444-8585, Japan b
a r t i c l e
i n f o
Article history: Received 5 December 2011 Available online 20 December 2011 Keywords: Olpiwi1 Olpiwi2 Germ cell Oryzias latipes Primordial germ cell
a b s t r a c t Piwi is necessary for germ stem cell survival in Drosophila and homologues have been identified in a diverse range of organisms. Here, we identify and characterize two homologous genes of piwi, Olpiwi1 and Olpiwi2, in the model fish medaka (Oryzias latipes). Olpiwi1 is similar to Ziwi in zebrafish or Miwi in the mouse, and Olpiwi2 is similar to Zili in zebrafish or Mili in the mouse. Moreover, Olpiwi2 mRNA is produced from two different chromosomes. RT-PCR showed expression of Olpiwi1 and Olpiwi2 predominantly in the gonads. In situ hybridization revealed germ cell-specific expression of Olpiwi1 and Olpiwi2 throughout the development of oocytes from oogonia to mature oocytes in the ovary, and from spermatogonia to spermatocytes in the testes of adults. RT-PCR and whole mount in situ hybridization showed that both Olpiwi1 and Olpiwi2 were maternally deposited in the embryo. Olpiwi1 and Olpiwi2 were detected in primordial germ cells during embryonic development. These results suggest that both Olpiwi1 and Olpiwi2 are germ cell specific, and may play important roles in germ cell development and gametogenesis in this model species. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Piwi proteins of the Argonaute family are defined by the presence of the domains PAZ and Piwi [1,2]. The three types of Piwi proteins identified in Drosophila are Piwi, Aubergine and Ago3; both Piwi and Aubergine are germ cell-specific in the fly. A loss of Piwi results in a loss of germ stem cells, and over-expression of piwi induces over-proliferation of germ stem cells. Piwi is necessary for the self-renewal of germ line stem cells in both males and females [3–5]. Mutation of Aubergine causes male sterility and maternal lethality [6]. Homologues of Piwi have been identified in a number of diverse organisms. A study using antisense RNA has shown that Prg1 and Prg2, two Piwi homologues in Caenorhabditis elegans, are important for germ cell maintenance [4]. Four Piwi proteins exist in humans and three have been identified in the mouse (Mus musculus): MIWI (Piwil1), MILI (Piwil2) and MIWI2 (Piwil4). MIWI and MILI are restricted to germ lineages [7] and knockout of MIWI or MILI leads to male sterility by blocking the process of spermatogenesis [8–10]. Mutation of MIWI2 causes a loss of germ cells [11].
The Piwi homologues Ziwi and Zili were identified in zebrafish (Danio rerio), and both of them are pivotal for germ cells [12–14]. Ziwi, Piwi like 1 of zebrafish, is co-expressed with Vasa in germ cells during embryogenesis [12,13]. Loss of Ziwi causes a loss of germ cells as a result of apoptosis during larval development; reducing Ziwi results in abnormal apoptosis of germ cells in adults [13]. Zili, Piwi like 2 of zebrafish, is required for germ cell differentiation and meiosis [14]. Medaka (Oryzias latipes) is an important model fish for developmental biology because of its transparent embryology, short generation span, easy maintenance in the laboratory, available genome sequence, and well-established embryonic stem cells [15] and germ stem cells [16]. Here, we clone and characterize two piwi-like genes, Olpiwi1 (GenBank ID: EU413991) and Olpiwi2 (GenBank ID: EU413992) in medaka using RT-PCR and in situ hybridization. We found that both Olpiwi1 and Olpiwi2 were specifically expressed in primordial and adult germ cells.
2. Materials and methods 2.1. Fish
⇑ Corresponding author at: Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Huazhong Normal University, Wuhan 430079, Hubei, China. Fax: +86 27 67861936. E-mail addresses: [email protected], [email protected] (H. Zhao). 0006-291X/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2011.12.062
Outbred himedaka (Oryzias latipes) were maintained under an artificial photoperiod (light:dark) of 14L:10D at 26 °C. Spontaneously spawned eggs were collected and incubated at an ambient temperature of 26 °C.
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597
2.2. Isolation of Olpiwil1 and Olpiwil2 By searching the genome database of medaka (http:// www.ensembl.org/Oryzias_latipes/), we found three ensemble sequences similar to piwi-like genes: ENSORLG00000013695 and ENSORLG00000017696 on chromosome 9, and ENSORLG0000001 3656 on chromosome 13 named piwi1, piwi2a and piwi2b, respectively. We cloned partial sequences of the three putative piwi homologues by RT-PCR from the testes with the primers piwi1F (ATGTCTGGTCGGGCTCGTGC), piwi1R (TCACAGGTAGAAGAGGTAG TTGTCC); piwi2aF (AAGCTGGGGTCAAAGGAGCCT), piwi2aR (ATGATTCCGTCCCACCAGCCT); and piwi2bF (TCATTTCTGGCCACATCCT CCTAGTGCC), piwi2bR (TGATCGAGAACTGTTCCCGCTGGGA). Genespecific primers were designed on the fragments to obtain the whole length of the cDNAs by rapid amplification of cDNA ends (RACE). Total RNA from testis tissue was extracted using RNeasy (Qiagen, Hilden, Germany) and cDNA was synthesized according to the manual of the SMART™ RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA). The gene specific primers for 50 RACE were piwi1-5-1 TTGCGTCCGATCTGTTGCATTTCCAG (1st) and piwi1-5-2 TTGGTGGCAGTTCATTTGTCAGGGTG (2nd); piwi2a5-1 TCTGAGTTGGGAGGCAACACCTTCGT (1st) and piwi2a-5-2 TGAGATTGACCACGTCGCAGAGTTGAAC (2nd); piwi2b-5-1 TTGGCACCAGTAGCAAAGGAGGAGGA (1st) and piwi2b-5-2 TCCTTCCAGCGC TTTCGTACAGTCCT (2nd). The gene specific primers for 30 -RACE were piwi1-3-1 TGGAAGCGTCTCACCAACCCACTACA (1st), and piwi1-3-2 GCTCCATGCCAGTACGCTCACAAGCT (2nd); piwi2a-3-1 AAGCTGGGGTCAAAGGAGCCTCCA (1st), and piwi2a-3-2 CGATGAG CATGAGGTTTGGCATGATG (2nd); piwi2b-3-1 TGCCTCAAATGCCCC GTCCCTTCCCA (1st), and piwi2b-3-2 AAGATTGTGGTTTACCGAGAT GGCGTGT (2nd). Sequences were assembled by Lasergene (DNAStar, Madison, WI, USA) and examined against the GenBank database. 2.3. Detection of Olpiwi1 and Olpiwi2 in embryos and adult tissues by RT-PCR The total RNA of tissue from the brain, gill, heart, liver, intestine, kidney, spleen, ovaries and testes was extracted using the RNeasy kit and reverse-transcribed to cDNA using the Omniscript kit (Qiagen), as per the manufacturer’s protocols and after treatment with DNase I (Invitrogen, Carlsbad, CA, USA). The RT-PCR was performed in a reaction volume of 25 ll with the following program: 94 °C for 5 min; 30 cycles of 94 °C for 15 s, 60 °C for 15 s, 72 °C for 2.5 min for Olpiwi1 (1 min for Olpiwi2); and 72 °C for 7 min. The 2568 bp fragment of Olpiwi1 and the 383 bp of Olpiwi2 were amplified with
593
primers piwi1F, piwi1R and piwi2aF, piwi2aR. The 322 bp sequence of b-actin was also amplified as an internal control by RTPCR with the primers OlBAF (CACACCTTCTACAATGAGCTG) and OlBAR (ACCTCATGAAGATCCTCCTGACGG). 2.4. In situ hybridization In situ hybridization on paraffin sections of adult gonads and whole embryos was carried out according to protocols described elsewhere [17]. Sense and antisense digoxigenin-labeled RNA probes were synthesized using the DIG RNA labeling kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions from the plasmid pGEMTeasy (Promega, Madison, WI, USA) into which the 30 -end of Olpiwi1 or Olpiwi2 was subcloned. The developmental stage of oocytes and embryos was determined according to published criteria [18,19]. 3. Results 3.1. Isolation of Olpiwi1 and Olpiwi2 The full length of Olpiwi1 (GenBank ID: EU413991) is 2900 bp mapped to chromosome 9 with 19 exons containing an open reading frame (ORF) of 2568 bp that encodes a protein of 855 amino acids (aa). The full sequences of piwi2a and piwi2b were the same after sequence assemblage. Hence, the two sequences were named Olpiwi2. Olpiwi2 (GenBank ID: EU413992) is 3441 bp in full, containing an ORF of 3105 bp that encodes 1034 aa. Interestingly, Olpiwi2 is mapped to chromosome 9 with 13 exons of 1707 bp, and chromosome 13 with 11 exons of 1687 bp, linked with a sequence of 21 bp, AGAGATCCAACCCTGGAGGCA (Fig. 1, Table S1). The sequence of Olpiwi2 was confirmed with RT-PCR products using the primers at the beginning and the end of ORF at chromosome 9 and chromosome 13 (Fig. 1). A product of 896 bp using the primers piwi2a-3-2 and piwi2b-5-2 was sequenced and perfectly matches the assemblage sequence of Olpiwi2 (Fig. 1, Fig. S2). The 21 bp linkage sequence was unable to be mapped properly to the genome, possibly because the entire genome sequence for medaka remains unfinished and the variety of fish we used (himedaka) is different from the variety (HdrR) used by the species’ genome project. The deduced proteins of Olpiwi1 and Olpiwi2 have a typical PAZ domain and Piwi domain (Fig. S1). Phylogenetic analysis revealed that Olpiwi1 is most similar to Ziwi (GenBank ID: AAL57170), Miwi (GenBank ID: AAL31014) and HIWI (GenBank ID: AAC97371); Olpi-
Fig. 1. (A) The draft structure of Olpiwi2 mRNA shows the two regions at chromosome 9 and 13, start codon (ATG) and stop codon (TGA), and the positions and directions of the primers used for RT-PCR. (B) RT-PCR results of Olpiwi2 by different primers whose positions are shown above the lanes, the sizes of the markers are shown beside the gel document. (C) The partial sequencing result of the RT-PCR product (1033:1928, piwi2a-3-2 and piwi2b-5-2) highlights the linkage sequence of 21 bp in gray. (D) Expression of Olpiwi1 and Olpiwi2 during embryonic development as determined by RT-PCR.
594
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597
in the granules. Olpiwi2 signals were also strong in the granules in the germ cells of the testes (Fig. 2B). 3.3. Expression of Olpiwi1 during embryogenesis
Fig. 2. Expression of Olpiwi1 and Olpiwi2 in medaka (A) checked by RT-PCR in various tissues and (B) in the gonads. (a) Adult ovarian section hybridized with Olpiwi1. (b) Adult ovarian section hybridized with Olpiwi2. (c and c0 ) Olpiwi1 in adult testis under different magnification. (d and d0 ) Olpiwi2 in adult testis under different magnification. Sg, spermatogonia; Ce, spermatocytes at early stage; Cl, spermatocytes at later stage. Oo, oogonia; I, II, III, IV, V, VI, oocytes in diplotene at stage I, II, III, IV, V, VI, respectively. Bar, 50 lm.
wi2 is most similar to Piwil2 (Zili) in zebrafish (GenBank ID: ABM46842), Mili (GenBank ID: BAA93706), and PIWIL2 in humans (GenBank ID: BAC81342).
3.2. Expression pattern of Olpiwi1 and Olpiwi2 mRNA in adult tissue We checked the expression of Olpiwi1 and Olpiwi2 in different tissues using RT-PCR. The expression of Olpiwi1 could be clearly seen in the ovary, testes and intestine and was weakly visible in the heart and spleen (Fig. 2A). Olpiwi2 could be seen in all tissues (brain, gill, heart, liver, kidney, spleen, intestine, ovary and testes) (Fig. 2A). However, both Olpiwi1 and Olpiwi2 were expressed most strongly in the gonads of both sexes (Fig. 2A). These findings are different from the expression patterns of ziwi and zili, which are specific to the gonads of zebrafish [12–14]. In situ hybridization of Olpiwi1 and Olpiwi2 showed strong expression of Olpiwi1 and Olpiwi2 in the germ cells of male and female gonads (Fig. 2B). In the ovary, Olpiwi1 expression was very strong in the oogonia and oocytes at stage I to III. Faint expression was detected in stage IV–VI oocytes; no signal was seen in somatic cells. Signals in the oocytes occurred mostly in the cytoplasm and were strong in some granules. In the testes, strong Olpiwi1 signals were found in germ cells such as the spermatogonia and spermatocytes; signals were also strong in some granules (Fig. 2B). Similar to Olpiwi1, positive Olpiwi2 signals were only found in oocytes of the ovary and in the spermatogonia and spermatocytes of the testes, and not in somatic cells. Olpiwi2 signals were detected predominantly in oocyte cytoplasm and signals were strong
RT-PCR results showed Olpiwi1 mRNA is maternally deposited in embryos. Embryos showed strong expression of Olpiwi1from the 4-cell stage to gastrula stage. Signals became weak commencing 1-day post fertilization (dpf) but were maintained throughout all embryonic stages until hatching (Fig. 1D). Whole mount in situ hybridization of Olpiwi1 was performed for embryos at various stages (Fig. 3). Strong Olpiwi1 signals could be detected in the cytoplasm of zygotes (data not shown) and were distributed to all blastomeres of embryos from the 4-cell stage to blastula (Fig. 3A and B). The signals of Olpiwi1 at gastrula became stronger in the embryonic shield cells than other regions (Fig. 3C). After neurulation, signals of Olpiwi1 were detected in the brain and cells scattered beside the posterior embryonic trunk (Fig. 3D). Cells located in the posterior trunk exhibiting Olpiwi1 signals moved to the region between the 3rd and 5th somite and formed two clusters beside the embryonic trunk from 2 dpf (Fig. 3E). These cells were large in size and round in shape, a character of primordial germ cells (PGCs) (Fig. 3E and E0 ). Olpiwi1 signals were continuously expressed in the gonads till hatching (Fig. 3F and F0 ). A similar expression pattern in the PGCs has been found for olvas, the vasa-like gene in medaka [17,20]. Olvas signals scattered beside the posterior embryonic body at 2 dpf (Fig. 3G) and were continuously detectable in the gonad (Fig. 3H). Similar to ziwi in zebrafish [12], Olpiwi1 signals were detectable in the fin buds and eyes of medaka embryos (data not shown). 3.4. Expression of Olpiwi2 during embryogenesis Olpiwi2 was detected by RT-PCR in embryos from early stages until hatching. The expression of Olpiwi2 was strong in embryos from the 4-cell stage to gastrula, and then became weak and consistent throughout embryogenesis. However, Olpiwi2 expression was lower than Olpiwi1 expression in embryos after 2 dpf (Fig. 1D). Olpiwi2 expression was also observed by whole mount in situ hybridization (Fig. 4). Olpiwi2 was distributed throughout all blastomeres at early stages (e.g. 4-cell stage) (Fig. 4A). However, Olpiwi2 expression became stronger in central cells than outer cells at the 24–32-cells stage (Fig. 4B). This pattern reveals the early commencement and asymmetric expression of embryonic Olpiwi2 and is in accordance with the observation that the transition from maternal to zygotic transcription is uncoupled from the midblastula stage in medaka [21]. Olpiwi2 was expressed in all cells at the blastula stage (Fig. 4C). During gastrulation Olpiwi2 signals were obvious in cells of the embryonic shield (Fig. 4D). After neurulation the signals became very weak and even undetectable in embryos at 1 dpf (Fig. 4E). However, the two clusters of cells expressing Olpiwi2 could be seen in the gonad region at 2 dpf (Fig. 4F). Cells expressing Olpiwi2 were also large and round (Fig. 4F). Olpiwi2 signals were maintained in the gonads until hatching (Fig. 4G and G0 ). In contrast to Olpiwi1, Olpiwi2 was detected in the gonads only during embryonic development. 4. Discussion We identified two homologues of Piwi (Olpiwi1 and Olpiwi2) in medaka and confirmed germ cell-specific expression of Olpiwi1 and Olpiwi2 in adult gonads and PGCs. These findings are similar to data for Ziwi and Zili in zebrafish [12–14]. Ziwi and Zili can be detected in PGCs and adult male and female germ cells where they are located in granules [13,14]. Following a different pattern to that
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597
595
Fig. 3. Expression of Olpiwi1 during embryonic development by whole mount in situ hybridization. (A) stage 4, 4-cell, (B) stage 11, blastula, (C) stage 14, gastrula, (D) stage 18, 1 dpf; the arrow points to the signals in the head; the arrow heads point to the signals beside the posterior embryonic trunk. (E and E0 ) Stage 23, 2 dpf; (E0 ) is the counterpart of box region of (E) in high magnification; the arrow points to the signal in the brain, the arrow heads point to signals in primordial germ cells. (F and F0 ) Stage 36, 6 dpf, (F0 ) is the counterpart of box region of (F) in high magnification; arrow head points to the signal in the gonad. (G and H) In situ hybridization with Olvas probe. (G) Stage 19, 1 dpf; (H) stage 36, 6 dpf; the arrow heads point to the signals of Olvas in germ cells.
in zebrafish, both Olpiwi1 and Olpiwi2 mRNAs are maternally supplied (in zebrafish Ziwi but not Zili mRNA is maternally deposited) [13,14]. Interestingly, Olpiwi2 mRNA is transcribed from two different chromosomes as confirmed by sequence blast and RT-PCR with specific primers in two different exons located in two different chromosomes. The actual mechanism of the splicing of Olpiwi2 remains unclear. This phenomenon has been shown in the human acyl-CoA cholesterol acyltransferase-1 (ACAT-1) gene whose 4.3 kb ACAT-1 mRNA is produced from two different chromosomes [22]. It is very interesting and needs much more efforts to study how two chromosomes produce one mRNA. Besides expression in germ cells, Olpiwi1 and Olpiwi2 are also expressed in other tissues including that of the heart, intestine and spleen. Similarly, human Hiwi and PIWIL2 are expressed in germ cells, hematopoietic stem cells, normal and abnormal gastric tissues and tissues of the small intestine, prostate, liver, kidney, heart, skeletal muscle, breast and brain [23–27]. The ubiquitous expression of Olpiwi1 and Olpiwi2 in adult tissues may reflect the importance of Olpiwi1 and Olpiwi2 because Piwi proteins are stem
cell proteins [26–29]. For example, Piwi functions in maintaining the regenerative ability of stem cells in planaria [28,29]. Loss of Ziwi or Zili leads to a progressive loss of germ cells due to apoptosis during larval development in Ziwi/ fish or due to the inability of germ cells to differentiate in Zili/ fish [13,14]. Mutations in Miwi and Mili do not appear to affect the maintenance of mitotic germ cells, but do result in meiotic defects in mice [8,9]. Miwi2 seems to be essential for germ line stem cell maintenance in mice [11]. Those expressions of Olpiwi1 and Olpiwi2 correlate with germ cell development reveals that Olpiwi1 and Olpiwi2 may play important roles in the development, maintenance and differentiation of germ cells in medaka. Piwi proteins associate with piRNAs (small RNAs especially interact with Piwis) in transcriptional and posttranscriptional gene silencing under piRNA guidance [1,2]. Piwi plays a major role in silencing transposons and protecting the genomes of germ cells [1,2,10,11,13,30]. Mili mutants lose DNA methylation in transposons resulting in increased transposon activation [30]. Ziwi and Zili also bind with piRNAs [13,14]. In general, Ziwi binds antisense piRNAs, while Zili binds ‘sense’ piRNAs [14]. Based on these relation-
596
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597
Fig. 4. Expression of Olpiwi2 during embryonic development by whole mount in situ hybridization. (A) Stage 4, 4-cell, (B) stage 7, (C) stage 11, blastula, (D) stage 16, gastrula, (E) stage 18, 1 dpf, (F) stage 23, 2 dpf, (G and G0 ) stage 39, 0 dph (day post hatching); G0 is the counterpart of box region of G in high magnification. Arrows point to the signals of Olpiwi2 in the gonads.
ships we posit that Olpiwi1 and Olpiwi2 function by binding with piRNAs in medaka. Acknowledgments The authors thank Guijun Guan, Yasushi Shibata and Aya Suzuki for advice and help. This work was supported by National Natural Science Foundation of China (Grant # 31140053), Open Fund of Hubei Key Laboratory of Genetic Regulation and Integrated Biology and Japan Society for the Promotion of Science. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2011.12.062. References [1] C.R. Faehnle, L. Joshua-Tor, Argonautes confront new small RNAs, Curr. Opin. Chem. Biol. 11 (2007) 569–577. [2] L. Peters, G. Meister, Argonaute proteins: mediators of RNA silencing, Mol. Cell 26 (2007) 611–623. [3] H. Lin, A.C. Spradling, A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary, Development 124 (1997) 2463–2476. [4] D.N. Cox, A. Chao, J. Baker, L. Chang, D. Qiao, H. Lin, A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell selfrenewal, Genes Dev. 12 (1998) 3715–3727.
[5] D.N. Cox, A. Chao, H. Lin, Piwi encodes a nucleoplasmic factor whose activity modulates the number and division rate of germline stem cells, Development 127 (2000) 503–514. [6] A. Schmidt, G. Palumbo, M.P. Bozzetti, P. Tritto, S. Pimpinelli, U. Schafer, Genetic and molecular characterization of sting, a gene involved in crystal formation and meiotic drive in the male germ line of Drosophila melanogaster, Genetics 151 (1999) 749–760. [7] S. Kuramochi-Miyagawa, T. Kimura, K. Yomogida, A. Kuroiwa, Y. Tadokoro, Y. Fujita, M. Sato, Y. Matsuda, T. Nakano, Two mouse piwi-related genes: miwi and mili, Mech. Dev. 108 (2001) 121–133. [8] W. Deng, H. Lin, Miwi, a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis, Dev. Cell 2 (2002) 819–830. [9] S. Kuramochi-Miyagawa, T. Kimura, T.W. Ijiri, T. Isobe, N. Asada, Y. Fujita, M. Ikawa, N. Iwai, M. Okabe, W. Deng, et al., Mili, a mammalian member of piwi family gene, is essential for spermatogenesis, Development 131 (2004) 839– 849. [10] S.T. Grivna, B. Pyhtila, H. Lin, MIWI associates with translational machinery and Piwi-interacting RNAs (piRNAs) in regulating spermatogenesis, Proc. Natl. Acad. Sci. USA 103 (2006) 13415–13420. [11] M.A. Carmell, A. Girard, H.J.G. van de Kant, D.G. de Rooij, G.J. Hannon, Miwi2 is essential for spermatogenesis and repression of transposons in the mouse male germline, Dev. Cell 12 (2007) 503–514. [12] C.H. Tan, T.C. Lee, S.D. Weeraratne, V. Korzh, T.M. Lim, Z. Gong, Ziwi, the zebrafish homologue of the Drosophila Piwi co-localization with vasa at the embryonic genital ridge and gonad-specific expression in the adults, Mech. Dev. 119 (2002) S221–S224. [13] S. Houwing, L.M. Kamminga, E. Berezikov, D. Cronembold, A. Girard, H. van den Elst, D.V. Filippov, H. Blaser, E. Raz, C.B. Moens, R.H.A. Plasterk, G.J. Hannon, B.W. Draper, R.F. Ketting, A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in zebrafish, Cell 129 (2007) 69–82. [14] S. Houwing, E. Berezikov, R.F. Ketting, Zili is required for germ cell differentiation and meiosis in zebrafish, EMBO J. 27 (2008) 2702–2711. [15] Y. Hong, C. Winkler, M. Schartl, Pluripotency and differentiation of embryonic stem cell lines from the medakafish (Oryzias latipes), Mech. Dev. 60 (1996) 33– 44.
H. Zhao et al. / Biochemical and Biophysical Research Communications 418 (2012) 592–597 [16] Y. Hong, T. Liu, H. Zhao, H. Xu, W. Wang, et al., Establishment of a normal medakafish spermatogonial cell line capable of sperm production in vitro, Proc. Natl. Acad. Sci. USA 101 (2004) 8011–8016. [17] A. Shinomiya, M. Tanaka, T. Kobayashi, Y. Nagahama, S. Hamaguchi, The vasalike gene, olvas, identifies the migration path of primordial germ cells during embryonic body formation stage in the medaka, Oryzias latipes, Dev. Growth Differ. 42 (2000) 317–326. [18] T. Iwamatsu, Stages of normal development in the medaka Oryzias latipes, Zool. Sci. 11 (1994) 825–839. [19] T. Iwamatsu, T. Ohta, E. Oshima, N. Sakai, Oogenesis in the medaka Oryzias latipes: stages of oocytes development, Zool. Sci. 5 (1988) 353–373. [20] M. Tanaka, M. Kinoshita, D. Kobayashi, Y. Nagahama, Establishment of medaka (Oryzias latipes) transgenic lines with the expression of green fluorescent protein fluorescence exclusively in germ cells: a useful model to monitor germ cells in a live vertebrate, Proc. Natl. Acad. Sci. USA 98 (2001) 2544–2549. [21] M. Kraeussling, T.U. Wagner, M. Schartl, Highly asynchronous and asymmetric cleavage divisions accompany early transcriptional activity in pre-blastula medaka embryos, PLoS ONE 6 (2011) e21741, doi:10.1371/journal. pone.0021741. [22] B.L. Li, X.L. Li, Z.J. Duan, O. Lee, S. Lin, Z.M. Ma, C.C. Chang, X.Y. Yang, J.P. Park, T.K. Mohandas, W. Noll, L. Chan, T.Y. Chang, Human acyl-CoA:cholesterol acyltransferase-1 (ACAT-1) gene organization evidence that the 4.3-kilobase ACAT-1 mRNA is produced from two different chromosomes, J. Biol. Chem. 274 (1999) 11060–11071.
597
[23] A.K. Sharma, M.C. Nelson, J.E. Brandt, M. Wessman, N. Mahmud, K.P. Weller, R. Hoffman, Human CD34(+) stem cells express the hiwi gene, a human homologue of the Drosophila gene piwi, Blood 97 (2001) 426–434. [24] D. Qiao, A.M. Zeeman, W. Deng, L.H. Looijenga, H. Lin, Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas, Oncogene 21 (2002) 3988–3999. [25] X. Liu, Y. Sun, J. Guo, H. Ma, J. Li, B. Dong, G. Jin, J. Zhang, J. Wu, L. Meng, C. Shou, Expression of hiwi gene in human gastric cancer was associated with proliferation of cancer cells, Int. J. Cancer 118 (2006) 1922–1929. [26] J.H. Lee, D. Schütte, G. Wulf, L. Füzesi, H.-J. Radzun, S. Schweyer, W. Engel, K. Nayernia, Stem-cell protein Piwil2 is widely expressed in tumors and inhibits apoptosis through activation of Stat3/Bcl-XL pathway, Hum. Mol. Genet. 15 (2006) 201–211. [27] L. Chen, R. Shen, Y. Ye, X.-A. Pu, X. Liu, et al., Precancerous stem cells have the potential for both benign and malignant differentiation, PLoS ONE 2 (2007) e293, doi:10.1371/journal.pone.0000293. [28] P.W. Reddien, N.J. Oviedo, J.R. Jennings, J.C. Jenkin, A.S. Alvarado, SMEDWI-2 is a PIWI-like protein that regulates planarian stem cells, Science 310 (2005) 1327–1330. [29] L. Rossi, A. Salvetti, A. Lena, R. Batistoni, P. Deri, C. Pugliesi, E. Loreti, V. Gremigni, DjPiwi-1, a member of the PAZ-Piwi gene family, defines a subpopulation of planarian stem cells, Dev. Genes Evol. 216 (2006) 335–346. [30] A.A. Aravin, R. Sachidanandam, A. Girard, K. Fejes-Toth, G.J. Hannon, Developmentally regulated piRNA clusters implicate MILI in transposon control, Science 316 (2007) 744–747.