Specific identification and molecular typing analysis of Lactobacillus johnsonii by using PCR-based methods and pulsed-field gel electrophoresis

FEMS Microbiology Letters 217 (2002) 141^154

www.fems-microbiology.org

Speci¢c identi¢cation and molecular typing analysis of Lactobacillus johnsonii by using PCR-based methods and pulsed-¢eld gel electrophoresis Marco Ventura, Ralf Zink



Nestle¤ Research Center, Route du Jorat 57, Vers-Chez-Les-Blanc, 1000 Lausanne 26, Switzerland Received 7 August 2002; accepted 17 August 2002 First published online 7 November 2002

Abstract A fast and reliable Multiplex-PCR assay was established to identify the species Lactobacillus johnsonii. Two opposing rRNA genetargeted primers have been designed for this specific PCR detection. Specificity was verified with DNA samples isolated from different lactic acid bacteria. Out of 47 Lactobacillus strains isolated from different environments, 16 were identified as L. johnsonii by PCR. The same set of strains was investigated with five alternative molecular typing methods: enterobacterial repetitive intergenic consensus PCR (ERIC-PCR), repetitive extragenic palindromic PCR (REP-PCR), amplified fragment length polymorphism, single triplicate arbitrarily primed PCR, and pulsed-field gel electrophoresis in order to compare the discriminatory power of these methods. The reported data strongly support the highly significant heterogeneity among all L. johnsonii isolates, potentially linked to their origin of isolation. The use of species-specific primers as well as rapid and highly powerful PCR-based molecular typing tools (namely ERIC- and REP-PCR techniques) should be respectively envisaged for identifying, differentiating and monitoring L. johnsonii strains from various environmental samples, for product monitoring, for species tracing in clinical studies as well as bacterial profiling of various microecological or gastrointestinal environments. 6 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Lactobacillus johnsonii; Molecular typing; ERIC-PCR ; REP-PCR ; Multiplex-PCR ; PFGE; AFLP

1. Introduction The members of the genus Lactobacillus are common inhabitants of the gastrointestinal tract of animals and humans. Additionally, they are extensively used in the production of various fermented foods [1]. Some Lactobacillus strains are either producing (or are added to) fermented products (e.g. yoghurt) or are applied for pharmaceutical preparations [2]. Many food products, supplements or pharmaceutical preparations are claiming to contain viable probiotic strains. Strains with probably the longest history of proven health bene¢ts and safe use are various members of the Lactobacillus acidophilus and Lactobacillus

* Corresponding author. Tel. : +41 (21) 785-8901; Fax : +41 (21) 785-8925. E-mail address : [email protected] (R. Zink).

casei group. Especially for Lactobacillus johnsonii NCC 533 the functional properties regarding its ability to adhere to the intestinal mucosa, bile and acid resistance, intestinal colonization, bacteriocin production have been extensively studied and are well documented [15^17]. Phenotypical testing, identi¢cation and DNA^DNA hybridizations extensively contributed to elucidate the taxonomical position of L. johnsonii within the former L. acidophilus group [3^5]. Furthermore, phylogenetic analysis con¢rmed that L. johnsonii is very closely related to Lactobacillus gasseri (homology group B), while group A harbors L. acidophilus, Lactobacillus amylovorus, Lactobacillus crispatus and Lactobacillus gallinarum [3,6]. Traditional phenotypical identi¢cation of lactobacilli, based mainly on morphological cell characteristics and fermentation sugar pro¢les (API 50), are still on a routine base widely applied, but a reliable identi¢cation of members from the L. acidophilus complex by strictly phenotypical testing is very often highly unsatisfactory. In recent years, several molecular tools have been proposed for species identi¢cation of

0378-1097 / 02 / $22.00 6 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII : S 0 3 7 8 - 1 0 9 7 ( 0 2 ) 0 1 0 7 0 - 4

FEMSLE 10736 29-11-02

142

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

Lactobacillus species. These molecular approaches used di¡erent techniques including : ampli¢cation restriction digestion analysis of the 16S rRNA gene [7], species-speci¢c PCR primers [8,9], DNA^DNA hybridizations with probes targeting speci¢c sequences of rRNA gene [10], sequencing of 16S rRNA genes [11] and 16S^23S rRNA gene intergenic spacer regions [12]. In addition, di¡erentiation among the L. acidophilus complex has been achieved by random ampli¢ed polymorphic DNA (RAPD)-PCR [13,14]. Furthermore, microbiological investigations of the composition of the gastrointestinal micro£ora of mice demonstrated the powerful applicability of denaturing gradient gel electrophoresis combined with PCR as a molecular analytical tool of choice [9]. One major aim for the food industry is the critical selection, identi¢cation, characterization and tracing of various lactic acid bacteria (LAB) in use in various dairy products [15^17]. For this purpose it is of crucial importance to possess rapid and reliable tools for molecular ¢ngerprinting in order to identify and distinguish various strains of the species L. johnsonii and other LAB from clinical, fecal, intestinal and food samples. Molecular approaches such as pulsed-¢eld gel electrophoresis (PFGE) [18] and ribotyping [19] allow an overall clear identi¢cation potential at the strain level but are somehow not suitable for routine use. Alternative simple and faster genotypical approaches involve the use of PCR for molecular ¢ngerprinting. Molecular PCR typing of lactobacilli has been carried out by RAPD analysis [20,21], by a triplicate arbitrarily primed PCR procedure (TAP-PCR) or by ampli¢ed fragment length polymorphism (AFLP) [20]. TAP-PCR uses a speci¢c primer targeting a highly conserved sequence within the 16S rRNA gene and resulting PCR amplicons can be used for molecular ¢ngerprinting of a wide range of LAB [22]. In the AFLP technique total genomic DNA is digested using two restriction enzymes and double-stranded nucleotide adapters are usually ligated to the DNA fragments serving as primer binding sites for PCR ampli¢cation. The use of PCR primers complementary to the adapter and to the restriction site sequence yields strain-speci¢c ampli¢cation patterns. repetitive extragenic palindromic (REP) elements and enterobacterial repetitive intergenic consensus (ERIC) sequences are two recently described PCR methods allowing a very good discrimination among bacterial strains [23^26]. REP elements and ERIC sequences are dispersed throughout bacterial genomes and PCR studies con¢rmed that interREP and inter-ERIC distances or pro¢les are typical for given bacterial species and sometimes even for strains within a given species [26]. However, REP- and ERICPCR techniques have so far not been extensively used for the di¡erentiation of lactobacilli strains. Despite the large variety of available molecular tools, all techniques suitable for the characterization of Lactobacillus isolates lack in many cases the crucial factors, speed and overall repeatability. AFLP and PFGE are highly reliable but can

be very time-consuming and are not suited for a routine use in many laboratories. Similarly, PCR procedures such as RAPD and TAP-PCR demonstrate a rather weak reproducibility and often require a complicated set-up of experimental controls. On the contrary, REP- and ERIC-PCR working on speci¢c target sequences could o¡er alternative opportunities to characterize Lactobacillus strains. The aims of our study were two-fold : (i) to provide a set of PCR primers for the speci¢c identi¢cation of strains of the species L. johnsonii; and (ii) to compare REP-PCR, ERIC-PCR, AFLP, TAP-PCR analysis and the PFGE technique for their overall discriminative power for the identi¢cation of L. johnsonii strains.

2. Materials and methods 2.1. Bacterial strains and growth conditions The bacterial strains used in this study and their origins are listed in Table 1. All LAB were anaerobically grown in MRS broth (Difco Laboratories, Detroit, MI, USA) at 37‡C. All L. johnsonii strains were previously biochemically characterized for their range of fermentable carbohydrates by using the API 50-CHL kit (BioMerieux, Lyon, France) and various morphological traits. 2.2. Identi¢cation of L. johnsonii strains by species-speci¢c primers Chromosomal DNA isolation was conducted by the method of Zhong et al. [27]. All available Lactobacillus 16S rDNA sequences were retrieved from two databases, EMBL and GenBank, and aligned by using the Clustal W program. A potential species-speci¢c primer (LJ1) for L. johnsonii could be identi¢ed. This primer was used with other listed primers (Table 2) in this study as outlined in Fig. 1B. Ampli¢cation reactions were performed in a total volume of 50 Wl containing 25 ng of template DNA and a reaction mix of 20 mM Tris^HCl, 50 mM KCl, 200 WM of each deoxynucleoside triphosphate, 1 WM of LJ1, 2 WM of 338r and 0.5 WM of P6, 1.5 mM MgCl2 and 1 U of Taq DNA polymerase (Gibco-BRL Life Technologies, UK). Each PCR cycling pro¢le consisted of an initial denaturation step of 5 min at 95‡C followed by an ampli¢cation for 30 cycles : denaturation (1 min at 95‡C), annealing (1 min at 54‡C) and extension (2 min at 72‡C). The resulting PCR amplicons were visualized under UV light (260 nm) in a 1% (w/v) agarose electrophoresis followed by a subsequent ethidium bromide staining (0.5 Wg ml31 ). 2.3. ERIC-PCR and REP-PCR genotyping The primers used for ERIC-PCR and REP-PCR are listed in Table 2. Primers REP-I and REP-II were synthe-

FEMSLE 10736 29-11-02

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

143

Table 1 Bacterial strains used Species

Strain

Origin and reference

L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. johnsonii L. gasseri L. gasseri L. gasseri L. gasseri L. gasseri L. acidophilus L. crispatus L. crispatus L. crispatus L. amylovorus L. amylolyticus L. gallinarum L. helveticus L. casei subsp. paracasei L. casei subsp. paracasei L. casei subsp. rhamnosus L. casei subsp. casei L. fermentum L. brevis L. reuteri L. salivarius L. delbrueckii subsp. lactis L. delbrueckii subsp. lactis L. delbrueckii subsp. lactis L. delbrueckii subsp. bulgaricus L. delbrueckii subsp. delbrueckii L. plantarum Bi¢dobacterium lactis Bi¢dobacterium breve Bi¢dobacterium longum Streptococcus thermophilus

ATCC 33200T ATCC 332 ATCC 11506 JCM 8793 DSM 20553 JCM 8791 NCC 533 NCC 1b NCC 1c NCC 1741 NCC 1717 NCC 1703 NCC 1669 NCC 1657 NCC 1646 NCC 1627 NCC 30604 DSM 20243T ATCC 19992 DSM 20077 VPI 11759 ATCC 4356T DSM 20584T CIP 103602 NCTC5 DSM 20531T DSM 11664T ATCC 33199T ATCC 15009T ATCC 334T IMPC 21060 ATCC 7469 ATCC 393T ATCC 9338T ATCC 14869T DSM 20016T ATCC 11741T DSM 20072T CNRZ 250 ATCC 7830 DSM 20081T DSM 20074T ATCC 14917T DSM 10140T ATCC 15700T ATCC 15707T DSM 20617T

Human blood Unknown Unknown Pig feces Sour milk Mouse feces Human feces Human feces Human feces Human feces Human feces Cheese Human feces Human feces Human feces Unknown Unknown Human Feces Human feces Unknown Human Eye Chicken Human vaginal Cattle waste corn fermentation Beer wort Chicken crop Swiss Emmental cheese Emmental cheese Unknown Unknown Cheese Unknown Human feces Intestine of adult Saliva Emmental cheese Cheese Unknown Bulgarian yoghurt Sour grain mash Pickled cabbage Yoghurt Intestine of infant Intestine of adult Pasteurized milk

ATCC : American Type Culture Collection; DSM: Deutsche Sammlung fu«r Mikroorganismen; NCC: Nestec Culture Collection ; JCM: Japanese Collection of Microorganisms; CNRZ: Centre Nationale de Recherche Zootechniques; CIP: Collection of Institute Pasteur; NCTC: National Collection of Type Cultures; VPI: Virginia Polytechnical Institute.

sized to contain the nucleotide inosine (N) at ambiguous positions in the REP consensus sequence [26]. The 25-Wl reaction mixture contained 10 mM Tris^HCl, 50 mM KCl, 3 mM MgCl2 , 200 WM of each deoxynucleoside triphosphate (Gibco-BRL Life Technologies, UK), 1 WM of each primer, 2.5 U of Taq DNA polymerase (Gibco-BRL Life Technologies, UK) and 25 ng of the respective template DNA. Samples were denatured for 3 min at 94‡C and processed in the following manner: (a) for REP-PCR:

one cycle at 94‡C for 3 min; 35 cycles at 94‡C for 30 s, at 40‡C for 60 s, at 72‡C for 4 min and one cycle at 72‡C for 7 min; (b) for ERIC-PCR: one cycle at 94‡C for 3 min; followed by 35 cycles at 94‡C for 30 s, at 48‡C for 60 s, at 72‡C for 5 min and one cycle at 72‡C for 7 min. All PCR amplicons were electrophoresed on 2% (w/v) agarose gels at a constant voltage of 4 V cm31 . PCR patterns were stained with ethidium bromide (0.5 Wg ml31 ) and visualized under UV light at 254 nm.

FEMSLE 10736 29-11-02

144

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

Table 2 PCR primer used in this study Oligonucleotide

Sequencea 5PC3P

LJ1 338r P6 ECO MSE ERIC-I ERIC-II REP-I REP-II P32-A P32-B

GATGATTTTAGTTCTTGCACTAA ACTCCTACGGGAGGCAGC CTACGGCTACCTTGTTACGA GACTGCGTACCAATTC GATGAGTCCTGAGTAAC ATGTAAGCTCCTGGGGATTCAC AAGTAAGTGACTGGGGTGAGCG NNNNCGNCGNCATCNGGC NCGNCTTATCNGGCCTAC s CAGCAGCCGCGGTAATAC CAGCAGCCGCGGTAATAC

a

Primers REP-I and REP-II were synthesized to contain the nucleotide inosine (N) at ambiguous positions in the REP consensus sequence [26].

2.4. AFLP genotyping Digestion of chromosomal DNA with the restriction enzymes EcoRI and MseI and subsequent ligation of restriction half-site-speci¢c adapters was done as described previously [29]. The designed EcoRI and MseI adapters consisted of an equimolar mixture of partially complementary oligonucleotides (i) 5P-CTCGTAGACTGCGTACC3P and 5P-GACGATGAGTCCTGAG-3P, and (ii) 3PCTGACGCATGGTTA-5P and 3P-CTACTCAGGACTCAT-5P, respectively. Speci¢c ampli¢cations were performed by the use of two primers : ECO (Table 2) and MSE (Table 2). Ampli¢cation reactions were performed as outlined previously [30], except that only 25 ng of template DNA and 2.5 U of Taq DNA polymerase (GibcoBRL Life Technologies, UK) were used. PCR reactions were performed with the Perkin Elmer 9700 thermal cycler with the following temperature pro¢les: one cycle at 94‡C for 30 s, 65‡C for 30 s, 72‡C for 60 s followed by a touchdown phase represented by a reduction of the annealing temperature of 0.8‡C at each cycle during 12 cycles, and 94‡C for 30 s, 56‡C for 30 s, 72‡C for 60 s for the last 23 cycles. After the PCR reaction an equal volume of 50 Wl of 98% (w/v) formamide, 10 mM EDTA, 0.1% (w/v) xylene cyanol and 0.1% (w/v) bromophenol blue were added to each PCR reaction mixture. Samples were heated at 90‡C for 3 min, rapidly cooled on ice and subsequently loaded on a

denaturing acrylamide gel (5%; 19:1 acrylamide:bis; 7.5 M urea; 0.5UTBE bu¡er (100 mM Tris, 100 mM boric acid, 2 mM EDTA, pH 8.3)). The polyacrylamide gel was poured onto glass plates (Bio-Rad, UK) with 0.4-mm spacers and combs (Bio-Rad, UK). TBE bu¡er was used as electrophoresis bu¡er, the gel was pre-run for 30 min at constant power (35 W) at 40‡C. Generally, 15-Wl samples of each reaction mixture were loaded on the gel. Electrophoresis gel run was performed at constant power (45 W) at 50‡C for 120 min using the DG-Code unit (Bio-Rad, UK). Subsequently, all acrylamide gels were stained with SYB (Bio-Rad, UK) following the supplier’s instructions and PCR amplicons were visualized by UV light (254 nm). 2.5. TAP-PCR genotyping PCR mixtures (30 Wl) contained 14 WM of two primers P32-A and P32-T (Table 2) [22] ; 10 mM Tris^HCl, 50 mM KCl; 10 mM Tris^HCl, 50 mM KCl, 3 mM MgCl2 , 200 WM of each deoxynucleoside triphosphate (Gibco-BRL Life Technologies, UK); 2.5 U of Taq DNA polymerase (Gibco-BRL Life Technologies, UK) and 25 ng of template DNA. Ampli¢cations were carried out in a Perkin Elmer 9700 thermal cycler with the following temperature pro¢le: one cycle of 92‡C for 2 min followed by 40 cycles of 92‡C for 30 s and 38‡C, 40‡C or 42‡C for 1 min, followed by 68‡C for 1 min and 30 s and a ¢nal 10-min incubation at 68‡C. PCR fragments were separated in 2% (w/v) agarose gel electrophoresis at a constant voltage of 4 V cm31 and visualized by ethidium bromide staining at 254 nm. 2.6. PFGE genotyping Lactobacilli were grown to an A600 of 0.5 in MRS medium. Chloramphenicol (100 Wg ml31 ) was added, and incubation was continued for 2 h. Cells were harvested from 3 ml of culture, washed twice with 10 mM Tris, 20 mM NaCl, 50 mM EDTA (pH 7.2), and suspended in 300 Wl of the same bu¡er. An aliquot (200 Wl) of the same dilution was mixed with an equal volume of 1.5% pulsed-¢eld electrophoresis licensed low-melting-point agarose (Bio-Rad, UK) before solidifying in molds for 30 min at 4‡C. The agarose blocks were incubated overnight at C

Fig. 1. Multiplex-PCR products of several Lactobacillus and Bi¢dobacterium species (a) and schematic location of the primers used and the overall PCR approach (b). a: Lane 1, L. johnsonii ATCC 33200; lane 2, L. johnsonii ATCC 332; lane 3, L. johnsonii DSM 20553; lane 4, L. johnsonii NCC 1669; lane 5, L. johnsonii ATCC 11506; lane 6, L. johnsonii NCC 1657; lane 7, L. johnsonii NCC 1646; lane 8, L. johnsonii NCC 1717 ; lane 9, L. johnsonii JCM 8793; lane 10, L. johnsonii NCC 1741; lane 11, L. johnsonii JCM 8791; lane 12, L. johnsonii NCC 1703; lane 13, L. johnsonii NCC 533; lane 14, L. johnsonii NCC 1b; lane 15, L. johnsonii NCC 1c; lane 16, L. johnsonii NCC 1627 ; lane 17, L. gasseri DSM 20243; lane 18, L. gasseri DSM 20077 ; lane 19, L. gasseri ATCC 19992; lane 20, L. gasseri VPI 11759; lane 21, L. acidophilus ATCC 4356; lane 22, L. crispatus DSM 20584; lane 23, L. crispatus NCTC5; lane 24, L. amylovorus DSM 20531 ; lane 25, L. gallinarum ATCC 33199 ; lane 26, L. casei subsp. paracasei ATCC 334; lane 27, L. casei subsp. casei ATCC 393; lane 28, L. casei subsp. rhamnosus ATCC 53103 ; lane 29, L. helveticus ATCC 15009 ; lane 30, L. salivarius ATCC 11741 ; lane 31, L. delbrueckii subsp. lactis DSM 20072 ; lane 32, L. delbrueckii subsp. delbrueckii DSM 20074; lane 33, L. delbrueckii subsp. bulgaricus DSM 20081 ; lane 34, L. plantarum DSM 20714; lane 35, L. brevis ATCC 14869 ; lane 36, L. fermentum ATCC 9338; lane 37, L. reuteri DSM 20016 ; lane 38, Bi¢dobacterium lactis DSM 10140; lane 39, B. longum ATCC 15707 ; lane 40, B. breve ATCC 15700; lane 41, L. amyloliticus DSM 11664 ; lane 42, Streptococcus thermophilus DSM 20617; lane M contains the molecular size marker 1-kb DNA ladder (Gibco-BRL).

FEMSLE 10736 29-11-02

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

37‡C in a lysis bu¡er, 6 mM Tris, 1 M NaCl, 100 mM EDTA, 1% sarcosyl, 1 mg ml31 of lysozyme and 20 U of mutanolysin (Sigma) per ml. Proteinase K (1 mg ml31 ) treatment was performed in 100 mM EDTA, 1% sarcosyl for 18 h at 50‡C. The agarose blocks were incubated with

145

20 mM Tris, 50 mM EDTA (pH 8.0) containing 1 mM phenylmethylsulfonyl £uoride (Sigma) for 1 h. Before restriction enzyme digestion the agarose blocks were washed twice in 1UTE for 1 h each. Restriction enzyme digestion with SmaI was performed for 12 h at 37‡C. Electrophore-

FEMSLE 10736 29-11-02

146

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

Fig. 2. ERIC-PCR ¢ngerprints of Lactobacillus strains (a); dendrograms representing genetic relationships among L. johnsonii strains based on ERICPCR ¢ngerprints (b). a: Lane 1, L. johnsonii ATCC 33200; lane 2, L. johnsonii ATCC 332; lane 3, L. johnsonii DSM 20553; lane 4, L. johnsonii NCC 1669 ; lane 5, L. johnsonii ATCC 11506; lane 6, L. johnsonii NCC 1657 ; lane 7, L. johnsonii NCC 1646; lane 8, L. johnsonii NCC 1717; lane 9, L. johnsonii JCM 8793; lane 10, L. johnsonii NCC 1741 ; lane 11, L. johnsonii JCM 8791; lane 12, L. gasseri NCC 30604; lane 13, L. johnsonii NCC 1703; lane 14, L. johnsonii NCC 533; lane 15, L. johnsonii NCC 1b; lane 16, L. johnsonii NCC 1c; lane 17, L. johnsonii NCC 1627; lane M contains the molecular size marker 1-kb DNA ladder (Gibco-BRL). In panel b, the arrow denotes the cutting level for separation clusters.

sis was carried out with the CHEF DR II apparatus (BioRad, UK) in 1% PFGE certi¢ed agarose (Bio-Rad, UK) with 0.5UTBE bu¡er. The pulse time was 1^6 s, current was 6 V cm31 , temperature was 14‡C, and the running time was overall 22 h. The agarose gel was stained with ethidium bromide (0.5 Wg ml31 ) and visualized under UV light at 254 nm.

2.7. Data analysis All achieved results from the various applied methods (ERIC-PCR, REP-PCR, AFLP, TAP-PCR and PFGE) were analyzed with the GelCompare software (Applied Maths, Belgium). The overall achievable patterns were used to construct dendrograms using the UPGMA (un-

FEMSLE 10736 29-11-02

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

147

Table 3 Bacterial identi¢cation by PCR method and grouping of L. johnsonii strains according to the overall combination of all achievable typing resultsa Group and strain

Species-speci¢c primer Genotype by: identi¢cation

Origin

ERIC-PCR type

REP-PCR type

AFLP type

TAP-PCR type

PFGE type

johnsonii johnsonii johnsonii johnsonii johnsonii johnsonii johnsonii johnsonii johnsonii johnsonii

E1 E1 E1 E1 E1 E1 E1 E1 E1 E1

R1 R1 R1 R1 R1 R1 R1 R1 R1 R1

A1 A1 A1 A1 A1 A1 A1 A1 A1 A1

C1 C1 C1 C1 C1 C1 C1 C1 C2 C2

P1 P1 P1 P1 P1 P1 P1 P1 P2 P3

Human feces Human feces Human feces Human feces Human feces Human feces Human feces Sour milk Unknown Human feces

L. johnsonii

E2

R2

A2

C2

P2

Unknown

L. johnsonii

E3

R3

A3

C1

P4

Cheese

L. johnsonii

E4

R1

A4

C2

P5

Mouse feces

L. johnsonii L. johnsonii L. johnsonii

E6 E1 E5

R4 R1 R1

A5 A6 A7

C1 C1 C1

P6 P7 P8

Human blood Pig feces Unknown

b

Group I L. johnsonii NCC 1669 L. johnsonii NCC 1657 L. johnsonii NCC 533 L. johnsonii NCC 1b L. johnsonii NCC 1c L. johnsonii NCC 1717 L. johnsonii NCC 1646 L. johnsonii DSM 20553 L. johnsonii ATCC 332 L. johnsonii NCC 1741 Group II L. johnsonii ATCC 11506 Group III L. johnsonii NCC 1703 Group IV L. johnsonii JCM 8791 Ungrouped strains L. johnsonii ATCC 33200T L. johnsonii JCM 8793 L. johnsonii NCC 1627 a b

L. L. L. L. L. L. L. L. L. L.

Types were determined by ERIC-PCR, REP-PCR, AFLP, PFGE, and TAP-PCR. Groups are based on linkage in the same cluster or are designed to the same cluster by at least three genotypical methods.

weighted pair group method using arithmetic averages) clustering algorithm.

3. Results 3.1. Species-speci¢c identi¢cation of L. johnsonii strains The analysis of the 16S rDNA sequence of the L. johnsonii type strain (ATCC 33200) indicated that this strain is closely related to L. gasseri DSM 20243. Based on the analysis of both 16S rDNA sequences, one PCR primer (LJ1) was designed for the speci¢c detection of all L. johnsonii strains. The oligonucleotide LJ1 targeting position 42 of the type strain 16S rDNA sequence (accession number: AJ002515) was coupled with the oligonucleotide P6 targeting a common region of eubacteria 16S rDNA sequences [28]. Moreover, due to the often occurring variability in PCR conditions the missing of any amplicons should be attributed not only to the absence of any DNA target but also to an overall failure of the ampli¢cation reaction. In order to distinguish between these events, we included in the same reaction a pair of primers P6 and 338r targeting conserved regions in the 16S rDNA sequences of eubacteria (Fig. 1b). When Multiplex-PCR was performed with a mixture of these three primers two products of 1471 and 1192 bp were detected only in the presence of DNA isolated from L. johnsonii strains. The ampli¢cation of other LAB species resulted in only one amplicon of

1471 bp. The results of PCR assays with L. johnsonii species-speci¢c primers are depicted in Fig. 1a. We identi¢ed 16 L. johnsonii strains originally isolated from di¡erent environments (Table 1) which were analyzed with di¡erent molecular typing tools. All 16 strains resulted in Sau3AI and DraI 16S rDNA restriction pro¢les typical for the species L. johnsonii [7], con¢rming all results achieved using the here described species-speci¢c PCR primers for the identi¢cation of L. johnsonii. 3.2. ERIC-PCR and REP-PCR analysis ERIC-PCR for all investigated L. johnsonii strains generated multiple DNA fragments ranging from 4.072 kb to less than 0.298 kb with various intensities (Fig. 2). A common intensive band of about 260 bp could be identi¢ed in all investigated L. johnsonii isolates (whereas only a weak signal was detectable for L. gasseri DSM 20243T, L. gasseri ATCC 19992 and L. gasseri DSM 20077 (data not shown)). These 16 isolates were grouped into six di¡erent groups with clearly distinguishable ERIC-PCR patterns, designated as E1^E6 (Table 3). Since all generated DNA patterns are relatively complex, they were analyzed using a computer program for comparative analysis of DNA patterns (GelCompare software). The strain relationship among all tested strains was calculated based on the UPGMA analysis and the resulting dendrogram is presented in Fig. 2b. The cluster E1 includes 11 strains, while the remaining groups E2^E6 harbor the other ¢ve isolates.

FEMSLE 10736 29-11-02

148

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

Fig. 3. REP-PCR pro¢les of Lactobacillus strains (a); dendrograms representing genetic relationships among L. johnsonii strains based on REP-PCR ¢ngerprints (b). a: Lane 1, L. gasseri NCC 30604; lane 2, L. johnsonii NCC 1741 ; lane 3, L. johnsonii NCC 1b; lane 4, L. johnsonii NCC 533; lane 5, L. johnsonii NCC 1c; lane 6, L. johnsonii JCM 8793; lane 7, L. johnsonii NCC 1669 ; lane 8, L. gasseri DSM 20243 ; lane 9, L. johnsonii NCC 1646; lane 10, L. johnsonii NCC 1717; lane 11, L. johnsonii NCC 1703; lane 12, L. johnsonii JCM 8791 ; lane 13, L. johnsonii DSM 20553; lane 14, L. johnsonii ATCC 332; lane 15, L. johnsonii NCC 1657; lane 16, L. johnsonii ATCC 33200 ; lane 17, L. johnsonii NCC1627; lane 18, L. johnsonii ATCC 11506 ; lane M contains the molecular size marker 1-kb DNA ladder (Gibco-BRL). In panel b, the arrow denotes the cutting level for separation clusters.

FEMSLE 10736 29-11-02

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

149

Fig. 4. Chromosomal AFLP patterns of L. johnsonii and L. gasseri strains (a); dendrograms representing genetic relationships among L. johnsonii strains based on AFLP ¢ngerprints (b). a: Lane M contains the molecular size marker 50-bp DNA ladder (Gibco-BRL); lane 1, E. coli K12; lane 2, L. johnsonii NCC 1627; lane 3, L. gasseri DSM 20243; lanes 4^7: NCC 1c, NCC 1b, NCC 533, NCC 1703, respectively ; lane 8, L. gasseri NCC 30604 ; lane 9^ 19: JCM 8791, NCC 1741, JCM 8793, NCC 1717, NCC 1646, NCC 1657, ATCC 11506, NCC 1669, DSM 20553, ATCC 332, ATCC 33200, respectively. In panel b, the arrow denotes the cutting level for separation clusters.

Within group E1 further ERIC-PCR pro¢les were observable with a variable genetic similarity value. This second level of clustering suggested as well that a remarkable polymorphism exists among all strains in these two

groups. In cluster E1 only very few strains (NCC 1669, NCC 1657, NCC 1717, NCC 1b, NCC 1c) yielded ERICPCR patterns with di¡erences in only one or two bands. As a control step, ERIC-PCR was also performed using

FEMSLE 10736 29-11-02

150

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

FEMSLE 10736 29-11-02

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

151

Fig. 6. PFGE analysis of L. johnsonii strains as determined with restriction enzyme SmaI. Lane 1, L. johnsonii ATCC 33200; lane 2, L. johnsonii DSM 20553 ; lane 3, L. johnsonii ATCC 11506 ; lane 4, L. johnsonii ATCC 332; lane 5, L. johnsonii NCC 1627; lane 6, L. johnsonii NCC 1669; lane 7, L. johnsonii NCC 1657; lane 8, L. johnsonii NCC 1741 ; lane 9, L. johnsonii NCC 1703; lane 10, L. johnsonii JCM 8791; lane 11, L. johnsonii NCC 533; lane 12, L. johnsonii NCC 1717; lane 13, L. johnsonii NCC 1c; lane 14, L. johnsonii NCC 1646; lane 15, L. johnsonii NCC 1b; lane 16, L. johnsonii JCM 8793.

genomic DNA isolated from various type strains of other LAB (Table 1). The used REP primer pair generated in total 2^11 fragments of about the size of 300^5000 bp (Fig. 3). One dominating detectable band of about 1200 bp could be identi¢ed in all strains (except for L. johnsonii ATCC 11506) belonging to Johnson’s B complex. Overall, the REP ampli¢cation patterns were less complicated than those generated by ERIC-PCR. A computer analysis of the REP pro¢les generated only four groups, i.e. R1^R4 (Table 3). The type strain of L. johnsonii ATCC 33200 is once again grouped separately while the groups R1 contain 13 strains, while only one strain had a unique pattern.

Since ERIC and REP elements were originally identi¢ed in Escherichia coli and enterobacteria, we tested primers based on these repetitive element sequences at di¡erent annealing temperatures. For all L. johnsonii strains genomic DNA was extracted at various and independent occasions and was subjected to PCR for di¡erent time lengths and applying di¡erent thermal cyclers. For each individual strain the ERIC-PCR and REP-PCR patterns obtained with these di¡erent and independent PCR approaches were constantly reproducible regardless of above described variable parameters.

6 Fig. 5. TAP-PCR-generated ¢ngerprints of L. johnsonii and L. gasseri strains obtained with annealing temperatures of 42‡C (a) and 38‡C (b); dendrograms representing genetic relationships among L. johnsonii strains based on TAP-PCR ¢ngerprints are depicted in panel c. a: Lane M contains the molecular size marker 1-kb DNA ladder (Gibco-BRL) ; lane 1, L. gasseri NCC 30604; lanes 2^7, L. johnsonii NCC 1741, NCC 533, NCC 1b, NCC 1c, JCM 8793, NCC 1669, respectively; lane 7, L. gasseri DSM 20243 ; lane 8^19: NCC 1646, NCC 1717, NCC 1703, JCM 8791, DSM 20553, ATCC 332, NCC 1657, ATCC 332, ATCC 33200, NCC 1627, ATCC 11506, respectively. b: lane M contains the molecular size marker 1-kb DNA ladder (GibcoBRL) ; lane 1, L. gasseri NCC 30604; lanes 2^7, L. johnsonii NCC 1741, NCC 533, NCC 1b, NCC 1c, JCM 8793, NCC 1669, respectively; lane 7, L. gasseri DSM 20243; lanes 8^18: NCC 1646, NCC 1717, NCC 1703, JCM 8791, DSM 20553, ATCC 332, NCC 1657, ATCC 33200, ATCC 11506, NCC 1627, respectively. In panel c, the arrow denotes the cutting level for separation clusters.

FEMSLE 10736 29-11-02

152

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

3.3. AFLP analysis The digestion of chromosomal DNA of lactobacilli strains listed in Table 1 was performed using the two restriction enzymes EcoRI and MseI. The low G+C (mol%) content of L. johnsonii (33.1^34.8% [3]) permitted the feasibility of such a typing approach. AFLP patterns of all tested L. johnsonii strains yielded fragments of approximately 200^1000 bp and resulted in about 20 well separated bands (Fig. 4). These AFLP dendrograms are grouped into seven main clusters, namely A1^A7. The linkage levels of AFLP clusters ranged from 82% to 46% (data not shown). The strain compositions of each group corresponded well to those already established with the ERIC-PCR method, with the single exception of strain JCM 8793 (Table 3). It was not possible to detect any AFLP fragment being typical for the species L. johnsonii. When all these AFLP typing trials were repeated only small variations in their overall background intensities were observed. However, after normalization and subtraction of the occurring background values the similarity levels for all L. johnsonii strains generated by UPGMA analysis for di¡erent gels were in about the same range (90^ 96%). 3.4. TAP-PCR analysis The TAP-PCR ampli¢cation method, encompassing triplicate reactions assayed at three di¡erent annealing temperatures, was used to ¢ngerprint L. johnsonii strains. Approximately six to eight PCR fragments were observed with sizes varying from 200 to 1600 bp (Fig. 5). These ampli¢cation patterns generated with the primers P32-A and P32-T do not show a large complexity and subsequent computer analysis demonstrated that all L. johnsonii strains could be in fact grouped in only two clusters. A rather dominating C1 cluster contains 12 strains while cluster C2 is consisting of only four strains (Table 3). The results of this TAP-PCR for the tested L. johnsonii strains demonstrated a remaining change due to the respectively applied annealing temperature (range from 38‡C to 42‡C), but did not a¡ect the overall resulting PCR amplicon pro¢les. The ampli¢cation of only a few PCR fragments ceased following minor changes in the annealing temperature. 3.5. PFGE analysis L. johnsonii genomic DNA digested with SmaI yielded fragments of approximately 9.4^291 kb (Fig. 6). According to the number and the size of the fragments we could distinguish eight di¡erent genomic ¢ngerprints for all L. johnsonii strains, namely P1^P8 (Table 3). The strain composition of each group is listed in Table 3 and they are in good accordance with those achievable with the other typing tools. L. johnsonii ATCC 332 and ATCC 11506 had

identical SmaI PFGE pro¢les. Another group with very similar SmaI PFGE patterns contained L. johnsonii NCC 1669, NCC 1657, NCC 1646 and NCC 533, while the SmaI pro¢les of L. johnsonii DSM 20553, NCC 1b, NCC 1717 and NCC 1c could not be distinguished from each other, but nevertheless di¡ered from those of the previous group by only one extra band, respectively. All the other SmaI PFGE pro¢les of the remaining L. johnsonii strains were unique. 3.6. Combination of achieved typing results All genotypical groups depicted in Table 3 are deduced from the UPGMA analysis by using the same cutting level for separation clusters (at a genetical similarity level of 80%). All combined typing results (Table 3) demonstrated that four strain clusters (Group I to Group IV) are clearly distinguishable and that all those strains within each individual group are more similar to each other than to the remaining strains. Highest homogeneity levels with regard to their environmental origin and genotypical traits could be demonstrated for those strains clustered in Group I (NCC 1669, NCC 1657, NCC 533, NCC 1b, NCC 1c, NCC 1717, NCC 1646). Nevertheless, typing results with TAP-PCR and PFGE were not identical for two strains (ATCC 332, NCC 1741) in this group. The remaining three clusters (Group II, Group III and Group IV) each consisted of only one individual strain. Furthermore, only three strains failed to be clustered to one of the above de¢ned four groups, including the type strain of L. johnsonii. Within each of the four groups a further detailed di¡erentiation could be established at a much higher genetic similarity level.

4. Discussion The sequencing and analysis of the 16S and 23S rRNA genes are considered as one of the cornerstones of modern microbial taxonomy. These sequences are used to de¢ne species-speci¢c and genus-speci¢c PCR primers for a rapid detection of LAB. Moreover, in recent years, several rapid methods for the detection and identi¢cation of lactobacilli have been developed [7,9^11,13,14,27,30]. Traditional microbiological assays for the identi¢cation of Lactobacillus species are very often time-consuming and can yield rather variable results. We established a molecular identi¢cation tool for L. johnsonii, based on PCR primers targeting the 16S rRNA gene. We adapted this technique to all L. johnsonii strains listed in Table 1 and to various other LAB. The primers LJ1 and P6 allowed a very speci¢c ampli¢cation for the species L. johnsonii, but not for any other Lactobacillus, Bi¢dobacterium or Streptococcus strains reported in Table 1 (see also Fig. 1). Moreover, this primer pair allowed the rapid discrimination of L. johnsonii strains

FEMSLE 10736 29-11-02

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

from closely related L. gasseri strains. This demonstrated that for some very closely related species (e.g. L. johnsonii and L. gasseri) a reliable and con¢rmative identi¢cation by traditional biochemical tests should always be supplemented by at least one molecular ¢ngerprinting method. For any a⁄rmative identi¢cation at the species level, molecular methods require extremely conserved genes, present preferably in large copy-numbers within each individual bacterial cell (e.g. rRNA genes) and techniques (e.g. PCR employing species-speci¢c primers) being able to distinguish between isolates with minimal genetic di¡erences (e.g. a one-base substitution in the 16S rDNA sequence). In this study we assessed the suitability of two additional PCR-based methods not extensively applied for lactobacilli so far: ERIC-PCR and REP-PCR for a very rapid and highly reliable characterization of L. johnsonii isolates at their strain level. We also applied two additional molecular ¢ngerprinting methods (PFGE and TAP-PCR) to investigate di¡erent levels of genetic di¡erences, previously evaluated in the molecular typing of LAB [22,34]. In addition, a rather novel high-resolution genomic ¢ngerprinting method (AFLP) was additionally applied to validate all achieved results. This method was recently con¢rmed to be a powerful tool for the delineation of strain related beyond the species level for several bacterial genera [20]. A convincing ¢nding in our study was the possible classi¢cation of most investigated strains into four individual groups that were highly similar based on achievable results with at least three molecular ¢ngerprinting methods (Table 3). A likely explanation could be envisaged in their common clonal origin. All human fecal isolates were mainly clustered within the same genetical group (Group I) with all ¢ve molecular ¢ngerprinting methods applied. Furthermore, Table 3 summarizes that some L. johnsonii strains were typed as belonging to the same genotype group with all ¢ve methods, which must be considered as a very reliable identi¢cation. As it is depicted in Table 3 not all typing methods resulted in the same genotype grouping since they investigate di¡erent genotypical traits. The sensibilities of these di¡erent applied typing tools are highly di¡erent. In fact, PFGE denotes mainly large di¡erences in the genome sizes due to the presence of large insertion or deletion, but nevertheless a point mutation a¡ecting a restriction site may result in a di¡erent PFGE pro¢le. Therefore, PFGE is as well suited to display small di¡erences as AFLP with the increasing number of applied restriction enzymes. Moreover, the comparison of the patterns generated by applying PCR typing techniques (ERIC-, REP- and TAP-PCR) consisted in di¡erences in sizes due to their presence or absence of the DNA sequence target by the employed primers. In addition, these techniques generated relative small amplicons allowing an easy detection of small nucleotide insertion or deletion. Our results suggest that a more than adequate level of

153

discrimination among L. johnsonii strains can be achieved by using an adapted combination of the here described typing tools. According to other authors [14,20], the distinctive position for the type strain L. johnsonii ATCC 33200 could be con¢rmed and resulted from a molecular ¢ngerprinting point of view rather separated from all other L. johnsonii strains. This rather atypical genotype of the L. johnsonii type strain could also be con¢rmed with other molecular typing tools in this work. A potential explanation might be linked to its atypical origin (i.e. isolated from blood) while all other remaining L. johnsonii strains have in most cases a strictly intestinal or dairy-food origin. For any bacterial strain assumed to be involved in colonizing the gastrointestinal tract of humans and/or animals and demonstrating any positive traits, it is extremely important to possess a wide range of powerful molecular ¢ngerprinting, identi¢cation and monitoring tools able to adequately characterize all these strains. So far, only one publication reported the tracing and detection of one speci¢c L. gasseri strain by PCR [32]. The applied strain-speci¢c primers targeted a gene encoding one surface protein. Therefore, the achieved typing results con¢rmed through various identical genotypical traits in all investigated L. johnsonii strains from di¡erent environments that a common clonal origin could be a very likely explanation. In many Lactobacillus studies, PFGE has been shown to be a very powerful method for strain typing [18,33] and is therefore frequently as well used in epidemiological studies [34]. However, it is a laborious and expensive method, with only a limited number of samples to be analyzed at the same time. All electrophoresis-based methods (e.g. AFLP) used for molecular typing are also often time-consuming, require a good experimental experience, a strict standardization and are not likely to be performed in routine analysis in a standard microbiology laboratory. Our results suggest that PCR ¢ngerprinting methods such as ERIC-PCR, REP-PCR and TAP-PCR are of more utility due to their rapid and easy performance. Even ERIC- and REP-PCR are all primarily typing methods, also they have the potential to give species-speci¢c information. Furthermore, ERIC- and REP-PCR have speci¢c advantages compared to other molecular ¢ngerprinting methods. In comparison to ribotyping [19], both of these techniques analyze the complete bacterial genome and not just one individual gene region. This might be overall more advantageous because the interpretation power of rRNA-based data (i.e. the use of one single gene or operon) in molecular typing analysis appears sometimes to be questionable [12,31]. Future studies will deal with the identi¢cation of species-speci¢c and strain-speci¢c di¡erences between L. johnsonii and closely related species (e.g. L. gasseri and L. acidophilus) by using the DNA/DNA hybridization microarrays approach.

FEMSLE 10736 29-11-02

154

M. Ventura, R. Zink / FEMS Microbiology Letters 217 (2002) 141^154

References [17] [1] Kandler, O. and Weiss, N. (1986) Genus Lactobacillus. In: Bergey’s Manual of Systematic Bacteriology, Vol. 2 (Sneath, P.H.A., Mair, N.S., Sharp, M.E. and Holt, J.G., Eds.), pp. 1209^1234. William and Wilkins, Baltimore, MD. [2] Klein, G., Pack, A., Bonaparte, C. and Reuter, G. (1998) Taxonomy and physiology of probiotic lactic acid bacteria. Int. J. Food Microbiol. 41, 103^125. [3] Fujishawa, T., Benno, Y., Yaeshima, T. and Mitsuoka, T. (1992) Taxonomic study of the Lactobacillus acidophilus Group, with recognition of Lactobacillus gallinarum sp nov. and Lactobacillus johnsonii sp nov. and synonymy of Lactobacillus acidophilus Group A3 (Johnson et al., 1980) with the type-strain of Lactobacillus amylovorus (Nakamura 1981). Int. J. Syst. Bacteriol. 42, 487^491. [4] Johnson, J.L., Phelps, C.F., Cummins, C.S., London, J. and Gasser, F. (1980) Taxonomy of the Lactobacillus acidophilus group. Int. J. Syst. Bacteriol. 30, 53^68. [5] Lauer, E., Helming, C. and Kandler, O. (1980) Heterogeneity of the species Lactobacillus acidophilus (Moro, Hansen and Moquot) as revealed by biochemical characteristics and DNA^DNA hybridisation. Zbl. Bakt. Hyg. 1, 150^168. [6] Schleifer, K.H. and Ludwig, W. (1995) Phylogeny of the genus Lactobacillus and related genera. Syst. Appl. Microbiol. 18, 461^467. [7] Ventura, M., Casas, I., Morelli, L. and Callegari, L. (2000) Rapid ampli¢ed ribosomal DNA restriction analysis (ARDRA) identi¢cation of Lactobacillus spp. isolated from faecal and vaginal samples. Syst. Appl. Microbiol. 23, 504^509. [8] Nour, M. (1998) 16S^23S and 23S^5S intergenic spacer regions of lactobacilli : nucleotide sequence, secondary structure and comparative analysis. Res. Microbiol. 149, 433^448. [9] Walter, J., Tannock, G.W., Tilsala-Timisjarvi, A., Rodtong, A., Loach, D.M., Munro, K. and Alatossava, T. (2000) Detection and identi¢cation of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-speci¢c PCR primers. Appl. Environ. Microbiol. 66, 297^303. [10] Pot, B., Hertel, C., Ludwig, W., Descheemaeker, P., Kersters, K. and Schleifer, K.H. (1993) Identi¢cation and classi¢cation of Lactobacillus acidophilus, L. gasseri and L. johnsonii strains by SDS^PAGE and rRNA target oligonucleotide probe hybridisation. J. Gen. Microbiol. 139, 513^517. [11] Kullen, M.J., Sanozky-Dawes, R.B., Crowell, D.C. and Klaenhammer, T.R. (2000) Use of the DNA sequence of variable regions of the 16S rRNA for rapid and accurate identi¢cation of bacteria in the Lactobacillus acidophilus complex. J. Appl. Microbiol. 89, 511^516. [12] Tannock, G.W., Tilsala-Timisjarvi, A., Rodtong, S., Ng, J., Munro, K. and Alatossava, T. (1999) Identi¢cation of Lactobacillus isolates from the gastrointestinal tract, silage, and yoghurt by 16S^23S rRNA gene intergenic spacer region sequence comparison. Appl. Environ. Microbiol. 65, 4264^4276. [13] Du Plessis, E.M. and Dicks, L.M.T. (1995) Evaluation of random ampli¢ed polymorphic DNA (RAPD)-PCR as a method to di¡erentiate Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus amylovorus, Lactobacillus gallinarum, Lactobacillus gasseri and Lactobacillus johnsonii. Curr. Microbiol. 31, 114^118. [14] Roy, D., Ward, P., Vincent, D. and Mondou, F. (2000) Molecular identi¢cation of potentially probiotic lactobacilli. Curr. Microbiol. 40, 40^46. [15] Felley, C.P., Corthesy-Theulaz, I., Rivero, J.R., Sipponen, P., Kaufmann, M., Bauerfeind, P., Wiesel, P.H., Brassart, D., Pfeifer, A., Blum, A.L. and Michetti, L. (2001) Favourable e¡ect of an acidi¢ed milk (LC-1) on Helicobacter gastritis in man. Eur. J. Gastroenterol. Hepatol. 13, 25^29. [16] Granato, D., Perotti, F., Masserey, I., Rouvet, M., Golliard, M., Servin, A. and Brassart, D. (1999) Cell surface-associated lipoteichoic acid acts as an adhesion factor for attachment of Lactobacillus john-

[18]

[19] [20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

sonii La1 to human enterocytelike caco-2 cells. Appl. Environ. Microbiol. 65, 1071^1077. Marteau, P., Vaerman, J.P., Dehennin, J.P., Bord, S., Brassart, D., Pochart Desjeux, J.F. and Rambaud, J.D. (1997) E¡ects of intrajejunal perfusion and chronic ingestion of Lactobacillus johnsonii strain La1 on serum concentrations jejunal secretions of immunoglobulins and serum proteins in healthy humans. Gastroenterol. Clin. Biol. 21, 293^298. Busse, H.J., Denner, E.B.M. and Lubitz, W. (1996) Classi¢cation and identi¢cation of bacteria-current approaches to an old problem ^ overview of methods used in bacterial systematics. J. Biotechnol. 47, 3^38. Rodtong, S. and Tannock, G.W. (1993) Di¡erentiation of Lactobacillus strains by ribotyping. Appl. Environ. Microbiol. 59, 3480^3484. Gancheva, A., Pot, B., Vanhonacker, K., Hoste, B. and Kersters, K. (1999) A polyphasic approach towards the identi¢cation of strains belonging to Lactobacillus acidophilus and related species. Syst. Appl. Microbiol. 22, 573^585. William, J.D., Kubelik, A.R., Livak, K., Rafalski, J.A. and Tingey, S.V. (1990) DNA polymorphisms ampli¢ed by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531^6535. Cusick, S.M. and O’Sullivan, D.J. (2000) Use of a single, triplicate arbitrarily primed-PCR procedure for molecular ¢ngerprinting of lactic acid bacteria. Appl. Environ. Microbiol. 66, 2227^2231. Appuhamy, S., Coote, J.C., Low, J.C. and Parton, R. (1998) PCR methods for rapid identi¢cation and characterization of Actinobacillus seminis strains. J. Clin. Microbiol. 36, 814^817. Jersek, B., Gilot, B., Gubina, M., Klun, N., Mehle, J., Tcherneva, E., Rijpens, N. and Herman, L. (1999) Typing of Listeria monocytogenes strains by repetitive element sequence-based PCR. J. Clin. Microbiol. 37, 103^109. Kerouanton, A., Brisabois, A., Grout, J. and Picard, B. (1996) Molecular epidemiological tools for Salmonella Dublin typing. FEMS Immunol. Med. Microbiol. 14, 25^29. Versalovic, J., Koeuth, T. and Lupski, J.R. (1991) Distribution of repetitive DNA sequences in eubacteria and application to ¢ngerprinting of bacterial genomes. Nucleic Acids Res. 19, 6823^6831. Zhong, W., Millisap, K., Bialkowska-Hobrzanska, H. and Reid, G. (1998) Di¡erentiation of Lactobacillus species by molecular typing. Appl. Environ. Microbiol. 64, 2418^2423. Di Cello, F.P. and Fani, R. (1996) A molecular strategy for the study of natural bacterial communities by PCR-based techniques. Minerva Biotecnol. 8, 126^134. Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Freijters, A., Pot, J., Peleman, J., Kuiper, M. and Zabeau, M. (1995) AFLP: a new concept for DNA ¢ngerprinting. Nucleic Acids Res. 21, 4407^4414. Tilsala-Timisijarvi, B.A. and Alatossava, T. (1997) Development of oligonucleotide primers from the 16^23S rRNA intergenic sequences for identifying di¡erent dairy and probiotic lactic acid bacteria by PCR. Int. J. Food Microbiol. 35, 49^56. Waterhouse, R.N. and Glover, L.A. (1993) Di¡erences in the hybridisation pattern of Bacillus subtilis genes coding for rRNA depend on the method of DNA preparation. Appl. Environ. Microbiol. 59, 919^ 921. Lucchini, F., Kmet, V., Cesena, C., Coppi, L.V. and Morelli, L. (1998) Speci¢c detection of a probiotic Lactobacillus strain in faecal samples by using multiplex PCR. FEMS Microbiol. Lett. 158, 273^ 278. Roussel, Y., Colmin, C., Simonet, J.M. and Decaris, B. (1993) Strain characterization, genome size and plasmid content in the L. acidophilus group. J. Appl. Bacteriol. 74, 549^556. Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H. and Swaminathan, B. (1995) Interpreting chromosomal DNA restriction patterns produced by pulsed-¢eld gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33, 2233^2239.

FEMSLE 10736 29-11-02