Specific in vitro transcription of the insertion sequence IS2

J. Mol. Biol. (1983) 169, 53-81

S p e c i f i c in V i t r o T r a n s c r i p t i o n

of the Insertion

Sequence

IS2

DEBORAH M. HINTON~ AND RICHARD E. Mtrs~o~

Cancer Biology Program National Cancer Institute-Frederick Cancer Research Facility Frederick, M D 21701 U.S.A. (Received 9 September 1982, and in revised form 16 March 1983) The insertion sequence IS2 is a small transposable element of Escherichia coli that lacks any known genetic markers, Insertion of this element in one orientation (I) within bacterial operons blocks expression of downstream genes. In the other orientation (II), IS2 has been associated with the constitutive expression of genes distal to its insertion, suggesting that IS2 might contain promoters directing transcription of IS2(II) into other genes. To test the transcription potential of IS2, we have transcribed in vitro DNA templates from gal3, a Gal- allele in which an IS2(I) is inserted between the gal promoter and the gal genes. We have detected two IS2-specific RNAs which initiate from promoters within IS2 and are transcribed in orientation II (away from the gaIETK genes). Though the presence and orientation of these promoters suggests that they could be responsible for the constitutive expression of genes adjacent to an IS2(II) element, an alternative role could be for transcription of IS2-encoded genes. Although IS2(I) insertions normally block expression of adjacent genes, certain altered (e.g. mutant) IS2(I) sequences lead to the constitutive expression of downstream genes. We have transcribed DNA templates from galW~5and gal~331, which are GaV alleles that contain altered IS2(I) insertions within the gal operon. For each allele, we have detected two gal-directed transcripts initiating within the IS2 sequence. These RNAs are not detected upon transcription of the unaltered IS2(I) DNA and the promoters arise as a direct consequence of the IS2(I) alterations. This result suggests that these promoters detected in vitro are responsible tbr the Gal¢ phenotype of these alleles.

1. I n t r o d u c t i o n The insertion element IS2 is a small transposable element of the bacteria Escherichia coli (for reviews, see Starlinger, 1980; Calos & Miller, 1980; Kleckner, 1981). This 1327 base-pair element lacks a n y known genetic markers b u t occurs in several copies within the E. coli chromosome (Saedler & Heiss, 1973). In addition, it has been isolated as rare mutational insertions at various sites in bacterial and phage operons (Hirsch et al., 1972; F i a n d t et al., 1972;Saedler et al., 1974: A h m e d & Scraba, 1975; Mosharrafa et al., 1976; Pilacinski et al., 1977; Charlier et al., 1978). Present address: National Institutes of Health, Building 4, Room 116, Bethesda, MD 20205, U.S.A. Author to whom reprint requests should be sent. 53 0022-21436/83/250053-29 $03JX~/O ~ 1983 Academic Press |ne. (London) Ltd.

54

D.

M.

HINTON AND I:t. E. MUSSO

Besides its ability to transpose within the genome, the IS2 element can affect the expression of adjacent genes. For example, the IS2 sequence in orientation I contains a r/m-sensitive termination site which blocks transcription of genes downstream from the IS2(I) DNA (de Crombrugghe et al., 1973). Thus, an IS2(I) insertion within an operon is a polar mutation, eliminating the expression of genes distal to its insertion. In contrast, insertions of IS2 in orientation II often result in the constitutive expression of adjacent genes (Saedler et al., 1974; Pilacinski et al., 1977; Walz el al., 1978). Thus, it has been speculated, IS2 may contain a promoter for transcription in orientation II. This interpretation has been questioned, however, since not all IS2(II) insertions show this effect (Charlier et al., 1978; Starlinger, 1980) and since those IS2(II) insertions which show the promoter effects were genetically selected to activate expression of the adjacent genes. In addition, the sequence of IS2 DNA from the insertion mutant galOP-308 : :IS2(I) has no regions which resemble known bacterial promoters (Ghosal et al., 1979). Two plausible explanations for these results are that different copies of IS2 may have different sequences (only some atlelic forms of IS2 have active promoters) or that the novel joint sequences created by integration of IS2(II) at certain sites may serve as promoters. Given the first possibility of IS2 heterogeneity, an analysis of in vivo transcripts from IS2 would suffer from the question of which copy of IS2 DNA served as the template. We have therefore used in vitro transcription to analyze a specific IS2 template derived from the polar mutant galOP-3:: IS2(I) (hereafter called 9a13). Alterations within the IS2(I) sequence may also result in the constitutive expression of adjacent genes (Ghosal & Saedler, 1977; Peterson et al., 1979; Ahmed et al., 1980; Delius et al., 1980; Besemer et al., 1980). Inspection of these IS2(I) alterations in several Galc alleles has revealed that the sequence change is confined to 100 bp~f of DNA at one end of the element (Ghosal & Saedler, I978; Sommer et al., 1979; Ahmed et al., 1980). The mechanism whereby such localized alterations of the polar IS2(I) sequence lead to the constitutive expression of downstream genes is not clear. One could speculate that the sequence changes of IS2(I) generate new promoters that direct transcription into adjacent genes; however, DNA sequence analyses of the altered IS2(I) DNAs have demonstrated only one alteration that generates a sequence similar to a consensus promoter sequence (Sommer et al., 1979). Alternatively, the constitutive phenotype might result from the mutation of a transcription termination site, thus permitting a normally cryptic IS2(I) transcript to extend into the adjacent genes. In fact, the sequence of IS2 does contain a region located approximately 90 bp from the end of the element that resembles some r/m-sensitive termination sites (Ghosal et al., 1979). However, whether this sequence represents a functional site for transcription termination is not known. We have used in vitro transcription to determine whether normal IS2 or altered IS2(I) sequences contain promoters that could be responsible for the constitutive expression of adjacent genes or for transcription of genes within IS2 itself. DNA templates from three gal alleles have been examined (Fig. 1). The Gal- strain t Abbreviation used: bp, base-pair.

IS2 TRANSCRIPTION

55

gal3::IS2(I) (Ahmed & Scraba, 1975) contains an IS2(I) insertion immediately preceding the first gene, galE, of the galactose operon (Ahmed et al., 1980). In gal3, the insertion of this polar IS2(I) sequence reduces the expression of the gal genes to only 1% t h a t of fully induced Gal + (Ahmed & Johansen, 1975). The alleles

gal~331 and galWC5 are unstable Galc r e v e r t a n t s of gal3 whose relative levels of gal expression are 65% and 7 to 20% of fully induced Gal +, respectively (Ahmed & Scraba, 1978; Ahmed & Johansen, 1978). In b o t h these alleles, the IS2(I) sequence change involves additional DNA (54 bp in galWC5, 108 bp in gal¢331) t h a t occurs 66 bp from the IS2-galE junction (Ahmed et al., 1980). DNA sequence analyses have revealed t h a t the e x t r a DNA is derived from a complex duplication of the normal IS2 sequence located between positions - 3 3 and - 7 8 . As in other IS2(I) alterations, sequences resembling known bacterial promoters are not readily discernible in these Gal¢ alleles. In this study, we tested the transcription potential of these altered IS2(I) alleles directly b y transcribing DNA templates from galW¢5 and gal¢331 in vitro. Transcription of templates from the G a l - parent, gal3, has d e m o n s t r a t e d the transcription potential o f an unaltered IS2 and provided a control for the Gal c templates. 2. Materials and M e t h o d s (a) Isolation of DNA restriction fragment8 The plasmid pBRHgal3 contains the DNA between the HindIII sites of gal3 shown in Fig. 1 cloned into the HindIII site of pBR322. The plasmids pBRHgal"¢5 and pBRHgalC331 contain the corresponding DNA fragments from galW¢5 and gate331, respectively (Fig. 1). The construction of these plasmids has been described (Ahmed et al., 1980). Each plasmid was digested with either HindIII or HhaI restriction enzymes using the reaction conditions given by the vendor (Bethesda Research Laboratories, Inc.). The HhaI digestion products were separated by electrophoresis on a 4°/o (w/v) acrylamide gel (40 em long, 0"3 cm thick) run in 1 x TASE (TASE is 40 mM-Tris-aeetate, pH 7"8, 20 mMsodium acetate, 2 mM-Na2EDTA ) for 16 h at 200 V and the DNA detected by staining with methylene blue. The HindIII digestion products were separated by electrophoresis on a 1"5% (w/v) agarose gel (23 cm long, 1"4 cm thick) run in 1 x TASE for 16 h at 30 V and the DNA stained with ethidium bromide. Gel slices containing DNA were placed in dialysis bags and the DNA was eluted by electrophoresis (McDonnell et at., 1977). After concentration and removal of the ethidium bromide by extraction with isobutanol, the DNA was loaded on a DEAE-cellulose column (0"7 cm × 0"8 cm). The column was washed with buffer A (50 mM-Tris • HC1, pH 8-0, 1 mM-EDTA) and 150 mM-NaCl in buffer A. The DNA was eluted by a solution of 1 M-NaCI in buffer A, precipitated with ethanol, dried and stored in water at -20°C. (b) In vitro transcription reactions In vitro transcription reactions were performed and RNA isolated as described (Musso et al., 1977a) using RNA polymerase holoenzyme isolated through step 5 of the procedure of Berg et al. (1971). After formation of a preinitiation complex for l0 min at 37°C (0"05 to 0"1 t~g DNA in 25 to 50iLl of 20 mM-Tris • HCI (pH 8"0), 75 mM-KC1, 5 mM-MgCl2, 0"l mMEDTA, 0-5mM-dithiothreitol, 50t~g bovine serum albumin/ml and 15tLg RNA polymerase/ml) and challenge with heparin (100 t~g/ml) for 2 rain, transcription was started by adding the 5'-NTPs at the concentrations indicated in the Figure legends ([~-3~P]NTPs were obtained from New England Nuclear Corp., unlabeled nucleotides were purchased from P-L Biochemicals, Inc.). Transcription was stopped after 20 min at 37°C and the [a2P]RNA was recovered by extraction with phenol and precipitation with ethanol. The

56

D. M. H I N T O N AND R. E. MUSSO

RNA was resuspended in 0"5 x TBE buft~r (TBE is 89 mM-Tris-borate, pH 8"3, 2-5 mMNa2EDTA) containing 6 M-urea, 0"04% (w/v) bromophenol blue, and 0-04% (w/v) xylene cyanol FF, heated at 70°C for 3 min, and then fractionated by electrophoresis on a polyacrylamide/7 M-urea denaturing gel (37 cm long, 0"2 cm thick) run in 0'5 × TBE for 14 h at 1 l0 V. After detection of the labeled RNA species by autoradiography, the RNAs smaller than 20 bases were eluted by the crush, soak, and spin procedure of Maxam & Gilbert (1977). Larger RNAs were eluted in dialysis bags by electrophoresis for 3 h at 100 V in 5 mM-Tris-acetate (pH 8"0) (McDonnell et al., 1977). Carrier transfer RNA (100~g) was added and the RNA was precipitated in ethanol. (c) Hybridization of R N A to single-stranded D N A Analytical and preparative hybridizations of RNA were performed as described (Musso et al., 1974). Separated strands of AcI857r32S7 (At32) (Fiandt et al., 1972) or ApgalacI85787 (Apgal8) (Feiss et al,, 1972) DNA were prepared and hybridized to labeled RNA in 2 x SSC (SSC is 15 mM-sodium citrate, pH 7"0, 150 mM-NaC1) at 66°C for 4 h, and the R N A - D N A hybrids were collected on nitrocellulose filters (Schleicher and Schuell, Inc.). For analytical hybridizations, the filters were then incubated with pancreatic ribonuclease (Worthington; 20 ~g/ml in 2 × SSC) at 22°C for" 30 min to eliminate any single-stranded RNA. To prepare hybridized RNA for T 1 fingerprinting, the single-stranded RNA on the filters was eliminated by treatment with T l ribonuclease (Calbiochem; 5 units/ml in 2 x SSC) at 22°C for 30 min. Following this treatment, the nuclease T 1 was inactivated with iodoacetate and the RNA was then eluted from the filters by heating in water at 90°C for 3 min. The [32p]RNA was precipitated with ethanol with 100#g tRNA and analyzed as described below. (d) Enzymatic digestion of R N A Two-dimensional fingerprints of the 32p-labeled RNA were generated by standard techniques (Brownlee, 1972): 32p-labeled RNA (plus 100/~g carrier tRNA) was digested at 37°C for 45 min with 15 units T 1 ribonuclease in 6~,1 RNase buffer (20 mM-Tris • HC1, pH 7-5, 1 mM-EDTA). The T~ products were then fractionated on a 2-dimensional system: the first dimension was electrophoresis on Cellogel 250 strips (Kalex Scientific Co.) at pH 3"5, and the second dimension was chromatography on a DEAE-cellulose plate (250 ~m, ceilulose/DEAE, 9:1 from Analtech, Inc.) developed with a l : l ratio of 45 min and 60 min hydrolyzed 3% Homomixture B. The separated T 1 products were eluted from the DEAE-cellulose and analyzed by secondary digestions with pancreatic ribonuclease (2"5 tzg in 5 #l of RNase buffer) of ribonuclease U2 (Calbiochem ; 0"l unit in 5~1 containing 20 mM-sodium acetate, pH 4"8, l mM-EDTA). The secondary products were separated on DE 81 paper (Whatman) by electrophoresis at pH 3"5. The mobilities of these products differed somewhat from earlier published values (Brownlee, 1972; Musso et al., 1974) because of a change in the paper by the manufacturer. To determine the 5' start of a transcript, 32p-labeled RNA (plus 100 ~g carrier tRNA) was digested with nuclease Pz (P-L Biochemicals: 10t~g in 10~l sodium acetate, pH 5-6) (Fujimoto et al., 1974; Johnson & Lazzarini, 1977). The P~ products were separated by 2dimensional chromatography on polyethyleneimine (PEI) thin-layer plates (Brinkmann Instruments, Inc.): the first dimension was a stepwise separation in 0'5, 2"0 and 4"0 N-sodium formate (pH 3-4), and the second dimension was separation in 0"75 M-KH2PO 4 (pH 3"4) (Cashel et al., t969). To determine the 5' penultimate residue, 32P-labeled RNA (plus 100 #g carrier tRNA) was digested with 2 units ribonuclease T 2 (Calbiochem), 0"5~g pancreatic ribonuclease, and 20 units ribonuclease T l in 10#l of 50 mM-ammonium acetate (pH 4'5) (Brownlee, 1972). The T 2 products were separated by electrophoresis on DE 81 paper at pH 1"7. 32p-labeled RNA was treated with phosphatase by the following procedure. The RNA (plus 100/zg carrier tRNA) was incubated with 22 units of calf intestine alkaline phosphatase/ml (Boehringer Mannheim) in RNase buffer for 45rain at 37°C. The phosphatase products were analyzed by paper electrophoresis on DE 81 paper at pH 1-7.

IS2 T R A N S C R I P T I O N

57

3. Results

HhaI and HindIII DNA fragments (shown schematically in Fig. l) spanning the IS2-gaIE junction from the Gal- allele gal3 and the GaV alleles galW¢5 and gal=331 were transcribed in vitro. The [3~-P]RNA transcripts were then fractionated by polyacrylamide gel electrophoresis under denaturing conditions (Fig. 2). Although the three gal alleles yield some common transcripts, the Gal ~ alleles produce novel RNAs. We have used hybridization as well as enzymatic digestions to align the transcription products with their template DNA sequences. The results are described in the text below with supporting data in the Appendix. (a) In vitro transcription of gal3 DNA In vitro transcription of the DNA templates from gal3 yielded one major RNA as well as other minor RNAs. The analyses presented below enable us to assign the major RNA and a minor RNA as transcripts of the IS2 DNA in orientation IT. Another minor RNA is assigned as a gale transcript. Allele

IS2

gale

Transcript Name

Transcript Name

•

H,n d m

gal3

H~oI

I

t I

Major IS2(]I) Minor 1S2(rr}

L

5"-460 ~

-54.0

-6~4 . "

,,

HhaI

H/ndTff

I

+140

r

+430

IS2-gal' ~, I S 2 - g a l

s

galWC5

Hind ~T Hha [

Major IS 2('i'[ )

ga/E

~J'/'////////J~

I

-66

q

Hha , + I40

Hmdm + 430

IS2-gal'

"

•

g a/¢331

5',,,od., ~ 3"

Major IS2(TT)

.... 1 , Hh ,

I

-6'6

IS2-ga/

Hi;d" ÷I4o

+

Ao

Fro. I. ~chematic diagram of the D N A templates from gal3,'gal*C5and gal~331. The IS2(1) insertion in gal3 occurs in the gal operon immediately before the DNA representing the galE mRNA at position + 1 ; HhaI and HindIII restriction sites in galE occur at position + 140 and +430, respectively. The IS2(I) DNA is shown from position - 1 (at the IS2-gatE junction) to - 4 6 0 (at. the HindIII restriction site), (The insertion site of IS2 in gal3 is identical to the independently isolated Gal- strain galOP308: :IS2([): Hirsch et al., 1972: Fiandt et al., 1972.) In galWC5and ga1¢331, DNA insen%s of 54 and 108 bp, respectively, occur between position - 6 6 and - 6 7 of the normal IS2(I) sequence. These inserts arise from a complex duplication of the normal IS2 sequence between position - 3 3 and - 7 8 and result in several direct and inverted repeats. Consequently, the normal IS2 sequence between - 3 3 and - 6 6 is repeated within these inserts and that repeat is shown by the heavy arrows. The locations of the major RNA species (seen in Fig. 2) are shown relative to the DNA templates. The initiation sites and directions of these RNAs were determined by the analyses described in the text and the Appendix.

58

D.

M. H I N T O N

AND

R.

2

:5

E.

MUSSO

RNA

5 0 0 bases - -

400

bases A major I S 2 ( ~ ) minor I S 2(Tr)

IS2-gol 200

bases - IS2

-gal

XC--

go/E

FI(;. 2.

'

IS2 TRANSCRIPTION

59

(i) Major 182(11) transcript The HindIII and HhaI restriction fragments encompassing the IS2(I)-galE junction of gal3 contain 460 and 340 bp of IS2 DNA, respectively (Fig. l). Transcription of the HindIII fragment in vitro gave a major transcript of ,,~400 bases (not shown) while the major RNA species after transcription of the HhaI template was ~ 2 7 5 bases (Fig. 2). This RNA hybridized specifically to the 1 strand of Ar32 and thus contains [$2 sequences but neither A nor gal sequences (Table 1). We designate this transcript as an IS2(II) RNA because it arises from the transcription of IS2 directed away from galE. To align the transcript with the IS2 sequence, RNA from the HhaI template was digested with T1 ribonuclease and analyzed by two-dimensional fingerprinting techniques (Fig. Al(a)). The T l products were further analyzed with pancreatic RNase (Table A1) allowing us to correlate the T 1 products with the IS2 DNA sequence starting 66 bp from the IS2(I)-galE junction. Oligonucleotide T12 (IS2 positions - 6 6 to - 7 2 ) is the farthest upstream T 1 product to correlate with the IS2 sequence. T h e n e x t possible upstream T 1 product, TA (U-C-U-U-A-A-U-A-CTABLE 1

Hybridization of tran~'cripts to DNA In m;tro transcriptt Major IS2(II) RNA (4900 cts/min) galE RNA (2400 cts/min) Major IS2(II) RNA (6680 cts/min) IS2-gal RNA (1500 cts/min)

DNA templates

r ),r32

gal3 HindIII ga~ HindIII gal¢331HhaI gal~331 tthal

61 67 139 217

l ~r32 r hpgal8 l ;tpgal8 1551 179 1024 63

108 68 20 16

290 1200 100 236

Transcripts are named by the designations given in Fig, 2 and the text. The number in parentheses denotes the cts/min of 32p present in each hybridization. :~ DNA templates used [br in vitro transcription are depicted in Fig. 1. In vitro reactions were pertbrmed as described in Materials and Methods using the NTP concentrations given in the legend to Fig. 2, lane 3. The cts/min hybridizing to the various DNAs represent the 3zp cts/min remaining on the nitrocellulose filter after the RNA was hybridized to the separated strands of A DNA listed. The hybridizations were pertbrmed as described in Materials and Methods. ~r32 DNA contains an IS2 insertion within the )" region of ~ (Fiandt et al., 1972). The I strand of ~r32 will hybridize to RNA transcribed from IS2 in orientation II (away from valE). Conversely, the r strand of ~r32 will hybridize to any RNA transcribed in orientation I (toward galE). ~pgal8 (Feiss el al., 1972) contains the galactose operon but does not contain IS2 DNA. The l strand of hpgal8 is transcribed to yield the gal message. Thus, any gale mRNA will hybridize to this strand. Conversely. the r strand of Apgal8 will hybridize to RNA which is antisense to the gal mRNA.

FI(~. 2. RNA species from the HhaI restriction fragments from gal3, gal~"¢5 and gaP331, Autoradiograms show the in vitro transcription products of the HhaI DNA templates from gat3 (lane I ), galW¢5 (lane 2) and gal¢331 (lane 3) after separation on a 50/o polyacrylamide/7 l~l-urea gel. In vitro transcription reactions and product separations were performed as described in Materials and Methods. For lane 1. the following 5'-NTP concentrations were used: 5/~,~I-[a-a2P]UTP (78 Ci/mmol), 10/~,~I-CTP, 50g~I-GTP and 50/~M-ATP: tbr lanes 2 and 3, 10g,~I-[a-a2P]UTP (295Ci/mmol), 50/~I-CTP, 200 g~I-ATP and 200 g,~I-GTP. XC reJ~rs to the position of the marker dye xylene cyanol FF. The locations of RNAs of 500, 400 and 200 bases were determined by running RNAs of known length: these positions are denoted. The RNA products are named according to the designations given in the text. (The level of valE RNA expressed by the gal3 template varied. In other transcription reactions, the level was less than that shown here.)

-100

-180

,

-170

-160

o

•

o

-1~0

io

-120

•

-110

-~0

-80, -70

-00

-50

-40

-310

-20

-10

-1+1

+10

galE(

+20

~

=

.

-

,

IS2-gal', o

" o

v

°

fS2-golo o

. . . . . . . . . . Major IS 2(TT) : Minor I S 2 (if)

o

•

'...... •

°.

•

, ......

~'

5T~]TTAGTA--~CAAL~GGTTACTC~TCAC~AT TTTTC~TCATA.~T TCTGATAGT GAATA,"~TTCACTATA.~CCAACAC~ACCTCTk~GTCCCCCGGTCAGATTATC~TATTCC, GATTACCTC~TTAATAC

~tca~TC~c~G~c~caa~A~c~a~AfcAc~A~t~T~T~ct~`~Trc~`~cc~c~c~c~aa~at~

-100

.

.

.

.

.

.

.

Major I S 2 ( H I

Is2 - g a f , ....... , I S 2 - g a / ,

GTI~TTAGTAG.ACtu~C,A(]ST T/~TC~TCAC~TTTTtT,~ICATAATTC TC~.TAL~ A TC~TA~'~I TCACI.~TC~T TAV.:,ATC~V~T%TC~TCATMT TCTGAT/~TGAAT~TTCACTAT/~£CAACAGACC TCI~J'~ICCCCCC, GTCAC:,ATTATSGTATTCG(1ATT~CCTC~TT,~AT~

CATCMTCAETGTETCC~I~CTAaTCTAA~I;INTATT~~' b~CTAE~TIATII~I~T~STCTT~T~TNTTTTT~.£~A~T~r.~A~A~TA~IT~IAIIc~T~EI~TTC~.`~C~ET~I~.~GCCTM~c~.~r~T~A~

-140

-150

g a l wc5

gel3

.

.

.

.

.

.

.

Major I S 2 (rt)

golC55/

FI(:. 3. DNA sequences at the IS2-gaIE junctions of qal3, galW~5 and ya1¢331. Positions + 1 through +29 represent galE sequence (Musso el al., 1974; Ahmed et al., 1980): negative numbers designate IS2 DNA (Ahmed et al.. 1980). The 54 bp and 108 bp inserts in gal~¢5 and gal:331, respectively, are indicated by the brackets above and below the sequence. These inserts generate several repeats which are shown by the arrows (continuous arrows, direct repeats; broken arrows, inverted repeats). The positions of transcripts from these DNAs are designated by wavy lines. These RNAs were characterized by the analyses described in the text and the Appendix. Sequence hyphens have been omitted ibr clarity.

.

G[A6TT~T~ ACP~AGGTT~I~TCAI~TTTTIT~TCAThAT TCTGAT~(ChATAAM)CA(:TATCAGAATTAT~TC/W~ATCT~ TCATAATTCTGATAGTCC~T1 TATTCACTATCAGAAT TATGATC~TCTE%CATAATTCTGA TAGTGAATAAAITCACTAT/~ACCMCAGASC TCTAAGTCCCCCGGTCAC~TTATGGTATTCGGATT~CTC~ TTMTAC

CATCMEA~Ci Gll CTCCMT~CTAbT~TP~'~WET~TATT~C~ATC~ l IAT'~TMGISAIA6TC TTMTAC~T TTTT~CT~TATT~CTAfC~'~TA,4ATMGT~T~TCI TAAT~TAGTTT~TAGACTAGT~TTM~C TA~CACT[ATTT~GT~TATT(~GTTGTCTG~TTCAGGGG~CAGTCTMT~CAT~CCTMTC~G~,~TTAT5

-20~

IS2 TRANSCRIPTION

61

U-A-Gp), that would arise from transcription of positions - 5 4 through - 6 5 was not detected. Thus, the start of the major IS2(II) transcript lies within this region. In order to determine the starting nucleoside triphosphate of the transcript, the major RNA labeled with all four (a-32P)-labeled NTPs was digested with P1 ribonuclease, an enzyme that cleaves to yield pppN from the 5' end of an RNA. Since radioactive ATP was observed (Fig. A2), the 5' end of the major IS2(II) transcript corresponds to one of the A residues in the oligonucleotide TA (positions - 6 4 , - 6 1 , - 5 9 or -58). The start was assigned to position - 6 4 by analyses of short RNAs transcribed from the HhaI fragment in the presence of [a-32P]UTP (Fig. A3). The results of these analyses (Table A2) are consistent with the 5' end of the major IS2(II) RNA being pppA-G-U-U-U . . . . starting 64 bp from the IS2-galE junction (Fig. 3). (ii) Minor IS2(II) transcript Transcription of the HhaI fragment from gal3 also gave a minor RNA species migrating slightly faster than the major IS2(II) RNA (Fig. 2). The TI fingerprint of this RNA (Fig. Al(b)) is identical to that of the major IS2(II) RNA except for the absence of the T 1 oligomers T9 and T12. Furthermore, secondary analysis of the product T7 revealed that the oligomer T7a was also missing (Table A1). Thus, the minor transcript must initiate downstream of the start of the T7a (position -78). To locate the 5' terminus more precisely, T 1 products from [a-32P]ATPlabeled RNA were analyzed (Table A1) demonstrating the presence of product T27a (positions - 8 7 through -91). Finally, P1 digestion of t h e RNA labeled with all four [~-32P]NTPs yielded the radioactive product GTP (not shown). Thus, the start of the minor IS2(II) RNA is designated as one (or more) of the three G residues located as positions - 8 3 , - 8 4 and - 8 6 (Fig. 3). This initiation site lies ~ 2 0 bp downstream from the start of the major IS2(II) transcript. (iii) galE transcript A second minor RNA species produced by the gal3 templates was determined to arise by transcription of the galE gene. Hybridization analyses (Table 1) indicate that this RNA contains galE sequences but does not anneal to 2 or IS2 DNA. To locate the start of this gal RNA, a T 1 fingerprint of the [a-23P]UTPlabeled transcript was compared to a TI map of galE messenger RNA (Fig. A4(a) and (b)). Correlation of the T 1 products with the DNA sequence demonstrated that the RNA initiates within the galE message sequence. No oligomers representing the expected T 1 products from either the IS2-galE junction (T2) or positions +11 to +17 (T10) of the gale mRNA were observed (Fig. A4 and Table A3). Since the oligomer T8b (representing positions +23 to +29) was present, the galE RNA from gal3 must start between positions + I1 and ÷22 of the galE message sequence (Fig. 3). (iv) Other transcripts As seen in Figure 2, other minor RNA species were observed after in vitro transcription of the HhaI DNA fragment from gal3. These RNAs, being greater

62

D. M. HINTON AND R. E, MUSSO

than 400 bases in size, were equivalent to or larger than the DNA template itself. Thus, we surmised that these RNAs represent initiation and/or strand-switching by RNA polymerase at the template ends. (b) In vitro transcription of galW'5 a~u/gal*331 DNA Transcription of the HhaI restriction fragments from galWC5and gal¢331 yielded several RNA species (Fig. 2). The major RNAs were determined to include a transcript identical to the major IS2(II) RNA of gal3 and two gal-directed transcripts not observed with the gal3 template. Both of the latter RNAs initiate within the IS2 DNA upstream of galE and, thus, are designated as IS2-gal and IS2-gal' RNAs. (i) Major IS2(I1) tra~script Transcription of the galWC5or gal¢331 HhaI fragments yielded an RNA which comigrated with the major IS2(II) transcript of gal3 (Fig. 2). T 1 fingerprints of [a-32P]UTP-labeled RNA generated from any one of these templates were identical (Fig. Al(c) and (d)). To determine whether this transcript, like the major IS2(II) RNA from gal3, started with the sequence pppApG . . . . the transcript from galC331was labeled with [~-32P]GTP and digested with T2 ribonuclease. The radioactive product pppAp was released from the 5' terminus indicating 5' residues are indeed pppApG (not shown). Taken together with the T1 fingerprint analyses, these results indicate that the IS2(II) transcript observed with gal¢331 and gaI~¢5templates is identical to the major IS2(II) RNA from gal3. However, a start at position - 6 4 , the start of this RNA in the normal IS2 allele, would yield RNAs of 335 bases in gal"~5 and 390 bases in gale331, not the detected 280 bases. This difference would result from initiating at position - 6 4 because these longer RNAs would pass through the 54 or 108 bp of inserted DNA. Inspection of the galWC5 and gal¢331 DNAs (Fig. 3) shows that a sequence idential to that surrounding the start site of the major IS2(II) RNA ( - 6 4 ) of gal3 is repeated on the left edge of each of these inserts. Initiation of the major IS2(II) RNAs of galWC5and ga1¢331in this repeat would give RNAs identical to that observed with the normal IS2 allele. Thus, we designate positions - 1 1 8 and - 1 7 2 as the start of this RNA in galW¢5and galC331, respectively. (ii) IS2-gal transcript An RNA species of -~200 bases was obtained after in vitro transcription of the HhaI templates of either gal~331 or galW~5but not after transcription of the gal3 DNA (Fig. 2). Hybridization of this RNA from gal'331 to separated strands of )l DNA containing either the IS2 or the galE sequence demonstrated that the RNA represents transcription of both the gale gene and the IS2 DNA upstream of galE (Table 1). Thus, we designate the transcript as IS2-gal. TI fingerprints for the [a-32P]UTP-labeled IS2-gal transcripts derived from the gal~331 and the galW¢5 templates were similar and further analyses were performed with the transcript from gal¢331 only. Figure A4 shows the T l fingerprint of [a-32P]ATP-labeled IS2-gal (c) and that of [a-32P]UTP-labeled IS2-gal after hybridization to the r strand of 2r32 DNA (d).

IS2 TRANSCRIPTION

(i3

The first map represents a fingerprint of both the galE and IS2-derived RNA, while the second map shows the T, products from the IS2-derived portion only. Correlation of these T, products with the known IS2 and galE DNA sequences and the T 1 map of galE mRNA (Fig. A4(a)) indicated that the transcript represents a gal-directed RNA initiating within the IS2(I) sequence. The farthest upstream T 1 product observed is T3a. The next upstream T, oligomer, T8a {U-AU-U-A-A-Gp), representing the IS2 sequence from position - 5 5 to - 6 1 , is not observed on the IS2-specific map. Secondary analysis of T3a (Table A3) demonstrated that this oligomer contained the 5' start of the transcript and indicated that the RNA initiates between the A residue at position - 4 8 and the G at - 5 5 . To determine the 5' terminus more precisely, the [a-32P]UTP-labeled transcript was digested with ribonuclease T 2 (Fig. A5(a), lane 1). This treatment released the 32P-labeled products pppUp and pppAp from the 5' end of the RNA. Thus, at a minimum the A residue (position - 5 1 ) and one or both of the T residues {positions - 5 0 and - 5 2 ) are initiation sites for IS2-gal RNA (Fig. 3). (iii) IS2-gal' transcript The IS2-gal RNA is another transcript which was not detected with the gal3 template but was observed upon transcription of gale331 and galWC5DNA. Similar TI fingerprints were obtained for this RNA from the gale331 and from galW¢5 templates and further analyses were performed with the transcript from gale331 only. Figure A4(e) shows the T, map of the RNA labeled in the presence of [~-32P]ATP. Comparison of this map with the map of IS2-gal {Fig. A4(c)) demonstrates that these two fingerprints are similar except for the appearance of two new T, products (T18 and T12) and a greater apparent yield of the product T8. Secondary analyses indicate that all three oligomers correlate with the IS2 sequence upstream of the IS2-gal starts (Table A3). The farthest upstream T~ product detected was T12. The T 1 oligomer TA (U-C-U-U-A-A-U-A-C-U-A-Gp), which would arise from the next upstream IS2 sequence, was not observed. Thus, the IS2-gal' RNA starts within the sequence of TA. The 5' terminus was found to be pppA by using P1 nuclease (Fig. A5(b)) and the second residue was shown to be Gp by using T 2 RNase (Fig. A5(a), lane 3). Thus, the start of the IS2-gal' RNA is assigned to position - 7 5 of the IS2 DNA (Fig. 3). (iv) Other transcripts from galWC5 and gale331 As seen in Figure 2, other minor RNA species are observed after transcription of the gal¢331 and the galW¢5 HhaI templates. Some of these minor transcripts were similar in size ( ~ 5 0 0 nucleotides) to the DNA templates, suggesting the RNAs arose by transcription initiation or strand-switching of the RNA polymerase at the template ends. Thus, these RNAs are dismissed as in vitro transcription artifacts. Other minor transcripts, novel to the gal¢331 and/or the galW¢5 templates, migrated with a size less than that of the templates. We suspected that these RNAs might initiate in the DNA spanning the 54 bp and 108 bp inserts of galW¢5 and gal~331 where several large direct and inverted repeats reproduce the DNA regions containing the transcription initiation sites of the IS2-gal, IS2-gat' and

64

D. M. HINTON AND R. E. MUSSO

major IS2(II) RNAs (Fig. 3). We suspected that' the reiteration of these initiation sites might result in other transcripts that have the same 5' start as one of these RNAs but different internal nucleotide sequences. To test this hypothesis, the minor band A from galW¢5 (Fig. 2), an RNA which migrates with a size ~ 5 0 bases larger than the major IS2(II) transcript, was analyzed by T 1 fingerprinting (Fig. Al(e)). The overall pattern matched that of the major IS2(II) RNA (Fig. Al(a)), but several new oligomers were observed. Secondary analyses demonstrated that the new products could be correlated with the IS2 DNA sequence of galW¢5 starting 54 bp upstream of the major IS2(II) start (Table A1). The DNA sequence in this region repeats the start of the major IS2(II) transcript of galWC5 (Fig. 3). Thus, we designate RNA A as a minor IS2(II) transcript which initiates in this duplicated region of galW¢5. Since the I08 bp insert of gal:331 also duplicates the major IS2(II) RNA start 54 bp upstream, the galC331 transcript which comigrates with RNA A is presumed to start in this region. 4. Discussion

(a) Promoters detected within the 182 sequences At the onset of these studies, we sought to determine whether portions of the normal IS2 (from gal3) or the altered IS2s (from galW:5 and gale331) could initiate transcription in vitro. Previous sequence analyses of these IS2 alleles had not revealed regions which strongly resemble known bacterial promoters (Ghosal et al., 1979; Ahmed et al., 1980). However, our transcriptions of small DNA restriction fragments representing portions of these IS2s have resulted in several RNAs. This represents the first direct evidence for specific transcription from IS2 DNA. The normal IS2, from gal3, yields two IS2(II) transcripts. The major one initiates at position - 6 4 ; the minor, ~ 2 0 bp downstream. In our in vitro system even the major promoter is rather weak, being about 4~/o as active (copies of transcript per template molecule) as the 4 S RNA (oop) promoter of phage (data not shown). This may explain previous failures to detect the IS2 promoters by transcription of intact ~ DNA containing IS2 (Besemer & Molzberger, 1977; R. E. Musso, unpublished work). Transcription of the altered IS2s from galWC5 and gal¢331 also produces the major IS2(II) RNA. In addition, these altered IS2s yield two ga/-directed transcripts which initiate 75 and ~ 5 0 bp upstream of the IS2-galE junction. These results demonstrate that both the normal and the altered IS2 sequences contain regions which promote specific transcription in vitro. By analogy with other bacterial promoters, we designate the 40 bp upstream of each of the transcript's starts as the promoters for these RNAs. The designations for each of these promoters as well as the RNA whose transcription it directs are given in Figure 4. Two regions, located 10 and 35 bp upstream from the RNA start site, are rather conserved among known bacterial promoter sequences (Rosenberg & Court, 1979). These regions are important for RNA polymerase binding and the initiation of transcription. As seen in Figure 4, each of the detected IS2 promoters shows homology with the conserved region that lies -~ 10 bp from the site of initiation: all match in the most highly conserved first, second, and sixth

IS2 TRANSCRIPTION Promoter -40 -30 -20 -I0 +i GACAACCA~T ;CACTTAAAA ; AGTGATAGC ; TTAATACTG ; TTTTTAG!P ts2 (~)

S T

ATCACTT~~AATA :GTGATAGTCTTAATACTAGTTTTTAG Ptsz(n)Q

JA ;TTAAGACTATCACTT~AATA :GTGATAGTCTTAATACTAGTTTTTAG Plsz

- ge/'3L~/

65

RNA MajorIS2(IT) (gal3) Major I s 2 ( n ]

(gal~5, ga1¢331)

IS2-gal' (goi¢331)

I;ATTAAGACTATCACTTAF"~AAGTGATAGC ;TTAATACTG ITTTTTAG Pis2 -gel'5 TTGACA TATAAT

IS2-ga/' (galWCS)

ATAAGTGATAGTCTTAATACTAGTTTTTAGACTAGTCATTGGAGAACAG P~S2(~)

Minor IS2 (I[)

TGATAGTCTTAATACTAGTTTTTAGACTAGTATTAAGACTATCACTTAT Piss' -~a/

IS2

n

TTGACA

TTGACA

TATAAT

-go~

TATAAT

Fro. 4. Sequences of promoters at the IS2-galE junctions of gal3, gal~=5 and gal=331. The 40 bases upstream from the starts of the transcripts detected in vitro are designated as the promoter regions. The numbers above the sequences correspond to the 5' start of the RNA ( + 1) and the sequence of the promoter ( - 1 to - 4 0 ) . (For the minor IS2(II) RNA, the 5' start was determined to be a G residue at position - 8 3 , - 8 5 , and/or - 8 6 . The 5' start is indicated here as position - 8 3 since it shows the best correlation with the expected - l 0 and - 3 5 regions.) The sequences of the consensus regions at the - 1 0 and - 3 5 portions of a bacterial promoter are denoted. The boxed area shows the homologous sequences in the promoters PnsziH), Pt~lm~, Pv.~,rz.u and P=sz~r,~. The arrows indicate the inverted repeat present in these 4 promoter sequences. The underlined sequence within P~s..,~,l indicates t h a t this region comes from the DNA alteration within the gal~5 and the ga~331 alleles.

positions (T-A-T-A-A-T). However, only P',sz(n) correlates well with the expected - 3 5 sequence, T-T-G-A-C-A, particularly in the strongly conserved trimer T-T-G. Paradoxically P'ls2(II) shows greater homology to both the - 1 0 and - 3 5 consensus sequences but is functionally a weaker promoter than Pns,(m. In such weak promoters the sequence outside the - 1 0 and - 3 5 regions may have a significant effect on relative promoter strength. Often promoters with poor homology in the - 3 5 region are weak in a simple in vitro system. In some cases (i.e. lacPI and lacP115) such promoters are also weak in vivo (Calos, 1978; Rosenberg & Court, 1979); other promoters lacking a consensus - 3 5 sequence can still be quite active in vivo because a positive control factor facilitates RNA polymerase interaction with the promoter. Three such promoters which have been well-characterized are gall) l (Musso et al., 1977a,b), araPBA D (Schleif & Smith, 1978; Horwitz et al., 1980), and ~ P,= (Schmeissner et al., 1980). Although our in vitro experiments indicate a positive effector is not absolutely required for transcription, the palindromic sequence centered at - 2 1 / - 2 2 of Pns,(n) (or at -40/-41 of P'ls~(n)) might serve as a site for a regulatory protein. Further studies are in progress to examine the level of activity and possible regulation of the IS2 promoters in vivo. Comparison of the promoter sequences in Figure 4 reveals that three of those present in the altered IS2 alleles (PIsz(ma, Plsz_gal'331, and Pxsz-g°rs) share extensive homology with Plsz(n), a promoter detected in the normal IS2(II) sequence. This 3

tiff

D. M. H I N T O N AND R. E. MUSSO

h o m o l o g y a r i s e s f r o m t h e n a t u r e o f t h e I S 2 a l t e r a t i o n s t h e m s e l v e s . T h e 54 b p a n d 108 b p i n s e r t s o f gal"¢5 a n d gal¢331, r e s p e c t i v e l y , a r e d e r i v e d f r o m a c o m p l e x d u p l i c a t i o n o f t h e n o r m a l I S 2 s e q u e n c e ( A h m e d et al., 19801. T h i s d u p l i c a t i o n g e n e r a t e s s e v e r a l r e p e a t s in t h e r e g i o n o f t h e i n s e r t s (Fig. 3). T h u s , in gaP331 t h e n o r m a l I S 2 s e q u e n c e f r o m - 3 3 to - 6 6 (which i n c l u d e s m o s t o f Pise(n)) h a s b e e n r e p e a t e d to c r e a t e t h e p r o t n o t e r s Plsetm~ a n d Plse-garza~. I n t h e l a t t e r c a s e t h e r e p e a t is i n v e r t e d so t h e p r o m o t e r is n o w d i r e c t e d t o w a r d t h e gal genes. As s h o w n in F i g u r e 3, s i m i l a r r e p e a t s g e n e r a t e d b y t h e 54 b p i n s e r t in galW¢5 a r e r e s p o n s i b l e for t h e p r o m o t e r s Pts2(n)~ a n d Plse.gav,~- H o w e v e r , galW¢5 a n d gal~331 a l s o c o n t a i n r e p e a t s o f t h e I S 2 p r o m o t e r s in o t h e r p o s i t i o n s . T a b l e 2 lists t h e p o s i t i o n s o f t h e s e p r o m o t e r s e q u e n c e s , t h e size o f t h e P~NA t h a t w o u l d be e x p r e s s e d b y e a c h p o s i t i o n a n d w h e t h e r t h a t R N A is d e t e c t e d . O b v i o u s l y , t h e d e t e c t e d level o f in vitro t r a n s c r i p t i o n p r o m o t e d b y t h e s e n e a r l y i d e n t i c a l s e q u e n c e s v a r i e s . W e can p r o p o s e t h r e e e x p l a n a t i o n s for t h e a p p a r e n t v a r i a b l e s t r e n g t h s o f t h e s e promoters. As a trivial explanation, the RNA from some of these sites might contain multiple secondary structures (arising from the DNA repeats) which c o u l d r e s u l t in t h e R N A b e h a v i n g a n o m a l o u s l y o n t h e gels. T o m i n i m i z e t h i s p o s s i b i l i t y , we h a v e u s e d d e n a t u r i n g gel c o n d i t i o n s . B e s i d e s t h i s e x p l a n a t i o n , t w o more interesting possibilities emerge. First, secondary structure of the DNA a r i s i n g f r o m t h e r e p e a t s m i g h t influence t h e a c t i v i t y o f a p r o m o t e r s e q u e n c e . S e c o n d , t h e p o s i t i o n s o f t h e p r o m o t e r s r e l a t i v e to one a n o t h e r m i g h t a f f e c t a g i v e n p r o m o t e r ' s efficiency. T h e l a t t e r h y p o t h e s i s is a t t r a c t i v e for e x p l a i n i n g t h e

TABLE 2

Po,ition~' of the IS2 promoter~ in gaV331 and galW~5

Template

ffal~5 llhal

ff, l¢331 HhaI

Promoter

Positiont

1)ire~.tion

P~s~,m~ Pwsz~r.~ PIsz.~,t Pjs,ztm P'uselm

- 118 to - 7 5 to -51 to -fi4 to -137 to

- 77 - 1I(i -92 -23 -9fi

Toward Toward Toward Toward Toward

Ptse(m~ Plse,j~rz,-~l Pls:,.a~t P*s:,-a.r.~ PIs~m~ P~se,~.r.; P~se.a,~ P'lsem~

-172 to - 7 5 to -51 to - 118 to - 6 4 to - 129 to - 105 to - 191 to

-131 - 1tfi -92 -77 -23 - 170 - 146 - 150

Toward Toward Toward Toward Toward Toward Toward Toward

Size of expected RNA (bases)

IS2( I 1) ffal ffa/ IS2(ll) lS2(II)

280 215 190 335 2fi0

lS2(ll)

280 215 190 335 390 270 245 2(i0

g.I ffal IS2(II) IS2(ll)

ffal (jal IS2(II)

RNA detected .~ Major 1S2(II )

IS2-9al' lS2-yal RNA A++ --§ Major IN2(ll)

IS2-9al' IS2-9al RNA A~ --§ --§ --§ --§

The promoters are designated as in Fig. 4 and the positions refer to those given in Fig. 3. I)etected RNAs are named according to the designations given in the text. i" The fit~t number given represents the site of transcription initiation. The 5' end of RNA A was not determined but it is given as a detected RNA since it matches by size and by "1"~fingerprint analysis the expected transcript from P~s~,,t~in gal~5 and Ptsz~j~r.~in 9off331. § Little or no RNA of this size detected after gel eleetrophoresis.

Is~ TRANS('RIPTION

(17

apparent lack of transcription from P1s~,(t~)in gal~331 and galW¢5 versus the high level promoter in gal3. In the altered IS2 alleles, P,sz(m partially overlaps the sequence of P,s~,.y,tand the direction of Pisz(,,) opposes that of both the gal-directed promoters. Perhaps this location of Pisz(,I), overlapping and opposing the gal promoters, decreases its activity. In conclusion, the IS2 promoters we have detected are distinguished by two unusual features. First, all but P'[sz(m exhibit little homology to the consensus - 3 5 region. Second, their activity appears to be influenced by the position of the sequence within the DNA template. Neither the detection of the promoters nor these characteristics could have been predicted by simple inspection of the DNA sequences. Thus, these transcription studies have been useful for identifying regions of the IS2 DNA which promote transcription in vitro. (b) Correlation of the in vitro gal transcripts with the gal3. galWC5, and gaV331 pheaotypes We have considered two hypotheses to explain the constitutive expression of the gal genes adjacent to the altered IS2(I) inserts in galWC5 and gale331. First. such IS2(I) alterations could result in gal expression by the creation of new galdirected promoters. Alternatively, these alterations could disrupt an IS2(I) transcription termination site which normally blocks the continuation of transcription from an IS2(I) promoter into the gal genes. Our detection of two gal-directed transcripts initiating within the IS2 DNA of galWC5 and galC331 supports the first hypothesis and suggests that these RNAs might be responsible for the GaV phenotypes of these alleles. Such a possibility is supported by the fact that neithel' of these RNAs is detected with the Gal- (gal3) template (Fig. 2). Moreover, the promoters tbr the IS2-gal and IS2-gal' RNAs arise as a direct consequence of the IS2(I) alterations. Pisz y,i is created at the novel joint between the 54 bp or 108 bp insert and the normal IS2(I) sequence (Fig. 4). In fact, the - 1 0 region is contributed by a sequence present on the normal IS2 DNA. The promoter for the IS2-gal' RNA also arises from the IS2(I) sequence alterations that duplicate the sequence of Pls~,(n) and invert it to direct transcription toward galE. Thus, we postulate that the gal-directed promoters we have detected in vitro are responsible for the Gal¢ phenotypes of galW~5 and gale331. Other GaV alleles are known to occur after alterations of the polar IS2(I) DNA. We propose that the Gal ~ phenotypes result from promoters generated in ways similar to those of gal~331 and galW~5. For example, the allele gal~200 231 arises from gal3 by the insertion of IS2(II) sequences at position - 6 5 of the polar IS2(I) (Ahmed el al.. 1980). In ~,itro transcription of templates from gal~200 A31 yields an RNA which initiates at positions - 5 1 and - 5 2 (Hinton & Musso, 1982) and thus is identical to IS2-gal. In addition, the structure of the promoter for this transcript is similar to P,s~,,j,l: it contains the same - l0 region contributed by the normal IS2 DNA and a - 3 5 region contributed bY the alteration in the IS2 sequence (in this ease. the IS2(II) insert). In addition, the mechanism which creates the IS2-gal' promoter may also operate in another GaV allele, galOP308:: IS2-6 (Ghosal & Saedle~', 1978). Like gal¢331, this allele contains a 108 bp

68

D. M. HINTON AND R. E. MUSSO

insert of IS2-derived sequences although in IS2-6 this insert lies between position - 7 8 and - 7 9 . Inspection of the IS2-6 sequence reveals that the major IS2(II) promoter Pis~(n)a is again duplicated and inverted in the direction of the gal genes. Thus, the Galc phenotype of galOP-308::IS2-6, like that of gale331, is likely due to the expression of gal genes from this inverted duplication of Pis~(,l)aBesides galW:5 and galC331, a low level of in vitro gal transcription is also observed with the DNA from the Gal- parent, gal3. However, since this transcipt initiates between positions + 11 and + 22 of the galE gene, the promoter for this RNA spans the IS2-galE junction. Thus, this promoter is created at the site of the IS2(I) insertion. At first, the presence of such transcription is confusing since the IS2(I) insertion in gal3 is considered a polar mutation. However, the Gal- strain does retain a residual amount of gal expression, ~ l~/o of the fully induced gal operon (Ahmed & Johansen, 1975). This low level of gal expression might be produced as a consequence of this novel joint promoter. (c) Possible significance of I S 2 ( I I ) transcription These transcription studies have detected two IS2(II) promoters within the normal IS2 DNA. Although these promoters clearly function in vitro, the critical question is whether they also promote transcription in vivo. Previously, genetic studies have led to speculation that the IS2 sequence contains active promoters which direct transcription in orientation II into adjacent genes (Saedler et al., 1974; Pilacinski et al., 1977; Starlinger, 1980). Our detection of the promoters P,s~(n) and P'ls~(m suggests that these might be responsible for this constitutive expression of IS2(II)-adjacent genes. However, the levels of transcription from these promoters are low, at least in vitro, whereas the level of constitutive expression of genes after IS2(II) insertions has been high. In addition, in order to express these adjacent genes, the transcripts would need to extend through the entire IS2 sequence. Consequently, no transcription termination sites could reside within the IS2(II) DNA. Thus, while it is possible that genes adjacent to IS2(II) are transcribed from these promoters, we cannot assume that this is the case. Besides the constitutive expression of adjacent genes, a second possible role for the IS2(II) promoters could be to initiate mRNA for IS2-encoded gene product(s). By analogy with the transposable elements Tn3 (Heffron et al., 1979), y8 (Reed, 1981), and Tn5 (Rothstein et al., 1980), IS2 may encode a transposase required for its transposition and perhaps a repressor for regulating any transposition functions. We are presently investigating whether either of the IS2(II) promoters we have detected in vitro are responsible for such gene products.

® '?-i:! :~', ~..~-,~.~ :~

....

~'.a~

iI

-:-;: ~ : : I ~

p~

• .~.~:~' :~

-i

.

.

.

.

~ <~

~ - l ~ d - ± ~ ~l.Cl.~il V

(c)

;elfooel (pH 3 . 5 )

~c:. AI(c) and (d)

-~!i~I.

( pH 3 . 5 ) Cd)

:elloge

~ - .

%ii

' .'::7" y'~: Y':I

,:>5(~,

o

I

y

IS2 ' r I : { A N S C I ~ I P T I O N

71

o O

E O

Celloge! (pH 3-5) (e) FI~. A I. Fingerprint,.~ of l~Nase T I digests of (a) l~-,-32PlUTP-labeled major I~z)(II) I~NA from gal:L (h) [a-3-'PlUTP-l~beled minor IS2(II) RNA fronl ffa/3. (c) Ix-a2PIUTP-labeled major 182(1I) leNA fi'om flU/W%, (d) [~-3zPtUTP-labeled major IH,~(ll) RXA from .qM¢331. and (e) [a-a2P]UTP-laheled RNA A from yal~5. The transcripts were isolated after in ~ilro transcription of the Hhttl fragments of ~at3, ~a.tW¢5or ffat¢331 using the tbllowing 5'-NTP concentrations tot (a). (b), (e) amd (d): 10u~l-la32p]UTP (295Ci/mmol), 50~I-CTP, 200,u,~I-ATP and 200/~i-(l'rP: tot {e): 5~I-la-a2P]UTP (600 Ci/mmol). 7/z,xI-GTP and 30 ~.~I-ATP, The "1"Z maps were generated as des~'ribed in Materiv, ls and Methods. B denotes the position of t.he marker dye xylene cyanol FF and Y denotes the po.~ition of orange G. TA denote,~ the expet.ted position ~t' the putential '1"~product represent.ing positions - 5 4 to -~i5. which is not observed in the major ISZ?(II) P,NA fingerprint (a). T27a denotes the position of an [~-32PJATP-labeled q'~ oligomer obtained with the major and minor l~e(l I) RNAs. It is not observed on the [a-32PllJTP-labeled maps shown above.

72

D. M. H I N T O N

A N D R. E. M U S S O

f o~ 0.

v

!

&

y

Step formate (pH 3-4)

FIo. A2. Autoradiogram of the P, nuclease products from the major 182(11) transcript synthesized from the HhaI fragment of gal3. The in v/fro transcription reaction was performed as described in Materials and Methods using the following nucleotide concentrations: 50 ~M-[~-32P]UTP (8 Ci/mmol}, 50 ~M-[~-32P]CTP (8 Ci/mmol), 200 ~M-[~-3zP]ATP (8 Ci/mmol), and 200 ~M-[a-32P]GTP (8 Ci/mmol). The P~ digestion and the product separation were performed as described in Materials and Methods. The direction of development for the two different solvents is shown by arrows; the positions of marker nucleotides are indicated by circles.

IS2 TRANSCRIPTION

73

Origin - -

,i ¸

,%,

'!i XC~

BP8

~ 4 pppA-G-U-U-U-U(OH) 3 pppA-G-U-U-U(OH) 2 pppA- G - U- U (OH) ;pppA-G-U(OH)

~,:,~:

,

:~'

FI(;. A3. Autoradiogram of the in vitro transcription products synthesized from the HhaI DNA template of gal3 after separation on a 20% (w/v) polyacrylamide/7 u-urea gel. The transcription reaction was performed as described in Materials and Methods and in the legend to Fig. 2, lane 2. XC denotes the position of the marker dye xylene cyanol F F and BPB denotes bromophenol blue. The RNA in each band was extracted and characterized by enzYmatic digestions described in Table A2. The sequences are assigned to the bands based on these analyses.

74

t). M. H I N T O N

A N D R. E. M U S S O

B

tt a.

.=

o

o

o

o

J=

E o I

•

/

F-'N

k,_JT2 CeHogel (pH 5.5) (0)

Cellogel ( pH 5,5) (b)

1"1(:, A4. Fingerprints of the RNase T t digests of (a) [c,-32PlUTP-laheled galE mRN'A: (b) i~-32pIUTP-laheh.d gale RNA fi'[)m gal3: (e)[x-32plATP-laheled lS2-gnl RNA from gale331: (d) [~-321)l13TP-labeled IS2-g~fl 14NA after hybridization to the r strand of ~r32: and (e) [~-32P]ATPlabeled IS2-gal' RNA from gaP331, The transcript in (a) was obtained after the in ~fftra transcription of an HhaI fragment containing the ffal operator/promoter region |bilowed by 140 bp of galE sequence (Musso et al., 1974,1977a). The other transcripts were isolated after in vitro transcription of the HhaI fragments from 9al3 or .qal~331 using the following 5'-NTP concentrations: (b) 2/z,~-[a-32p]UTP (540 Ci/mmol), 2/xM-('~FP, 200/~.~t-GTP, 200 tz~I-ATP: (c) and (e), 100/L,~I-[a-3~P]ATP (50 Ci/mmol), 200 ~I-GTP, 50/~.~I-Cq'P. l0/~I-UTP: (d) l0 l~I-[a-a2P]UTP (295 Ci/mmol), 50 IxM-(,~FP, 200 ~M~ATP, 21)0tt~I-GTP. The T 1 maps were generated as described in Materials and Methods. B denotes the position of the marker dye xylene cyanol FF and Y denotes the position of orange G. (TA in (e) denotes the expected position o|" the potential T~ product representing positions - 8 5 to - 7 4 of IS2 DNA. Although it would migrate similarly to spot "F9. secondary analysis of spot T9 (Table A3) did oat yiehl products expe(,ted tbr TA )

'.r•

el.

o

ot

•;"

o

111

,(qd DJ 60~ Ow OJq:)OmOH

.-.

.

.

~

i

'

,

!

i

' . . . .

.~q ci DJ 6o~, o w o ~ y = o w OH

•

.

....

.

i,.i-:.,:~: •

~.

..... '

...:~

...-.~,

,h _'2 "~ d',

~...:~..-.~_ _: ~~-...!~..-.~.

{~.7.

~'..-

: "

"~'~:~'~" " .:.-.

.

-...

~qd oJ 8 o l DWOJ qOOWOH

-K

-.

)rigin~

~

2 (a)

.÷-

5

L.

4

)dgin

Step formate (pH 5-4) (b)

10/~M-GTP and 50 ~uM-ATP; for lane 3, l0 ~M-[a-32P]GTP (400 Ci/mmol), 50 pM-UTP, 50 pM-CTP and 50 gM-ATP. The procedure for the nuelease T 2 digestion s given in Materials and Methods. Lane 2 shows the position of [~-a2P]pppAp generated by the T 2 digestion of [a-a2]ATP-labeled 6 S RNA. Y denotes the position of the marker dye, orange G. (b) Autoradiograph of the P1 nuclease products from 32P-labeled IS2-gat' RNA synthesized from the HhaI fragment of Ia1~331. The in vitro transcription reaction was performed using the following nucleotide concentrations: 50 ~M[~-32P]UTP (8 Ci/mmol), 50 pM-[~-32P]CTP ',SCi/mmol), 200 pM-[a*32P]ATP (8 Ci/mmol) and 200/~M-[a-32P]GTP (8 Ci/mmol). The PI digestion and product separation were performed as described in Ylaterials and Methods. The direction of development for the 2 different solvents is shown by arrows: the positions of marker nucleotides are indicated by

F1o. A5. Characterization of the 5' starts of IS2-gal and IS2-gal' RNAs. (a) Autoradiograph of the ribonuclease T 2 products from [a-32P]UTP-labeled IS27al RNA (lane l) and [a-a2P]GTP-labeled IS2-gal' RNA (lane 3) after eleetrophoresis on DE 81 paper at pH 1-7. The transcripts were isolated by in vitro ~ranscription of the HindIII fragment of ga1¢331 using the following nucleotide concentrations: for lane 1, 8 pM-[a-32P]UTP (500 Ci/mmol), l0 #M-CTP,

c3.

r"

Major I S 2 ( I I ) R N A from gal3

Map

UTP UTP UTP UTP UTP UTP UTP UTP

UTP UTP UTP UTP UTP

T9 T10

TI7 TI8

T19 T20 T21

TI2 Tl3 T14 T15 T16

T 11

b

UTP

T 8a

AAG AG C_, _C G

G U, G

AG, AC AC, C , U AU U. (UU) C, G ~.U AU, C, U, (UU) G

AAU, AAC, G, U

AU, C, U

UTP

c

AU C, U AU-" U

UTP UTP UTP UTP

T3 T4 T5 T6 T7a b

AU, G

Pancreatic RNase di ge s t i on p r o d u c t s

UTP

La bel

T2

Sp ot

UG[U] UUG UUG[U] AAG[U] CCAG[U] CUG[U] CUG

ACUAG[U] UCUUACUG CAACAUG UUUUUAG UCUCCCUCG[U] AUUAAAG UUAUUUCUCUG G[U]

AACUUG

CAAUUG[U]

UUCCUG

AUG AUG[U] AUG AUUG CUUUG AUCG UUCAG UCAUUG UCUUAG

S ugge st e d s e q u e n c e r

Pancreatic R N ase digestion products of RNase T1 oligonucleotides from the major I S2 ( I I ) R N A R N A (gal3) and R N A A (galWC5)

TA B LE A 1

to to to to to to to to to to to to to to to to to to to

to to to to -223 to - 270 to - 3 1 2 to

-92 -99 - 179 -95 - 166 - 146 - 156 - 78 - 102 - 294 - 150 - 306 -73 -262 - 203 -66 - 186 -329 -227 - 185 -210 - 290 -211 - 195 -291 - 259

-212 - 197 -293 - 261 - 226 - 272 -314

-94 - 101 - 181 - 98 - 170 - 149 - 160 - 83 - 107 - 299 - 155 - 311 -77 -269 - 209 -72 - 194 -335 -237

P o s itio n in D N A sequence

(gal3), minor I S2 ( I I )

A B (' I) E

At:, U t ' , U AU AAU, AG. At', C, U AAAU, AAG, A t ' , A(', U AAAAAf', AG, ('

AAAC, AA(!. AG

ATP

UTP UTP UTP UTP UTP

('. U

AU (' AA(' AAU

Panereativ R N a s e digestion products

UTP

UTP UTP UTP UTP

"1'22 T23 '1"24 T25

T7B v T27a~t b ~'

Label

Spot

(continued)

ND§ UAUUAAG ( ¢ t t A A t At t A t , I U1 Af'UAUf'A('UUAAAUAA(/IU] U( 'UAAAAA('UAGI U]

('f'UUAG UU('CUG AAf'.AGIA ] AAA('G AA('AG

('('At'( / ( '('U(ff.'(l AAt'I.'f'("AG ('AAUA(!('AC

Suggested setlueneet

to to to to

ND§ -78 - 108 -85 -66

-- 107 - 299 -91 - 1211 - 289

-322 - 305 --343 - 253

to - 8 4 to - 119 to - 1 0 1 to - 7 7

- 102 to - 294 to - 8 7 to - 116 to - 285 to

-318 - 300 -336 - 245

Position in DNA sequence

T h e spot n u m b e r s reter to the 'l'l olignnut,leotides in Fig. A1. T h e 'l'~ oligomers were isolated, treated with pan('reatie RNase, anti eleetrophoresed on D E A E paper at I)H 3"5 as d~seribed in Materials and Methods (main text). A molar yieht of greater t h a n or less t h a n one is denoted by underscoring and parentheses, respet.tive]y. Nearest-neighbor is denoted by bra(,kets. Spot T] from the major 1N2(II) RNA was not analyzed. Spots T l 2 a n d T15 ti'om t h e m a j o r IN2(lI) RNA gave the product UU, p r e s u m a b l y from incomplete digestion by pan(,reatie RNase. For the m a j o r lS2(II) RNA. the observed '1"~ 1,roducts agree with those predicted by the published IN2 DNA sequence (Ghosal el al., 1979) ext,ept lor t h e appearanve of an extra U residue in the s p o t s T4 a n d TIO. S u b s e q u e n t DNA sequenve a n a l y s e s of the IS2 I)NA have eomfirmed t h e presence of these residues (Musso & Bidwell. unpul)lishett observations). Spots F a n d G from RNA A were not aealyzed. Sequen(*e h y p h e n s have been o m i t t e d tot vlarity. "I"Analysis of R N a s e "Fi oligomers from the m a j o r IS2(ll) RNA labeled with la-S-'PI('TP. [-,A2P]ATP and/or [~-32pIGTP gave results consistent with these assignments. Spot T27a, b, ~: is not observed on the m a j o r or minor [S2(II) m a p s shown in Fig. AI since this prndm.t is not labeled by I'~-a2PIUTP, It was obtained f?am an t-,A2P]ATP-labeled "F~ map. § Spot A could not be assigned.

tlNA A from

Minor I82( 11 ) RNA from gal3

Map

TABI.V AI

T19

T10 TI I TI2 TI3 TI5 TI8

"1'2 T3 T5a h 'I'll T7 TSa t) TSa h T9

Taa

Tgh

Sp~t

AAU. At'. (' AA(;. A('. A t ' . l ' AAU. AU, ('. (t') AAU. AU A('. [" AA{;, AAU. (;. U AAU. A t ' A t ' . V. I' (', G AAU, U AG U (' At" U A{;. A(' AAAA('.('

ATI' ATI' ATP

['TP

['TP ATP ATP UTP UTP ATP ATP ATP UTP ATP

{lq)p(Xp)nlt. AAll. A [ ' . AlL I,"

AAU. AU

Panm'eatil. |{Nase digestiml prodm.ts

UTP UTF' ATP

I"1'1)

UTP

Label

(gaF331)

{?AAAA(!(~

(!('UAAI.'(; t'AA('A(I[t'] UUUUUAI; AUU('A(' AUAUU(I A('I.'A(IIt" l

U('UAAUA('('AUAA(I A('UAI'('A('UUAUUUAA(qU I t'('At'A('('V(I ('AAUUA('U(I AUAA('('U('U(I |'UA('AUUG VAI-'UAAqIIAI AAVUAI'flIA I UA['['AA(I AAUI'AUC Ui'AU('AVt'('t't'i;IAI

pl,p(A<'t'AV~')A('t'VAUVt'.hA~qUI +

AAI_'UA['(;

Nu~gested sequem'e

to

+.q6

-

+17 to + 133 to - 6 7 to 13 to - 3 0 to - l i 2

to + 1 0 t,, - 3 S to +711 to + 8 9 to + 127 t,, +B3 to - 5 5 t. +29 to - 5 5 to +2!1 to + I 17

+ 9 0 to

-

+11 + 128 -73 18 -35 -4ili

-4 -54 +t~ +81 + 118 4-56 -~H +23 -111 +23 + 106

( - 5 4 - - 4 ! t ) + t~ -3,~

+ 2 3 t~J +2,9

Pnsitiml in DNA sequem.e

at pH ::1-5 an desvribed in Materials and Methods. A molar yield ~t" greater l han or tess t h a n one ix denoted by unders~.f~ring and parenthesis, respeetively. Nearest-neighbor is denoted by braekets. Nequenee h y p h e n s have been o m i t t e d tbr clarity. t ( J h a r a e t e r i z e d as a 5 ' - t r i p h o s p h a t e (oligo)nueleotide by its low mobility (0"10 relative to xylene eyanol FF) but t h e exact sequem.e eoukl not he determined by these analyses. ~. 5' s t a r t determined to lie between positions - 4 9 a n d - 5 4 . hut the exm't s t a r t vouhl not be determined 113"this analysis.

T, oligomers were isolated from t h e "171 m a p s s h o w n in Fig. A4 (spot T8 from gale RNA a n d s p o t s T5. '1'6. T7. TS, Tg, "1'10, 'Fla. TI5. T I 8 a n d TI.q from IS2-ffal' ItNA) or t'mm [ a - s 2 p l t ' T P - l a h e l e d T I m a p s (not shown), The '1"1 produets were treated with panereatie I/Nase and eleetr.phoresed ml I ) E A E paper

lS2-,,t.l' HNA (fla/'3311

(gal'3311

IS<,qu/ RNA

(,¢te/3 )

flolE RXA

Map

RNA

Pancreatic RNa.se digestion products of RNa.~'e 7' l oli~tonucleotide,s'J'rom galE R N A (gal3). l q'2-gal R N A (gaV331 .rid IN2-gal'

TA,~LE A3

(7 .I,ble A 2 overleaf)

80

D. M. H I N T O N AND R. E. MUSSO TABLE A 2

Analysis of the small oligonucleotide products from the in v i t r o transcription of the gal3 H h a I template

Band

Mobility after phosphatase

1 2 3 4

I'19 0-70 0.23 0"04

Pancreatic RNase products ppp(Xp)n ppp(Xp)n ppp(Xp)n, U ppp(Xp)n, U

RNase U2 products G

Suggested sequence pppAGU[OH] pppAGUU[OH] pppAGUUU[OH] pppAGUUUU[OH]

Band numbers refer to the gel bands shown in Fig. A3. The [~-32P]UTP-labeled RNA was isolated from gel slices and treated with phosphatase, pancreatic RNase, or RNase U2 as described in Materials and Methods. After pbosphatase treatment, the products were analyzed by electrophoresis on DEAE paper at pH 1"7. Mobilities are relative to the marker dye xylene cyanol FF. (These values differ from published values (Brownlee, 1972) due to a change in the paper by the manufacturer.) After pancreatic RNase or RNase U2 treatment, the products were analyzed by electrophoresis on DEAE paper at pH 3-5. The product ppp(Xp)n was identified as a 5'-polyphosphated moiety based on its low mobility (0"05 at pH 3"5 relative to xylene cyanol FF).

We are grateful to A. Ahmed for his gift of the plasmids pBRHgal3, pBRHgalWC5 and pBRHgal¢331. We thank K. Bidwell for technical assistance, R. Grafstrom and C. Benyajati for careful reading of the manuscript, and B. Traynor for her diligent typing. This work was supported by the National Cancer Institute (under contract no. N01-C0-75380 with Litton Bionetics, Inc.). One of us (D.M.H.) was an American Cancer Society Postdoctoral Fellow.

REFERENCES Ahmed, A. & Johansen, E. (1975). Mol. Gen. Genet. 142, 263-275. Ahmed, A. & Johansen, E. (1978). J. Mol. Biol. 121, 269-281. Ahmed, A. & Scraba, D. (1975). Mol. Gen. Genet. 136, 233-242. Ahmed, A. & Scraba, D. (1978). Mol. Gen. Genet. 163, 189-196. Ahmed, A., Bidwell, K. & Musso, R. (1980). Cold Spring Harbor Symp. Quant. Biol. 45, 141-151. Berg, D., Barrett, K. & Chamberlin, M. (1971). Methods Enzymol. 21,506-519. Besemer, J. & Molzberger, C. (1977). Mol. Gen. Genet. 153, 51-60. Besemer, J., GSrtz, G. & Charlier, D. (1980). Nucl. Acids Res. 8, 5825-5833. Brownlee, G. G. (1972). Determination of Sequences in RNA, American Elsevier Publishing Co. Inc., New York. Calos, M. P. (1978). Nature (London), 274, 762-765. Calos, M. P. & Miller, J. H. (1980). Cell, 20, 579-595. Cashel, M., Lazzarini, R. A. & Kalbacher, B. (1969). J. Chromatogr. 40, 103-109. Charlier, D., Crabeel, M., Palchaudhuri, S., Cunin, R., Boyen, A. & Glansdorff, N. (1978). Mol. Gen. Genct. 161, 175-184. de Crombrugghe, B., Adhya, S., Gottesman, M. & Pastan, I. {1973). Nature New Biol. 241, 260-264. Delius, H., Charlier, D. & Besemer, J. (1980). Mol. Gen. Genet. 179, 391-397. Feiss, M., Adhya, S. & Court, D. L. (1972). Genetics, 71, 18-206. Fiandt, M., Szybalski, W. & Malamy, M. H. (1972). Mol. Gen. Genet. 119, 223-231.

IS2 T R A N S C R I P T I O N

81

Fujimoto, M., Kuninaka, A. & Yoshino, H. (1974). Agric. Biol. Chem. 38, 1555-1561. Ghosal, D. & Saedler, H. (1977). Mol. Gen. Genet. 158, 123-128. Ghosal, D. & Saedler, H. (1978). Nature (London), 275, 611-617. Ghosal, D., Sommer, H. & Saedler, H. (1979). Nucl. Acids Res. 6, 1111-1122. Heffron, F., McCarthy, B. J., Ohtsubo, H. & Ohtsubo, E. (1979). Cell, 18, 1153-1163. Hinton, D. M. & Musso, R. E. (1982). Nuel. Acids Res. 1O, 5015-5030. Hirsch, H.J., Starlinger, P. & Brachet, P. (1972). Mol. Gen. Geuet. 119, 191-206. Horwitz, A. H., Morandi, C. & Wilcox, G. (1980). J . Bacteriol. 142, 659-667. Johnson, L. D. & Lazzarini, R. A. (1977). Virology, 77, 863-866. Kleckner, N. {1981). Annu. Rev. Genet. 15, 341-404. Maxam, A. M. & Gilbert, W. {1977). Proc. Nat. Acad. Sci., U.S.A. 74. 560-564. McDonnell, M. W., Simon, M. N. & Studier, F. W. (1977). J. Mol. Biol. 110, 119-146. Mosharrafa, E., Pilacinski, W., Zissler, J., Fiandt, M. & Szybalski, W. (1976). Mol. Gen. Genet. 147, 103-109. Musso, R. E., de Crombrugghe, B., Pastan, I., Sklar, J., Yot, P. & Weissman, S. (1974). Proc. Nat. Acad. Sci., U.S.A. 71, 4940-4944. Musso, R. E., Di Lauro, R., Adhya, S. & de Crombrugghe, B. (1977a). Cell, 12, 847-854. Musso, R., Di Lauro, R., Rosenberg, M. & de Crombrugghe, B. (1977b). Proc. Nat. Acad. Sci., U.S.A. 74, 106-110. Peterson, P. A., Ghosal, D., Sommer, H. & Saedler, H. (1979). Mol. Gen. Genet. 173, 15-21. Pilacinski, W., Mosharrafa, E., Edmundson, R., Zissler, J., Fiandt, M. & Szybalski, W. (1977). Gene, 2, 61-74. Reed, R. R. (1981). Proc. Nat. Acad. Sci., U.S.A. 78, 3428-3432. Rosenberg, M. & Court, D. (1979). Annie. Rev. Genet. 13, 319-353. Rothstein, S. J., Jorgensen, R. A., Pastle, K. & Reznikoff, W. S. (1980). Cell, 19, 795-805. Saedler, H. & Heiss, B. (1973). Mol. Gen. Genet. 122, 267-277. Saedler, H., Reif, H. J., Hu, S. & Davidson, N. (1974). Mol. Gen. Genet. 182, 265-289. Schleif, R. & Smith, B. R. (1978). J . Biol. Chem. 253, 6931-6933. Schmeissner, U., Court, D., Schimatake, H. & Rosenberg, M. (1980). Proc. Nat. Acad. Sci., U.S.A. 77, 3191-3195. Sommer, H., Cullum, J. & Saedler, H. (1979). Mol. Gen. Genet. 175, 53-56. Starlinger, P. (1980). Plasmid, 3, 241-259. Walz, A., Ratzkin, B. & Carbon, J. {1978). Proc. Nat. Acad. Sci., U.S.A. 75, 6171-6176. Edited by M . Gottesman