- Email: [email protected]
Spermine Binding to GC-Rich DNA: Experimental and Theoretical Studies
ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS
Vol. 325, No. 1, January 1, pp. 39–46, 1996 Article No. 0005
Spermine Binding to GC-Rich DNA: Experimental and Theoretical Studies Masayuki Yuki,* Vladislav Grukhin,* Chong-Soon Lee,† and Ian S. Haworth*,1 *Department of Pharmaceutical Sciences, University of Southern California, 1985 Zonal Avenue, Los Angeles, California 90033; and †Department of Biochemistry, Yeungnam University, Kyongsan, 712-749, South Korea
Received April 10, 1995, and in revised form October 11, 1995
The DNA binding of spermine has been studied using experimental and computational approaches. Spermine blocks 5*-GC interstrand crosslinking by 2,5-diaziridinylbenzoquinone in the oligonucleotide duplex 5*CTTCCAAGATGCATCAGATG 5*-CATCTGATGCATCTTGGAAG (where the underlined nucleotide bases represent the crosslinking site). Molecular dynamics simulations suggest that this is a result of preferential spermine binding at the 5*-GC major groove site of the oligonucleotide. A further simulation with a GC-alternating sequence shows a similar preference for the 5*GC step. In a simulation including multiple spermine molecules, occupation of alternate 5*-GC steps occurred. From this, we deduce a mechanism for the experimentally observed cooperativity of spermine binding to poly(dGdC)2 . q 1996 Academic Press, Inc. Key Words: spermine; DNA; diaziridinylquinone; crosslink; molecular dynamics.
Polyamines such as spermine (Fig. 1) are linear polycations found ubiquitously in mammalian cells. They have an important biological role, and it has long been recognized that depletion of polyamines will inhibit cell growth (1, 2). The mechanisms by which polyamines might support cell growth are slowly emerging, and many potential in vivo effects of polyamines have been reported. For example, Faaland et al. (3) have shown that the natural polyamines spermine (Fig. 1), spermidine, and putrescine can modulate signal transduction pathways of the epidermal growth factor receptor. Alteration of polyamine levels has been explored as a potential antiparasitic and anticancer strategy, either by inhibition of enzymes (particularly ornithine 1
decarboxylase, ODC)2 involved in polyamine biosynthesis or by direct displacement of natural polyamines with synthetic analogues. Many examples of the inhibition of ODC by a-difluoromethylornithine have been reported (4–7). Guo et al. (8) have described an inhibitor of S-adenosylmethionine decarboxylase (another enzyme involved in the polyamine biosynthetic pathway) which showed anti-trypanasomal (anti-parasitic) activity. The alternative strategy of administration of synthetic polyamines that exert anti-tumor effects through inhibition of the activity of the natural polyamines has also been widely reported, with bis(ethyl)polyamine analogs proving most effective (see, for example, 9–13). Given that they are positively charged at physiological pH, it is likely that cellular polyamines are in part associated with nucleic acids. For example, Fernandez et al. (14) have explored the correlation between polyamine–tRNA interactions and antiproliferative effects. It has also been shown that polyamines are in close physical association with chromatin (15, 16). This has led to the suggestion that synthetic polyamine analogues may disrupt chromatin structure and N1,N14bis(ethyl)homospermine has been shown to make the DNA of a human cell line more susceptible to micrococcal nuclease and DNAse digestion (17). As a corollary of this, it has been found in vitro that the most effective anti-tumor polyamines condense DNA poorly (18). Despite the intensive study of the interaction, the molecular level nature of polyamine–DNA complexes remains unresolved. An NOE (nuclear Overhauser effect) study suggested no specific binding of spermine to the Drew–Dickerson dodecamer d(CGCGAATTCGCG)2 (19). Similarly, a 23Na NMR study suggested 2 Abbreviations used: ODC, ornithine decarboxylase; DZQ, 2,5-diaziridinylbenzoquinone; ISC, interstrand crosslinks; mep, molecular electrostatic potential.
To whom correspondence should be addressed.
39
0003-9861/96 $12.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4849$9227
11-30-95 08:01:16
arcas
AP: Archives
40
YUKI ET AL.
FIG. 1. (a) Spermine and (b) 2,5-diaziridinylbenzoquinone in oxidized (left) and reduced (right) forms.
that a series of diamines interacts with DNA only through electrostatic interactions (20). On the other hand, Andreasson et al. (21) showed reduced diffusion of a fully methylated spermidine analogue when bound to several DNA duplexes. Furthermore, at low polyamine:DNA ratios the diffusion rate of the methylspermidine approached that of the DNA itself, suggesting a relatively rigid localization of the polyamine on the DNA. It may also be that this interaction should be stronger with natural, nonmethylated polyamines because the lack of methyl groups reduces the steric effect between the polyamine and the DNA (22). It has been suggested that spermine favors binding to GC-alternating sequences (23). This is also indirectly suggested by the spermine location in the X-ray structure of the Drew–Dickerson dodecamer, in which spermine binds in the GC region in the major groove (24). A major groove location is also suggested by spermine blocking of mechlorethamine guanine N7 alkylation (25). Marquet and Houssier (26) suggested from uv spectra that spermine directly interacts with nucleotide bases of the GC-alternating sequence. Computational studies are generally in line with these experimental results, and also suggest that the spermine binding site is in the major groove (27–32). The crystal structure of the r(C)d(CGGCGCCG)r(G) sequence with a spermine molecule suggests that spermine bends DNA toward the major groove by interacting with the backbone on the major groove side of the central region of the duplex (33). However, another X-ray study showed a spermine molecule in the minor groove of the central 5*-GCGC region of d(ATGCGCAT)2 (34). An AT minor-groove-binding site of spermine has been suggested from the use of a spermine analogue with a reporter group attached to it (35, 36). One of the more interesting aspects of the spermine interaction with poly(dGdC)2 is the cooperativity of the spermine binding (37). This is intriguing, given the tet-
/ m4849$9227
11-30-95 08:01:16
arcas
racationic nature of spermine, which suggests that the neighboring molecules should repel each other. It is of note, however, that in the crystal structures of the DNA–adriamycin–spermine and DNA–daunomycin– spermine complexes, two spermine molecules bind in close proximity in the major groove (38). The study presented here uses a combination of experimental and computational approaches. First, we examined the ability of spermine to compete with the powerful DNA crosslinking agent 2,5-diaziridinylbenzoquinone, or DZQ (Fig. 1). DZQ forms G–G interstrand crosslinks, most favorably at a 5*-TGC sequence, upon reduction with DT-diaphorase (39–43) or ascorbic acid (40), via alkylation at the N7 position of guanine in the major groove. If the major groove of a 5*-GC sequence is a favored spermine binding site, we might expect considerable interference of spermine with the crosslinking reaction. To assess this, we examined the DNA–DZQ reaction in the presence of various concentrations of spermine, using an oligonucleotide duplex containing a single 5*-GC site. We then used the same sequence in a molecular dynamics simulation of the DNA–spermine interaction. To further study the behavior of spermine at the 5*-GC site and the possible cooperative effect of multiple spermine molecules, we then performed molecular dynamics simulations of a GC-alternating sequence with one and four spermine molecules. Observations made in the multiple spermine simulation provide an explanation of spermine binding cooperativity with poly(dGdC)2 . MATERIALS AND METHODS
Experimental Method Chemicals and reagents. DZQ was obtained as previously described (40, 41). NADH (grade IV) was obtained from Sigma. [g32 P]ATP was purchased from NEN. Spermine tetrahydrochloride was purchased from Sigma. All other reagents were at least of analytical grade. Preparation of oligonucleotides. Oligonucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems 391) and deprotected with saturated ammonium hydroxide at 557C overnight. After ethanol precipitation, the oligonucleotide was purified on a 20% denaturing polyacrylamide gel. Purification of DNA ISC. Approximately 10 mg of the oligonucleotide top strand was 5*-end-labeled with T4 polynucleotide kinase and [g-32P]ATP. After removal of unincorporated [g-32P]ATP by ethanol precipitation, an equal amount of complementary strand was added, heated to 657C, and then cooled to room temperature overnight to form an annealed duplex in 30 ml of double-deionized water. The duplex oligonucleotide (1 mM duplex concentration) was incubated first with 0, 0.5, 5, 50, or 500 mM spermine at 377C for 1 h and subsequently with DZQ (10 mM) for 10 min in 50 ml of 10 mM potassium phosphate (pH 5.8) containing 100 mM NADH, 2 mM sodium ascorbate, and 1 mM EDTA. DNA interstrand crosslinks induced by the reduced quinone were purified by running a 20% denaturing polyacrylamide gel (mono:bis acrylamide ratio 29:1, 8 M urea) until the xylene cylanol marker had migrated 10 cm. The gel was exposed to X-ray film, and the percentage of DNA ISC in the duplex oligonu-
AP: Archives
41
SPERMINE BINDING TO GC-RICH DNA
FIG. 2. (a) The sequence of the oligonucleotide duplex (referred to as TGCA) used in the experiments and computer simulations. Note that the bold letter G denotes the guanine bases at the interstrand crosslinking site. (b) The sequence of the oligonucleotide [referred to as (GC)9] used in computer simulations.
cleotide was determined by microdensitometry using an LKB Ultrascan XL laser densitometer.
Computational Method Molecular dynamics simulations were performed using the AMBER 4.0 force field (44, 45). The DNA helices d(N9TGCAN7)•d(N7TGCAN9) (Fig. 2a) and d(GC)9•d(GC)9 (Fig. 2b) were used. These are hereafter referred to as TGCA and (GC)9 , respectively. Standard AMBER 4.0 parameters and charges were applied to the DNA. To compute charges for spermine, AM1 calculations (46) using the MOPAC6.0 package were performed. The molecular electrostatic potential (mep) of a spermine molecule (in its tetracationic form) was derived from the AM1 wave function (47) using the program RATTLER (48). The atomic point charge distributions were evaluated from the mep using the same program (Table I). Canonical B-DNA coordinates from the QUANTA 4.0 package (49) were used to construct the DNA helices. Specific water molecules were not included and a distance-dependent dielectric (e Å 4r) was used to reproduce the effect of solvent on the electrostatic interactions. Simulations were performed at 298K for 1600 ps on the TGCA/ single spermine system (Simulation 1), 800 ps on the (GC)9/single spermine system (Simulation 2), and 800 ps on the (GC)9/four spermine system (Simulation 3), using a time step of 0.002 ps. The coordinates of structures generated in the dynamics trajectory were saved every 0.4 ps. The DNA motion was frozen throughout all simulations. The starting position of spermine was unbiased toward any bind˚ from the DNA. In the initial part of the ing site and was about 15 A simulation, the spermine molecules diffuse toward the DNA and then move freely over the surface. The motion of the spermine molecules was assessed in terms of the distance of the midpoint between the N5 and N10 of spermine (see Fig. 1) and the O6 of guanine in the major groove or N2 of guanine in the minor groove.
RESULTS
Experimental The oligonucleotide TGCA (Fig. 2a) was equilibrated with serially diluted concentrations of spermine and DZQ was subsequently added. The resultant interstrand-crosslinked DNA diadduct was separated from the single-strand DNA using denaturing poly-
/ m4849$9227
11-30-95 08:01:16
arcas
acrylamide gel electrophoresis. An autoradiogram was made from the gel (Fig. 3a) and the thickness of the first band (Band 1) was measured using densitometry (Fig. 3b). Band 1 has previously been shown to contain the DNA diadduct due to crosslinking at the 5*-GC site (43). The intensity of the crosslinking band decreased by approximately 30% with 0.5 mM spermine (Fig. 3b). With larger concentrations of spermine, the crosslinking decreased further in a nonlinear fashion. For the purpose of defining potential spermine binding sites, we consider a ‘‘binding site’’ to comprise a single base pair step. Hence, in a 20mer oligonucleotide, we would have 38 such sites, 19 in the major groove and 19 in the minor groove. At a 1:1 concentration of spermine:DNA and assuming a uniform distribution of spermine, each site should be occupied about 2.7% (1/ 38) of the time. (Such an analysis assumes an infinite spermine–DNA binding constant—the occupation of each site would be reduced somewhat in reality, since a small percentage of the spermine will remain unbound, even at this low spermine:binding site concentration ratio.) Hence, in TGCA, from this simple approach we might expect 2.7% crosslink inhibition (or perhaps slightly higher if binding to the sites neighboring the 5*-GC inhibited crosslink formation) at 1 mM spermine, since the DNA duplex concentration is also 1 mM. However, with 0.5 mM spermine and 1 mM DNA, the crosslinking was inhibited approximately 30%. Here, the DNA:spermine concentration ratio was 2:1. Such a result suggests that spermine binds favorably to the 5*GC step, causing direct blocking of the DZQ alkylation. It is also possible that the alkylation inhibition could be indirectly due to DNA conformational changes induced by spermine. Currently this possibility cannot be ruled out, but since we observe significant inhibition at low spermine:DNA ratios (where on average only one spermine is associated with a given DNA duplex at any instant), we believe direct blocking of alkylation is most likely.
TABLE I
Atomic Point Charges (in Millielectrons) of a Spermine Tetracation as Calculated from the AM1-Derived mep Atom
Charge
Atom
Charge
N1, N14 H1, H14 C2, C13 H2, H13 C3, C12 H3, H12 C4, C11
028 278 0107 143 0157 109 0132
H4, H11 N5, N10 H5, H10 C6, C9 H6, H9 C7, C8 H7, H8
145 76 258 0173 148 0121 101
AP: Archives
42
YUKI ET AL.
FIG. 3. (a) Autoradiogram of the TGCA–DZQ crosslinked adduct in the presence of 0, 0.5, 5, 50, and 500 mM spermine. (b) Densitometry of Band 1 in Fig. 3a, where the percentage of the band density is compared to that at 0.0 mM spermine concentration (100%).
Computational Simulation 1: TGCA/single spermine. We performed a 1600-ps molecular dynamics simulation of the DNA oligonucleotide used in the experiment (Fig. 2a). During the simulation, the spermine migrated over the surface of the DNA. The distance between the spermine and the base pairs in the major groove at the 5*-GC step in the oligonucleotide (specifically, the distance between the midpoint of spermine N5 and N10 and the O6 of G11 or G29) was monitored and is shown in Fig. 4. Based on this criterion, spermine is located in the major groove at the 5*-GC step for 15.6% of the simulation time, in two periods between 300 and 450 ps and between 1175 and 1275 ps. The spermine
FIG. 4. Spermine–DNA distances (shown as running averages over 4-ps windows) extracted from the molecular dynamics simulation of the TGCA/single spermine system between the midpoint of the two central nitrogen atoms (N5 and N10) of spermine and the major groove marker atom (O6) of G11 and G29. For each time point, the shorter of these two distances is shown.
/ m4849$9227
11-30-95 08:01:16
arcas
orientation in this site is not constant, as shown by a superimposition of spermine molecules taken from the simulation (Fig. 5). The movement of spermine into, out of, and back into the 5*-GC site indicates that the initial position of spermine is not biased toward the 5*-GC site. Simulation 2: (GC)9/single spermine. An 800-ps molecular dynamics simulation of the (GC)9 DNA duplex/single spermine system was performed. The distance between the two central nitrogen atoms of the spermine (N5 and N10) and each of the major groove or the minor groove marker atoms (O6 and N2 of guanine, respectively) was recorded against time. For each time point, the shortest distance was extracted and is shown for major and minor grooves in Fig. 6a. Hence, this
FIG. 5. Superimposed snapshots of spermine bound to the 5*-GC site of TGCA system from 320 to 440 ps, taken at 20-ps intervals.
AP: Archives
SPERMINE BINDING TO GC-RICH DNA
43
of the simulation. At 350 ps, however, the spermine molecule moves to the G11/G25 step, as indicated by the crossover of the plot. Such crossovers also occur at 420 and 560 ps. This indicates that spermine is not stable in any single 5*-GC site. However, it does retain a general major groove location. Simulation 3: (GC)9/four spermine molecules. An 800-ps molecular dynamics simulation was also performed on the (GC)9/four spermine system (Fig. 7). Similar distance plots to those described above are shown for each spermine in Fig. 7. Of the four spermine molecules, one (IV) moved into the major groove immediately. A second one (III) retained a backbone location for 200 ps and then adopted a major groove location. The remaining two (I and II) competed for the major groove in the central part of the duplex, I moving into the major groove at 400 ps while II remained on the backbone (Fig. 7). At no time did any spermine molecules go into the minor groove. During the second half of the simulation, the three major groove-bound spermines (I, III, IV) remained at
FIG. 6. Spermine–DNA distances (shown as running averages over 4-ps windows) extracted from the molecular dynamics simulation of the (GC)9/single spermine system between the midpoint of the two central nitrogen atoms (N5 and N10) and (a) the major groove (solid line) or minor groove (dashed line) marker atoms (O6 and N2, respectively) of the guanine closest to the spermine at a given time point and (b) the major groove marker atoms of the guanines G9 and G27 (solid line) and the major groove marker atoms of the guanines G11 and G25 (dashed line). In b, if the solid line is lower than the dashed line, the spermine molecule is closer to the G9/G27 site than the G11/G25 site. Crossing of the lines indicates a transition of the spermine molecule from one binding site to another.
plot gives an indication of the groove location of the ˚ in the distances at spermine. A difference of about 5 A a given time point shows the spermine to be in a groovebound location. Similar distances to the nearest major and minor groove marker atoms represents backbone binding. It is important to note that the plot for each groove is a composite of the shortest marker atom– spermine distances; that is, it may represent spermine moving along a given groove. This is, in fact, what occurs in this simulation (see below). Following an initial period in the minor groove, at 200 ps the spermine moved into the major groove and remained there for the rest of the simulation (Fig. 6a). However, while in the major groove, the spermine is still relatively mobile, with movement into and out of neighboring 5*-GC steps. This is illustrated in Fig. 6b, in which distances between spermine and the 5*-GC step of G9/G27 and between spermine and the 5*-GC step of G11/G25 are shown against time (Fig. 6b). Spermine stays in the G9/G27 step from 250 to 350 ps
/ m4849$9227
11-30-95 08:01:16
arcas
FIG. 7. Spermine–DNA distances (shown as running averages over 4-ps windows) extracted from the gas-phase molecular dynamics simulation of the (GC)9/four spermine system between the midpoint of the two central nitrogen atoms (N5 and N10) of the (a) spermine I, (b) spermine II, (c) spermine III, and (d) spermine IV and the major groove (bold line) or minor groove (light line) marker atoms (O6 and N2, respectively) of the guanine closest to the respective spermine molecule at a given time point.
AP: Archives
44
YUKI ET AL.
FIG. 8. Superimposed plot of spermine molecules I, III, and IV from 80 to 800 ps taken at 80-ps intervals.
the same 5*-GC steps, each of which are separated by an unoccupied 5*-GC step. Specifically, these molecules were binding to G9/G27, G13/G23, and G5/G31 steps, respectively. This is shown in Fig. 8, and is in contrast to the single spermine simulation, in which the spermine is able to freely move from one 5*-GC step to another. As discussed below, this provides us with an insight into the observed cooperativity of the spermine interaction with poly(dGdC)2 . DISCUSSION
The nature of the DNA–spermine interaction has received considerable attention, but the exact manner in which spermine binds to DNA is still unresolved. Our experimental data are suggestive of a favorable interaction of spermine at a 5*-GC step in the DNA major groove, based on the observed inhibition of the DZQ crosslink formation at such a step. Computational results support this, suggesting that spermine can locate this binding site in a random sequence DNA duplex and remain bound in this position for some time. Although our computational approach is rather simplified (particularly in the omission of explicit water molecules), and hence some caution is required in drawing definitive conclusions from the data, the general agreement with experiment provides us with some confidence in the simulation. Application of the same computational approach to
/ m4849$9227
11-30-95 08:01:16
arcas
a GC-alternating helix, with first one and then four spermine molecules in the system, provided us with some insights into the spermine–GC interaction. It has been suggested (26) that spermine makes contacts with the bases when bound to a GC-alternating sequence and that, based on uv data, a change of binding regime occurs at a spermine:base pair ratio (rsb) of approximately 0.2 (or one spermine every five base pairs). Equilibrium binding data (37) presented as a Scatchard plot suggest that the spermine–GC interaction is cooperative (50, 51). These data are consistent with a change in binding regime at an rsb of about 0.2, with the first binding mode being cooperative (31). A second mode, occurring once the sites of the first are saturated, is noncooperative, and has a saturated site size of about one spermine every two base pairs (31). In the multiple spermine simulation with 5*-GC, three of the four spermine molecules adopted positions at 5*-GC steps, with each of these positions separated by an unoccupied 5*-GC step. This distribution of spermine molecules four base pairs apart is consistent with the favored binding mode described above (rsb of about 0.2). Furthermore, the cooperativity exhibited by this binding mode can be rationalized by the computer simulation data. This has previously been difficult to understand, since intuitively one might expect a bound tetracationic species to make binding of a similar species to a neighboring binding site less favorable, compared to binding to an isolated site. The basis for the cooperativity lies in the preference of spermine for the 5*-GC site of the major groove (compared to, for example, the 5*-CG site, or a minor groove location) and, most importantly, the ability of neighboring spermine molecules to restrict motion away from this site, once it has been occupied. In the single spermine simulation with a GC-alternating sequence, the spermine is able to locate a 5*-GC site, but, in a similar fashion to binding to a 5*-GC site in random sequence DNA, only retains the binding location for a short period of time. For the random sequence DNA, this results in the adoption of binding sites with other base sequences. For a GC-alternating sequence, the spermine rapidly locates a neighboring 5*-GC site. However, during the transition period, the interaction between spermine and DNA is presumably weakened. In the multiple spermine simulation, each of the three spermine molecules that entered the major groove located a 5*-GC step and then retained this binding site at the specific step for the duration of the simulation. This seems to occur because motion away from the step would result in too close an approach to a neighboring spermine. Hence, overall, the thermodynamic stability of the spermine–DNA complex is increased by maximizing the time the spermine spends in the most favorable position.
AP: Archives
SPERMINE BINDING TO GC-RICH DNA
We do not want to imply that the spermine occupies a binding site in the same way as, for example, a DNA minor groove binding ligand such as netropsin, in which very specific interactions occur between the ligand and the DNA, resulting in relatively rigid complexes with fixed orientations. Rather, spermine moves around within the 5*-GC site, but may have a general preference for this region, compared to others. This preference presumably arises from the electrostatic attraction to the major groove face of the guanine bases. In our earlier interpretation of this interaction, we chose to draw a distinction between so-called ‘‘downgroove’’ binding (in which the spermine only contacts bases) and ‘‘cross-groove’’ binding, in which contacts with bases and phosphates occur (31). We now consider these modes to be interchangeable and probably indistinguishable, experimentally, with both occurring within the influence of the 5*-GC step. The conformation adopted by spermine at the 5*-GC step remains questionable. In gas-phase simulations there is a tendency for interactions to develop between the primary amines and the phosphate backbone. However, when we perform simulations on fully solvated systems, beginning from a complex similar to that shown in Fig. 8, we observe a tendency for the spermine molecules to adopt U-shaped conformations [similar to that observed by Bancroft et al. (52) with Z-DNA] with a consequent reduction of the primary amine–phosphate backbone interaction.
45
M., and Feuerstein, B. G. (1995) Cancer Chem. Pharm. 36, 411– 417. 11. Smirnov, I. V., Feuerstein, B. G., Pellarin, M., Marton, L. J., Deen, D. F., and Basu, H. S. (1994) Cell. Mol. Biol. 40, 974–980. 12. Ghoda, L., Basu, H. S., Porter, C. W., Marton, L. J., and Coffino, P. (1993) Mol. Pharmacol. 42, 302–306. 13. Basu, H. S., Pellarin, M., Feuerstein, B. G., Shirahata, A., Samejima, K., Deen, D. F., and Marton, L. J. (1993) Cancer Res. 53, 3948–3955. 14. Fernandez, C. O., Frydman, B., and Samejima, K. (1994) Cell. Mol. Biol. 40, 933–944. 15. Smirnov, I. V., Dimitrov, S. I., and Makarov, V. L. (1988) J. Biomol. Struct. Dyn. 5, 1149–1161. 16. Hougaard, D. M., Bolund, L., Fujiwara, K., and Larsson, L.-J. (1987) Eur. J. Cell Biol. 44, 151–155. 17. Basu, H. S., Sturkenboom, M. C. J. M., Delcros, J.-G., Csokan, P. P., Szollosi, Feuerstein, B. G., and Marton, L. J. (1992) Biochem. J. 282, 723–727. 18. Basu, H. S., Schwietert, H. C. A., Feuerstein, B. G., and Marton, L. J. (1990) Biochem. J. 269, 329–334. 19. Wemmer, D. E., Srvengopal, K. S., Reid, B. R., and Morris, D. R. (1985) J. Mol. Biol. 185, 457–459. 20. Padmanabhan, S., Brushaber, V. M., Anderson, C. F., and Record, M. T., Jr. (1991) Biochemistry 30, 7550–7559. 21. Andreasson, B., Nordenskiold, L., Braunlin, W. H., Schoultz, J., and Stilbs, P. (1993) Biochemistry 32, 961–967. 22. Plum, E. G., and Bloomfield, V. A. (1990). Biopolymers 29, 13– 17. 23. Stewart, K. D. (1988) Biochem. Biophys. Res. Commun. 152, 1441–1446. 24. Drew, H. R., and Dickerson, R. E. (1981) J. Mol. Biol. 151, 535– 556. 25. Hartley, J. A., Forrow, S. M., and Souhami, R. L. (1990) Biochemistry 29, 2985–2991.
ACKNOWLEDGMENTS We gratefully acknowledge the support of NIH Grant CA6429901 and grants from the Pharmaceutical Manufacturers Association and the American Association of Colleges of Pharmacy.
26. Marquet, R., and Houssier, C. (1988) J. Biomol. Struct. Dyn. 6, 235–246. 27. Feuerstein, B. G., Pattabiraman, N., and Marton, L. J. (1986) Proc. Natl. Acad. Sci. USA 3, 5948–5952. 28. Feuerstein, B. G., Pattabiraman, N., and Marton, L. J. (1989) Nucleic Acids Res. 17, 6883–6892.
REFERENCES 1. Tabor, C. W., and Tabor, H. (1984) Annu. Rev. Biochem. 53, 749– 790.
29. Feuerstein, B. G., Pattabiraman, N., and Marton, L. J. (1990) Nucleic Acids Res. 18, 1271–1282.
2. Pegg, A. E. (1988) Cancer Res. 48, 759–774.
30. Feuerstein, B. G., Williams, L. D., Basu, H. S., and Marton, L. J. (1991) J. Cell. Biochem. 46, 37–47.
3. Faaland, C. A., Laskin, J. D., and Thomas, T. J. (1995) Cell Growth Diff. 6, 115–121. 4. Redgate, E. S., Boggs, S., Grudziak, A., and Deutsch, M. (1995) J. Neuro-Oncol. 25, 167–179. 5. Pegg, A. E., Schantz, L. M., and Coleman, C. S. (1995) J. Cell. Biochem. 22, 132–138. 6. Meyskens, F. L., and Gerner, E. W. (1995) J. Cell. Biochem. 22, 126–131. 7. Heby, O., Persson, L., Holm, I., and Ask, A. (1989) ICSU Symp. Series 12, 221–226.
31. Haworth, I. S., Rodger, A., and Richards, W. G. (1991) Proc. R. Soc. London B 244, 107–116. 32. Haworth, I. S., Rodger, A., and Richards, W. G. (1992) J. Biomol. Struct. Dyn. 10, 195–211. 33. Ban, C., Ramakrishnan, B., and Sundaralingam, M. (1994) Nucleic Acids Res. 22, 5466–5476. 34. Clark, G. R., Brown, D. G., Sanderson, M. R., Chwalinski, T., Neidle, S., Veal, J. M., Jones, R. I., Wilson, W. D., Zon, G., Garman, E., and Stuart, D. I. (1990) Nucleic Acids Res. 18, 5521– 5528.
8. Guo, J. Q., Wu, Y. Q., Rattendi, D., Bacchi, C. J., and Woster, P. M. (1995) J. Med. Chem. 38, 1770–1777.
35. Behr, J. P. (1989) J. Chem. Soc. Chem. Commun. 101–103.
9. Harari, P. M., Pickart, M. A., Contreras, L., Petereit, D. G., Basu, H. S., and Marton, L. J. (1995) Int. J. Radiat. Oncol. Biol. Phys. 32, 687–694.
37. Winkle, A., and Crooks, P. A. (1988) J. Pharm. Pharmacol. 40, 809–811.
10. Bergeron, R. J., Basu, H. S., Marton, L. J., Deen, D. F., Pellarin,
38. Frederick, C. A., Williams, L. D., Ughetto, G., van der Marel,
/ m4849$9227
11-30-95 08:01:16
arcas
36. Schmid, N., and Behr, J. P. (1991) Biochemistry 30, 4357–4361.
AP: Archives
46
39.
40. 41. 42. 43. 44.
YUKI ET AL. G. A., van Boom, J. H., Rich, A., and Wang, A. J.-J. (1990) Biochemistry 29, 2538–2549. Hartley, J. A., Berardini, M., Ponti, M., Gibson, N. W., Thompson, A. S., Thurston, D. E., Hoey, B. M., and Butler, J. (1991) Biochemistry 30, 11719–11724. Lee, C.-S., Hartley, J. A., Berardini, M. D., Butler, J., Siegel, D., Ross, D., and Gibson, N. W. (1992) Biochemistry 31, 3019–3025. Berardini, M. D., Souhami, R. L., Lee, C.-S., Gibson, N. W., Butler, J., and Hartley, J. A. (1993) Biochemistry 32, 3306–3312. Yuki, M., and Haworth, I. S. (1993) Anti-Cancer Drug Des. 8, 269–287. Haworth, I. S., Lee, C.-S., Yuki, M., and Gibson, N. W. (1993) Biochemistry. 32, 12857–12863. Pearlman, D. A., Case, D. A., Caldwell, J. C., Seibel, G. L., Singh, U. C., Weiner, P., and Kollman, P. A. (1991) AMBER 4.0. University of California, San Francisco.
/ m4849$9227
11-30-95 08:01:16
arcas
45. Weiner, S. J., Kollman, P. A., Nguyen, D. T., and Case, D. A. (1986) J. Comput. Chem. 7, 230–252. 46. Dewar, M. J. S., Zoebisch, E. G., Healy, E. F., and Stewart, J. J. P. (1985) J. Am. Chem. Soc. 107, 3902. 47. Ferenczy, G. G., Reynolds, C. A., and Richards, W. G. (1990) J. Comput. Chem. 11, 159–170. 48. Oxford Molecular, Ltd. RATTLER. Magdalene Science Park, Oxford, UK. 49. Molecular Simulations, Inc. (1994) QUANTA Version 4.0. 16 New England Executive Park, Burlington, MA 01803-5297. 50. McGhee, J. D., and von Hippel, P. H. (1974) J. Mol. Biol. 86, 469–489. 51. McGhee, J. D., and von Hippel, P. H. (1976) J. Mol. Biol. 103, 679. 52. Bancroft, D., Williams, L. D., Rich, A., and Egli, M. (1994) Biochemistry 33, 1073–1086.
AP: Archives
Vol. 325, No. 1, January 1, pp. 39–46, 1996 Article No. 0005
Spermine Binding to GC-Rich DNA: Experimental and Theoretical Studies Masayuki Yuki,* Vladislav Grukhin,* Chong-Soon Lee,† and Ian S. Haworth*,1 *Department of Pharmaceutical Sciences, University of Southern California, 1985 Zonal Avenue, Los Angeles, California 90033; and †Department of Biochemistry, Yeungnam University, Kyongsan, 712-749, South Korea
Received April 10, 1995, and in revised form October 11, 1995
The DNA binding of spermine has been studied using experimental and computational approaches. Spermine blocks 5*-GC interstrand crosslinking by 2,5-diaziridinylbenzoquinone in the oligonucleotide duplex 5*CTTCCAAGATGCATCAGATG 5*-CATCTGATGCATCTTGGAAG (where the underlined nucleotide bases represent the crosslinking site). Molecular dynamics simulations suggest that this is a result of preferential spermine binding at the 5*-GC major groove site of the oligonucleotide. A further simulation with a GC-alternating sequence shows a similar preference for the 5*GC step. In a simulation including multiple spermine molecules, occupation of alternate 5*-GC steps occurred. From this, we deduce a mechanism for the experimentally observed cooperativity of spermine binding to poly(dGdC)2 . q 1996 Academic Press, Inc. Key Words: spermine; DNA; diaziridinylquinone; crosslink; molecular dynamics.
Polyamines such as spermine (Fig. 1) are linear polycations found ubiquitously in mammalian cells. They have an important biological role, and it has long been recognized that depletion of polyamines will inhibit cell growth (1, 2). The mechanisms by which polyamines might support cell growth are slowly emerging, and many potential in vivo effects of polyamines have been reported. For example, Faaland et al. (3) have shown that the natural polyamines spermine (Fig. 1), spermidine, and putrescine can modulate signal transduction pathways of the epidermal growth factor receptor. Alteration of polyamine levels has been explored as a potential antiparasitic and anticancer strategy, either by inhibition of enzymes (particularly ornithine 1
decarboxylase, ODC)2 involved in polyamine biosynthesis or by direct displacement of natural polyamines with synthetic analogues. Many examples of the inhibition of ODC by a-difluoromethylornithine have been reported (4–7). Guo et al. (8) have described an inhibitor of S-adenosylmethionine decarboxylase (another enzyme involved in the polyamine biosynthetic pathway) which showed anti-trypanasomal (anti-parasitic) activity. The alternative strategy of administration of synthetic polyamines that exert anti-tumor effects through inhibition of the activity of the natural polyamines has also been widely reported, with bis(ethyl)polyamine analogs proving most effective (see, for example, 9–13). Given that they are positively charged at physiological pH, it is likely that cellular polyamines are in part associated with nucleic acids. For example, Fernandez et al. (14) have explored the correlation between polyamine–tRNA interactions and antiproliferative effects. It has also been shown that polyamines are in close physical association with chromatin (15, 16). This has led to the suggestion that synthetic polyamine analogues may disrupt chromatin structure and N1,N14bis(ethyl)homospermine has been shown to make the DNA of a human cell line more susceptible to micrococcal nuclease and DNAse digestion (17). As a corollary of this, it has been found in vitro that the most effective anti-tumor polyamines condense DNA poorly (18). Despite the intensive study of the interaction, the molecular level nature of polyamine–DNA complexes remains unresolved. An NOE (nuclear Overhauser effect) study suggested no specific binding of spermine to the Drew–Dickerson dodecamer d(CGCGAATTCGCG)2 (19). Similarly, a 23Na NMR study suggested 2 Abbreviations used: ODC, ornithine decarboxylase; DZQ, 2,5-diaziridinylbenzoquinone; ISC, interstrand crosslinks; mep, molecular electrostatic potential.
To whom correspondence should be addressed.
39
0003-9861/96 $12.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4849$9227
11-30-95 08:01:16
arcas
AP: Archives
40
YUKI ET AL.
FIG. 1. (a) Spermine and (b) 2,5-diaziridinylbenzoquinone in oxidized (left) and reduced (right) forms.
that a series of diamines interacts with DNA only through electrostatic interactions (20). On the other hand, Andreasson et al. (21) showed reduced diffusion of a fully methylated spermidine analogue when bound to several DNA duplexes. Furthermore, at low polyamine:DNA ratios the diffusion rate of the methylspermidine approached that of the DNA itself, suggesting a relatively rigid localization of the polyamine on the DNA. It may also be that this interaction should be stronger with natural, nonmethylated polyamines because the lack of methyl groups reduces the steric effect between the polyamine and the DNA (22). It has been suggested that spermine favors binding to GC-alternating sequences (23). This is also indirectly suggested by the spermine location in the X-ray structure of the Drew–Dickerson dodecamer, in which spermine binds in the GC region in the major groove (24). A major groove location is also suggested by spermine blocking of mechlorethamine guanine N7 alkylation (25). Marquet and Houssier (26) suggested from uv spectra that spermine directly interacts with nucleotide bases of the GC-alternating sequence. Computational studies are generally in line with these experimental results, and also suggest that the spermine binding site is in the major groove (27–32). The crystal structure of the r(C)d(CGGCGCCG)r(G) sequence with a spermine molecule suggests that spermine bends DNA toward the major groove by interacting with the backbone on the major groove side of the central region of the duplex (33). However, another X-ray study showed a spermine molecule in the minor groove of the central 5*-GCGC region of d(ATGCGCAT)2 (34). An AT minor-groove-binding site of spermine has been suggested from the use of a spermine analogue with a reporter group attached to it (35, 36). One of the more interesting aspects of the spermine interaction with poly(dGdC)2 is the cooperativity of the spermine binding (37). This is intriguing, given the tet-
/ m4849$9227
11-30-95 08:01:16
arcas
racationic nature of spermine, which suggests that the neighboring molecules should repel each other. It is of note, however, that in the crystal structures of the DNA–adriamycin–spermine and DNA–daunomycin– spermine complexes, two spermine molecules bind in close proximity in the major groove (38). The study presented here uses a combination of experimental and computational approaches. First, we examined the ability of spermine to compete with the powerful DNA crosslinking agent 2,5-diaziridinylbenzoquinone, or DZQ (Fig. 1). DZQ forms G–G interstrand crosslinks, most favorably at a 5*-TGC sequence, upon reduction with DT-diaphorase (39–43) or ascorbic acid (40), via alkylation at the N7 position of guanine in the major groove. If the major groove of a 5*-GC sequence is a favored spermine binding site, we might expect considerable interference of spermine with the crosslinking reaction. To assess this, we examined the DNA–DZQ reaction in the presence of various concentrations of spermine, using an oligonucleotide duplex containing a single 5*-GC site. We then used the same sequence in a molecular dynamics simulation of the DNA–spermine interaction. To further study the behavior of spermine at the 5*-GC site and the possible cooperative effect of multiple spermine molecules, we then performed molecular dynamics simulations of a GC-alternating sequence with one and four spermine molecules. Observations made in the multiple spermine simulation provide an explanation of spermine binding cooperativity with poly(dGdC)2 . MATERIALS AND METHODS
Experimental Method Chemicals and reagents. DZQ was obtained as previously described (40, 41). NADH (grade IV) was obtained from Sigma. [g32 P]ATP was purchased from NEN. Spermine tetrahydrochloride was purchased from Sigma. All other reagents were at least of analytical grade. Preparation of oligonucleotides. Oligonucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems 391) and deprotected with saturated ammonium hydroxide at 557C overnight. After ethanol precipitation, the oligonucleotide was purified on a 20% denaturing polyacrylamide gel. Purification of DNA ISC. Approximately 10 mg of the oligonucleotide top strand was 5*-end-labeled with T4 polynucleotide kinase and [g-32P]ATP. After removal of unincorporated [g-32P]ATP by ethanol precipitation, an equal amount of complementary strand was added, heated to 657C, and then cooled to room temperature overnight to form an annealed duplex in 30 ml of double-deionized water. The duplex oligonucleotide (1 mM duplex concentration) was incubated first with 0, 0.5, 5, 50, or 500 mM spermine at 377C for 1 h and subsequently with DZQ (10 mM) for 10 min in 50 ml of 10 mM potassium phosphate (pH 5.8) containing 100 mM NADH, 2 mM sodium ascorbate, and 1 mM EDTA. DNA interstrand crosslinks induced by the reduced quinone were purified by running a 20% denaturing polyacrylamide gel (mono:bis acrylamide ratio 29:1, 8 M urea) until the xylene cylanol marker had migrated 10 cm. The gel was exposed to X-ray film, and the percentage of DNA ISC in the duplex oligonu-
AP: Archives
41
SPERMINE BINDING TO GC-RICH DNA
FIG. 2. (a) The sequence of the oligonucleotide duplex (referred to as TGCA) used in the experiments and computer simulations. Note that the bold letter G denotes the guanine bases at the interstrand crosslinking site. (b) The sequence of the oligonucleotide [referred to as (GC)9] used in computer simulations.
cleotide was determined by microdensitometry using an LKB Ultrascan XL laser densitometer.
Computational Method Molecular dynamics simulations were performed using the AMBER 4.0 force field (44, 45). The DNA helices d(N9TGCAN7)•d(N7TGCAN9) (Fig. 2a) and d(GC)9•d(GC)9 (Fig. 2b) were used. These are hereafter referred to as TGCA and (GC)9 , respectively. Standard AMBER 4.0 parameters and charges were applied to the DNA. To compute charges for spermine, AM1 calculations (46) using the MOPAC6.0 package were performed. The molecular electrostatic potential (mep) of a spermine molecule (in its tetracationic form) was derived from the AM1 wave function (47) using the program RATTLER (48). The atomic point charge distributions were evaluated from the mep using the same program (Table I). Canonical B-DNA coordinates from the QUANTA 4.0 package (49) were used to construct the DNA helices. Specific water molecules were not included and a distance-dependent dielectric (e Å 4r) was used to reproduce the effect of solvent on the electrostatic interactions. Simulations were performed at 298K for 1600 ps on the TGCA/ single spermine system (Simulation 1), 800 ps on the (GC)9/single spermine system (Simulation 2), and 800 ps on the (GC)9/four spermine system (Simulation 3), using a time step of 0.002 ps. The coordinates of structures generated in the dynamics trajectory were saved every 0.4 ps. The DNA motion was frozen throughout all simulations. The starting position of spermine was unbiased toward any bind˚ from the DNA. In the initial part of the ing site and was about 15 A simulation, the spermine molecules diffuse toward the DNA and then move freely over the surface. The motion of the spermine molecules was assessed in terms of the distance of the midpoint between the N5 and N10 of spermine (see Fig. 1) and the O6 of guanine in the major groove or N2 of guanine in the minor groove.
RESULTS
Experimental The oligonucleotide TGCA (Fig. 2a) was equilibrated with serially diluted concentrations of spermine and DZQ was subsequently added. The resultant interstrand-crosslinked DNA diadduct was separated from the single-strand DNA using denaturing poly-
/ m4849$9227
11-30-95 08:01:16
arcas
acrylamide gel electrophoresis. An autoradiogram was made from the gel (Fig. 3a) and the thickness of the first band (Band 1) was measured using densitometry (Fig. 3b). Band 1 has previously been shown to contain the DNA diadduct due to crosslinking at the 5*-GC site (43). The intensity of the crosslinking band decreased by approximately 30% with 0.5 mM spermine (Fig. 3b). With larger concentrations of spermine, the crosslinking decreased further in a nonlinear fashion. For the purpose of defining potential spermine binding sites, we consider a ‘‘binding site’’ to comprise a single base pair step. Hence, in a 20mer oligonucleotide, we would have 38 such sites, 19 in the major groove and 19 in the minor groove. At a 1:1 concentration of spermine:DNA and assuming a uniform distribution of spermine, each site should be occupied about 2.7% (1/ 38) of the time. (Such an analysis assumes an infinite spermine–DNA binding constant—the occupation of each site would be reduced somewhat in reality, since a small percentage of the spermine will remain unbound, even at this low spermine:binding site concentration ratio.) Hence, in TGCA, from this simple approach we might expect 2.7% crosslink inhibition (or perhaps slightly higher if binding to the sites neighboring the 5*-GC inhibited crosslink formation) at 1 mM spermine, since the DNA duplex concentration is also 1 mM. However, with 0.5 mM spermine and 1 mM DNA, the crosslinking was inhibited approximately 30%. Here, the DNA:spermine concentration ratio was 2:1. Such a result suggests that spermine binds favorably to the 5*GC step, causing direct blocking of the DZQ alkylation. It is also possible that the alkylation inhibition could be indirectly due to DNA conformational changes induced by spermine. Currently this possibility cannot be ruled out, but since we observe significant inhibition at low spermine:DNA ratios (where on average only one spermine is associated with a given DNA duplex at any instant), we believe direct blocking of alkylation is most likely.
TABLE I
Atomic Point Charges (in Millielectrons) of a Spermine Tetracation as Calculated from the AM1-Derived mep Atom
Charge
Atom
Charge
N1, N14 H1, H14 C2, C13 H2, H13 C3, C12 H3, H12 C4, C11
028 278 0107 143 0157 109 0132
H4, H11 N5, N10 H5, H10 C6, C9 H6, H9 C7, C8 H7, H8
145 76 258 0173 148 0121 101
AP: Archives
42
YUKI ET AL.
FIG. 3. (a) Autoradiogram of the TGCA–DZQ crosslinked adduct in the presence of 0, 0.5, 5, 50, and 500 mM spermine. (b) Densitometry of Band 1 in Fig. 3a, where the percentage of the band density is compared to that at 0.0 mM spermine concentration (100%).
Computational Simulation 1: TGCA/single spermine. We performed a 1600-ps molecular dynamics simulation of the DNA oligonucleotide used in the experiment (Fig. 2a). During the simulation, the spermine migrated over the surface of the DNA. The distance between the spermine and the base pairs in the major groove at the 5*-GC step in the oligonucleotide (specifically, the distance between the midpoint of spermine N5 and N10 and the O6 of G11 or G29) was monitored and is shown in Fig. 4. Based on this criterion, spermine is located in the major groove at the 5*-GC step for 15.6% of the simulation time, in two periods between 300 and 450 ps and between 1175 and 1275 ps. The spermine
FIG. 4. Spermine–DNA distances (shown as running averages over 4-ps windows) extracted from the molecular dynamics simulation of the TGCA/single spermine system between the midpoint of the two central nitrogen atoms (N5 and N10) of spermine and the major groove marker atom (O6) of G11 and G29. For each time point, the shorter of these two distances is shown.
/ m4849$9227
11-30-95 08:01:16
arcas
orientation in this site is not constant, as shown by a superimposition of spermine molecules taken from the simulation (Fig. 5). The movement of spermine into, out of, and back into the 5*-GC site indicates that the initial position of spermine is not biased toward the 5*-GC site. Simulation 2: (GC)9/single spermine. An 800-ps molecular dynamics simulation of the (GC)9 DNA duplex/single spermine system was performed. The distance between the two central nitrogen atoms of the spermine (N5 and N10) and each of the major groove or the minor groove marker atoms (O6 and N2 of guanine, respectively) was recorded against time. For each time point, the shortest distance was extracted and is shown for major and minor grooves in Fig. 6a. Hence, this
FIG. 5. Superimposed snapshots of spermine bound to the 5*-GC site of TGCA system from 320 to 440 ps, taken at 20-ps intervals.
AP: Archives
SPERMINE BINDING TO GC-RICH DNA
43
of the simulation. At 350 ps, however, the spermine molecule moves to the G11/G25 step, as indicated by the crossover of the plot. Such crossovers also occur at 420 and 560 ps. This indicates that spermine is not stable in any single 5*-GC site. However, it does retain a general major groove location. Simulation 3: (GC)9/four spermine molecules. An 800-ps molecular dynamics simulation was also performed on the (GC)9/four spermine system (Fig. 7). Similar distance plots to those described above are shown for each spermine in Fig. 7. Of the four spermine molecules, one (IV) moved into the major groove immediately. A second one (III) retained a backbone location for 200 ps and then adopted a major groove location. The remaining two (I and II) competed for the major groove in the central part of the duplex, I moving into the major groove at 400 ps while II remained on the backbone (Fig. 7). At no time did any spermine molecules go into the minor groove. During the second half of the simulation, the three major groove-bound spermines (I, III, IV) remained at
FIG. 6. Spermine–DNA distances (shown as running averages over 4-ps windows) extracted from the molecular dynamics simulation of the (GC)9/single spermine system between the midpoint of the two central nitrogen atoms (N5 and N10) and (a) the major groove (solid line) or minor groove (dashed line) marker atoms (O6 and N2, respectively) of the guanine closest to the spermine at a given time point and (b) the major groove marker atoms of the guanines G9 and G27 (solid line) and the major groove marker atoms of the guanines G11 and G25 (dashed line). In b, if the solid line is lower than the dashed line, the spermine molecule is closer to the G9/G27 site than the G11/G25 site. Crossing of the lines indicates a transition of the spermine molecule from one binding site to another.
plot gives an indication of the groove location of the ˚ in the distances at spermine. A difference of about 5 A a given time point shows the spermine to be in a groovebound location. Similar distances to the nearest major and minor groove marker atoms represents backbone binding. It is important to note that the plot for each groove is a composite of the shortest marker atom– spermine distances; that is, it may represent spermine moving along a given groove. This is, in fact, what occurs in this simulation (see below). Following an initial period in the minor groove, at 200 ps the spermine moved into the major groove and remained there for the rest of the simulation (Fig. 6a). However, while in the major groove, the spermine is still relatively mobile, with movement into and out of neighboring 5*-GC steps. This is illustrated in Fig. 6b, in which distances between spermine and the 5*-GC step of G9/G27 and between spermine and the 5*-GC step of G11/G25 are shown against time (Fig. 6b). Spermine stays in the G9/G27 step from 250 to 350 ps
/ m4849$9227
11-30-95 08:01:16
arcas
FIG. 7. Spermine–DNA distances (shown as running averages over 4-ps windows) extracted from the gas-phase molecular dynamics simulation of the (GC)9/four spermine system between the midpoint of the two central nitrogen atoms (N5 and N10) of the (a) spermine I, (b) spermine II, (c) spermine III, and (d) spermine IV and the major groove (bold line) or minor groove (light line) marker atoms (O6 and N2, respectively) of the guanine closest to the respective spermine molecule at a given time point.
AP: Archives
44
YUKI ET AL.
FIG. 8. Superimposed plot of spermine molecules I, III, and IV from 80 to 800 ps taken at 80-ps intervals.
the same 5*-GC steps, each of which are separated by an unoccupied 5*-GC step. Specifically, these molecules were binding to G9/G27, G13/G23, and G5/G31 steps, respectively. This is shown in Fig. 8, and is in contrast to the single spermine simulation, in which the spermine is able to freely move from one 5*-GC step to another. As discussed below, this provides us with an insight into the observed cooperativity of the spermine interaction with poly(dGdC)2 . DISCUSSION
The nature of the DNA–spermine interaction has received considerable attention, but the exact manner in which spermine binds to DNA is still unresolved. Our experimental data are suggestive of a favorable interaction of spermine at a 5*-GC step in the DNA major groove, based on the observed inhibition of the DZQ crosslink formation at such a step. Computational results support this, suggesting that spermine can locate this binding site in a random sequence DNA duplex and remain bound in this position for some time. Although our computational approach is rather simplified (particularly in the omission of explicit water molecules), and hence some caution is required in drawing definitive conclusions from the data, the general agreement with experiment provides us with some confidence in the simulation. Application of the same computational approach to
/ m4849$9227
11-30-95 08:01:16
arcas
a GC-alternating helix, with first one and then four spermine molecules in the system, provided us with some insights into the spermine–GC interaction. It has been suggested (26) that spermine makes contacts with the bases when bound to a GC-alternating sequence and that, based on uv data, a change of binding regime occurs at a spermine:base pair ratio (rsb) of approximately 0.2 (or one spermine every five base pairs). Equilibrium binding data (37) presented as a Scatchard plot suggest that the spermine–GC interaction is cooperative (50, 51). These data are consistent with a change in binding regime at an rsb of about 0.2, with the first binding mode being cooperative (31). A second mode, occurring once the sites of the first are saturated, is noncooperative, and has a saturated site size of about one spermine every two base pairs (31). In the multiple spermine simulation with 5*-GC, three of the four spermine molecules adopted positions at 5*-GC steps, with each of these positions separated by an unoccupied 5*-GC step. This distribution of spermine molecules four base pairs apart is consistent with the favored binding mode described above (rsb of about 0.2). Furthermore, the cooperativity exhibited by this binding mode can be rationalized by the computer simulation data. This has previously been difficult to understand, since intuitively one might expect a bound tetracationic species to make binding of a similar species to a neighboring binding site less favorable, compared to binding to an isolated site. The basis for the cooperativity lies in the preference of spermine for the 5*-GC site of the major groove (compared to, for example, the 5*-CG site, or a minor groove location) and, most importantly, the ability of neighboring spermine molecules to restrict motion away from this site, once it has been occupied. In the single spermine simulation with a GC-alternating sequence, the spermine is able to locate a 5*-GC site, but, in a similar fashion to binding to a 5*-GC site in random sequence DNA, only retains the binding location for a short period of time. For the random sequence DNA, this results in the adoption of binding sites with other base sequences. For a GC-alternating sequence, the spermine rapidly locates a neighboring 5*-GC site. However, during the transition period, the interaction between spermine and DNA is presumably weakened. In the multiple spermine simulation, each of the three spermine molecules that entered the major groove located a 5*-GC step and then retained this binding site at the specific step for the duration of the simulation. This seems to occur because motion away from the step would result in too close an approach to a neighboring spermine. Hence, overall, the thermodynamic stability of the spermine–DNA complex is increased by maximizing the time the spermine spends in the most favorable position.
AP: Archives
SPERMINE BINDING TO GC-RICH DNA
We do not want to imply that the spermine occupies a binding site in the same way as, for example, a DNA minor groove binding ligand such as netropsin, in which very specific interactions occur between the ligand and the DNA, resulting in relatively rigid complexes with fixed orientations. Rather, spermine moves around within the 5*-GC site, but may have a general preference for this region, compared to others. This preference presumably arises from the electrostatic attraction to the major groove face of the guanine bases. In our earlier interpretation of this interaction, we chose to draw a distinction between so-called ‘‘downgroove’’ binding (in which the spermine only contacts bases) and ‘‘cross-groove’’ binding, in which contacts with bases and phosphates occur (31). We now consider these modes to be interchangeable and probably indistinguishable, experimentally, with both occurring within the influence of the 5*-GC step. The conformation adopted by spermine at the 5*-GC step remains questionable. In gas-phase simulations there is a tendency for interactions to develop between the primary amines and the phosphate backbone. However, when we perform simulations on fully solvated systems, beginning from a complex similar to that shown in Fig. 8, we observe a tendency for the spermine molecules to adopt U-shaped conformations [similar to that observed by Bancroft et al. (52) with Z-DNA] with a consequent reduction of the primary amine–phosphate backbone interaction.
45
M., and Feuerstein, B. G. (1995) Cancer Chem. Pharm. 36, 411– 417. 11. Smirnov, I. V., Feuerstein, B. G., Pellarin, M., Marton, L. J., Deen, D. F., and Basu, H. S. (1994) Cell. Mol. Biol. 40, 974–980. 12. Ghoda, L., Basu, H. S., Porter, C. W., Marton, L. J., and Coffino, P. (1993) Mol. Pharmacol. 42, 302–306. 13. Basu, H. S., Pellarin, M., Feuerstein, B. G., Shirahata, A., Samejima, K., Deen, D. F., and Marton, L. J. (1993) Cancer Res. 53, 3948–3955. 14. Fernandez, C. O., Frydman, B., and Samejima, K. (1994) Cell. Mol. Biol. 40, 933–944. 15. Smirnov, I. V., Dimitrov, S. I., and Makarov, V. L. (1988) J. Biomol. Struct. Dyn. 5, 1149–1161. 16. Hougaard, D. M., Bolund, L., Fujiwara, K., and Larsson, L.-J. (1987) Eur. J. Cell Biol. 44, 151–155. 17. Basu, H. S., Sturkenboom, M. C. J. M., Delcros, J.-G., Csokan, P. P., Szollosi, Feuerstein, B. G., and Marton, L. J. (1992) Biochem. J. 282, 723–727. 18. Basu, H. S., Schwietert, H. C. A., Feuerstein, B. G., and Marton, L. J. (1990) Biochem. J. 269, 329–334. 19. Wemmer, D. E., Srvengopal, K. S., Reid, B. R., and Morris, D. R. (1985) J. Mol. Biol. 185, 457–459. 20. Padmanabhan, S., Brushaber, V. M., Anderson, C. F., and Record, M. T., Jr. (1991) Biochemistry 30, 7550–7559. 21. Andreasson, B., Nordenskiold, L., Braunlin, W. H., Schoultz, J., and Stilbs, P. (1993) Biochemistry 32, 961–967. 22. Plum, E. G., and Bloomfield, V. A. (1990). Biopolymers 29, 13– 17. 23. Stewart, K. D. (1988) Biochem. Biophys. Res. Commun. 152, 1441–1446. 24. Drew, H. R., and Dickerson, R. E. (1981) J. Mol. Biol. 151, 535– 556. 25. Hartley, J. A., Forrow, S. M., and Souhami, R. L. (1990) Biochemistry 29, 2985–2991.
ACKNOWLEDGMENTS We gratefully acknowledge the support of NIH Grant CA6429901 and grants from the Pharmaceutical Manufacturers Association and the American Association of Colleges of Pharmacy.
26. Marquet, R., and Houssier, C. (1988) J. Biomol. Struct. Dyn. 6, 235–246. 27. Feuerstein, B. G., Pattabiraman, N., and Marton, L. J. (1986) Proc. Natl. Acad. Sci. USA 3, 5948–5952. 28. Feuerstein, B. G., Pattabiraman, N., and Marton, L. J. (1989) Nucleic Acids Res. 17, 6883–6892.
REFERENCES 1. Tabor, C. W., and Tabor, H. (1984) Annu. Rev. Biochem. 53, 749– 790.
29. Feuerstein, B. G., Pattabiraman, N., and Marton, L. J. (1990) Nucleic Acids Res. 18, 1271–1282.
2. Pegg, A. E. (1988) Cancer Res. 48, 759–774.
30. Feuerstein, B. G., Williams, L. D., Basu, H. S., and Marton, L. J. (1991) J. Cell. Biochem. 46, 37–47.
3. Faaland, C. A., Laskin, J. D., and Thomas, T. J. (1995) Cell Growth Diff. 6, 115–121. 4. Redgate, E. S., Boggs, S., Grudziak, A., and Deutsch, M. (1995) J. Neuro-Oncol. 25, 167–179. 5. Pegg, A. E., Schantz, L. M., and Coleman, C. S. (1995) J. Cell. Biochem. 22, 132–138. 6. Meyskens, F. L., and Gerner, E. W. (1995) J. Cell. Biochem. 22, 126–131. 7. Heby, O., Persson, L., Holm, I., and Ask, A. (1989) ICSU Symp. Series 12, 221–226.
31. Haworth, I. S., Rodger, A., and Richards, W. G. (1991) Proc. R. Soc. London B 244, 107–116. 32. Haworth, I. S., Rodger, A., and Richards, W. G. (1992) J. Biomol. Struct. Dyn. 10, 195–211. 33. Ban, C., Ramakrishnan, B., and Sundaralingam, M. (1994) Nucleic Acids Res. 22, 5466–5476. 34. Clark, G. R., Brown, D. G., Sanderson, M. R., Chwalinski, T., Neidle, S., Veal, J. M., Jones, R. I., Wilson, W. D., Zon, G., Garman, E., and Stuart, D. I. (1990) Nucleic Acids Res. 18, 5521– 5528.
8. Guo, J. Q., Wu, Y. Q., Rattendi, D., Bacchi, C. J., and Woster, P. M. (1995) J. Med. Chem. 38, 1770–1777.
35. Behr, J. P. (1989) J. Chem. Soc. Chem. Commun. 101–103.
9. Harari, P. M., Pickart, M. A., Contreras, L., Petereit, D. G., Basu, H. S., and Marton, L. J. (1995) Int. J. Radiat. Oncol. Biol. Phys. 32, 687–694.
37. Winkle, A., and Crooks, P. A. (1988) J. Pharm. Pharmacol. 40, 809–811.
10. Bergeron, R. J., Basu, H. S., Marton, L. J., Deen, D. F., Pellarin,
38. Frederick, C. A., Williams, L. D., Ughetto, G., van der Marel,
/ m4849$9227
11-30-95 08:01:16
arcas
36. Schmid, N., and Behr, J. P. (1991) Biochemistry 30, 4357–4361.
AP: Archives
46
39.
40. 41. 42. 43. 44.
YUKI ET AL. G. A., van Boom, J. H., Rich, A., and Wang, A. J.-J. (1990) Biochemistry 29, 2538–2549. Hartley, J. A., Berardini, M., Ponti, M., Gibson, N. W., Thompson, A. S., Thurston, D. E., Hoey, B. M., and Butler, J. (1991) Biochemistry 30, 11719–11724. Lee, C.-S., Hartley, J. A., Berardini, M. D., Butler, J., Siegel, D., Ross, D., and Gibson, N. W. (1992) Biochemistry 31, 3019–3025. Berardini, M. D., Souhami, R. L., Lee, C.-S., Gibson, N. W., Butler, J., and Hartley, J. A. (1993) Biochemistry 32, 3306–3312. Yuki, M., and Haworth, I. S. (1993) Anti-Cancer Drug Des. 8, 269–287. Haworth, I. S., Lee, C.-S., Yuki, M., and Gibson, N. W. (1993) Biochemistry. 32, 12857–12863. Pearlman, D. A., Case, D. A., Caldwell, J. C., Seibel, G. L., Singh, U. C., Weiner, P., and Kollman, P. A. (1991) AMBER 4.0. University of California, San Francisco.
/ m4849$9227
11-30-95 08:01:16
arcas
45. Weiner, S. J., Kollman, P. A., Nguyen, D. T., and Case, D. A. (1986) J. Comput. Chem. 7, 230–252. 46. Dewar, M. J. S., Zoebisch, E. G., Healy, E. F., and Stewart, J. J. P. (1985) J. Am. Chem. Soc. 107, 3902. 47. Ferenczy, G. G., Reynolds, C. A., and Richards, W. G. (1990) J. Comput. Chem. 11, 159–170. 48. Oxford Molecular, Ltd. RATTLER. Magdalene Science Park, Oxford, UK. 49. Molecular Simulations, Inc. (1994) QUANTA Version 4.0. 16 New England Executive Park, Burlington, MA 01803-5297. 50. McGhee, J. D., and von Hippel, P. H. (1974) J. Mol. Biol. 86, 469–489. 51. McGhee, J. D., and von Hippel, P. H. (1976) J. Mol. Biol. 103, 679. 52. Bancroft, D., Williams, L. D., Rich, A., and Egli, M. (1994) Biochemistry 33, 1073–1086.
AP: Archives