- Email: [email protected]
CXCR3 pathway in rats
Neuroscience Letters 721 (2020) 134802
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research article
Spinal caspase-6 contributes to remifentanil-induced hyperalgesia via regulating CCL21/CXCR3 pathway in rats
T
Chunyan Wanga, Qing Lia, Zhen Jiaa, Haifang Zhanga, Yize Lia, Qi Zhaoa, Lin Sua, Yang Yua,*, Rubin Xub,* a b
Department of Anesthesiology, Tianjin Medical University General Hospital, Tianjin Research Institute of Anesthesiology, Tianjin, 300052, China Department of Anesthesiology, Tianjin First Center Hospital, Tianjin, 300192, China
ARTICLE INFO
ABSTRACT
Keywords: Caspase-6 CCL21 CXCR3 Remifentanil-induced hyperalgesia Spinal cord
Background: Neuroinflammation in the spinal cord is a pathological event in remifentanil-induced hyperalgesia (RIH), but its underlying molecular mechanisms remain unclear. Recent studies recapitulate the significance of the intracellular protease caspase-6 in the release of inflammatory mediators and synaptic plasticity in pathologic pain. Also, chemokine CCL21 is involved in microglia activation and nociceptive transduction. This study examined whether spinal caspase-6 is associated with RIH via CCL21 and its receptor CXCR3. Methods: The acute exposure to remifentanil (1 μg kg−1 min−1for 60 min) was used to establish RIH, verified by assessment of mechanical paw withdrawal threshold and thermal paw withdrawal latency. The caspase-6 inhibitor, a neutralizing antibody against CCL21 (anti-CCL21), a selective CXCR3 antagonist NBI-74330, recombinant caspase-6 and CCL21 were used for the investigation of pathogenesis as well as the prevention of hyperalgesia. The expression of caspase-6, CCL21 and CXCR3 was also evaluated by RT-qPCR and Western blot. Results: This study discovered mechanical allodynia and thermal hyperalgesia along with the increase in the expression of spinal caspase-6 and CCL21/CXCR3 after remifentanil exposure. Central caspase-6 inhibition prevented behavioral RIH and spinal up-regulation of CCL21/CXCR3 level. Intrathecal anti-CCL21 injection reduced RIH and spinal expression of CXCR3. The delivery of recombinant caspase-6 facilitated acute nociceptive hypersensitivity and increased spinal CXCR3 release in naïve rats, reversing by co-application of antiCCL21. Also, NBI-74330 attenuated RIH and exogenous CCL21-caused acute pain behaviors. Conclusion: This study highlighted that spinal caspase-6-mediated up-regulation of CCL21/CXCR3 is vital in the pathogenesis of RIH in rats.
1. Introduction Remifentanil, a potent short-acting μ-opioid receptor agonist, is widely utilized for intraoperative pain control, but its excellent analgesic effect is limited by the development of postoperative remifentanil- induced hyperalgesia (RIH) which is associated with the generation and maintenance of acute confusional state and chronic pain [1–4]. Studies illuminated that both neuroinflammation and excitatory synaptic plasticity are implicated in the pathogenesis of postoperative hyperalgesia after remifentanil infusion [5–8], although underlying molecular mechanisms remain elusive. Caspases are intracellular cysteine proteases and best known for triggering apoptosis and neurodegeneration [9]. Studies manifest that several caspases which modulate glial activation and neuroinflammation are involved in chronic pain-related syndromes [10–12]. Among
⁎
different caspases, caspase-6, localized in axons, is illustrated to participate in neuropathic pain and inflammatory pain, which may be associated with the secretion of inflammatory mediators, microglia activation and the enhancement of excitatory synaptic transmission [13–15]. It is virtually unclear whether and how caspase-6 in the spinal cord dorsal horn mediates RIH. Several reports have confirmed the contribution of chemokine-related neuron-glia communication in the neuroinflammation and pain phenomena [16–20]. Spinal CCL21, as microglia-activating factor, is over-released after peripheral nerve injury and mediates the neuronalglial interaction in the pathogenesis of neuropathic pain [21,22]. Recently, epigenetic up-regulation of CCL21 in dorsal horn neurons is implicated in the bortezomib-induced mechanical allodynia [23]. However, whether CCL21 is implicated in RIH has not yet been reported.
Corresponding authors. E-mail addresses: [email protected] (Y. Yu), [email protected] (R. Xu).
https://doi.org/10.1016/j.neulet.2020.134802 Received 7 December 2019; Received in revised form 29 January 2020; Accepted 30 January 2020 Available online 31 January 2020 0304-3940/ © 2020 Elsevier B.V. All rights reserved.
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
Hence, our present study investigated how caspase-6 regulated CCL21 and its receptor CXCR3 in RIH. In particularly, expressions of caspase-6, CCL21 and CXCR3 in the spinal dorsal horn were examined after remifentanil infusion. Furthermore, behavioral hypernociception was measured after spinal caspase-6 inhibition, pharmacologic blockage of CCL21 pathway and exogenous caspase-6 delivery. We herein identified the prominent role of caspase-6 in nociceptive transduction by mediating CCL21 pathway in RIH and demonstrated its potential as a therapeutic target to reduce RIH.
All behavioral data were collected and recorded by the same investigator to eliminate observational biases. 2.4. Western blot The animals were deeply anesthetized using sevoflurane (3 %). The L3-5 segments of the spinal cord dorsal horn were isolated rapidly and homogenized in ice-cold lysis buffer containing protease inhibitors (Sigma–Aldrich Co. MO, USA). The lysate was then centrifuged and supernatant was removed as the protein sample. The loading and blotting of equal amount of total proteins were detected and verified by using membrane with monoclonal mouse anti-β-actin antibody (1:5000; Sigma-Aldrich, MO, USA). Samples were separated on 10 % SDS-PAGE, and then transferred onto PVDF membrane. The membranes were blocked incubated overnight at 4 °C with polyclonal rabbit antibodies against rat caspase-6, CCL21 or CXCR3 (all 1:2000, Abcam, Cambridge, UK), and then developed with horseradish peroxidaseconjugated goat anti-rabbit IgG antibodies (1:2000, Jackson Immuno Research, USA) for 1 h. Membrane bound secondary antibodies were detected by using enhanced chemiluminescence solution and visualized by using a chemiluminescence imaging system (Syngene, Cambridge, UK). The results were expressed as the percentage of endogenous control (β-actin) immunoreactivity. The density of each specific band was calculated by using Gene Tools Match software (Syngene, Cambridge, UK).
2. Materials and methods 2.1. Animals Adult (8-10-week-old) male Sprague-Dawley rats were obtained from the Laboratory Animal Center of the Military Medical Science Academy of the Chinese People’s Liberation Army. Animals were housed at 23 ± 2 °C under a natural day/night cycle with ad libitum access to a standard diet and water. All animal procedures were reviewed and approved by the Institutional Animal Care and Use Committee of Tianjin Medical University (Tianjin, China). The care and treatment of experimental animals were in conformity to the International Association for the Study of Pain. Rats were acclimated for 7 days before any experiments. The investigators were blinded to the randomized grouping of the animals and treatment conditions for all the experiments. 2.2. Drugs and administration
2.5. Real-time qPCR
Remifentanil hydrochloride (RenFu Pharmaceutical Co., Yichang, China) was solubilized in saline (1 mg remifentanil in 100 ml saline) and intravenously administered 1 μg kg−1 min−1for 60 min under sevoflurane anesthesia (induction, 3.0 %; surgery, 2.0 %; Maruishi Pharmaceutical Co., Ltd., Osaka, Japan) using a nose mask. The dose of remifentanil was selected based on previous reports [6–8]. Intravenous saline was infused 0.1 ml·kg−1 min-1 for 60 min as control exposure. The caspase-6 inhibitor VEID-fmk (R&D Systems, MN, USA), a neutralizing antibody against CCL21 (anti-CCL21, R&D Systems, MN, USA), a selective CXCR3 antagonist NBI-74330 (Tocris Bioscience, Bristol, United Kingdom), recombinant caspase-6 (Abcam, Cambridge, UK), recombinant CCL21 (Abcam, Cambridge, UK) and normal saline (as control) were intrathecally injected and the doses of these drugs were chosen based on previous reports [13,14,21,23], our preliminary investigations and the manufacturers’ instructions. Under brief anesthesia with sevoflurane, intrathecal injection with reagents (10 μl) was performed through the levels of L5 and L6 using a 30 G needle, as described previously [7].
The levels of caspase-6, CCL21 and CXCR3 mRNA in the dorsal horn of spinal cord were determined. The total mRNA was extracted by using RNA 4 Aqueous kit (Ambion Inc., Austin, TX). Reverse transcriptase reaction was performed for each mRNA sample with using Retroscript kit (Ambion Inc., Austin, TX). 1 mg of total mRNA was used as template to synthesize first strand cDNA. RT-qPCR was performed with 3 independent repetitions using the API Prism 7900 H T Sequence Detection system according to the instruction of SYBER Green PCR Master Mix (Applied Biosystems, Foster city, CA). The reaction program was as follows: 2 min at 50 °C, 10 min at 95 °C, 40 cycles for 15 s at 95 °C and 60 s at 60 °C. Gene expression was calculated from the standard curve, and quantitative normalization of each sample was performed by using the expression of the GAPDH (glyceraldehydes 3-phosphate dehydrogenase), which is used as an internal control using the delta-delta-Ct method [26]. Data were presented as fold change over control. Gene primers sequences were as follows: caspase-6 Forward 5′- TCAGGGCT AGGACACCG-3′ Reverse 5′- TTGAAGATGAGGGCAACTCC-3′, CCL21 Forward 5′- CCCCGGCTGCAGGAA -3′ Reverse, 5′- TGTTCAGTTC TCT TGCAGCCC -3′, CXCR3 Forward 5′- AACAGCACCTCTC CCTACGA -3′ Reverse, 5′- TTGAAGATACGTCCCCGGAA -3′, and GAPDH Forward 5′-AACAGCAACTCCCACTCTTC-3′ Reverse 5′-CCTCTCTTGCTCA GTGT CCT-3′.
2.3. Behavioral analysis To test the mechanical sensitivity, rats were confined in elevated cages with wire mesh bottom and allowed acclimatization for 1 h. Electronic Von Frey Filaments (BSEVF3, Harvard Apparatus Co., MA, USA) were applied vertically to stimulate the plantar of the right hind paw; the experiments was repeated three times at 3-min interval at each time point as described previously [7,24,25]. The paw withdrawal threshold was determined as the mean pressure (g) of three trials: when rats shook, withdrew, or licked their paws. A maximal cut-off threshold of 40 g was set to avert the tissue damage. The hotplate (YLS-6B, Zhenghua Biological Instrument Equipment Co., Ltd, Huaibei, China) evaluated the thermal sensitivity. The time the rat spent on the hotplate at 52 °C before showing a clear paw withdrawal, shaking, or licking was recorded and measured at each time point [6–8]. The paw withdrawal latency was calculated as the average time (s) of three repeated experiments. A cut-off time of 30 s was used to avoid the damage to the hindpaws.
2.6. Statistic analysis SPSS 18.0 software (SPSS, Inc., Chicago, IL) was utilized to conduct all the statistical analyses of the data, which were presented as mean ± standard deviation (SD). Sample sizes were estimated on the basis of previous studies for similar types of behavioral and biochemical analyses [9,14]. Behavioral data were performed by two-way ANOVA with repeated measures followed by Bonferroni post hoc comparisons. The results of Western blot and RT-qPCR assay were analyzed using one-way ANOVA with Bonferroni post hoc comparisons. P < 0.05 was the criterion for statistical significance. 2
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
Fig. 1. Behavioral hyperalgesia after remifentanil infusion. (A) Development of mechanical allodynia as evaluated by paw withdrawal threshold in von Frey test after remifentanil infusion. (B) Development of thermal hyperalgesia as evaluated by paw withdrawal latency in Hotplate test after remifentanil infusion. Data were expressed as mean ± SD (n = 6). &P < 0.05 vs baseline, *P < 0.05 vs normal saline group.
3. Results
CCL21 and CXCR3 were determined after remifentanil intervention utilizing RT-qPCR assay and western blot. When compared with naïve animals, mice receiving remifentanil treatment showed the significant up-regulation in the expression of caspase-6, CCL21 and CXCR3 (both mRNA and protein) in the spinal cord dorsal horn from 2 h to 48 h after infusion (P < 0.05, n = 6 per group). All these data suggested that acute remifentanil administration induces long-lasting spinal caspase-6 secretion and CCL21/CXCR3 over-expression, which might be linked to the development of RIH.
3.1. Mechanical allodynia and thermal hyperalgesia were induced after remifentanil infusion No significant differences in the basal mechanical and thermal sensitivity was observed between the two groups (P > 0.05, n=6 per group, Fig. 1A and B). Von Frey test showed that remifentanil infusion caused a rapid (< 2 h) and persistent (> 48 h) reduction in paw withdrawal threshold (P < 0.05, n = 6 per group, Fig. 1A) in comparison with normal saline exposure, suggesting the production of mechanical allodynia due to remifentanil exposure. Simultaneously, hotplate test showed that remifentanil infusion also caused a significant decrease in paw withdrawal latency for at least 2 days (P < 0.05, n = 6 per group, Fig. 1B), indicating that a long-lasting post-infusion thermal hyperalgesia was caused after remifentanil intervention. Together, these results demonstrated that acute exposure to remifentanil induced and maintained nociceptive hypersensitivity.
3.3. Central caspase-6 inhibition reduces behavioral RIH and spinal expression of CCL21/CXCR3 To evaluate the potential role of caspase-6 in the pain transduction after remifentanil intervention, the caspase-6 inhibitor VEID-fmk (30 μg) was intrathecally injected 10 min before remifentanil infusion. As expected, the results manifested effective reversal of mechanical allodynia and thermal hyperalgesia by intrathecal pretreatment with VEID-fmk. This was reflected by a significant increase in mechanical paw withdrawal threshold and thermal paw withdrawal latency in RIH rats (P < 0.05, n = 6 per group, Fig. 3A and B). More strikingly, our data displayed that VEID-fmk following central application considerably suppressed the release of CCL21 and the production of CXCR3
3.2. Remifentanil increases caspase-6 secretion and CCL21/CXCR3 expression in the dorsal horn of spinal cord As seen in Fig. 2A–G, the mRNA and protein levels of caspase-6,
Fig. 2. Time course of caspase-6 secretion and CCL21/CXCR3 expression in the dorsal horn of spinal cord after remifentanil infusion. The spinal dorsal horn L3-5 segments were collected for RT-qPCR and western blot. Values of caspase-6 (A), CCL21 (B) and CXCR3 (C) mRNA expressions were presented as fold increase over group naïve and normalized with the expression of GAPDH. (D) Bands in western blot identified the expression of caspase-6, CCL21 and CXCR3 protein. β-actin was utilized as the internal standard. Values for the ratios of caspase-6/β-actin (E), CCL21/β-actin (F) and CXCR3/β-actin (G) were normalized with group naïve. Data were expressed as mean ± SD (n = 6). *P < 0.05; **P < 0.01 vs group naïve. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. 3
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
Fig. 3. Intrathecal inhibition of caspase-6 reduces RIH behaviors and spinal expression of CCL21/CXCR3 in RIH animals. The caspase-6 inhibitor VEID-fmk (30 μg) was intrathecally injected 10 min before remifentanil infusion. In remifentanil-treated group, normal saline as control was intrathecally injected 10 min before remifentanil infusion. Paw withdrawal threshold (A) and paw withdrawal latency (B) of the right hindpaw were assessed and recorded. The spinal dorsal horn L3-5 segments were collected at 48 h after remifentanil exposure for RT-qPCR and western blot. Values of CCL21 (C) and CXCR3 (D) mRNA expressions were presented as fold increase over group normal saline and normalized with the expression of GAPDH. (E) Bands in western blot identified the expression of CCL21 and CXCR3 protein. β-actin was utilized as the internal standard. Values for the ratios of CCL21/β-actin (F) and CXCR3/β-actin (G) were normalized with group normal saline. Data were expressed as mean ± SD (n = 6). &P < 0.05 vs baseline, #P < 0.05 vs group normal saline, *P < 0.05 vs group remifentanil.
in the dorsal horn of spinal cord (P < 0.05, n = 6 per group, Fig. 3C–G). Therefore, these detailed results identified that central (intrathecal) inhibition of caspase-6 alleviates RIH behaviors via regulating spinal expression of CCL21 and CXCR3.
further identified the association between caspase-6 and CCL21/CXCR3 signaling in central pain modulation.
3.4. Pharmacologic blockage of CCL21/CXCR3 alleviates behavioral RIH
The present study indicated the importance of spinal caspase-6 secretion in the activation of CCL21/CXCR3 pathway after acute exposure to remifentanil. This in turn underlies the pathogenesis of RIH phenotype. Specifically, mechanical allodynia and thermal hyperalgesia were detectable from 2 h to at least 48 h during the post-infusion period, which was accompanied by caspase-6 secretion and up-regulation of CCL21/CXCR3 expression in the dorsal horn of spinal cord. Furthermore, central suppression of caspase-6 ameliorated RIH phenomena and down-regulated spinal release of CCL21/CXCR3. Meanwhile, spinal inhibition of CCL21/CXCR3 signaling also impaired mechanical allodynia and thermal hyperalgesia after remifentanil treatment. Finally, exogenous caspase-6 following spinal application elicited acute pain behaviors and up-regulated CXCR3 expression, which in turn was reversed by pharmacologic blockage of CCL21. Studies have summarized the pivotal role of neuroinflammation in the generation of pathologic pain, which was associated with the release of inflammatory mediators, the activation of glial cells and the plasticity of excitatory synapses in the central nervous system [5,16,27]. The intracellular protease caspase-6 is one of most vital regulators in neuronal apoptosis and axonal degeneration [12,28]. Recently, the contribution of caspase-6 in modulating TNF-α secretion, microglia activation and synaptic transmission in the process of formalin-induced inflammatory pain has been reported [13]. The regulation of caspase-6 in nociceptors in neuropathic pain after paclitaxel injection and spared nerve injury has been validated [14]. We herein initially reported that remifentanil exhibited a rapid and persistent caspase-6 secretion in the spinal dorsal horn, in agreement with the time course of RIH phenotype. This is the first study to demonstrate that central (intrathecal) inhibition of caspase-6 pathway impairs mechanical allodynia and thermal hyperalgesia caused by remifentanil. Also, we elucidated that recombinant caspase-6 following intrathecal administration evoked temporary pain hypersensitivity. These detailed results clarified the identification of spinal caspase-6 regulation in the pathogenesis of RIH. However, how spinal caspase-6 signaling mediates
4. Discussion
To confirm the implication of CCL21 and CXCR3 in behavioral hyperalgesia after remifentanil administration, a neutralizing antibody against CCL21 (anti-CCL21) and a selective CXCR3 antagonist NBI74330 were employed to block CCL21/CXCR3 pathway. It is noteworthy that intrathecal pretreatment with anti-CCL21 (8 μg) and NBI74330 (20 μg) significantly elevated mechanical paw withdrawal threshold and thermal paw withdrawal latency (P < 0.05, n = 6 per group, Fig. 4A and B) in rats with remifentanil exposure, demonstrating the attenuation of both mechanical allodynia and thermal hyperalgesia by central (intrathecal) blockage of CCL21/CXCR3 pathway. Interestingly, our RT-qPCR and western blot results also found that the upregulation of CXCR3 in the dorsal horn of RIH animals was successfully impaired after anti-CCL21 injection (P < 0.05, n = 6 per group, Fig. 4C–E). Thus, these data identified the contribution of spinal CCL21/CXCR3 pathway in the development of RIH. 3.5. Central inhibition of CCL21 pathway reverses the caspase-6 evoked pain hypersensitivity Exogenous caspase-6 and anti-CCL21 were used to further verify the pivotal interaction between caspase-6 and CCL21 signaling in pronociceptive transmission. We reported that recombinant caspase-6 at 1 μg evoked mechanical allodynia and thermal hyperalgesia in naïve rats from 2 h to 12 h after spinal application (P < 0.05, n = 6 per group, Fig. 5A and B). Strikingly, exogenous caspase-6 following central injection elicited CXCR3 overload in the spinal cord dorsal horn (P < 0.05, n = 6 per group, Fig. 5C–E). Intriguingly, caspase-6 caused acute pain behaviors and increased CXCR3 were reversed by co-administration of anti-CCL21 at 8 μg (P < 0.05, Fig. 5). Also, intrathecal administration of exogenous CCL21 (0.1 μg) directly generated acute hyperalgesic state, which was impaired by NBI-74330 (20 μg) pretreatment (P < 0.05, n = 6 per group, Fig. 5A and B). These results 4
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
Fig. 4. Intrathecal blockage of CCL21/CXCR3 pathway impairs behavioral RIH. A neutralizing antibody against CCL21 (anti-CCL21, 8 μg) and a selective CXCR3 antagonist NBI-74330 (20 μg) was intrathecally injected 10 min before remifentanil infusion. In remifentanil-treated group, normal saline as control was intrathecally injected 10 min before remifentanil infusion. Paw withdrawal threshold (A) and paw withdrawal latency (B) of the right hindpaw were assessed and recorded. The spinal dorsal horn L3-5 segments were collected at 48 h after remifentanil exposure for RT-qPCR and western blot. (C) Values of CXCR3 mRNA expressions were presented as fold increase over group normal saline and normalized with the expression of GAPDH. (D) Bands in western blot identified the expression of CXCR3 protein. β-actin was utilized as the internal standard. Values for the ratios of CXCR3/β-actin (E) were normalized with group normal saline. Data were expressed as mean ± SD (n = 6). &P < 0.05 vs baseline, #P < 0.05 vs group normal saline, *P < 0.05 vs group remifentanil.
Fig. 5. Induction of acute pain by caspase-6 injection and reduction of caspase-6-induced allodynia by central inhibition of CCL21 pathway. Recombinant caspase-6 (1 μg) and CCL21 (0.1 μg) were intrathecally administered in naïve rats. A neutralizing antibody against CCL21 (anti-CCL21, 8 μg) was co-injected intrathecally in caspase-6-treated rats. Normal saline as control was co-injected intrathecally in caspase-6-treated rats. A selective CXCR3 antagonist NBI-74330 (20 μg) was coinjected intrathecally in CCL21-treated rats. Normal saline as control was co-injected intrathecally in CCL21-treated rats. Paw withdrawal threshold (A) and paw withdrawal latency (B) of the right hindpaw were assessed. The spinal dorsal horn L3-5 segments were collected at 12 h after caspase-6 exposure for RT-qPCR and western blot. (C) Values of CXCR3 mRNA expressions were presented as fold increase over group naïve and normalized with the expression of GAPDH. (D) Bands in western blot identified the expression of CXCR3 protein. β-actin was utilized as the internal standard. Values for the ratios of CXCR3/β-actin (E) were normalized with group naïve. Data were expressed as mean ± SD (n = 6). &P < 0.05 vs baseline, #P < 0.05 vs group naïve, ^P < 0.05 vs group caspase-6, *P < 0.05 vs group CCL21.
5
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
microglia activation and central pain sensitization following remifentanil infusion remains to be identified. Chemokines have been recognized for their critical role in neuroinflammation-associated nociceptive production [16]. Recently, CCL3 pathway is identified as one of the most important mediators in the maintenance of opioid evoked pronociception facilitation [29]. CCL7 is required for the plasticity of excitatory glutamatergic synapses and behavioral RIH via the release of IL-18 [30]. Spinal interaction between CX3CL1 and CX3CR1 is regarded as a critical step in mechanical allodynia after remifentanil exposure [31]. Here, we hypothesized that CCL21, a microglia activator, might be one downstream of caspase-6 signaling in RIH generation. For the first time, we reported that the expression of CCL21 and CXCR3 in the spinal dorsal horn was elevated during the remifentanil post-infusion period. More importantly, this is also the first report that central inhibition of CCL21 reduced RIH and spinal CXCR3 level. Also, central exposure to selective CXCR3 antagonist directly impaired RIH behaviors and exogenous CCL21-evoked acute pain hypersensitivity. This evidence identified that the interaction between CCL21 and CXCR3 is vital in the development of RIH. Next, we explored the specific interaction between caspase-6 and CCL21 pathway in pronociception transduction. Strikingly, for the first time, we elucidated that pharmacologic inhibition of caspase-6 downregulated the release of CCL21 and CXCR3 in the spinal dorsal horn. Furthermore, spinal expression of CXCR3 was increased after intrathecal injection of recombinant caspase-6. More intriguingly, caspase-6-caused acute hyperalgesic state was reversed by spinal blockage of CCL21 pathway. Collectively, these evidence strongly supported that spinal caspase-6 regulates the expression of CCL21 and CXCR3, inducing remifentanil associated post-infusion hyperalgesia. This in turn demonstrated that targeting the caspase-6 signaling might offer a novel approach for RIH management. Nonetheless, future studies are warranted to further investigate how caspase-6 mediates the activation of CCL21 pathway in nociception transmission. Additionally, it is wellknown that excitatory nociceptive synaptic plasticity depends on spinal GluA1-containing AMPA receptor activation [32–34]. Whether AMPA receptor underlies caspase-6/CCL21/CXCR3 signaling mediated central pain sensitization, however, remains to be established. In summary, spinal caspase-6 overload contributed to remifentanilinduced mechanical allodynia and thermal hyperalgesia by modulating the release of CCL21/CXCR3 in the dorsal horn of spinal cord. These new findings rendered the possibility of targeting caspase-6/CCL21/ CXCR3 pathway for RIH control and substantially benefitted patients with RIH in clinics.
References [1] D. Fletcher, V. Martinez, Opioid-induced hyperalgesia in patients after surgery: a systematic review and a meta-analysis, Br. J. Anaesth. 112 (2014) 991–1004. [2] L. Zhang, R. Shu, Q. Zhao, Y. Li, Y. Yu, G. Wang, Preoperative butorphanol and flurbiprofen axetil therapy attenuates remifentanil-induced hyperalgesia after laparoscopic gynaecological surgery: a randomized double-blind controlled trial, Br. J. Anaesth. 117 (2016) 504–511. [3] D. Araldi, L.F. Ferrari, J.D. Levine, Repeated mu-opioid exposure induces a novel form of the hyperalgesic priming model for transition to chronic pain, J. Neurosci. 35 (2015) 12502–13517. [4] L.A. Roeckel, G.M. Le Coz, C. Gavériaux-Ruff, F. Simonin, Opioid-induced hyperalgesia: cellular and molecular mechanisms, Neuroscience 338 (2016) 160–182. [5] R.R. Ji, A. Chamessian, Y.Q. Zhang, Pain regulation by non-neuronal cells and inflammation, Science 354 (2016) 572–577. [6] L.H. Yang, G.M. Xu, Y. Wang, Up-regulation of CXCL1 and CXCR2 contributes to remifentanil-induced hypernociception via modulating spinal NMDA receptor expression and phosphorylation in rats, Neurosci. Lett. 626 (2016) 135–141. [7] L. Zhang, S. Guo, Q. Zhao, Y. Li, C. Song, C. Wang, Y. Yu, G. Wang, Spinal protein kinase Mζ regulates α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking and dendritic spine plasticity via kalirin-7 in the pathogenesis of remifentanil- induced postincisional hyperalgesia in rats, Anesthesiology 129 (2018) 173–186. [8] M. Zhu, S.T. Yuan, W.L. Yu, L.L. Jia, Y. Sun, CXCL13 regulates the trafficking of GluN2B-containing NMDA receptor via IL-17 in the development of remifentanilinduced hyperalgesia in rats, Neurosci. Lett. 648 (2017) 26–33. [9] R.K. Graham, D.E. Ehrnhoefer, M.R. Hayden, Caspase-6 and neurodegeneration, Trends Neurosci. 34 (2011) 646–656. [10] S.M. Burm, E.A. Zuiderwijk-Sick, A.E. ’t Jong, C. van der Putten, J. Veth, I. Kondova, J.J. Bajramovic, Inflammasome-induced IL-1β secretion in microglia is characterized by delayed kinetics and is only partially dependent on inflammatory caspases, J. Neurosci. 35 (2015) 678–687. [11] A. Dolunay, S.P. Senol, M. Temiz-Resitoglu, D.S. Guden, A.N. Sari, S. Sahan-Firat, B. Tunctan, Inhibition of NLRP3 inflammasome prevents LPS-induced inflammatory hyperalgesia in mice: contribution of NF-κB, caspase-1/11, ASC, NOX, and NOS isoforms, Inflammation 40 (2017) 366–386. [12] M.A. Burguillos, T. Deierborg, E. Kavanagh, Persson, N. Hajji, A. Garcia-Quintanilla, J. Cano, P. Brundin, E. Englund, J.L. Venero, B. Joseph, Caspase signalling controls microglia activation and neurotoxicity, Nature 472 (2011) 319–324. [13] T. Berta, C.K. Park, Z.Z. Xu, R.G. Xie, T. Liu, N. Lü, Y.C. Liu, R.R. Ji, Extracellular caspase-6 drives murine inflammatory pain via microglial TNF-α secretion, J. Clin. Invest. 124 (2014) 1173–1186. [14] T. Berta, F.E. Perrin, M. Pertin, R. Tonello, Y.C. Liu, A. Chamessian, A.C. Kato, R.R. Ji, I. Decosterd, Gene expression profiling of cutaneous injured and non-injured nociceptors in SNI animal model of neuropathic pain, Sci. Rep. 7 (2017) 9367. [15] T. Berta, J.E. Lee, C.K. Park, Unconventional role of Caspase-6 in spinal microglia activation and chronic pain, Mediators Inflamm. 2017 (2017) 9383184. [16] R.R. Ji, Z.Z. Xu, Y.J. Gao, Neuroinflammation drives chronic pain: emerging targets with pro- and anti-inflammatory roles, Nat. Rev. Drug Discov. 13 (2014) 533–548. [17] B.C. Jiang, D.L. Cao, X. Zhang, Z.J. Zhang, L.N. He, C.H. Li, W.W. Zhang, X.B. Wu, T. Berta, R.R. Ji, Y.J. Gao, CXCL13 drives spinal astrocyte activation and neuropathic pain via CXCR5, J. Clin. Invest. 126 (2016) 745–761. [18] J. Li, G. Deng, H. Wang, M. Yang, R. Yang, X. Li, X. Zhang, H. Yuan, Interleukin-1β pre-treated bone marrow stromal cells alleviate neuropathic pain through CCL7mediated inhibition of microglial activation in the spinal cord, Sci. Rep. 7 (2017) 42260. [19] K. Kwiatkowski, K. Popiolek-Barczyk, A. Piotrowska, E. Rojewska, K. Ciapała, W. Makuch, J. Mika, Chemokines CCL2 and CCL7, but not CCL12, play a significant role in the development of pain-related behavior and opioid-induced analgesia, Cytokine 119 (2019) 202–213. [20] S. Liu, Y.P. Liu, Y. Lv, J.L. Yao, D.M. Yue, M.Y. Zhang, D.Y. Qi, G.J. Liu, IL-18 contributes to bone cancer pain by regulating glia cells and neuron interaction, J. Pain 19 (2018) 186–195. [21] K. Biber, M. Tsuda, H. Tozaki-Saitoh, K. Tsukamoto, E. Toyomitsu, T. Masuda, H. Boddeke, K. Inoue, Neuronal CCL21 up-regulates microglia P2X4 expression and initiates neuropathic pain development, EMBO J. 30 (2011) 1864–1873. [22] K. Schmitz, G. Pickert, N. Wijnvoord, A. Häussler, I. Tegeder, Dichotomy of CCL21 and CXCR3 in nerve injury-evoked and autoimmunity-evoked hyperalgesia, Brain Behav. Immun. 32 (2013) 186–200. [23] Y. Zheng, Y. Sun, Y. Yang, S. Zhang, T. Xu, W. Xin, S. Wu, X. Zhang, GATA3-dependent epigenetic upregulation of CCL21 is involved in the development of neuropathic pain induced by bortezomib, Mol. Pain 15 (2019) 1744806919863292. [24] L. Zhang, R. Shu, H. Wang, Y. Yu, C. Wang, M. Yang, M. Wang, G. Wang, Hydrogenrich saline prevents remifentanil- induced hyperalgesia and inhibits MnSOD nitration via regulation of NR2B-containing NMDA receptor in rats, Neuroscience 280 (2014) 171–180. [25] Y.Z. Li, X.H. Tang, C.Y. Wang, N. Hu, K.L. Xie, H.Y. Wang, Y.H. Yu, G.L. Wang, Glycogen synthase kinase-3β inhibition prevents remifentanil-induced postoperative hyperalgesia via regulating the expression and function of AMPA receptors, Anesth. Analg. 119 (2014) 978–987. [26] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative CT method, Nat. Protocols 3 (2008) 1101–1108. [27] C. Luo, T. Kuner, R. Kuner, Synaptic plasticity in pathological pain, Trends Neurosci. 37 (2014) 343–355. [28] A. Nikolaev, T. McLaughlin, D.D. O’Leary, M. Tessier-Lavigne, APP binds DR6 to
CRediT authorship contribution statement Chunyan Wang: Conceptualization, Funding acquisition, Writing original draft. Qing Li: Data curation, Project administration. Zhen Jia: Visualization, Investigation. Haifang Zhang: Visualization, Investigation. Yize Li: Formal analysis, Methodology. Qi Zhao: Visualization, Investigation. Lin Su: Software, Validation. Yang Yu: Supervision, Writing - review & editing. Rubin Xu: Visualization, Writing - review & editing. Declaration of Competing Interest The authors have declared that no conflict of interest exists. Acknowledgment This work was supported by research grants from the National Natural Science Foundation of China (81600962, 81801107, 81571077, 81500961 and 81400908). 6
Neuroscience Letters 721 (2020) 134802
C. Wang, et al. trigger axon pruning and neuron death via distinct caspases, Nature 457 (2009) 981–989. [29] N. Li, L. Zhang, R. Shu, L. Ding, Z. Wang, H. Wang, Y. Yu, G. Wang, Involvment of CCL3/CCR5 signaling in dorsal root ganglion in remifentanil-induced hyperalgesia in rats, Clin. J. Pain 32 (2016) 702–710. [30] Z. Qiang, W. Yu, Chemokine CCL7 regulates spinal phosphorylation of GluA1containing AMPA receptor via interleukin-18 in remifentanil-induced hyperalgesia in rats, Neurosci. Lett. 711 (2019) 134440. [31] G. Gong, L. Hu, F. Qin, L. Yin, X. Yi, L. Yuan, W. Wu, Spinal WNT pathway contributes to remifentanil induced hyperalgesia through regulating fractalkine and
CX3CR1 in rats, Neurosci. Lett. 633 (2016) 21–27. [32] O. Kopach, V. Krotov, P. Belan, N. Voitenko, Inflammatory-induced changes in synaptic drive and postsynaptic AMPARs in lamina II dorsal horn neurons are celltype specific, Pain. 156 (2015) 428–438. [33] A. Latremoliere, C.J. Woolf, Central sensitization: a generator of pain hypersensitivity by central neural plasticity, J. Pain 10 (2009) 895–926. [34] S.G. Woodhams, R. Markus, P.R.W. Gowler, T.J. Self, V. Chapman, Cell type-specific super-resolution imaging reveals an increase in calcium-permeable AMPA receptors at spinal peptidergic terminals as an anatomical correlate of inflammatory pain, Pain 160 (2019) 2641–2650.
7
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research article
Spinal caspase-6 contributes to remifentanil-induced hyperalgesia via regulating CCL21/CXCR3 pathway in rats
T
Chunyan Wanga, Qing Lia, Zhen Jiaa, Haifang Zhanga, Yize Lia, Qi Zhaoa, Lin Sua, Yang Yua,*, Rubin Xub,* a b
Department of Anesthesiology, Tianjin Medical University General Hospital, Tianjin Research Institute of Anesthesiology, Tianjin, 300052, China Department of Anesthesiology, Tianjin First Center Hospital, Tianjin, 300192, China
ARTICLE INFO
ABSTRACT
Keywords: Caspase-6 CCL21 CXCR3 Remifentanil-induced hyperalgesia Spinal cord
Background: Neuroinflammation in the spinal cord is a pathological event in remifentanil-induced hyperalgesia (RIH), but its underlying molecular mechanisms remain unclear. Recent studies recapitulate the significance of the intracellular protease caspase-6 in the release of inflammatory mediators and synaptic plasticity in pathologic pain. Also, chemokine CCL21 is involved in microglia activation and nociceptive transduction. This study examined whether spinal caspase-6 is associated with RIH via CCL21 and its receptor CXCR3. Methods: The acute exposure to remifentanil (1 μg kg−1 min−1for 60 min) was used to establish RIH, verified by assessment of mechanical paw withdrawal threshold and thermal paw withdrawal latency. The caspase-6 inhibitor, a neutralizing antibody against CCL21 (anti-CCL21), a selective CXCR3 antagonist NBI-74330, recombinant caspase-6 and CCL21 were used for the investigation of pathogenesis as well as the prevention of hyperalgesia. The expression of caspase-6, CCL21 and CXCR3 was also evaluated by RT-qPCR and Western blot. Results: This study discovered mechanical allodynia and thermal hyperalgesia along with the increase in the expression of spinal caspase-6 and CCL21/CXCR3 after remifentanil exposure. Central caspase-6 inhibition prevented behavioral RIH and spinal up-regulation of CCL21/CXCR3 level. Intrathecal anti-CCL21 injection reduced RIH and spinal expression of CXCR3. The delivery of recombinant caspase-6 facilitated acute nociceptive hypersensitivity and increased spinal CXCR3 release in naïve rats, reversing by co-application of antiCCL21. Also, NBI-74330 attenuated RIH and exogenous CCL21-caused acute pain behaviors. Conclusion: This study highlighted that spinal caspase-6-mediated up-regulation of CCL21/CXCR3 is vital in the pathogenesis of RIH in rats.
1. Introduction Remifentanil, a potent short-acting μ-opioid receptor agonist, is widely utilized for intraoperative pain control, but its excellent analgesic effect is limited by the development of postoperative remifentanil- induced hyperalgesia (RIH) which is associated with the generation and maintenance of acute confusional state and chronic pain [1–4]. Studies illuminated that both neuroinflammation and excitatory synaptic plasticity are implicated in the pathogenesis of postoperative hyperalgesia after remifentanil infusion [5–8], although underlying molecular mechanisms remain elusive. Caspases are intracellular cysteine proteases and best known for triggering apoptosis and neurodegeneration [9]. Studies manifest that several caspases which modulate glial activation and neuroinflammation are involved in chronic pain-related syndromes [10–12]. Among
⁎
different caspases, caspase-6, localized in axons, is illustrated to participate in neuropathic pain and inflammatory pain, which may be associated with the secretion of inflammatory mediators, microglia activation and the enhancement of excitatory synaptic transmission [13–15]. It is virtually unclear whether and how caspase-6 in the spinal cord dorsal horn mediates RIH. Several reports have confirmed the contribution of chemokine-related neuron-glia communication in the neuroinflammation and pain phenomena [16–20]. Spinal CCL21, as microglia-activating factor, is over-released after peripheral nerve injury and mediates the neuronalglial interaction in the pathogenesis of neuropathic pain [21,22]. Recently, epigenetic up-regulation of CCL21 in dorsal horn neurons is implicated in the bortezomib-induced mechanical allodynia [23]. However, whether CCL21 is implicated in RIH has not yet been reported.
Corresponding authors. E-mail addresses: [email protected] (Y. Yu), [email protected] (R. Xu).
https://doi.org/10.1016/j.neulet.2020.134802 Received 7 December 2019; Received in revised form 29 January 2020; Accepted 30 January 2020 Available online 31 January 2020 0304-3940/ © 2020 Elsevier B.V. All rights reserved.
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
Hence, our present study investigated how caspase-6 regulated CCL21 and its receptor CXCR3 in RIH. In particularly, expressions of caspase-6, CCL21 and CXCR3 in the spinal dorsal horn were examined after remifentanil infusion. Furthermore, behavioral hypernociception was measured after spinal caspase-6 inhibition, pharmacologic blockage of CCL21 pathway and exogenous caspase-6 delivery. We herein identified the prominent role of caspase-6 in nociceptive transduction by mediating CCL21 pathway in RIH and demonstrated its potential as a therapeutic target to reduce RIH.
All behavioral data were collected and recorded by the same investigator to eliminate observational biases. 2.4. Western blot The animals were deeply anesthetized using sevoflurane (3 %). The L3-5 segments of the spinal cord dorsal horn were isolated rapidly and homogenized in ice-cold lysis buffer containing protease inhibitors (Sigma–Aldrich Co. MO, USA). The lysate was then centrifuged and supernatant was removed as the protein sample. The loading and blotting of equal amount of total proteins were detected and verified by using membrane with monoclonal mouse anti-β-actin antibody (1:5000; Sigma-Aldrich, MO, USA). Samples were separated on 10 % SDS-PAGE, and then transferred onto PVDF membrane. The membranes were blocked incubated overnight at 4 °C with polyclonal rabbit antibodies against rat caspase-6, CCL21 or CXCR3 (all 1:2000, Abcam, Cambridge, UK), and then developed with horseradish peroxidaseconjugated goat anti-rabbit IgG antibodies (1:2000, Jackson Immuno Research, USA) for 1 h. Membrane bound secondary antibodies were detected by using enhanced chemiluminescence solution and visualized by using a chemiluminescence imaging system (Syngene, Cambridge, UK). The results were expressed as the percentage of endogenous control (β-actin) immunoreactivity. The density of each specific band was calculated by using Gene Tools Match software (Syngene, Cambridge, UK).
2. Materials and methods 2.1. Animals Adult (8-10-week-old) male Sprague-Dawley rats were obtained from the Laboratory Animal Center of the Military Medical Science Academy of the Chinese People’s Liberation Army. Animals were housed at 23 ± 2 °C under a natural day/night cycle with ad libitum access to a standard diet and water. All animal procedures were reviewed and approved by the Institutional Animal Care and Use Committee of Tianjin Medical University (Tianjin, China). The care and treatment of experimental animals were in conformity to the International Association for the Study of Pain. Rats were acclimated for 7 days before any experiments. The investigators were blinded to the randomized grouping of the animals and treatment conditions for all the experiments. 2.2. Drugs and administration
2.5. Real-time qPCR
Remifentanil hydrochloride (RenFu Pharmaceutical Co., Yichang, China) was solubilized in saline (1 mg remifentanil in 100 ml saline) and intravenously administered 1 μg kg−1 min−1for 60 min under sevoflurane anesthesia (induction, 3.0 %; surgery, 2.0 %; Maruishi Pharmaceutical Co., Ltd., Osaka, Japan) using a nose mask. The dose of remifentanil was selected based on previous reports [6–8]. Intravenous saline was infused 0.1 ml·kg−1 min-1 for 60 min as control exposure. The caspase-6 inhibitor VEID-fmk (R&D Systems, MN, USA), a neutralizing antibody against CCL21 (anti-CCL21, R&D Systems, MN, USA), a selective CXCR3 antagonist NBI-74330 (Tocris Bioscience, Bristol, United Kingdom), recombinant caspase-6 (Abcam, Cambridge, UK), recombinant CCL21 (Abcam, Cambridge, UK) and normal saline (as control) were intrathecally injected and the doses of these drugs were chosen based on previous reports [13,14,21,23], our preliminary investigations and the manufacturers’ instructions. Under brief anesthesia with sevoflurane, intrathecal injection with reagents (10 μl) was performed through the levels of L5 and L6 using a 30 G needle, as described previously [7].
The levels of caspase-6, CCL21 and CXCR3 mRNA in the dorsal horn of spinal cord were determined. The total mRNA was extracted by using RNA 4 Aqueous kit (Ambion Inc., Austin, TX). Reverse transcriptase reaction was performed for each mRNA sample with using Retroscript kit (Ambion Inc., Austin, TX). 1 mg of total mRNA was used as template to synthesize first strand cDNA. RT-qPCR was performed with 3 independent repetitions using the API Prism 7900 H T Sequence Detection system according to the instruction of SYBER Green PCR Master Mix (Applied Biosystems, Foster city, CA). The reaction program was as follows: 2 min at 50 °C, 10 min at 95 °C, 40 cycles for 15 s at 95 °C and 60 s at 60 °C. Gene expression was calculated from the standard curve, and quantitative normalization of each sample was performed by using the expression of the GAPDH (glyceraldehydes 3-phosphate dehydrogenase), which is used as an internal control using the delta-delta-Ct method [26]. Data were presented as fold change over control. Gene primers sequences were as follows: caspase-6 Forward 5′- TCAGGGCT AGGACACCG-3′ Reverse 5′- TTGAAGATGAGGGCAACTCC-3′, CCL21 Forward 5′- CCCCGGCTGCAGGAA -3′ Reverse, 5′- TGTTCAGTTC TCT TGCAGCCC -3′, CXCR3 Forward 5′- AACAGCACCTCTC CCTACGA -3′ Reverse, 5′- TTGAAGATACGTCCCCGGAA -3′, and GAPDH Forward 5′-AACAGCAACTCCCACTCTTC-3′ Reverse 5′-CCTCTCTTGCTCA GTGT CCT-3′.
2.3. Behavioral analysis To test the mechanical sensitivity, rats were confined in elevated cages with wire mesh bottom and allowed acclimatization for 1 h. Electronic Von Frey Filaments (BSEVF3, Harvard Apparatus Co., MA, USA) were applied vertically to stimulate the plantar of the right hind paw; the experiments was repeated three times at 3-min interval at each time point as described previously [7,24,25]. The paw withdrawal threshold was determined as the mean pressure (g) of three trials: when rats shook, withdrew, or licked their paws. A maximal cut-off threshold of 40 g was set to avert the tissue damage. The hotplate (YLS-6B, Zhenghua Biological Instrument Equipment Co., Ltd, Huaibei, China) evaluated the thermal sensitivity. The time the rat spent on the hotplate at 52 °C before showing a clear paw withdrawal, shaking, or licking was recorded and measured at each time point [6–8]. The paw withdrawal latency was calculated as the average time (s) of three repeated experiments. A cut-off time of 30 s was used to avoid the damage to the hindpaws.
2.6. Statistic analysis SPSS 18.0 software (SPSS, Inc., Chicago, IL) was utilized to conduct all the statistical analyses of the data, which were presented as mean ± standard deviation (SD). Sample sizes were estimated on the basis of previous studies for similar types of behavioral and biochemical analyses [9,14]. Behavioral data were performed by two-way ANOVA with repeated measures followed by Bonferroni post hoc comparisons. The results of Western blot and RT-qPCR assay were analyzed using one-way ANOVA with Bonferroni post hoc comparisons. P < 0.05 was the criterion for statistical significance. 2
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
Fig. 1. Behavioral hyperalgesia after remifentanil infusion. (A) Development of mechanical allodynia as evaluated by paw withdrawal threshold in von Frey test after remifentanil infusion. (B) Development of thermal hyperalgesia as evaluated by paw withdrawal latency in Hotplate test after remifentanil infusion. Data were expressed as mean ± SD (n = 6). &P < 0.05 vs baseline, *P < 0.05 vs normal saline group.
3. Results
CCL21 and CXCR3 were determined after remifentanil intervention utilizing RT-qPCR assay and western blot. When compared with naïve animals, mice receiving remifentanil treatment showed the significant up-regulation in the expression of caspase-6, CCL21 and CXCR3 (both mRNA and protein) in the spinal cord dorsal horn from 2 h to 48 h after infusion (P < 0.05, n = 6 per group). All these data suggested that acute remifentanil administration induces long-lasting spinal caspase-6 secretion and CCL21/CXCR3 over-expression, which might be linked to the development of RIH.
3.1. Mechanical allodynia and thermal hyperalgesia were induced after remifentanil infusion No significant differences in the basal mechanical and thermal sensitivity was observed between the two groups (P > 0.05, n=6 per group, Fig. 1A and B). Von Frey test showed that remifentanil infusion caused a rapid (< 2 h) and persistent (> 48 h) reduction in paw withdrawal threshold (P < 0.05, n = 6 per group, Fig. 1A) in comparison with normal saline exposure, suggesting the production of mechanical allodynia due to remifentanil exposure. Simultaneously, hotplate test showed that remifentanil infusion also caused a significant decrease in paw withdrawal latency for at least 2 days (P < 0.05, n = 6 per group, Fig. 1B), indicating that a long-lasting post-infusion thermal hyperalgesia was caused after remifentanil intervention. Together, these results demonstrated that acute exposure to remifentanil induced and maintained nociceptive hypersensitivity.
3.3. Central caspase-6 inhibition reduces behavioral RIH and spinal expression of CCL21/CXCR3 To evaluate the potential role of caspase-6 in the pain transduction after remifentanil intervention, the caspase-6 inhibitor VEID-fmk (30 μg) was intrathecally injected 10 min before remifentanil infusion. As expected, the results manifested effective reversal of mechanical allodynia and thermal hyperalgesia by intrathecal pretreatment with VEID-fmk. This was reflected by a significant increase in mechanical paw withdrawal threshold and thermal paw withdrawal latency in RIH rats (P < 0.05, n = 6 per group, Fig. 3A and B). More strikingly, our data displayed that VEID-fmk following central application considerably suppressed the release of CCL21 and the production of CXCR3
3.2. Remifentanil increases caspase-6 secretion and CCL21/CXCR3 expression in the dorsal horn of spinal cord As seen in Fig. 2A–G, the mRNA and protein levels of caspase-6,
Fig. 2. Time course of caspase-6 secretion and CCL21/CXCR3 expression in the dorsal horn of spinal cord after remifentanil infusion. The spinal dorsal horn L3-5 segments were collected for RT-qPCR and western blot. Values of caspase-6 (A), CCL21 (B) and CXCR3 (C) mRNA expressions were presented as fold increase over group naïve and normalized with the expression of GAPDH. (D) Bands in western blot identified the expression of caspase-6, CCL21 and CXCR3 protein. β-actin was utilized as the internal standard. Values for the ratios of caspase-6/β-actin (E), CCL21/β-actin (F) and CXCR3/β-actin (G) were normalized with group naïve. Data were expressed as mean ± SD (n = 6). *P < 0.05; **P < 0.01 vs group naïve. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. 3
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
Fig. 3. Intrathecal inhibition of caspase-6 reduces RIH behaviors and spinal expression of CCL21/CXCR3 in RIH animals. The caspase-6 inhibitor VEID-fmk (30 μg) was intrathecally injected 10 min before remifentanil infusion. In remifentanil-treated group, normal saline as control was intrathecally injected 10 min before remifentanil infusion. Paw withdrawal threshold (A) and paw withdrawal latency (B) of the right hindpaw were assessed and recorded. The spinal dorsal horn L3-5 segments were collected at 48 h after remifentanil exposure for RT-qPCR and western blot. Values of CCL21 (C) and CXCR3 (D) mRNA expressions were presented as fold increase over group normal saline and normalized with the expression of GAPDH. (E) Bands in western blot identified the expression of CCL21 and CXCR3 protein. β-actin was utilized as the internal standard. Values for the ratios of CCL21/β-actin (F) and CXCR3/β-actin (G) were normalized with group normal saline. Data were expressed as mean ± SD (n = 6). &P < 0.05 vs baseline, #P < 0.05 vs group normal saline, *P < 0.05 vs group remifentanil.
in the dorsal horn of spinal cord (P < 0.05, n = 6 per group, Fig. 3C–G). Therefore, these detailed results identified that central (intrathecal) inhibition of caspase-6 alleviates RIH behaviors via regulating spinal expression of CCL21 and CXCR3.
further identified the association between caspase-6 and CCL21/CXCR3 signaling in central pain modulation.
3.4. Pharmacologic blockage of CCL21/CXCR3 alleviates behavioral RIH
The present study indicated the importance of spinal caspase-6 secretion in the activation of CCL21/CXCR3 pathway after acute exposure to remifentanil. This in turn underlies the pathogenesis of RIH phenotype. Specifically, mechanical allodynia and thermal hyperalgesia were detectable from 2 h to at least 48 h during the post-infusion period, which was accompanied by caspase-6 secretion and up-regulation of CCL21/CXCR3 expression in the dorsal horn of spinal cord. Furthermore, central suppression of caspase-6 ameliorated RIH phenomena and down-regulated spinal release of CCL21/CXCR3. Meanwhile, spinal inhibition of CCL21/CXCR3 signaling also impaired mechanical allodynia and thermal hyperalgesia after remifentanil treatment. Finally, exogenous caspase-6 following spinal application elicited acute pain behaviors and up-regulated CXCR3 expression, which in turn was reversed by pharmacologic blockage of CCL21. Studies have summarized the pivotal role of neuroinflammation in the generation of pathologic pain, which was associated with the release of inflammatory mediators, the activation of glial cells and the plasticity of excitatory synapses in the central nervous system [5,16,27]. The intracellular protease caspase-6 is one of most vital regulators in neuronal apoptosis and axonal degeneration [12,28]. Recently, the contribution of caspase-6 in modulating TNF-α secretion, microglia activation and synaptic transmission in the process of formalin-induced inflammatory pain has been reported [13]. The regulation of caspase-6 in nociceptors in neuropathic pain after paclitaxel injection and spared nerve injury has been validated [14]. We herein initially reported that remifentanil exhibited a rapid and persistent caspase-6 secretion in the spinal dorsal horn, in agreement with the time course of RIH phenotype. This is the first study to demonstrate that central (intrathecal) inhibition of caspase-6 pathway impairs mechanical allodynia and thermal hyperalgesia caused by remifentanil. Also, we elucidated that recombinant caspase-6 following intrathecal administration evoked temporary pain hypersensitivity. These detailed results clarified the identification of spinal caspase-6 regulation in the pathogenesis of RIH. However, how spinal caspase-6 signaling mediates
4. Discussion
To confirm the implication of CCL21 and CXCR3 in behavioral hyperalgesia after remifentanil administration, a neutralizing antibody against CCL21 (anti-CCL21) and a selective CXCR3 antagonist NBI74330 were employed to block CCL21/CXCR3 pathway. It is noteworthy that intrathecal pretreatment with anti-CCL21 (8 μg) and NBI74330 (20 μg) significantly elevated mechanical paw withdrawal threshold and thermal paw withdrawal latency (P < 0.05, n = 6 per group, Fig. 4A and B) in rats with remifentanil exposure, demonstrating the attenuation of both mechanical allodynia and thermal hyperalgesia by central (intrathecal) blockage of CCL21/CXCR3 pathway. Interestingly, our RT-qPCR and western blot results also found that the upregulation of CXCR3 in the dorsal horn of RIH animals was successfully impaired after anti-CCL21 injection (P < 0.05, n = 6 per group, Fig. 4C–E). Thus, these data identified the contribution of spinal CCL21/CXCR3 pathway in the development of RIH. 3.5. Central inhibition of CCL21 pathway reverses the caspase-6 evoked pain hypersensitivity Exogenous caspase-6 and anti-CCL21 were used to further verify the pivotal interaction between caspase-6 and CCL21 signaling in pronociceptive transmission. We reported that recombinant caspase-6 at 1 μg evoked mechanical allodynia and thermal hyperalgesia in naïve rats from 2 h to 12 h after spinal application (P < 0.05, n = 6 per group, Fig. 5A and B). Strikingly, exogenous caspase-6 following central injection elicited CXCR3 overload in the spinal cord dorsal horn (P < 0.05, n = 6 per group, Fig. 5C–E). Intriguingly, caspase-6 caused acute pain behaviors and increased CXCR3 were reversed by co-administration of anti-CCL21 at 8 μg (P < 0.05, Fig. 5). Also, intrathecal administration of exogenous CCL21 (0.1 μg) directly generated acute hyperalgesic state, which was impaired by NBI-74330 (20 μg) pretreatment (P < 0.05, n = 6 per group, Fig. 5A and B). These results 4
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
Fig. 4. Intrathecal blockage of CCL21/CXCR3 pathway impairs behavioral RIH. A neutralizing antibody against CCL21 (anti-CCL21, 8 μg) and a selective CXCR3 antagonist NBI-74330 (20 μg) was intrathecally injected 10 min before remifentanil infusion. In remifentanil-treated group, normal saline as control was intrathecally injected 10 min before remifentanil infusion. Paw withdrawal threshold (A) and paw withdrawal latency (B) of the right hindpaw were assessed and recorded. The spinal dorsal horn L3-5 segments were collected at 48 h after remifentanil exposure for RT-qPCR and western blot. (C) Values of CXCR3 mRNA expressions were presented as fold increase over group normal saline and normalized with the expression of GAPDH. (D) Bands in western blot identified the expression of CXCR3 protein. β-actin was utilized as the internal standard. Values for the ratios of CXCR3/β-actin (E) were normalized with group normal saline. Data were expressed as mean ± SD (n = 6). &P < 0.05 vs baseline, #P < 0.05 vs group normal saline, *P < 0.05 vs group remifentanil.
Fig. 5. Induction of acute pain by caspase-6 injection and reduction of caspase-6-induced allodynia by central inhibition of CCL21 pathway. Recombinant caspase-6 (1 μg) and CCL21 (0.1 μg) were intrathecally administered in naïve rats. A neutralizing antibody against CCL21 (anti-CCL21, 8 μg) was co-injected intrathecally in caspase-6-treated rats. Normal saline as control was co-injected intrathecally in caspase-6-treated rats. A selective CXCR3 antagonist NBI-74330 (20 μg) was coinjected intrathecally in CCL21-treated rats. Normal saline as control was co-injected intrathecally in CCL21-treated rats. Paw withdrawal threshold (A) and paw withdrawal latency (B) of the right hindpaw were assessed. The spinal dorsal horn L3-5 segments were collected at 12 h after caspase-6 exposure for RT-qPCR and western blot. (C) Values of CXCR3 mRNA expressions were presented as fold increase over group naïve and normalized with the expression of GAPDH. (D) Bands in western blot identified the expression of CXCR3 protein. β-actin was utilized as the internal standard. Values for the ratios of CXCR3/β-actin (E) were normalized with group naïve. Data were expressed as mean ± SD (n = 6). &P < 0.05 vs baseline, #P < 0.05 vs group naïve, ^P < 0.05 vs group caspase-6, *P < 0.05 vs group CCL21.
5
Neuroscience Letters 721 (2020) 134802
C. Wang, et al.
microglia activation and central pain sensitization following remifentanil infusion remains to be identified. Chemokines have been recognized for their critical role in neuroinflammation-associated nociceptive production [16]. Recently, CCL3 pathway is identified as one of the most important mediators in the maintenance of opioid evoked pronociception facilitation [29]. CCL7 is required for the plasticity of excitatory glutamatergic synapses and behavioral RIH via the release of IL-18 [30]. Spinal interaction between CX3CL1 and CX3CR1 is regarded as a critical step in mechanical allodynia after remifentanil exposure [31]. Here, we hypothesized that CCL21, a microglia activator, might be one downstream of caspase-6 signaling in RIH generation. For the first time, we reported that the expression of CCL21 and CXCR3 in the spinal dorsal horn was elevated during the remifentanil post-infusion period. More importantly, this is also the first report that central inhibition of CCL21 reduced RIH and spinal CXCR3 level. Also, central exposure to selective CXCR3 antagonist directly impaired RIH behaviors and exogenous CCL21-evoked acute pain hypersensitivity. This evidence identified that the interaction between CCL21 and CXCR3 is vital in the development of RIH. Next, we explored the specific interaction between caspase-6 and CCL21 pathway in pronociception transduction. Strikingly, for the first time, we elucidated that pharmacologic inhibition of caspase-6 downregulated the release of CCL21 and CXCR3 in the spinal dorsal horn. Furthermore, spinal expression of CXCR3 was increased after intrathecal injection of recombinant caspase-6. More intriguingly, caspase-6-caused acute hyperalgesic state was reversed by spinal blockage of CCL21 pathway. Collectively, these evidence strongly supported that spinal caspase-6 regulates the expression of CCL21 and CXCR3, inducing remifentanil associated post-infusion hyperalgesia. This in turn demonstrated that targeting the caspase-6 signaling might offer a novel approach for RIH management. Nonetheless, future studies are warranted to further investigate how caspase-6 mediates the activation of CCL21 pathway in nociception transmission. Additionally, it is wellknown that excitatory nociceptive synaptic plasticity depends on spinal GluA1-containing AMPA receptor activation [32–34]. Whether AMPA receptor underlies caspase-6/CCL21/CXCR3 signaling mediated central pain sensitization, however, remains to be established. In summary, spinal caspase-6 overload contributed to remifentanilinduced mechanical allodynia and thermal hyperalgesia by modulating the release of CCL21/CXCR3 in the dorsal horn of spinal cord. These new findings rendered the possibility of targeting caspase-6/CCL21/ CXCR3 pathway for RIH control and substantially benefitted patients with RIH in clinics.
References [1] D. Fletcher, V. Martinez, Opioid-induced hyperalgesia in patients after surgery: a systematic review and a meta-analysis, Br. J. Anaesth. 112 (2014) 991–1004. [2] L. Zhang, R. Shu, Q. Zhao, Y. Li, Y. Yu, G. Wang, Preoperative butorphanol and flurbiprofen axetil therapy attenuates remifentanil-induced hyperalgesia after laparoscopic gynaecological surgery: a randomized double-blind controlled trial, Br. J. Anaesth. 117 (2016) 504–511. [3] D. Araldi, L.F. Ferrari, J.D. Levine, Repeated mu-opioid exposure induces a novel form of the hyperalgesic priming model for transition to chronic pain, J. Neurosci. 35 (2015) 12502–13517. [4] L.A. Roeckel, G.M. Le Coz, C. Gavériaux-Ruff, F. Simonin, Opioid-induced hyperalgesia: cellular and molecular mechanisms, Neuroscience 338 (2016) 160–182. [5] R.R. Ji, A. Chamessian, Y.Q. Zhang, Pain regulation by non-neuronal cells and inflammation, Science 354 (2016) 572–577. [6] L.H. Yang, G.M. Xu, Y. Wang, Up-regulation of CXCL1 and CXCR2 contributes to remifentanil-induced hypernociception via modulating spinal NMDA receptor expression and phosphorylation in rats, Neurosci. Lett. 626 (2016) 135–141. [7] L. Zhang, S. Guo, Q. Zhao, Y. Li, C. Song, C. Wang, Y. Yu, G. Wang, Spinal protein kinase Mζ regulates α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking and dendritic spine plasticity via kalirin-7 in the pathogenesis of remifentanil- induced postincisional hyperalgesia in rats, Anesthesiology 129 (2018) 173–186. [8] M. Zhu, S.T. Yuan, W.L. Yu, L.L. Jia, Y. Sun, CXCL13 regulates the trafficking of GluN2B-containing NMDA receptor via IL-17 in the development of remifentanilinduced hyperalgesia in rats, Neurosci. Lett. 648 (2017) 26–33. [9] R.K. Graham, D.E. Ehrnhoefer, M.R. Hayden, Caspase-6 and neurodegeneration, Trends Neurosci. 34 (2011) 646–656. [10] S.M. Burm, E.A. Zuiderwijk-Sick, A.E. ’t Jong, C. van der Putten, J. Veth, I. Kondova, J.J. Bajramovic, Inflammasome-induced IL-1β secretion in microglia is characterized by delayed kinetics and is only partially dependent on inflammatory caspases, J. Neurosci. 35 (2015) 678–687. [11] A. Dolunay, S.P. Senol, M. Temiz-Resitoglu, D.S. Guden, A.N. Sari, S. Sahan-Firat, B. Tunctan, Inhibition of NLRP3 inflammasome prevents LPS-induced inflammatory hyperalgesia in mice: contribution of NF-κB, caspase-1/11, ASC, NOX, and NOS isoforms, Inflammation 40 (2017) 366–386. [12] M.A. Burguillos, T. Deierborg, E. Kavanagh, Persson, N. Hajji, A. Garcia-Quintanilla, J. Cano, P. Brundin, E. Englund, J.L. Venero, B. Joseph, Caspase signalling controls microglia activation and neurotoxicity, Nature 472 (2011) 319–324. [13] T. Berta, C.K. Park, Z.Z. Xu, R.G. Xie, T. Liu, N. Lü, Y.C. Liu, R.R. Ji, Extracellular caspase-6 drives murine inflammatory pain via microglial TNF-α secretion, J. Clin. Invest. 124 (2014) 1173–1186. [14] T. Berta, F.E. Perrin, M. Pertin, R. Tonello, Y.C. Liu, A. Chamessian, A.C. Kato, R.R. Ji, I. Decosterd, Gene expression profiling of cutaneous injured and non-injured nociceptors in SNI animal model of neuropathic pain, Sci. Rep. 7 (2017) 9367. [15] T. Berta, J.E. Lee, C.K. Park, Unconventional role of Caspase-6 in spinal microglia activation and chronic pain, Mediators Inflamm. 2017 (2017) 9383184. [16] R.R. Ji, Z.Z. Xu, Y.J. Gao, Neuroinflammation drives chronic pain: emerging targets with pro- and anti-inflammatory roles, Nat. Rev. Drug Discov. 13 (2014) 533–548. [17] B.C. Jiang, D.L. Cao, X. Zhang, Z.J. Zhang, L.N. He, C.H. Li, W.W. Zhang, X.B. Wu, T. Berta, R.R. Ji, Y.J. Gao, CXCL13 drives spinal astrocyte activation and neuropathic pain via CXCR5, J. Clin. Invest. 126 (2016) 745–761. [18] J. Li, G. Deng, H. Wang, M. Yang, R. Yang, X. Li, X. Zhang, H. Yuan, Interleukin-1β pre-treated bone marrow stromal cells alleviate neuropathic pain through CCL7mediated inhibition of microglial activation in the spinal cord, Sci. Rep. 7 (2017) 42260. [19] K. Kwiatkowski, K. Popiolek-Barczyk, A. Piotrowska, E. Rojewska, K. Ciapała, W. Makuch, J. Mika, Chemokines CCL2 and CCL7, but not CCL12, play a significant role in the development of pain-related behavior and opioid-induced analgesia, Cytokine 119 (2019) 202–213. [20] S. Liu, Y.P. Liu, Y. Lv, J.L. Yao, D.M. Yue, M.Y. Zhang, D.Y. Qi, G.J. Liu, IL-18 contributes to bone cancer pain by regulating glia cells and neuron interaction, J. Pain 19 (2018) 186–195. [21] K. Biber, M. Tsuda, H. Tozaki-Saitoh, K. Tsukamoto, E. Toyomitsu, T. Masuda, H. Boddeke, K. Inoue, Neuronal CCL21 up-regulates microglia P2X4 expression and initiates neuropathic pain development, EMBO J. 30 (2011) 1864–1873. [22] K. Schmitz, G. Pickert, N. Wijnvoord, A. Häussler, I. Tegeder, Dichotomy of CCL21 and CXCR3 in nerve injury-evoked and autoimmunity-evoked hyperalgesia, Brain Behav. Immun. 32 (2013) 186–200. [23] Y. Zheng, Y. Sun, Y. Yang, S. Zhang, T. Xu, W. Xin, S. Wu, X. Zhang, GATA3-dependent epigenetic upregulation of CCL21 is involved in the development of neuropathic pain induced by bortezomib, Mol. Pain 15 (2019) 1744806919863292. [24] L. Zhang, R. Shu, H. Wang, Y. Yu, C. Wang, M. Yang, M. Wang, G. Wang, Hydrogenrich saline prevents remifentanil- induced hyperalgesia and inhibits MnSOD nitration via regulation of NR2B-containing NMDA receptor in rats, Neuroscience 280 (2014) 171–180. [25] Y.Z. Li, X.H. Tang, C.Y. Wang, N. Hu, K.L. Xie, H.Y. Wang, Y.H. Yu, G.L. Wang, Glycogen synthase kinase-3β inhibition prevents remifentanil-induced postoperative hyperalgesia via regulating the expression and function of AMPA receptors, Anesth. Analg. 119 (2014) 978–987. [26] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative CT method, Nat. Protocols 3 (2008) 1101–1108. [27] C. Luo, T. Kuner, R. Kuner, Synaptic plasticity in pathological pain, Trends Neurosci. 37 (2014) 343–355. [28] A. Nikolaev, T. McLaughlin, D.D. O’Leary, M. Tessier-Lavigne, APP binds DR6 to
CRediT authorship contribution statement Chunyan Wang: Conceptualization, Funding acquisition, Writing original draft. Qing Li: Data curation, Project administration. Zhen Jia: Visualization, Investigation. Haifang Zhang: Visualization, Investigation. Yize Li: Formal analysis, Methodology. Qi Zhao: Visualization, Investigation. Lin Su: Software, Validation. Yang Yu: Supervision, Writing - review & editing. Rubin Xu: Visualization, Writing - review & editing. Declaration of Competing Interest The authors have declared that no conflict of interest exists. Acknowledgment This work was supported by research grants from the National Natural Science Foundation of China (81600962, 81801107, 81571077, 81500961 and 81400908). 6
Neuroscience Letters 721 (2020) 134802
C. Wang, et al. trigger axon pruning and neuron death via distinct caspases, Nature 457 (2009) 981–989. [29] N. Li, L. Zhang, R. Shu, L. Ding, Z. Wang, H. Wang, Y. Yu, G. Wang, Involvment of CCL3/CCR5 signaling in dorsal root ganglion in remifentanil-induced hyperalgesia in rats, Clin. J. Pain 32 (2016) 702–710. [30] Z. Qiang, W. Yu, Chemokine CCL7 regulates spinal phosphorylation of GluA1containing AMPA receptor via interleukin-18 in remifentanil-induced hyperalgesia in rats, Neurosci. Lett. 711 (2019) 134440. [31] G. Gong, L. Hu, F. Qin, L. Yin, X. Yi, L. Yuan, W. Wu, Spinal WNT pathway contributes to remifentanil induced hyperalgesia through regulating fractalkine and
CX3CR1 in rats, Neurosci. Lett. 633 (2016) 21–27. [32] O. Kopach, V. Krotov, P. Belan, N. Voitenko, Inflammatory-induced changes in synaptic drive and postsynaptic AMPARs in lamina II dorsal horn neurons are celltype specific, Pain. 156 (2015) 428–438. [33] A. Latremoliere, C.J. Woolf, Central sensitization: a generator of pain hypersensitivity by central neural plasticity, J. Pain 10 (2009) 895–926. [34] S.G. Woodhams, R. Markus, P.R.W. Gowler, T.J. Self, V. Chapman, Cell type-specific super-resolution imaging reveals an increase in calcium-permeable AMPA receptors at spinal peptidergic terminals as an anatomical correlate of inflammatory pain, Pain 160 (2019) 2641–2650.
7