SRPK1 and LBR Protein Kinases Show Identical Substrate Specificities

Biochemical and Biophysical Research Communications 255, 602– 607 (1999) Article ID bbrc.1999.0249, available online at http://www.idealibrary.com on

SRPK1 and LBR Protein Kinases Show Identical Substrate Specificities Stamatia Papoutsopoulou, Eleni Nikolakaki, and Thomas Giannakouros Laboratory of Biochemistry, School of Chemistry, Aristotelian University of Thessaloniki, Thessaloniki 54 006, Greece

Received January 19, 1999

Arginine/serine protein kinases constitute a novel class of enzymes that can modify arginine/serine (RS) dipeptide motifs. SR splicing factors that are essential for pre-mRNA splicing and the lamin B receptor (LBR), an integral protein of the inner nuclear membrane, are among the best characterized proteins that contain RS domains. Two SR Protein-specific Kinases, SRPK1 and SRPK2, have been shown to phosphorylate specifically the RS motifs of the SR family of splicing factors and play an important role in regulating both the spliceosome assembly and their intranuclear distribution, whereas an LBR-associated kinase, that specifically phosphorylates a strech of RS repeats located at the NH 2-terminal region of LBR, has been recently purified and characterized from turkey erythrocyte nuclear envelopes. Using synthetic peptides representing different regions of LBR and recombinant proteins produced in bacteria we now demonstrate that SRPK1 modifies LBR with similar kinetics and on the same sites as the LBR kinase, that are also phosphorylated in vivo. These data provide significant evidence for a new role of SRPK1 in addition to that of premRNA splicing. © 1999 Academic Press Key Words: SRPK1; LBR kinase; SR proteins; LBR.

RS protein kinases constitute a novel class of enzymes that specifically modify arginine/serine dipeptide motifs. Several proteins were found to contain RS domains that differ in length, number of arginine/ serine dipeptides and content of other amino acids (for relevant information see Ref. 1 and and an automatic update of RS domain-containing proteins under the following electronic address http://www.mann.emblheidelberg.de/Services/PeptideSearch/PeptideSearch Intro.html). A variety of in vitro and in vivo techniques including co-precipitation, yeast two-hybrid assays, Abbreviations: SR proteins, serine/arginine-rich proteins; SRPK, SR protein-specific kinase; LBR, lamin B receptor; GST, glutathione S-transferase; PAGE, polyacrylamide gel electrophoresis; PVP, polyvinylpyrrolidone. 0006-291X/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.

and far-western blots have revealed that RS regions can mediate protein-protein interactions (for review see Ref. 2). A number of RS domains were also found to infuence RNA binding (3), promote RNA-RNA annealing (4) or contain sequences that act as subcellular localization signals (5). Among the best characterized proteins that contain arginine/serine dipeptide motifs are the superfamily of arginine/serine-rich (RS) domain-containing splicing factors (for review see Ref. 6) and the lamin B receptor (LBR) (7). The so-called SR proteins are characterized by a shared phosphoepitope that cross-reacts with the monoclonal antibody mAb 104, at least one NH 2terminal RNA recognition motif and a basic COOHterminal domain rich in arginine and serine residues, often arranged in tandem repeats. Due to their RS domains SR proteins play a critical role in selecting and pairing functional splice sites and therefore they are not only essential for constitutive splicing but can also affect alternative splicing (8 –11). On the other hand LBR is an integral protein of the inner nuclear membrane that possesses a long, hydrophilic NH 2terminal domain, protruding into the nucleoplasm, eight hydrophobic segments which are predicted to span the membrane and a hydrophilic COOH-terminal domain (12, 13). Two SR Protein-specific Kinases (SRPK), SRPK1 and SRPK2 have been shown to phosphorylate specifically the RS motifs of the SR family of splicing factors and play decisive roles in spliceosome assembly and in mediating the trafficking of SR splicing factors in mammalian cells (14 –16). SRPK1 may also be responsible for the redistribution of splicing factors as cells enter mitosis (14). Furthermore mammalian Clk/Sty, considered as the prototype for a family of dualspecificity kinases (termed LAMMER kinases), was also found to interact with members of the SR family of splicing factors in the yeast two-hybrid system and to efficiently phosphorylate ASF/SF2 (17). However, the Clk/Sty kinase modifies, at least in vitro, not only Ser/ Arg but also Ser/Lys and Ser/Pro sites, suggesting that the enzyme has a broader substrate specificity than

602

Vol. 255, No. 3, 1999

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

SRPKs (18, 19). In regard to LBR phosphorylation we have recently purified and characterized from turkey erythrocyte nuclear envelopes an LBR-associated kinase that specifically phosphorylates a strech of RS repeats located at the NH 2-terminal region of LBR (20 –22). The enzyme co-isolates with LBR, participating in a subassembly of nuclear envelope proteins termed “the LBR complex”, and regulates interactions between LBR and its partners (20, 21). Given that the members of this protein kinase family phosphorylate the same consensus and exhibit similar mode of action—in terms that they regulate proteinprotein interactions—we sought to investigate more systematically the substrate specificities of both SRPK1 and LBR kinase in order to elucidate their respective roles in vivo. A set of peptides from the NH 2-terminal domain of LBR as well as mutations of individual serine residues within this domain were employed to demonstrate that SRPK1 and the LBR kinase phosphorylate identical sites in this substrate. Our data clearly show that SRPK1 can phosphorylate proteins in addition to known components of the splicing machinery and that specific serine residues of a common protein substrate are modified with the same kinetics by both kinases. MATERIALS AND METHODS Cloning of human SRPK1. RNA from HeLa cells was isolated using the guanidinium/isothiocyanate protocol (23). Poly(A) 1 RNA was selected by oligo (dT) 25 cellulose attached to Dynabeads according to the manufacturer’s instructions (Dynabeads Oligo (dT) 25; DYNAL A.S., Oslo, Norway) and used for solid-phase cDNA synthesis with Moloney murine leukemia virus reverse transcriptase (Gibco BRL, Eggenstein, Germany) for 45 min at 41°C, followed by the thermostable Thermus thermophilus reverse transcriptase (Boehringer Mannheim GMbH, Germany) for 5 min at 50°C and 10 min at 72°C. A 617 bp fragment was amplified by 30 cycles of polymerase chain reaction, using HeLa cDNA as template and two primers comprising part of the sequence of human SRPK1 (14) [sense primer 59- 370TGGGGAC ACTTTTCAACAGTATGG 393-39; antisense primer 59- 987CTCCATTTCCTCAATTTCCTGCAT 964-39]. Parameters for the first cycle of PCR were as follows: denaturation at 92°C for 1 min, annealing at 56°C for 3 min and extension at 72°C for 5 min, while for the remaining 29 cycles annealing were performed at 56°C for 40 s and extension at 72°C for 1 min. The PCR product was purified using the QIAEX gel extraction kit (QIAGEN GmbH, Hilden, Germany), sequenced and then labelled with [a- 32P] dCTP using the Multiprime DNA labelling system (Amersham, Bacacos SA, Greece). This labelled fragment was subsequently used to screen a Lambda ZAP Express human testis cDNA library (Stratagene, La Jolla, CA). 5 3 10 5 plaques were screened by hybridization of Hybond filters (Amersham), using standard procedures (24), to yield two positive clones, one of which was full-length. The sequence of both strands was determined by a series of nested deletions using unidirectional exonuclease III digestion according to the manufacturer’s instructions (double-stranded Nested deletion kit; Pharmacia Uppsala, Sweden). Construction of plasmids and expression of fusion proteins. The pGEX-2T bacterial expression vector (Pharmacia LKB Biotechnology Inc.) was used to express in E. coli human SRPK1 fused with glutathione S-transferase (GST). To this purpose oligo-nucleotides corre-

sponding to 21 nucleotides of the 59 and 39-complementary coding regions of human SRPK1 with additional Bam HI and Hind III sites at the 59 and 39 end, respectively, were prepared and polymerase chain reaction was performed as described previously (21). The product was digested with Bam HI and Hind III, repurified and cloned into the Bam HI/Hind III site of pGEX-2T. GST-SRPK1 was produced in bacteria and purified using glutathione-Sepharose (Pharmacia), as described (21). A polyclonal anti-GST antibody was raised against glutathione S-tranferase using the same immunization procedure as described previously (20). The same vector was also used to construct plasmids that encode the wild type (wtNt) and four mutated forms (wtNtA 78, wtNtA 80, wtNtA 82 and wtNtA 84) of the NH 2-terminal domain of chicken LBR (12) fused with GST (for pertinent information see reference 21). A fusion protein missing the RS motifs (deletion of residues 75-84; construct termed GST-DRSNt) was generated as described previously (21). Peptides R 0 ( 70SSPSRRSRSRSRSRSPGRPAKG 91), R 1 ( 61KQRKSQSSSSSPSRRSRSRS 80) and R 2 (78SRSRSRSPGRPAKG 91) were made at the Protein Sequencing and Peptide Synthesis Facility of the European Molecular Biology Laboratory, Heidelberg, Germany. In vitro kinase assays. RS kinase activity was determined by measuring the incorporation of PO 432 from [g- 32P]ATP (6000 Ci/mmol; ICN Pharmaceuticals Ltd, England) to electroeluted LBR or bacterially expressed mutants of the NH 2-terminal domain of chicken LBR or purified SR proteins. Routine assays were carried out at 30°C in a total volume of 25 ml containing 25 mM Tris-HCl, pH 7.5, 10 mM MgCl 2, 200 mM NaCl, 50 mM [g- 32P]ATP (6000 Ci/mmol), 1.5-5 mg of the appropriate substrate and an aliquot of the enzyme as indicated. Samples were incubated for 30 min at 30°C and the reaction was stopped by adding 5 ml of 5 X Laemmli buffer (25) and heating at 95°C for 3 min. LBR kinase was isolated from turkey erythrocyte nuclear envelopes as described (21). Electroeluted LBR was obtained from urea insoluble nuclear envelopes as described previously (21). For the determination of K m the amount of substrate in the reaction mixture was varied between 0.1 and 5 mg, and the concentration of ATP was raised to 100 mM. Incorporation of radioactivity was measured by excising the radioactive bands from an SDS-PAGE gel and scintillation counting. The K m values were calculated using the MicroCAl Origin (version 2.94) program. SR proteins were prepared from HeLa cells according to the method of Zhaler et al. (26). Phosphopeptide mapping analysis. Proteolytic peptide mapping was performed essentially as described by Luo et al. (27) and Simos and Georgatos (20). Briefly, in vitro phosphorylated GST-wtNt was run on a SDS-PAGE gel and then transferred to a nitrocellulose sheet. The radioactive GST-wtNt bands were excised, soaked in 0.5% PVP-360 (polyvinylpyrrolidone) in 100 mM acetic acid for 1 h at 37°C and washed extensively with water. The protein was digested by trypsin in 50 mM NH 4HCO 3 at 37°C, overnight. The released peptides were dried, resuspended in water and loaded on a cellulose TLC plate (Kodak). Electrophoresis (in the first dimension) was run at pH 8.9 (1% ammonium carbonate) for 1 h at 500 V; ascending chromatography (in the second dimension) was performed using as a solvent a mixture of n-butanol-pyridine-glacial acetic acid-water at a ratio of 75:50:15:60. Other methods. SDS-PAGE was performed according to Laemmli (25), using 12% gels. Dried gels were exposed to Kodak X-ray film with intensifying screens. Protein concentration was determined by the method of Bradford (28). All other chemicals were purchased from Sigma (Sigma Chemical Co., Deisenhofen, Germany).

RESULTS SRPK1 was originally cloned and characterized from HeLa cells, as a protein kinase with an apparent mo-

603

Vol. 255, No. 3, 1999

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

lecular mass of 92 kDa, and has been considered as highly specific for the serine/arginine-rich family of splicing factors (14, 15), whereas LBR kinase, that was purified and characterized from turkey erythrocyte nuclear envelopes as a protein with an apparent molecular mass of 110 kDa, modifies the RS dipeptide motifs located at the nucleoplasmic, NH 2-terminal domain of LBR (21). To determine whether LBR could also serve as substrate for SRPK1 we have isolated the complementary DNA clone of human SRPK1 and subsequently expressed the kinase in bacteria as a fusion

FIG. 1. Phosphorylation of SR proteins, LBR, GSTwtNt, and GST-DRSNt by GST-SRPK1 and purified LBR kinase. (A) SDSPAGE analysis on 10% gel and Coomassie blue staining of bacterially expressed SRPK1 fused with glutathione S-transferase. (B) Samples of ;4 mg of total SR proteins were analysed by SDS-PAGE on 13% gels and stained with Coomassie blue. The identity of the SR proteins was established by size (26). (C) In vitro phosphorylation of SR proteins, previously heated to 70°C by GST-SRPK1 (0.05 mg) and purified LBR kinase (0.012 mg). The protein level of GST-SRPK1 was based on SDS-PAGE analysis and Coomassie blue staining of the material eluted from the glutathione agarose affinity column, see Fig. 1A. No phosphorylation of heated SR proteins was observed in the absence of exogenously added kinase. (D) SDS-PAGE analysis and Coomassie Blue staining of electroeluted LBR (1.5 mg), bacterially produced GST-wtNt (5 mg), and GST-DRSNt (5 mg) (for nomenclature see text). The full-length fusion protein migrates with an apparent molecular mass of 51 kDa. The lower bands represent degradation products (see also Ye and Worman (13) and Nikolakaki et al. (21)). (E) In vitro phosphorylation of LBR and bacterially expressed proteins by GST-SRPK1 (0.05 mg). (F) In vitro phosphorylation of LBR and bacterially expressed proteins by purified LBR kinase from turkey erythrocyte nuclear envelopes (0.012 mg). Assays were performed as described under “Materials and Methods”. The samples were analyzed by SDS-PAGE on 12% gels and autoradiographed. Bars on the left indicate molecular masses (in kDa).

TABLE I

Determination of K m Values Displayed by GST-SRPK1 and LBR Kinase for the Phosphorylation of LBR and GST-wtNt K m (mM) Substrate

GST-SRPK1

LBR kinase

LBR GSTwtNt 1

0.38 6 0.13 1.19 6 0.53

0.30 6 0.09 1.31 6 0.45

Note. Phosphorylation of LBR and GSTwtNt by GST-SRPK1 (0.05 mg) and purified LBR kinase (0.012 mg) was measured as described under “Materials and Methods.” The amount of substrate in the reaction mixture was varied between 0.1 and 5 mg, and the concentration of ATP was raised to 100 mM. The calculation of the apparent K m values was based on the data from three experiments. 1 Due to the existence of the degradation products an average molecular mass of 40 kDa was assumed for GST-wtNt.

protein with GST (for details see “Materials and Methods”). An affinity purified protein of the predicted size (121 kDa; 92 kDa for SRPK1 and 27.5 kDa for GST) was obtained (Fig. 1A), altough some lower molecular weight proteins were also observed, presumably due to degradation. Further verification that the 121 kDa band corresponds to GST-SRPK1 was provided by its cross-reactivity with an anti-GST antibody (data not shown). The recombinant enzyme could efficiently phosphorylate purified LBR as well as a fusion protein consisting of GST and the NH 2-terminal domain of LBR (residues 1-205; construct termed GST-wtNt), whereas, as expexted, a similar fusion protein missing the RS motifs (deletion of residues 75-84; construct termed GST-DRS) was not phosphorylated (Fig. 1E). No activity was observed in extracts expressing the vector alone. The apparent K m values displayed by the fusion kinase for the phosphorylation of LBR and GSTwtNt were almost identical to the K m values observed for the phosphorylation of the respective substrates by purified LBR kinase (Table I). In a following step, given that SRPK1 phosphorylates multiple members of the SR family (14, 15, 18), we wished to examine the phosphorylation activity of LBR kinase using biochemically purified SR proteins as substrates. SR proteins were isolated from HeLa cells according to the protocol described by Zhaler et al. (26) and an aliquot of the purified proteins was analysed by SDS-PAGE (Fig. 1B) to confirm that the we had purified the expected proteins to near homogeneity. As shown in Fig. 1C both kinases were able to phosphorylate mainly SRp20 and SRp30a/b (the 30-kDa band contains two distinct polypeptides SRp30a and SRp30b, which correspond to ASF/SF2 and SC35, respectively) and to a lesser extent SRp40 and SRp55. The lower signals of SRp40 and SRp55 relative to SRp20 and SRp30a/b and the lack of phosphorylation of SRp75 could result from the fact that these proteins are already phosphorylated in our preparation of SR proteins.

604

Vol. 255, No. 3, 1999

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

could not be expressed in E. coli (see also Ref. 21). In agreement with our previous observations concerning the LBR kinase (21), all four mutated proteins could be phosphorylated similarly to GST-wtNt (Fig. 3B), suggesting that any one of the serine residues in the RS region of LBR may serve as phosphorylation site for SRPK1. A fusion protein consisting of GST and the RS region of LBR (residues 75-84; construct termed GSTRS) could also serve as a substrate for SRPK1 but was phosphorylated at a significantly lower extent than GST-wtNt (data not shown). The lower extent of phosphorylation, also observed in the case of the LBR kinase (see Ref. 21), is consistent with the results obtained with the peptides (Fig. 2) and is probably due to the lack of “context” information provided by sequences flanking the RS region. Two-dimensional proteolytic peptide mapping confirmed further that SRPK1 phosphorylates LBR at the same sites as the LBR kinase. Fig. 4 shows that the phosphopeptide maps of in vitro phosphorylated GSTwtNt by GST-SRPK1 and LBR kinase respectively, were practically identical. The same pattern was also

FIG. 2. Phosphorylation of purified LBR by GST-SRPK1 in the presence of different synthetic peptides. (A) Amino acid sequences of the peptides used. The relative position of the peptides in the LBR molecule is schematically indicated. Black boxes along the LBR sequence, numbered with Roman numerals, represent potential transmembrane domains. (B) 1.5 mg of electroeluted LBR were incubated with bacterially produced GST-SRPK1 (0.05 mg) in the presence of 0.5 mM of each peptide and 50 mM [g- 32P]ATP as described under “Materials and Methods”. Samples were subsequently analyzed by SDS-PAGE on a 15% gel and autoradiographed.

To further characterize the consensus recognized by SRPK1 we used a set of peptides of the NH 2-terminal domain of LBR that contained varying number of arginine-serine dipeptide motifs (Fig. 2A). Two of the peptides tested (R 2 and R 0) which contained three and five RS motifs, respectively, could be phosphorylated by GST-SRPK1 and inhibited almost completely the phosphorylation of LBR (Fig. 2B). However the third peptide (R 1) which also contained three RS dipeptide motifs but no downstream flanking sequence could not serve as substrate and affected LBR phosphorylation marginally (Fig. 2B), suggesting that SRPK1, like LBR kinase (see Ref. 21), requires a downstream sequence, flanking the RS domain. To determine more specifically the serine residues of the RS domain of LBR that are modified by SRPK1 we expressed in E. coli fusion proteins identical with GSTwtNt except that in each case one of Ser 78, Ser 80, Ser 82, Ser 84 of the RS motif was mutated to glycine or alanine. Mutation of Ser 76 to Gly resulted in a construct that

FIG. 3. Determination of the site(s) phosphorylated by SRPK1. In vitro phosphorylation of GST-wtNt, GST-DRSNt, GST-wtNtG 78, GST-wtNtA 80, GST-wtNtA 82, GST-wtNtA 84 (for nomenclature see text) by GST-SRPK1. The samples were analyzed by SDS-PAGE on 12% gels and stained with Coomassie Blue (A) or autoradiographed (B). Assays were performed as described under “Materials and Methods”. Bars on the left indicate molecular masses (in kDa). On top of the figure we show the respective RS domains of the constructs used in the in vitro phosphorylation assays.

605

Vol. 255, No. 3, 1999

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 4. Tryptic phosphopeptide analysis of GST-wtNt following in vitro phosphorylation by GST-SRPK1 and LBR kinase respectively. Analysis of phosphopeptides was carried out as described under “Materials and Methods”. Anode is on the left and cathode on the right. Origins of sample application are marked by J.

obtained by mixing equal counts of the tryptic digests (data not shown). From the sum of all these observations it can be safely concluded that SRPK1 exhibits essentially the same substrate specificity as the LBR kinase. DISCUSSION SRPK1 was originally described as a kinase highly specific for the SR-rich superfamily of splicing factors, that commit precursor mRNA to splicing and promote spliceosome assembly (14). According to a recently proposed model their phosphorylation would be required to mediate protein-protein interactions between components of the splicing machinery during spliceosome assembly, while their dephosphorylation would be necessary for the spliceosome to undergo catalysis (29). In this study we demonstrated that SRPK1 may also modify proteins outside the SR family such as LBR. Bacterially expressed SRPK1 phosphorylates LBR with similar kinetics and on the same sites as the LBR kinase that are also phosphorylated in vivo (see also Refs 20, 22). A similar K m value was also observed for the phosphorylation of ASF/SF2 by in vitro translated SRPK1 fused with a FLAG tag sequence (0.28 mM; Ref. 18), indicating that both LBR and ASF/SF2 are equally well recognized by SRPK1. A difference between the

two kinases was noted while normalizing their activities to give comparable phosphorylation of LBR and GST-wtNt. LBR kinase appeared to display greater specific activity (the specific activities were determined by dividing the kinase activities by the respective protein levels) towards both LBR and SR-rich splicing factors as compared to SRPK1 (Fig. 1). However, these quantitative estimates concerning SRPK1 and LBR kinase activities may not reflect the actual activity of the respective enzymes in vivo, since the two kinases were isolated from different sources and especially since GST-SRPK1 is susceptible to influences by the structure of the fusion protein. Furthermore the lack of a post-translational modification (i.e. phosphorylation) might be the reason for the lower activity of bacterially expressed SRPK1. In agreement with our previous observations, concerning the LBR kinase (21), any one of the serine residues in the RS region may serve as target of phosphorylation by SRPK1. Furthermore, analysis of a set of peptides of the NH 2-terminal domain of LBR, that contained varying number of arginine-serine dipeptide motifs, indicates that SRPK1, like LBR kinase, may phosphorylate RS domains containing a small number of SR dipeptides as long as those RS dipeptides are followed by a downstram flanking sequence. At present, since the cDNA for the LBR kinase has not been cloned yet, we can not exclude the possibility that SRPK1 is the LBR kinase. The apparent molecular masses of the two enzymes differ significantly (110 kDa for LBR kinase; 92 kDa for SRPK1), indicating that the two kinases are distinct. However specific posttranslational modifications may also be the reason for this difference in apparent M r or alternatively both proteins may represent isoforms arising from alternative splicing of the same transcript. In this regard it may be noted that GST-SRPK1, in contrast to the LBR kinase, was not able to bind and co-immunoprecipitate with LBR nor was it active in in situ kinase gel assays (data not shown). Previous studies have shown that one of the components of the multimeric LBR complex isolated from bird erythrocyte nuclear envelopes is p34/p32 (30), a homologue of a previously identified protein (p32) that was found to be tightly associated with ASF/SF2 (31). Taking into account the existence of RS motifs in the LBR molecule as well as the occurrence of a splicing factor-associated protein among the constituents of the LBR complex it can be speculated that LBR, alone or in combination with p34/p32, may interact with components of the splicing machinery. The presently observed data further strengthen this hypothesis and raise the possibility that phosphorylation of RS domains by SRPK1 and/or LBR kinase may function as a switch regulating the transient docking of nuclear “speckles” in the nuclear envelope, although this remains to be elucidated.

606

Vol. 255, No. 3, 1999

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

ACKNOWLEDGMENTS We thank G. Blobel, H.J. Worman and S.D. Georgatos for providing us with the LBR cDNA clone. We also thank J.G. Georgatsos and S.D. Georgatos for useful discussions and comments on the manuscript. This work was supported in part by a grant from the Greek Secretariat of Research and Technology to T. Giannakouros (PENED No 1644).

REFERENCES 1. Birney, E., Kumar, S., and Krainer, A. R. (1993) Nucleic Acids Res. 21, 5803–5816. 2. Valcarcel, J. and Green, M. R. (1996) Trends Biochem. Sci. 21, 296 –301. 3. Caceres, J. F., and Krainer A. R. (1993) EMBO J. 12, 4715– 4726. 4. Lee, C. G., Zamore, P. D., Green, M. R., and Hurwitz, J. (1993) J. Biol. Chem. 268, 13472–13478. 5. Li, H., and Bingham, P. M. (1991) Cell 67, 335–342. 6. Fu, X-D. (1995) RNA 1, 663– 680. 7. Worman, H. J., Yuan, J., Blobel, G., and Georgatos, S. D. (1988) Proc. Natl. Acad. Sci. USA 85, 8531– 8534. 8. Fu, X-D. (1993) Nature 365, 82– 85. 9. Caceres, J. F., Stamm, S., Helfman, D. M., and Krainer, A. R. (1994) Science 265, 1706 –1709. 10. Mayeda, A., and Krainer, A. R. (1992) Cell 68, 365–375. 11. Zhaler, A. M., Neugebauer, K. M., Lane, W. S., and Roth, M. B. (1993) Science 260, 219 –222. 12. Worman, H. J., Evans, C. D., and Blobel, G. (1990) J. Cell Biol. 111, 1535–1542. 13. Ye, Q. and Worman, H. J. (1994) J. Biol. Chem. 269, 11306 – 11311. 14. Gui, J-F., Lane, W. S., and Fu, X-D. (1994) Nature 369, 678 – 682.

15. Gui, J-F., Tronchere, H., Chandler, S. D., and Fu, X-D. (1994) Proc. Natl. Acad. Sci. USA 91, 10824 –10828. 16. Wang, H-Y, Lin, W., Dyck, J. A., Yeakley, J. M., Songyang, Z., Cantley, L. C., and Fu, X-D. (1998) J. Cell Biol. 140, 737–750. 17. Colwill, K., Pawson, T., Andrews, B., Prasad, J., Manley, J. L., Bell, J. C., and Duncan, P. I. (1996) EMBO J. 15, 265–275. 18. Colwill, K., Feng, L. L., Yeakley, J. M., Gish, G. D., Caceres, J. F., Pawson, T., and Fu, X-D. (1996) J. Biol. Chem. 271, 24569 – 24575. 19. Lee, K., Du, C., Horn, M., and Rabinow, L. (1996) J. Biol. Chem. 271, 27299 –27303. 20. Simos, G., and Georgatos, S. D. (1992) EMBO J. 11, 4027– 4036. 21. Nikolakaki, E., Simos, G., Georgatos, S. D., and Giannakouros, T. (1996) J. Biol. Chem. 271, 8365– 8372. 22. Nikolakaki, E., Meier, J., Simos, G., Georgatos, S. D., and Giannakouros, T. (1997) J. Biol. Chem. 272, 6208 – 6213. 23. Puissant, C., and Houdebine, L. M. (1990) BioTechniques 8, 148 –149. 24. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 25. Laemmli, U. K. (1970) Nature 227, 685– 688. 26. Zhaler, A. M., Lane, W. S., Stolk, J. A., and Roth, M. B. (1992) Genes & Dev. 6, 837– 847. 27. Luo, K., Hurley, T. R., and Sefton, B. M. (1991) Methods Enzymol. 201, 149 –152. 28. Bradford M. M. (1976) Anal. Biochem. 72, 248 –254. 29. Mermoud, J. E., Cohen, P. T. WP. T., and Lamond, A. I. (1994) EMBO J. 13, 5679 –5688. 30. Simos, G., and Georgatos, S. D. (1994) FEBS Lett. 346, 225–228. 31. Krainer, A. R., Mayeda, A., Kozak, D., and Binns, G. (1991) Cell 66, 383–394.

607