- Email: [email protected]
SSeCKS Gene Expression in Vascular Smooth Muscle Cells: Regulation by Angiotensin II and a Potential Role in the Regulation of PAI-1 Gene Expression
J Mol Cell Cardiol 32, 2207–2219 (2000) doi:10.1006/jmcc.2000.1246, available online at http://www.idealibrary.com on
SSeCKS Gene Expression in Vascular Smooth Muscle Cells: Regulation by Angiotensin II and a Potential Role in the Regulation of PAI-1 Gene Expression Stephen R. Coats, Joseph W. Covington, Ming Su, Lil M. Pabo´n-Pen˜a, Mesut Eren, Qin Hao and Douglas E. Vaughan Departments of Medicine and Pharmacology, Vanderbilt University Medical Center and Nashville VAMC, Nashville, Tennessee 37212-6300, USA (Received 17 March 2000, accepted in revised form 5 September 2000, published electronically 10 October 2000) S. R. C, J. W. C, M. S, L. M. P´ -P˜ , M. E, Q. H D. E. V. SSeCKS Gene Expression in Vascular Smooth Muscle Cells: Regulation by Angiotensin II and a Potential Role in the Regulation of PAI-1 Gene Expression. Journal of Molecular and Cellular Cardiology (2000) 32, 2207–2219. Rat aortic smooth muscle cells (RASM) express the src suppressed C-kinase substrate (SSeCKS), which is thought to be an integral regulatory component of cytoskeletal dynamics and G-protein coupled-receptor signaling modules. The specific sub-classes of growth factor receptors that regulate the genomic changes in SSeCKS expression in smooth muscle cells have not been characterized. In this study we identify SSeCKS as an angiotensin type 1 (AT1) receptordependent target gene in RASM cells treated with angiotensin II (Ang II). SSeCKS mRNA levels increase up to three-fold relative to the control within 3.5 h of Ang II treatment and are followed by a slight decrease of mRNA relative to the control levels after 24 h of stimulation. SSeCKS gene expression and plasminogen activator inhibitor-1 (PAI-1) gene expression correlate in RASM cells treated with Ang II. By co-transfecting plasmids bearing recombinant-SSeCKS and a PAI-1-promoter/luciferase reporter into Cos-1 cells, we show that alternative forms of recombinant-SSeCKS protein differentially influence PAI-1 promoter activity. These data indicate a biochemical linkage between SSeCKS activity and one or more of the cytoplasmic signaling pathways that are involved in the control of PAI-1 promoter activity. Finally, we show that the alternative forms of recombinantSSeCKS protein differentially influence cell-spreading when ectopically expressed in ras-transformed rat kidney (KNRK) fibroblasts. Taken together, our data suggest that SSeCKS interacts with intracellular signaling pathways that control cytoskeletal remodeling and extracellular matrix remodeling following Ang II stimulation of the RASM cell. 2000 Academic Press K W: Vascular smooth muscle; src-suppressed C-kinase substrate; Angiotensin II; Plasminogen activator inhibitor-1.
Introduction In mammalian arterial vessel walls, Ang II stimulates AT1 receptors, which in turn regulate important biological processes related to vascular structure and tone.1 This ligand–receptor system plays an important role in vascular hypertrophy,
proliferation and the extracellular matrix remodeling observed in blood vessels following vascular injury.2–8 Available evidence suggests that smooth muscle cell-responses to Ang II contribute to the clinical consequences of hypertension and atherosclerosis.9,10 Cultured smooth muscle cells exhibit the potential for serum-dependent vaso-
Please address all correspondence to: Douglas E. Vaughan, MD, Division of Cardiovascular Medicine, Vanderbilt University Medical Center, 315 MRBII, 2220 Pierce Ave. So., Nashville, TN 37232-6300, USA. Fax: +1615-936-1872; E-mail: [email protected]
0022–2828/00/122207+13 $35.00/0
2000 Academic Press
2208
S. R. Coats et al.
activated growth and proliferation by Ang II and associated cytokine-like serum factors.11–13 Key intracellular signal transducers such as p60c-src, phospholipase C-, ERK-1/-2, FAK and PKC are activated proximally downstream from the initial Ang II stimulation.11,12,14,15 Following Ang II stimulation, RASM cells increase expression of early response mRNAs including c-fos, c-myc, platelet-derived growth factor A-chain, tyrosine phosphatase (3CH134), PAI-1, PAI-2, monocyte chemoattractant protein-1, cationic amino acid transporters and epiregulin. These molecules and additional unidentified early response gene products are likely to play important roles in medial hypertrophy and fibroproliferative disorders.13,16–21 The Src suppressed C-kinase substrate/clone 72 (SSeCKS) was originally isolated from rat fibroblast cDNA libraries, and is the rodent homologue of the human protein, gravin.22–25 SSeCKS function has been correlated with v-src cellular transformation in rat fibroblasts.22,26 Endogenous SSeCKS gene expression is downregulated during transformation while ectopically overexpressed SSeCKS partially normalized cellular morphology and restored normal proliferation rates in transformed cells.22,26 Overexpression of SSeCKS in non-transformed fibroblasts results in a dramatic rearrangement of the actin cytoskeleton accompanied by extensive cell flattening and proliferation blockade. Molecular studies of SSeCKS have revealed biochemical and physical associations with phospholipid-dependent PKC activity, and the major PKC-dependent phosphorylation sites on SSeCKS have been mapped within the N-terminus of the protein.23,24,27 In addition, changes in the phosphorylation of SSeCKS have been correlated with cell cycle activity and mobilization of SSeCKS to the membrane ruffles and perinuclear regions.27,28 Evidence that SSeCKS can influence ERK-2 activity and integrin-independent FAK phosphorylation has been presented.29 Finally, it has recently been proposed that SSeCKS and the homologous human protein, gravin, belong to a group of regulatory molecules known as AKAPs.24,25,30 The data concerning SSeCKS/gravin implicates this protein as serving an important organizational role in cAMP-dependent and PKC-dependent processes that relate to the rearrangement of the actin cytoskeleton, cell proliferation and G-protein-coupled-receptor resensitization.22–24,26–31 In this report, we identify SSeCKS as an Ang II-inducible early gene in cultured RASM cells. Additionally, we show that angiotensin II-inducible SSeCKS gene expression correlates with Ang IIinducible plasminogen activator inhibitor-1 (PAI-
1) gene expression. We also present data that suggests a novel linkage between SSeCKS function and intracellular signaling pathways that control cytoskeletal dynamics and extracellular-matrix remodeling.
Materials and Methods Materials Ang II and bradykinin were from Bachem (Torrance, CA, USA). PMA, forskolin, genistein, fetal bovine serum and DMEM were from Sigma Chemical Co. (St. Louis, MO, USA) Dup753 was from Du Pont-Merck Pharmaceutical (Wilmington, Delaware, USA). PD123319 was obtained from ParkeDavis Pharmaceutical Co. (Ann Arbor, MI, USA).
Cell culture RASM cells were isolated as described previously.16 Cells sub-cultured 1–23 times were used for this study and were maintained in DMEM with 10% FBS, penicillin (100 units ml−1) and streptomycin (100 g ml−1). For experiments utilizing quiescent cells, serum was withdrawn from sub-confluent cultures for 24–48 h and subsequently treated as indicated in the text and figures.
Differential display RASM cells were seeded on 10-cm plates, and serum deprived for 24 h was treated with 100 n Ang II or vehicle alone for 3.5 h. Total RNA from RASM cells was extracted by standard phenol/guanidinium-isothiocyanate method as described previously32 and treated with DNase I (Promega, Madison, WI, USA). Anchored oligo-dT primers were used in combination with different arbitrary primers to perform differential display reactions as suggested by the manufacturer (GenHunter, Nashville, TN, USA). The primer combination that yielded the SSeCKS cDNA consisted of the anchor primer (5′-AAGCTTTTTTTTTTTG-3′) and the arbitrary primer (5′-AAGCTTCGACT-3′).
Northern blot analysis Total RNA was prepared from cultured RASM cells by phenol/guanidinium isothiocyanate. Ten micro-
Ang II Control of SSeCKS Gene Expression
grams of RNA was loaded per well on 1% agarose/ 2% formaldehyde gels transferred to nylon membranes, and hybridized with either [-32P]dCTP (Amersham, Piscataway, NJ, USA) random primed DNA probes or [-32P]UTP (Amersham, Piscataway, NJ, USA) labelled RNA probes as described previously.32 Blots were quantitated by phosphorimager analysis. SSeCKS mRNA levels were normalized to 18S and 28S rRNA levels or GAPDH mRNA levels.
RT-PCR analysis Total RNA was prepared from RASM cells as described above. One microgram of total RNA was subjected to reverse transcriptase PCR-analysis using the Access RT-PCR system according to the manufacturer’s instructions (Promega, Madison, WI, USA). The following primer set was used to detect SSeCKS: (5′-CCACTTCTCAAACTGGAGCATC-3′) and (5′-CAGACAAACTCCAGTATCTATC-3′). The following primer set was used to detect GAPDH: (5′-TGATGCTGGTGCTGAGTATGTCG-3′) and (5′AGTGAGCTTCCCGTTCAGCTCTG-3′). The resulting PCR products were resolved on a 5% polyacrylamide gel, visualized by staining with ethidium bromide, and the resulting bands were imaged and quantified using the UVP gel documentation system.
Antibodies The monoclonal antibody directed against an SSeCKS N-terminal peptide sequence was obtained from Transduction Laboratories. For the preparation of GST-SSeCKS fusion protein, a partial cDNA of RASM cell-SSeCKS was generated by reverse transcription-polymerase chain reaction using primers designed against fibroblast SSeCKS cDNA (GenBank accession number U23146). The sequence of the 5′ primer is as follows: (5′-GAAACGGATCCGAAGACCTTCTGAGAGTG-3′). The sequence of the 3′ primer is as follows: (5′CTGCCGGATCCTTGTTCTCTTTGACTGACTTGGTAG3′). Polyclonal antibody was prepared by immunizing a sheep against a GST-SSeCKS fusion protein bearing a carboxy-terminal fragment of RASM cell-SSeCKS (Exalpha, Boston, MA, USA) (see Fig. 6A). Multiple bleeds were obtained and yielded immune sera with high titers (>1:2000) of antiGST-SSeCKS antibody as determined by Western blots of RASM cell protein. For immunofluorescence analysis of SSeCKS in RASM cells, affinity-purified anti-SSeCKS polyclonal antibody was prepared as
2209
described previously using GST protein conjugated to glutathione sepharose beads and GST-SSeCKS protein conjugated to glutathione sepharose beads.24
Western blot analysis RASM cells were seeded in six-well dishes at approximately 2.5×105 cells per 35 mm well. Subsequently, the cells were serum-starved for 24 h and treated in triplicate with Ang II or vehicle for 6 h, 12 h or 24 h. Following treatments the cells were washed twice with PBS, and scraped in loading buffer [125 m Tris-HCL (pH 6.8), 4% SDS, 20% glycerol, 200 m DTT, 0.02% bromophenol blue]. Triplicate samples were pooled, sonicated briefly and stored at −80°C. The samples were subsequently denatured at 95°C for 2 min, spun briefly, and equal volumes of protein were loaded onto a 4% stacking/ 5% resolving polyacrylamide/SDS gel. Proteins were transferred to a nylon membrane and the membranes probed with the polyclonal anti-SSeCKS antibody (1:2000 dilution) or monoclonal anti-FAK antibody (1:500 dilution) (Transduction Laboratories, Lexington, KY, USA) to verify the equivalency of loading and provide an internal standard for the quantification of SSeCKS protein levels. The blots were washed and probed with anti-sheep IgG antibody coupled to HRP (1:10 000) or with anti-mouse IgG antibody coupled to HRP (1:10 000 dilution). Detection using luminol was performed as suggested by the manufacturer (Amersham, Piscataway, NJ, USA), and autoradiograms were analysed with the UVP gel documentation system to quantify the relative levels of SSeCKS protein.
Plasmid construction The human PAI-1 promoter-luciferase vector, pGLuc 6.4k, has been described previously.33 The construct pLacZ is pCDNA3.1His/LacZ (Invitrogen, Carlsbad, CA, USA). The full-length cDNA encoding RASM cell-SSeCKS was generated by reverse transcription-polymerase chain reaction using primers derived from the previously reported cDNA sequence of rat SSeCKS (GenBank accession number U23146). The sequence of the 5′ primer was as follows: (5′-GAATTCCAATTGGCAGGCAGTTCCACCGAGCAG3′). The sequence of the 3′ primer was as follows: (5′-AAGCTTGTCGACGCGTCGCTATGGCTGCACACCCG-3′). The resulting cDNA, in combination with a duplex oligomer encoding the flag epitope (amino acid sequence, MDYKDDDDK) was
2210
S. R. Coats et al.
ligated into the vector, pCIneo, to generate pCIFLSSeCKS. This construct encodes full-length SSeCKS with a flag epitope fused to the aminoterminus of the protein. Subsequently, an NheI/ HindIII fragment from pCIFLSSeCKS, containing the entire flag epitope-tagged-SSeCKS coding region, was subcloned into the vector pIND (Invitrogen, Carlsbad, CA, USA) to generate clone pINDFLSSeCKS. By using PCR-based site-directed mutagenesis,34 a TAA stop codon and a HindIII/ClaI restriction site were engineered into the region of pINDFLSSeCKS corresponding to nucleotides 1889– 1897 of SSeCKS. The mutated construct, pINDFLSSeCKS1889, was digested with HindIII, resulting in the removal of a fragment encoding amino acids 626–1596. The vector was then re-ligated to generate the flag epitope-tagged, carboxy-terminal deleted construct, pINDCSSeCKS. Further sitedirected mutagenesis of pINDFLSSeCKS1889 was performed to introduce a ClaI restriction endonulease site adjacent to the flag epitope. Subsequent digestion of this clone with ClaI resulted in the removal of a fragment encoding amino acids 5–626. The vector was then re-ligated to generate the flag epitope-tagged, amino-terminal deleted construct, pINDNSSeCKS. The pIND constructs were then digested with MluI, blunt-ended with T4 DNA polymerase, followed by digestion with BamHI. The resulting fragments were ligated into pQBIAdCMV5 (Quantum Biotechnologies, Montreal, Canada) that had been digested with PmeI and BamHI to generate the clones, pFLSSeCKS, pNSSeCKS, and pCSSeCKS (see Fig. 8). To confirm the proper expression of the recombinant proteins, pFLSSeCKS, pNSSeCKS, and pCSSeCKS were transfected into HEK293 cells. The resulting protein lysates were analysed by Western blotting as described above using the polyclonal anti-SSeCKS antibodies or the monoclonal anti-SSeCKS antibodies (data not shown).
Luciferase assay For transient transfection experiments in Cos-1 cells, cells were cultured in 25-mm 12-well plates in DMEM with 10% FBS, penicillin (100 units ml−1) and streptomycin (100 g ml−1). When cells reached 50–60% confluence, they were transfected using Lipofectamine Plus (Life Technologies, Grand Island, NY, USA) with 0.25 g of pGLuc 6.4k in combination with 0.25 g of either pLacZ, pFLSSeCKS, pNSSeCKS, or pCSSeCKS. Transfections proceeded in serum-free media for 3–6 h before the transfection complexes were removed
and replaced with fresh media. Cells were then incubated further for 20–72 h in serum-free DMEM or DMEM containing 10% FBS. Transfections were terminated by adding 100 l of reporter lysis buffer to each well and 20 l of lysate was used to determine luciferase activity according to the manufacturer (Promega, Madison, WI, USA).
Immunofluorescence KNRK cells were grown in single-chambered glass slides in DMEM containing 5% FBS until approximately 50–60% confluent. The cells were transfected with the 0.75 g of the appropriate plasmid constructs as indicated in Figure 8. Transfected cells were grown for 3 days, after which time the transfections were terminated by washing the cells twice with PBS, and then fixing the cells in 4% paraformaldehyde/PBS, followed by 80% methanol fixation. Fixed cells were blocked in phosphate buffered saline containing 2 g 100 ml−1 bovine serum albumin for 2 h. The blocked/fixed cells were stained with affinity purified anti-SSeCKS polyclonal antibody (1:100 dilution) in combination with either anti-flag epitope antibody (1:2000 dilution) or antibeta-galactosidase antibody (1:400 dilution). The cells were washed with PBS and stained with the second antibodies [anti-sheep, anti-IgG Cy-3 conjugate (1:300 dilution), and anti-mouse, anti-IgG Cy-2 conjugate (1:10 000 dilution)]. Fields were photographed using a ×40 objective.
Results Angiotensin II upregulates SSeCKS gene expression To identify novel candidate molecules related to Ang II-stimulated signaling, we used a differential display strategy to examine early gene expression in RASM cells. Pooled RNA isolates from RASM cells treated or not treated for 3.5 h with Ang II (100 n) were analysed by differential display, and 16 candidate cDNAs were chosen for further analysis from this initial screen (data not shown). From the selected cDNAs, a single cDNA was confirmed by Northern blotting analysis to be significantly increased (three-fold) in total RNA from cells treated with Ang II as compared to the vehicle-stimulated control sample (Fig. 1). Database analysis of an approximately 500 bp cDNA revealed identity to the extreme 3′ untranslated region of the previously cloned gene, SSeCKS, also called clone 72.22–24 As
Ang II Control of SSeCKS Gene Expression
2211
Figure 2 Dose-response of SSeCKS gene induction to Ang II. RASM cells were starved and treated with Ang II for the indicated times and doses. Total RNA was isolated and analysed by Northern blotting with a random primed SSeCKS cDNA probe.
Figure 1 Ang II induction of SSeCKS gene expression. RASM cells were starved, treated with or without Ang II for 3.5 h and total RNA was isolated. RNA was resolved on a 1% agarose/2% formaldehyde gel, transferred to a positively charged nylon membrane. A cDNA probe representing the 3′ end of SSeCKS mRNA was labeled by random priming and used to probe the blot. The images of ethidium bromide stained blots are depicted below the autoradiogram image.
judged by relative position of SSeCKS mRNA to the 28s rRNA, SSeCKS transcripts are in the 5–8 kb range, as previously described for SSeCKS mRNA in rat fibroblasts. Dose– and time–response experiments indicated that Ang II stimulation of SSeCKS expression occurred maximally between 10 n and 100 n and involved an early induction phase (3.5 h) followed by a suppression phase (24 h) (Fig. 2).
Serum-dependent SSeCKS gene induction is partially mediated by the AT1 receptor The specificity of Ang II stimulation of SSeCKS gene expression in RASM cells is evident from the failure of the vasoactive peptide bradykinin to induce SSeCKS gene expression (Fig. 3). Furthermore, the Ang II effect is mediated by an AT1 receptor-dependent pathway since Dup753 inhibits SSeCKS upregulation (Fig. 3). As expected, PAI-1 mRNA induction is mediated by the AT1 receptor pathway in RASM cells, whereas TIMP-1 and GAPDH gene expression are not appreciably modulated under
Figure 3 Ang II induction of SSeCKS gene expression is mediated by an AT1-dependent mechanism. RASM cells were serum deprived, treated with AT1-receptor antagonist (Dup753) or the AT2-receptor antagonist (PD123319) for 30 min prior to treatment with Ang II for 3.5 h. Total RNA was isolated and analysed by Northern blotting with the indicated probes (right).
these standard conditions.19 Neither SSeCKS expression nor PAI-1 expression was reduced by an AT2-receptor antagonist (Fig. 3). Additional experiments revealed that Dup753 (1 ) or genistein (10 ) significantly reduced FBS-induced SSeCKS levels to similar extents (Fig. 4A). Thus, the shortterm ability of quiescent RASM cells to yield increases in SSeCKS and PAI-1 levels is significantly dependent upon AT1 receptor activity. Further experiments were performed to evaluate the long-term effect of either an AT1 receptor antagonist (Dup753) alone or in combination with an
2212
S. R. Coats et al.
Figure 5 SSeCKS gene induction in RASM cells is influenced by culture confluency. RASM cells were plated at different dilutions (1/24, 1/16, 1/8, 1/4, and 1/2) in DMEM/10% FBS. Plates were cultured for 3 days, and culture confluency was estimated using phase contrast microscopy. RASM cell RNA was isolated and analysed by Northern blotting using a random primed SSeCKS DNA probe. Shown below the autoradiogram image is the image of the ethidium bromide stained blot.
SSeCKS gene expression in growing RASM cells (Fig. 4B). Taken together, these data demonstrate that the renin-angiotensin system contributes substantially to the regulation of SSeCKS gene expression in RASM cells.
Cell-contact induction of SSeCKS gene expression in RASM cells Figure 4 The renin–angiotensin system is an important component of serum-regulated SSeCKS gene expression in RASM cells. (A) The serum response of starved RASM cells is AT1-receptor dependent. RASM cells were starved, treated with Dup753 or genistein for 30 min, followed by treatment with FBS for 3.5 h. RNA was isolated and analysed by Northern blotting with the indicated probes. (B) Angiotensin converting enzyme inhibitor can suppress the levels of SSeCKS mRNA in growing RASM cells. RASM cells were cultured in triplicate 3.5 cm plates to approximately 60% confluency in normal growth media, then treated with Dup753 alone or in combination with captopril for 2 days. Results of RT-PCR analysis using GAPDH and SSeCKS primers are shown.
angiotensin converting enzyme inhibitor (captopril) upon SSeCKS mRNA levels in growing RASM cells (Fig. 4B). These data indicate that Dup753 combined with captopril can reduce the steady-state levels of SSeCKS mRNA to 76% the levels observed for cells treated with FBS or Dup753 alone. Based upon these experiments, we conclude that the exposure of RASM cells to AT1 receptor antagonist is sufficient to block the short-term serum response of SSeCKS gene expression (Fig. 4A), whereas an angiotensin converting enzyme inhibitor is required to attenuate the long-term serum response of
Previous studies of SSeCKS mRNA expression in rat fibroblasts have shown that baseline SSeCKS transcript levels are upregulated in confluent cultures as compared to the levels of sub-confluent cultures.28 We observed an effect of cell culture confluency on SSeCKS gene expression in RASM cells (Fig. 5). RASM cells exhibit a cell-to-cell contact-dependent induction of SSeCKS gene expression in addition to a serum-dependent or Ang II-dependent induction. The transcriptional activation of SSeCKS in RASM cells is associated with at least two pathways in this adherent cell culture; cell-tocell contact stimulation of gene expression and Gprotein-coupled receptor-mediated stimulation of gene expression.
SSeCKS protein expression in RASM cells To confirm the presence of SSeCKS protein in RASM cells, Western blotting was performed using a monoclonal antibody or a polyclonal antibody generated against the N-terminal portion and C-terminal portion respectively of rat SSeCKS (Fig. 6A). A protein blot was probed using a monoclonal antibody against the N-terminal portion of the protein (amino
Ang II Control of SSeCKS Gene Expression
2213
Figure 6 Cultured RASM cells express SSeCKS protein. (A) Illustration of antibodies used to detect rat smooth muscle cell protein. Monoclonal antibody raised against the N-terminal portion of the protein or polyclonal antibody raised against the C-terminal portion of SSeCKS used in this study. (B) Western blot analysis of RASM cell protein probed with the monoclonal anti-SSeCKS antibody. The relative position of a myosin protein marker is indicated. (C) Time course of protein expression from Ang II-treated RASM cells. Western blot analysis of RASM cell protein probed with the polyclonal anti-SSeCKS antibody. Cells were serum-starved for 24 h and treated with Ang II for the indicated times. Samples were processed as described in Materials and Methods. (D) Western blot analysis of RASM cell protein probed with the polyclonal anti-SSeCKS antibody or the monoclonal anti-SSeCKS antibody.
acid residues 48–192). The image of the protein revealed a band migrating significantly higher than a 208 kDa marker in RASM cells and at a similar mobility as a form of rat brain SSeCKS detected with the same antibody (Fig. 6B). Cellular steady state levels of SSeCKS protein are not altered in quiescent RASM cells treated with Ang II (200 n) for 6 h, 12 h or 24 h (Fig. 6C), although slight increases in endogenous SSeCKS protein levels relative to endogenous focal adhesion kinase (FAK) levels are apparent at 12 h and 24 h following Ang II treatment (Fig. 6C). We conclude that the change in SSeCKS mRNA levels in RASM cells occurs earlier and is more pronounced than the corresponding changes in SSeCKS protein levels. These observations are consistent with the previously observed SSeCKS mRNA and protein responses in rat
fibroblasts to mitogenic stimuli or phorbol esters. The Ang II induction of SSeCKS mRNA levels in RASM cells may result in post-translational alterations of the protein, such as phosphorylationstate changes, or may involve increased turnover rates of the protein rather than gross changes in the steady-state levels of the protein.27,28 Empirical studies of SSeCKS and the related human protein gravin have previously revealed one or more >200 kDa proteins in a variety of tissues and cell types when examined with polyclonal antibodies directed against the carboxy-terminal portion of recombinant SSeCKS protein.23,24,35 When RASM cell protein blots are probed with a polyclonal antibody directed against the carboxy-terminal portion of RASM cell-SSeCKS, a doublet of high molecular weight bands is observed resembling the
2214
S. R. Coats et al.
>280/290 kDa doublet seen for the fibroblast protein24 (Fig. 6D). Only the upper band is detected by the anti-SSeCKS monoclonal antibody (Fig. 6D). Based upon these data, the higher mobility SSeCKS protein band in RASM cells appears to lack the amino-terminal amino acid residues that are included within the region that is reactive to the monoclonal antibody.
SSeCKS influences PAI-1 promoter activity in Cos-1 cells As reviewed in the introduction of this report, the activation of smooth muscle cells with proatherogenic molecules, such as Ang II, leads to rapid activation of transcription of several classes of cellular products including the protease inhibitor PAI-1. We hypothesized that SSeCKS influences PAI-1 promoter activity due to the correlation of gene expression patterns observed for SSeCKS and PAI-1 mRNAs following the Ang II-induced stimulation of RASM cells (Fig. 3), and due to the evidence that the regulation of PAI-1 gene expression involves intracellular kinases that are capable of interacting with SSeCKS.19,36,37 To test this hypothesis, plasmids bearing cDNAs for alternative forms of recombinant-flag epiptope-tagged-SSeCKS were transiently co-transfected into Cos-1 cells with a plasmid bearing 6.4 kb fragment of the human PAI1 promoter fused to an ORF encoding luciferase (Fig. 7A). Ectopically expressed SSeCKS activates the PAI-1 promoter relative to the ectopically expressed negative control -galactosidase (pLacZ) in both growing or serum deprived Cos-1 cells (Fig. 7B and data not shown). In addition, the construct pNSSeCKS yielded the most potent PAI-1-promoter-activating fragment, while the construct pCSSeCKS yielded the least potent PAI-1-promoter-activating fragment (Fig. 7B). The full-length protein generated from pFLSSeCKS activated the PAI-1 promoter with a potency that was similar to the amino-terminal fragment. These data indicate that SSeCKS is capable of influencing PAI-1 promoter activity, presumably by interacting with cytoplasmic factors that modulate nuclear transcriptional activity.
RASM-cell-type SSeCKS influences cell-spreading activity in KNRK cells We examined growing and quiescent RASM cells for the presence of SSeCKS protein via indirect
immunofluorescence microscopy using affinitypurified polyclonal anti-SSeCKS antibodies. In growing RASM cells, SSeCKS is expressed in a fashion that is consistent with the expected cortical-cytoskeletal distribution and perinuclear localization of the protein (data not shown). Since one of the major recognized functional attributes of fibroblast-type SSeCKS is to control cytoskeletal architecture and cellular morphology,24,26,27,29,38 we examined the ability of RASM cell-type SSeCKS to elicit similar cytoskeletal responses. For this purpose, we used ras-transformed rat kidney fibroblast (KNRK) cells to examine the function of ectopically-expressed RASM-cell-type SSeCKS. KNRK cells exhibit a round cell morphology phenotype compared to normal rat kidney fibroblast cells and RASM cells, each type being relatively spread and flattened in morphology. In addition, KNRK cells exhibit a significant reduction in both SSeCKS mRNA levels and PAI-1 mRNA levels relative to the corresponding mRNA levels in normal rat kidney fibroblasts (data not shown). Transfection analysis in KNRK cells was performed using pLacZ, pFLSSeCKS, pNSSeCKS, and pCSSeCKS (Fig. 8). The results of these experiments demonstrate that pFLSSeCKS (Fig. 8D, E and F) and pCSSeCKS (Fig. 8J, K and L) are able to modulate cytoskeletal architecture of the KNRK cell, resulting in a spread or flattened phenotype, whereas pLacZ (Fig. 8A, B and C) and pNSSeCKS (Fig. 8G, H and I) are unable to substantially modulate the rounded morphology of the transformed KNRK cell. These data demonstrate that the amino-terminal fragment of SSeCKS (amino acid residues 5–626) confers the cell-speading activity of SSeCKS observed in these experiments. These data also reveal that the differential modulation of cell-spreading activity elicited by the SSeCKS constructs in KNRK cells (Fig. 8) correlates with the differential modulation of PAI-1 promoter activity elicited by these same constructs in Cos-1 cells (Fig. 7). This point is most clearly illustrated by comparing the transcriptional indices of FLSSeCKS and CSSeCKS with the index of NSSeCKS (Fig. 7). The lower transcriptional index in this situation correlates with the “normal” activity of FLSSeCKS or CSSeCKS to induce cell-spreading in a transformed cell-line (Fig. 8). Conversely, the higher transcriptional index of NSSeCKS correlates with the reduced ability of the protein to elicit cellspreading in a transformed cell-line, and suggests that the promoter-activating functions and the cell-spreading functions of SSeCKS are encoded within different regions of the molecule.
Ang II Control of SSeCKS Gene Expression
2215
Figure 7 Differential modulation of PAI-1 promoter activity by alternative forms of recombinant SSeCKS in Cos-1 cells. (A) Schematic representation of recombinant SSeCKS proteins expressed in transient transfection assays, and (B) a Western blot of the transiently expressed recombinant SSeCKS proteins from the cell lysates used for the luciferase assay. The blot was probed with a monoclonal anti-flag epitope antibody. Black box represents the flag epitope, open box represents the amino-terminal fragment of SSeCKS, and stippled box represents the carboxy-terminal fragment of SSeCKS. (B) Corresponding luciferase assay illustrating the relative influence of LacZ or SSeCKS constructs upon PAI1 promoter/luciferase activity. Error bars represent standard deviations derived from samples performed in triplicate. This data is representative of at least six independent experiments.
Discussion In the present study we demonstrated the ability of Ang II to induce a significant increase in the steady-state level of SSeCKS mRNA in RASM cells (Figs 1, 2 and 3). Our experiments were subsequently designed to further explore the potential of SSeCKS coupling to the Ang II system, correlating this data with experimental data from the fibroblast model system.22–24,26,27,29 Experiments using the AT1 receptor antagonist Dup753 and the angiotensin converting enzyme inhibitor, captopril, demonstrate that the renin–angiotensin system represents a significant component of the serum activity that induces SSeCKS gene expression in serum-starved RASM cells (Fig. 4A) and growing RASM cells (Fig. 4B). In addition, the activation of SSeCKS gene expression involves tyrosine kinase activation and/ or estrogen receptor-like pathways as determined
by the ability of genistein to reduce the serum response (Fig. 4A). The present study also suggests that serum factors, in addition to Ang II, are necessary to induce SSeCKS expression maximally in RASM cells (Fig. 3). We infer from the observed cell confluency effect that SSeCKS gene expression in smooth muscle cells is influenced combinatorily by specific autocrine factors (such as Ang II), and extracellular matrix components. We conclude that multiple factors are capable of influencing SSeCKS expression in RASM cells, but at the present time the hierarchy of regulatory factors is unknown. Further studies will be required to address this question. A significant finding of this study is that SSeCKS protein levels are slightly, but not dramatically, increased relative to FAK in RASM cells treated with Ang II. Furthermore, the time course for these changes of protein (12 and 24 h) is somewhat
2216
S. R. Coats et al.
Figure 8 Differential modulation of cell-spreading by alternative forms of recombinant SSeCKS in KNRK cells. KNRK cells were transfected with the indicated plasmid constructs (left). (A, D, G, J) Phase-contrast images; (B) second antibody cy-3 conjugate detection of the first antibody (anti--galactosidase); (E, H, K) second antibody cy-3 conjugate detection of the first antibody (anti-flag epitope); (C, F, I, L) second antibody cy-2 conjugate detection of the first antibody (polyclonal anti-SSeCKS antibody). Note that, in panel L, the pCSSeCKS-producing cells are not detected with the polyclonal anti-SSeCKS antibody due to the lack of reactive residues in this deletion construct.
delayed relative to the initial increases in SSeCKS mRNA levels (3.5 h). This suggests that SSeCKS protein function is likely to involve cellular changes that are prompted by Ang II during the initial 24 h following ligand stimulation. The observation that the steady-state levels of SSeCKS protein are not influenced by Ang II is in agreement with previous studies that explore the influence of serum or phorbol esters on SSeCKS expression in fibroblasts.27,28 In these studies, both serum factors and phorbol ester substantially altered SSeCKS mRNA levels and phospho-protein levels without comparably altering the steady state levels of the total SSeCKS protein. Based upon these observations, we propose that the changes in the levels of SSeCKS mRNA in RASM
cells are likely to reflect phosphorylation state changes in SSeCKS induced by Ang II by a cellular mechanism that may involve increased turnover rates of the protein. Additional studies using protein synthesis inhibitors and phosphorylation-state sensitive antibodies will be required to resolve these possibilities. Several lines of evidence support the possibility that SSeCKS can modulate cytoskeletal or transcriptional pathways. For example, increases in SSeCKS protein levels can modulate ERK-2 activation.26,29 Furthermore, prior studies have indicated that SSeCKS interacts directly with PKC, and with the RII subunit of cAMP-dependent protein kinase A.22,23,31 The experiments presented here
Ang II Control of SSeCKS Gene Expression
have demonstrated the ability of multiple forms of SSeCKS, including the full-length version of the protein, to modulate the rate of transcriptional activity of a human PAI-1 promoter-reporter construct in starved or growing Cos-1 cells (Fig. 7). The outcome of these experiments supports our hypothesis that an aspect of SSeCKS function couples to intracellular signaling pathways that influence the activation of gene targets such as PAI-1 in response to trophic stimuli such as Ang II. These experiments also suggest that in vivo mis-expression or deregulation of SSeCKS may lead to the deregulation of PAI-1 or other genes that are influenced by SSeCKS-linked cell signaling pathways. For example, the carboxyterminal fragment of SSeCKS, NSSeCKS, exhibited an increased ability to activate the PAI-1 promoter activity relative to the full-length fragment or aminoterminal fragment of SSeCKS (Fig. 7). Furthermore, these same constructs reveal the ability of the aminoterminal fragment (pCSSeCKS) of SSeCKS to recapitulate the control of cytoskeletal architecture exhibited by the full-length protein (Fig. 8). However, the carboxy-terminal fragment (pNSSeCKS) appears to be deficient in its ability to control cytoskeletal architecture (Fig. 8). The hypothetical deregulation of SSeCKS provided by our model system has not been reported to correlate with known vascular disorders in rodents or humans. However, it is noteworthy that in approximately 30% of the clinical cases of the human autoimmune disorder, myasthenia gravis, a carboxy-terminal fragment of the SSeCKS-homologue, gravin, is detected by autoantibodies in the patients’ serum.39 It may be useful to determine if the cellular pathology of these subtypes of myasthenia gravis or related autoimmune disorders involve perturbations in cell-signaling, cytoskeletal remodeling, and extracellular matrix remodeling that are due to the deregulation of SSeCKS/ gravin. The precise function of SSeCKS in vivo remains uncertain, although the available in vitro data strongly argues for a role of the protein in celladhesion, cell-spreading and mitogenic potential.24, 26,27,29,40 In addition, recent studies of the human protein, gravin, suggest a fundamental role of gravin/SSeCKS in organizing G-protein coupled-receptor signaling modules.30 Therefore, AT1 receptordependent activation of SSeCKS gene expression in RASM cells is consistent with our hypothesis that SSeCKS plays a role in AngII-mediated signaling. Accordingly, we view the genomic changes reported in this study as a molecular hallmark of SSeCKS participation in cytoskeletal changes that occur within minutes to hours following AT1 receptormediated signaling.
2217
In conclusion, Ang II stimulation of SSeCKS gene expression in RASM cells, and the ability of SSeCKS to modulate PAI-1 promoter activity in Cos-1 cells or to modulate cell-spreading in KNRK cells suggest a role for SSeCKS function in signaling pathways that regulate cytoskeletal remodeling and extracellular matrix remodeling. In the context of vascular smooth muscle cells, we hypothesize that SSeCKS function relates to molecular pathways that are activated during vascular responses to mechanical injury, hypertension or atherosclerosis.
Acknowledgements We thank Dr David M. Bader’s laboratory for outstanding technical support during the course of these studies. We also acknowledge the assistance of Dr Peng Liang and Dr David Kerins with differential display. We appreciate the assistance of Dr Heather T. Roselli for reference preparation and the VUMC Cell Imaging Resource Facility for assistance with printing the figures. This work was supported in part by NIHLBI R01 #51387 (DEV) and by NRSA #NS10040 (SRC).
References 1. G TL, E ME, C KJ. Angiotensin receptors and their antagonists. N Engl J Med 1996; 334: 1649–1654. 2. S CP, A AJ, S BL, O EH. Angiotensin type 1 receptors mediate smooth muscle proliferation and endothelin biosynthesis in rat vascular smooth muscle. J Pharmacol Exper Ther 1994; 271: 429–437. 3. P SB, W SS, P RL. Pressure mediates angiotensin II-induced arterial hypertrophy and PDGF-A expression. Hypertension 1998; 32: 452– 458. 4. H JC, H M, T MM, R LI, H TA, O GK. Angiotensin IIinduced hypertrophy of rat vascular smooth muscle is associated with increased 18 S rRNA synthesis and phosphorylation of the rRNA transcription factor, upstream binding factor. J Biol Chem 1995; 270: 25096–25101. 5. W H, T DS, M CJ. Angiotensin II induces delayed mitogenesis and cellular proliferation in rat aortic smooth muscle cells. Correlation with the expression of specific endogenous growth factors and reversal by suramin. J Clin Invest 1994; 93: 788–798. 6. M JB, D R N, P D, A S, S JL, L B. Pathophysiological role of the vascular smooth muscle cell. J Cardiovasc Pharmacol 1990; 16 (Suppl. 1): S4–S11. 7. C JH, T G, B MJ, C G,
2218
8.
9.
10.
11.
12. 13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
S. R. Coats et al.
C GR. Molecular biology of vascular hypertrophy. Basic Res Cardiol 1991; 86 (Suppl. 1): 3–11. H AD, Q WC, G JB, F EP. Angiotensin-converting enzyme inhibition suppresses plasminogen activator inhibitor-1 expression in the neointima of balloon-injured rat aorta. Circulation 1996; 93: 1073–1078. S NJ. Molecular biology of the renin-angiotensin system: implications for hypertension and beyond. J Cardiovasc Pharmacol 1991; 18 (Suppl. 2): S1–S6. L EM, Y S, J P, M TJ, T KK, B CR, P B. Emerging role of angiotensinconverting enzyme inhibitors in cardiac and vascular protection. Circulation 1994; 90: 2056–2069. S B, B KE, M MB. The role of tyrosine phosphorylation in angiotensin II mediated intracellular signaling and cell growth. J Mol Med 1996; 74: 85–91. A RW, G KK. Signal transduction in vascular smooth muscle. J Hypertens 1996; 14 (Suppl. 14(5)): S51–S54. T DS, C X, P JE, W AR, F P, M CJ. Epiregulin is a potent vascular smooth muscle cell-derived mitogen induced by angiotensin II, endothelin-1, and thrombin. Proc Nat Acad Sci USA 1999; 96: 1633–1638. D JL, B BC, C MA. Angiotensin II stimulates the pp44 and pp42 mitogen-activated protein kinases in cultured rat aortic smooth muscle cells. Biochem Biophys Res Comm 1992; 188: 257–264. H H, Q P, L C, L FC, D A. Platelet-derived growth factor and angiotensin II induce different spatial distribution of protein kinase C-alpha and -beta in vascular smooth muscle cells. Hypertension 1994; 23: 848–852. N AJ, P RE, E CS, L HL, D VJ. Angiotensin II induces c-fos expression in smooth muscle via transcriptional control. Hypertension 1989; 13: 706–711. N AJ, P RE, D VJ. Induction of platelet-derived growth factor A-chain and c-myc gene expressions by angiotensin II in cultured rat vascular smooth muscle cells. J Clin Invest 1989; 83: 1419– 1424. D JL, M MB, P WG, C CH, L LF, B KE, B BC. Angiotensin II induces 3CH134, a protein-tyrosine phosphatase, in vascular smooth muscle cells. J Biol Chem 1993; 268: 26037–26040. F EP, N JM, A LP, K GL. Angiotensin II induces plasminogen activator inhibitor1 and -2 expression in vascular endothelial and smooth muscle cells. J Clin Invest 1995; 95: 1353– 1362. L BC, G MR. Angiotensin II stimulates system y+ and cationic amino acid transporter gene expression in cultured vascular smooth muscle cells. J Biol Chem 1995; 270: 27577–27583. C XL, T PE, O MT, A RW, M RM. Angiotensin II induces monocyte chemoattractant protein-1 gene expression in rat vascular smooth muscle cells. Circ Res 1998; 83: 952–959. L X, N PJ, F B, T E, J R, G IH. Isolation and characterization of a
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34. 35.
36.
novel mitogenic regulatory gene, 322, which is transcriptionally suppressed in cells transformed by src and ras. Mol Cell Biol 1995; 15: 2754–2762. C C, M B, R K, D S, L Y, K SC, J S. Identification of a major protein kinase C-binding protein and substrate in rat embryo fibroblasts. Decreased expression in transformed cells. J Biol Chem 1996; 271: 6417–6422. L X, T E, N PJ, R M, G IH. A novel src- and ras-suppressed protein kinase C substrate associated with cytoskeletal architecture. J Biol Chem 1996; 271: 28430–28438. N JB, K TM, L LK, S JD. Gravin, an autoantigen recognized by serum from myasthenia gravis patients, is a kinase scaffold protein. Curr Biol 1997; 7: 52–62. L X, G IH. Reexpression of the major protein kinase C substrate, SSeCKS, suppresses v-src-induced morphological transformation and tumorigenesis [published errata appear in Cancer Res 1997; 57: 3068 and 1998; 58: 1770]. Cancer Res 1997; 57: 2304–2312. C C, C J, T H, H J, C J, J S. A major, transformation-sensitive PKCbinding protein is also a PKC substrate involved in cytoskeletal remodeling. J Biol Chem 1998; 273: 19482–19489. N PJ, G IH. Cell-cycle regulated expression and serine phosphorylation of the myristylated protein kinase C substrate, SSeCKS: correlation with culture confluency, cell cycle phase and serum response. Mol Cell Biochem 1997; 175: 233–241. G IH, L K, T E, G R, L X. Control of cytoskeletal architecture by the src-suppressed C kinase substrate, SSeCKS. Cell Mot Cytoskel 1998; 41: 1–17. S M, L F, S JD, W H-Y, M CC. Dynamic complexes of 2-adrenergic receptors with protein kinases and phosphatases and the role of gravin. J Biol Chem 1999; 274: 1588–1595. E J, G-J R, Z S, M X, O GA. Developmental expression of the protein kinase C substrate/binding protein (clone 72/ SSeCKS) in rat testis identification as a scaffolding protein containing an A-kinase-anchoring domain which is expressed during late-stage spermatogenesis. Eur J Biochem 1999; 263: 797–805. V DE, L SA, T K. Angiotensin II regulates the expression of plasminogen activator inhibitor-1 in cultured endothelial cells. A potential link between the renin-angiotensin system and thrombosis. J Clin Invest 1995; 95: 995–1001. C YQ, S M, W RR, H Q, C JW, V DE. Sp1 sites mediate activation of the plasminogen activator inhibitor-1 promoter by glucose in vascular smooth muscle cells. J Biol Chem 1998; 273: 8225–8231. G J, C LH, S MG, A SJ. Direct-rapid (DR) mutagenesis of large plasmids using PCR. Biotechniques 1995; 19: 559–564. G BD, B R, G T, Z G, G MH. Restricted endothelial cell expression of gravin in vivo. Anatom Record 1994; 239: 231– 242. F EP, X P, I T, S T, K M,
Ang II Control of SSeCKS Gene Expression K GL. Role of protein kinase C in glucose- and angiotensin II-induced plasminogen activator inhibitor expression. Contrib Nephrol 1996; 118: 180– 187. 37. K H, O T, R A, U P, C L, A PA. A common response element mediates differential effects of phorbol esters and forskolin on type-1 plasminogen activator inhibitor gene expression in human breast carcinoma cells. Eur J Biochem 1994; 220: 63–74. 38. N AJ. Role of the tissue renin-angiotensin system in vascular remodeling and smooth muscle
2219
cell growth. Curr Opin Nephrol Hypertens 1994; 3: 218–227. 39. G T, G B, L JC, , O’T T, MM R, L J, G MH. Molecular cloning and preliminary characterization of a novel cytoplasmic antigen recognized by myasthenia gravis sera. J Clin Invest 1992; 90: 992–999. 40. C YQ, G DM, R B, N AJ. Multiple enhancer elements mediate induction of cfos in vascular smooth muscle cells. Hypertension 1996; 27: 1224–1233.
SSeCKS Gene Expression in Vascular Smooth Muscle Cells: Regulation by Angiotensin II and a Potential Role in the Regulation of PAI-1 Gene Expression Stephen R. Coats, Joseph W. Covington, Ming Su, Lil M. Pabo´n-Pen˜a, Mesut Eren, Qin Hao and Douglas E. Vaughan Departments of Medicine and Pharmacology, Vanderbilt University Medical Center and Nashville VAMC, Nashville, Tennessee 37212-6300, USA (Received 17 March 2000, accepted in revised form 5 September 2000, published electronically 10 October 2000) S. R. C, J. W. C, M. S, L. M. P´ -P˜ , M. E, Q. H D. E. V. SSeCKS Gene Expression in Vascular Smooth Muscle Cells: Regulation by Angiotensin II and a Potential Role in the Regulation of PAI-1 Gene Expression. Journal of Molecular and Cellular Cardiology (2000) 32, 2207–2219. Rat aortic smooth muscle cells (RASM) express the src suppressed C-kinase substrate (SSeCKS), which is thought to be an integral regulatory component of cytoskeletal dynamics and G-protein coupled-receptor signaling modules. The specific sub-classes of growth factor receptors that regulate the genomic changes in SSeCKS expression in smooth muscle cells have not been characterized. In this study we identify SSeCKS as an angiotensin type 1 (AT1) receptordependent target gene in RASM cells treated with angiotensin II (Ang II). SSeCKS mRNA levels increase up to three-fold relative to the control within 3.5 h of Ang II treatment and are followed by a slight decrease of mRNA relative to the control levels after 24 h of stimulation. SSeCKS gene expression and plasminogen activator inhibitor-1 (PAI-1) gene expression correlate in RASM cells treated with Ang II. By co-transfecting plasmids bearing recombinant-SSeCKS and a PAI-1-promoter/luciferase reporter into Cos-1 cells, we show that alternative forms of recombinant-SSeCKS protein differentially influence PAI-1 promoter activity. These data indicate a biochemical linkage between SSeCKS activity and one or more of the cytoplasmic signaling pathways that are involved in the control of PAI-1 promoter activity. Finally, we show that the alternative forms of recombinantSSeCKS protein differentially influence cell-spreading when ectopically expressed in ras-transformed rat kidney (KNRK) fibroblasts. Taken together, our data suggest that SSeCKS interacts with intracellular signaling pathways that control cytoskeletal remodeling and extracellular matrix remodeling following Ang II stimulation of the RASM cell. 2000 Academic Press K W: Vascular smooth muscle; src-suppressed C-kinase substrate; Angiotensin II; Plasminogen activator inhibitor-1.
Introduction In mammalian arterial vessel walls, Ang II stimulates AT1 receptors, which in turn regulate important biological processes related to vascular structure and tone.1 This ligand–receptor system plays an important role in vascular hypertrophy,
proliferation and the extracellular matrix remodeling observed in blood vessels following vascular injury.2–8 Available evidence suggests that smooth muscle cell-responses to Ang II contribute to the clinical consequences of hypertension and atherosclerosis.9,10 Cultured smooth muscle cells exhibit the potential for serum-dependent vaso-
Please address all correspondence to: Douglas E. Vaughan, MD, Division of Cardiovascular Medicine, Vanderbilt University Medical Center, 315 MRBII, 2220 Pierce Ave. So., Nashville, TN 37232-6300, USA. Fax: +1615-936-1872; E-mail: [email protected]
0022–2828/00/122207+13 $35.00/0
2000 Academic Press
2208
S. R. Coats et al.
activated growth and proliferation by Ang II and associated cytokine-like serum factors.11–13 Key intracellular signal transducers such as p60c-src, phospholipase C-, ERK-1/-2, FAK and PKC are activated proximally downstream from the initial Ang II stimulation.11,12,14,15 Following Ang II stimulation, RASM cells increase expression of early response mRNAs including c-fos, c-myc, platelet-derived growth factor A-chain, tyrosine phosphatase (3CH134), PAI-1, PAI-2, monocyte chemoattractant protein-1, cationic amino acid transporters and epiregulin. These molecules and additional unidentified early response gene products are likely to play important roles in medial hypertrophy and fibroproliferative disorders.13,16–21 The Src suppressed C-kinase substrate/clone 72 (SSeCKS) was originally isolated from rat fibroblast cDNA libraries, and is the rodent homologue of the human protein, gravin.22–25 SSeCKS function has been correlated with v-src cellular transformation in rat fibroblasts.22,26 Endogenous SSeCKS gene expression is downregulated during transformation while ectopically overexpressed SSeCKS partially normalized cellular morphology and restored normal proliferation rates in transformed cells.22,26 Overexpression of SSeCKS in non-transformed fibroblasts results in a dramatic rearrangement of the actin cytoskeleton accompanied by extensive cell flattening and proliferation blockade. Molecular studies of SSeCKS have revealed biochemical and physical associations with phospholipid-dependent PKC activity, and the major PKC-dependent phosphorylation sites on SSeCKS have been mapped within the N-terminus of the protein.23,24,27 In addition, changes in the phosphorylation of SSeCKS have been correlated with cell cycle activity and mobilization of SSeCKS to the membrane ruffles and perinuclear regions.27,28 Evidence that SSeCKS can influence ERK-2 activity and integrin-independent FAK phosphorylation has been presented.29 Finally, it has recently been proposed that SSeCKS and the homologous human protein, gravin, belong to a group of regulatory molecules known as AKAPs.24,25,30 The data concerning SSeCKS/gravin implicates this protein as serving an important organizational role in cAMP-dependent and PKC-dependent processes that relate to the rearrangement of the actin cytoskeleton, cell proliferation and G-protein-coupled-receptor resensitization.22–24,26–31 In this report, we identify SSeCKS as an Ang II-inducible early gene in cultured RASM cells. Additionally, we show that angiotensin II-inducible SSeCKS gene expression correlates with Ang IIinducible plasminogen activator inhibitor-1 (PAI-
1) gene expression. We also present data that suggests a novel linkage between SSeCKS function and intracellular signaling pathways that control cytoskeletal dynamics and extracellular-matrix remodeling.
Materials and Methods Materials Ang II and bradykinin were from Bachem (Torrance, CA, USA). PMA, forskolin, genistein, fetal bovine serum and DMEM were from Sigma Chemical Co. (St. Louis, MO, USA) Dup753 was from Du Pont-Merck Pharmaceutical (Wilmington, Delaware, USA). PD123319 was obtained from ParkeDavis Pharmaceutical Co. (Ann Arbor, MI, USA).
Cell culture RASM cells were isolated as described previously.16 Cells sub-cultured 1–23 times were used for this study and were maintained in DMEM with 10% FBS, penicillin (100 units ml−1) and streptomycin (100 g ml−1). For experiments utilizing quiescent cells, serum was withdrawn from sub-confluent cultures for 24–48 h and subsequently treated as indicated in the text and figures.
Differential display RASM cells were seeded on 10-cm plates, and serum deprived for 24 h was treated with 100 n Ang II or vehicle alone for 3.5 h. Total RNA from RASM cells was extracted by standard phenol/guanidinium-isothiocyanate method as described previously32 and treated with DNase I (Promega, Madison, WI, USA). Anchored oligo-dT primers were used in combination with different arbitrary primers to perform differential display reactions as suggested by the manufacturer (GenHunter, Nashville, TN, USA). The primer combination that yielded the SSeCKS cDNA consisted of the anchor primer (5′-AAGCTTTTTTTTTTTG-3′) and the arbitrary primer (5′-AAGCTTCGACT-3′).
Northern blot analysis Total RNA was prepared from cultured RASM cells by phenol/guanidinium isothiocyanate. Ten micro-
Ang II Control of SSeCKS Gene Expression
grams of RNA was loaded per well on 1% agarose/ 2% formaldehyde gels transferred to nylon membranes, and hybridized with either [-32P]dCTP (Amersham, Piscataway, NJ, USA) random primed DNA probes or [-32P]UTP (Amersham, Piscataway, NJ, USA) labelled RNA probes as described previously.32 Blots were quantitated by phosphorimager analysis. SSeCKS mRNA levels were normalized to 18S and 28S rRNA levels or GAPDH mRNA levels.
RT-PCR analysis Total RNA was prepared from RASM cells as described above. One microgram of total RNA was subjected to reverse transcriptase PCR-analysis using the Access RT-PCR system according to the manufacturer’s instructions (Promega, Madison, WI, USA). The following primer set was used to detect SSeCKS: (5′-CCACTTCTCAAACTGGAGCATC-3′) and (5′-CAGACAAACTCCAGTATCTATC-3′). The following primer set was used to detect GAPDH: (5′-TGATGCTGGTGCTGAGTATGTCG-3′) and (5′AGTGAGCTTCCCGTTCAGCTCTG-3′). The resulting PCR products were resolved on a 5% polyacrylamide gel, visualized by staining with ethidium bromide, and the resulting bands were imaged and quantified using the UVP gel documentation system.
Antibodies The monoclonal antibody directed against an SSeCKS N-terminal peptide sequence was obtained from Transduction Laboratories. For the preparation of GST-SSeCKS fusion protein, a partial cDNA of RASM cell-SSeCKS was generated by reverse transcription-polymerase chain reaction using primers designed against fibroblast SSeCKS cDNA (GenBank accession number U23146). The sequence of the 5′ primer is as follows: (5′-GAAACGGATCCGAAGACCTTCTGAGAGTG-3′). The sequence of the 3′ primer is as follows: (5′CTGCCGGATCCTTGTTCTCTTTGACTGACTTGGTAG3′). Polyclonal antibody was prepared by immunizing a sheep against a GST-SSeCKS fusion protein bearing a carboxy-terminal fragment of RASM cell-SSeCKS (Exalpha, Boston, MA, USA) (see Fig. 6A). Multiple bleeds were obtained and yielded immune sera with high titers (>1:2000) of antiGST-SSeCKS antibody as determined by Western blots of RASM cell protein. For immunofluorescence analysis of SSeCKS in RASM cells, affinity-purified anti-SSeCKS polyclonal antibody was prepared as
2209
described previously using GST protein conjugated to glutathione sepharose beads and GST-SSeCKS protein conjugated to glutathione sepharose beads.24
Western blot analysis RASM cells were seeded in six-well dishes at approximately 2.5×105 cells per 35 mm well. Subsequently, the cells were serum-starved for 24 h and treated in triplicate with Ang II or vehicle for 6 h, 12 h or 24 h. Following treatments the cells were washed twice with PBS, and scraped in loading buffer [125 m Tris-HCL (pH 6.8), 4% SDS, 20% glycerol, 200 m DTT, 0.02% bromophenol blue]. Triplicate samples were pooled, sonicated briefly and stored at −80°C. The samples were subsequently denatured at 95°C for 2 min, spun briefly, and equal volumes of protein were loaded onto a 4% stacking/ 5% resolving polyacrylamide/SDS gel. Proteins were transferred to a nylon membrane and the membranes probed with the polyclonal anti-SSeCKS antibody (1:2000 dilution) or monoclonal anti-FAK antibody (1:500 dilution) (Transduction Laboratories, Lexington, KY, USA) to verify the equivalency of loading and provide an internal standard for the quantification of SSeCKS protein levels. The blots were washed and probed with anti-sheep IgG antibody coupled to HRP (1:10 000) or with anti-mouse IgG antibody coupled to HRP (1:10 000 dilution). Detection using luminol was performed as suggested by the manufacturer (Amersham, Piscataway, NJ, USA), and autoradiograms were analysed with the UVP gel documentation system to quantify the relative levels of SSeCKS protein.
Plasmid construction The human PAI-1 promoter-luciferase vector, pGLuc 6.4k, has been described previously.33 The construct pLacZ is pCDNA3.1His/LacZ (Invitrogen, Carlsbad, CA, USA). The full-length cDNA encoding RASM cell-SSeCKS was generated by reverse transcription-polymerase chain reaction using primers derived from the previously reported cDNA sequence of rat SSeCKS (GenBank accession number U23146). The sequence of the 5′ primer was as follows: (5′-GAATTCCAATTGGCAGGCAGTTCCACCGAGCAG3′). The sequence of the 3′ primer was as follows: (5′-AAGCTTGTCGACGCGTCGCTATGGCTGCACACCCG-3′). The resulting cDNA, in combination with a duplex oligomer encoding the flag epitope (amino acid sequence, MDYKDDDDK) was
2210
S. R. Coats et al.
ligated into the vector, pCIneo, to generate pCIFLSSeCKS. This construct encodes full-length SSeCKS with a flag epitope fused to the aminoterminus of the protein. Subsequently, an NheI/ HindIII fragment from pCIFLSSeCKS, containing the entire flag epitope-tagged-SSeCKS coding region, was subcloned into the vector pIND (Invitrogen, Carlsbad, CA, USA) to generate clone pINDFLSSeCKS. By using PCR-based site-directed mutagenesis,34 a TAA stop codon and a HindIII/ClaI restriction site were engineered into the region of pINDFLSSeCKS corresponding to nucleotides 1889– 1897 of SSeCKS. The mutated construct, pINDFLSSeCKS1889, was digested with HindIII, resulting in the removal of a fragment encoding amino acids 626–1596. The vector was then re-ligated to generate the flag epitope-tagged, carboxy-terminal deleted construct, pINDCSSeCKS. Further sitedirected mutagenesis of pINDFLSSeCKS1889 was performed to introduce a ClaI restriction endonulease site adjacent to the flag epitope. Subsequent digestion of this clone with ClaI resulted in the removal of a fragment encoding amino acids 5–626. The vector was then re-ligated to generate the flag epitope-tagged, amino-terminal deleted construct, pINDNSSeCKS. The pIND constructs were then digested with MluI, blunt-ended with T4 DNA polymerase, followed by digestion with BamHI. The resulting fragments were ligated into pQBIAdCMV5 (Quantum Biotechnologies, Montreal, Canada) that had been digested with PmeI and BamHI to generate the clones, pFLSSeCKS, pNSSeCKS, and pCSSeCKS (see Fig. 8). To confirm the proper expression of the recombinant proteins, pFLSSeCKS, pNSSeCKS, and pCSSeCKS were transfected into HEK293 cells. The resulting protein lysates were analysed by Western blotting as described above using the polyclonal anti-SSeCKS antibodies or the monoclonal anti-SSeCKS antibodies (data not shown).
Luciferase assay For transient transfection experiments in Cos-1 cells, cells were cultured in 25-mm 12-well plates in DMEM with 10% FBS, penicillin (100 units ml−1) and streptomycin (100 g ml−1). When cells reached 50–60% confluence, they were transfected using Lipofectamine Plus (Life Technologies, Grand Island, NY, USA) with 0.25 g of pGLuc 6.4k in combination with 0.25 g of either pLacZ, pFLSSeCKS, pNSSeCKS, or pCSSeCKS. Transfections proceeded in serum-free media for 3–6 h before the transfection complexes were removed
and replaced with fresh media. Cells were then incubated further for 20–72 h in serum-free DMEM or DMEM containing 10% FBS. Transfections were terminated by adding 100 l of reporter lysis buffer to each well and 20 l of lysate was used to determine luciferase activity according to the manufacturer (Promega, Madison, WI, USA).
Immunofluorescence KNRK cells were grown in single-chambered glass slides in DMEM containing 5% FBS until approximately 50–60% confluent. The cells were transfected with the 0.75 g of the appropriate plasmid constructs as indicated in Figure 8. Transfected cells were grown for 3 days, after which time the transfections were terminated by washing the cells twice with PBS, and then fixing the cells in 4% paraformaldehyde/PBS, followed by 80% methanol fixation. Fixed cells were blocked in phosphate buffered saline containing 2 g 100 ml−1 bovine serum albumin for 2 h. The blocked/fixed cells were stained with affinity purified anti-SSeCKS polyclonal antibody (1:100 dilution) in combination with either anti-flag epitope antibody (1:2000 dilution) or antibeta-galactosidase antibody (1:400 dilution). The cells were washed with PBS and stained with the second antibodies [anti-sheep, anti-IgG Cy-3 conjugate (1:300 dilution), and anti-mouse, anti-IgG Cy-2 conjugate (1:10 000 dilution)]. Fields were photographed using a ×40 objective.
Results Angiotensin II upregulates SSeCKS gene expression To identify novel candidate molecules related to Ang II-stimulated signaling, we used a differential display strategy to examine early gene expression in RASM cells. Pooled RNA isolates from RASM cells treated or not treated for 3.5 h with Ang II (100 n) were analysed by differential display, and 16 candidate cDNAs were chosen for further analysis from this initial screen (data not shown). From the selected cDNAs, a single cDNA was confirmed by Northern blotting analysis to be significantly increased (three-fold) in total RNA from cells treated with Ang II as compared to the vehicle-stimulated control sample (Fig. 1). Database analysis of an approximately 500 bp cDNA revealed identity to the extreme 3′ untranslated region of the previously cloned gene, SSeCKS, also called clone 72.22–24 As
Ang II Control of SSeCKS Gene Expression
2211
Figure 2 Dose-response of SSeCKS gene induction to Ang II. RASM cells were starved and treated with Ang II for the indicated times and doses. Total RNA was isolated and analysed by Northern blotting with a random primed SSeCKS cDNA probe.
Figure 1 Ang II induction of SSeCKS gene expression. RASM cells were starved, treated with or without Ang II for 3.5 h and total RNA was isolated. RNA was resolved on a 1% agarose/2% formaldehyde gel, transferred to a positively charged nylon membrane. A cDNA probe representing the 3′ end of SSeCKS mRNA was labeled by random priming and used to probe the blot. The images of ethidium bromide stained blots are depicted below the autoradiogram image.
judged by relative position of SSeCKS mRNA to the 28s rRNA, SSeCKS transcripts are in the 5–8 kb range, as previously described for SSeCKS mRNA in rat fibroblasts. Dose– and time–response experiments indicated that Ang II stimulation of SSeCKS expression occurred maximally between 10 n and 100 n and involved an early induction phase (3.5 h) followed by a suppression phase (24 h) (Fig. 2).
Serum-dependent SSeCKS gene induction is partially mediated by the AT1 receptor The specificity of Ang II stimulation of SSeCKS gene expression in RASM cells is evident from the failure of the vasoactive peptide bradykinin to induce SSeCKS gene expression (Fig. 3). Furthermore, the Ang II effect is mediated by an AT1 receptor-dependent pathway since Dup753 inhibits SSeCKS upregulation (Fig. 3). As expected, PAI-1 mRNA induction is mediated by the AT1 receptor pathway in RASM cells, whereas TIMP-1 and GAPDH gene expression are not appreciably modulated under
Figure 3 Ang II induction of SSeCKS gene expression is mediated by an AT1-dependent mechanism. RASM cells were serum deprived, treated with AT1-receptor antagonist (Dup753) or the AT2-receptor antagonist (PD123319) for 30 min prior to treatment with Ang II for 3.5 h. Total RNA was isolated and analysed by Northern blotting with the indicated probes (right).
these standard conditions.19 Neither SSeCKS expression nor PAI-1 expression was reduced by an AT2-receptor antagonist (Fig. 3). Additional experiments revealed that Dup753 (1 ) or genistein (10 ) significantly reduced FBS-induced SSeCKS levels to similar extents (Fig. 4A). Thus, the shortterm ability of quiescent RASM cells to yield increases in SSeCKS and PAI-1 levels is significantly dependent upon AT1 receptor activity. Further experiments were performed to evaluate the long-term effect of either an AT1 receptor antagonist (Dup753) alone or in combination with an
2212
S. R. Coats et al.
Figure 5 SSeCKS gene induction in RASM cells is influenced by culture confluency. RASM cells were plated at different dilutions (1/24, 1/16, 1/8, 1/4, and 1/2) in DMEM/10% FBS. Plates were cultured for 3 days, and culture confluency was estimated using phase contrast microscopy. RASM cell RNA was isolated and analysed by Northern blotting using a random primed SSeCKS DNA probe. Shown below the autoradiogram image is the image of the ethidium bromide stained blot.
SSeCKS gene expression in growing RASM cells (Fig. 4B). Taken together, these data demonstrate that the renin-angiotensin system contributes substantially to the regulation of SSeCKS gene expression in RASM cells.
Cell-contact induction of SSeCKS gene expression in RASM cells Figure 4 The renin–angiotensin system is an important component of serum-regulated SSeCKS gene expression in RASM cells. (A) The serum response of starved RASM cells is AT1-receptor dependent. RASM cells were starved, treated with Dup753 or genistein for 30 min, followed by treatment with FBS for 3.5 h. RNA was isolated and analysed by Northern blotting with the indicated probes. (B) Angiotensin converting enzyme inhibitor can suppress the levels of SSeCKS mRNA in growing RASM cells. RASM cells were cultured in triplicate 3.5 cm plates to approximately 60% confluency in normal growth media, then treated with Dup753 alone or in combination with captopril for 2 days. Results of RT-PCR analysis using GAPDH and SSeCKS primers are shown.
angiotensin converting enzyme inhibitor (captopril) upon SSeCKS mRNA levels in growing RASM cells (Fig. 4B). These data indicate that Dup753 combined with captopril can reduce the steady-state levels of SSeCKS mRNA to 76% the levels observed for cells treated with FBS or Dup753 alone. Based upon these experiments, we conclude that the exposure of RASM cells to AT1 receptor antagonist is sufficient to block the short-term serum response of SSeCKS gene expression (Fig. 4A), whereas an angiotensin converting enzyme inhibitor is required to attenuate the long-term serum response of
Previous studies of SSeCKS mRNA expression in rat fibroblasts have shown that baseline SSeCKS transcript levels are upregulated in confluent cultures as compared to the levels of sub-confluent cultures.28 We observed an effect of cell culture confluency on SSeCKS gene expression in RASM cells (Fig. 5). RASM cells exhibit a cell-to-cell contact-dependent induction of SSeCKS gene expression in addition to a serum-dependent or Ang II-dependent induction. The transcriptional activation of SSeCKS in RASM cells is associated with at least two pathways in this adherent cell culture; cell-tocell contact stimulation of gene expression and Gprotein-coupled receptor-mediated stimulation of gene expression.
SSeCKS protein expression in RASM cells To confirm the presence of SSeCKS protein in RASM cells, Western blotting was performed using a monoclonal antibody or a polyclonal antibody generated against the N-terminal portion and C-terminal portion respectively of rat SSeCKS (Fig. 6A). A protein blot was probed using a monoclonal antibody against the N-terminal portion of the protein (amino
Ang II Control of SSeCKS Gene Expression
2213
Figure 6 Cultured RASM cells express SSeCKS protein. (A) Illustration of antibodies used to detect rat smooth muscle cell protein. Monoclonal antibody raised against the N-terminal portion of the protein or polyclonal antibody raised against the C-terminal portion of SSeCKS used in this study. (B) Western blot analysis of RASM cell protein probed with the monoclonal anti-SSeCKS antibody. The relative position of a myosin protein marker is indicated. (C) Time course of protein expression from Ang II-treated RASM cells. Western blot analysis of RASM cell protein probed with the polyclonal anti-SSeCKS antibody. Cells were serum-starved for 24 h and treated with Ang II for the indicated times. Samples were processed as described in Materials and Methods. (D) Western blot analysis of RASM cell protein probed with the polyclonal anti-SSeCKS antibody or the monoclonal anti-SSeCKS antibody.
acid residues 48–192). The image of the protein revealed a band migrating significantly higher than a 208 kDa marker in RASM cells and at a similar mobility as a form of rat brain SSeCKS detected with the same antibody (Fig. 6B). Cellular steady state levels of SSeCKS protein are not altered in quiescent RASM cells treated with Ang II (200 n) for 6 h, 12 h or 24 h (Fig. 6C), although slight increases in endogenous SSeCKS protein levels relative to endogenous focal adhesion kinase (FAK) levels are apparent at 12 h and 24 h following Ang II treatment (Fig. 6C). We conclude that the change in SSeCKS mRNA levels in RASM cells occurs earlier and is more pronounced than the corresponding changes in SSeCKS protein levels. These observations are consistent with the previously observed SSeCKS mRNA and protein responses in rat
fibroblasts to mitogenic stimuli or phorbol esters. The Ang II induction of SSeCKS mRNA levels in RASM cells may result in post-translational alterations of the protein, such as phosphorylationstate changes, or may involve increased turnover rates of the protein rather than gross changes in the steady-state levels of the protein.27,28 Empirical studies of SSeCKS and the related human protein gravin have previously revealed one or more >200 kDa proteins in a variety of tissues and cell types when examined with polyclonal antibodies directed against the carboxy-terminal portion of recombinant SSeCKS protein.23,24,35 When RASM cell protein blots are probed with a polyclonal antibody directed against the carboxy-terminal portion of RASM cell-SSeCKS, a doublet of high molecular weight bands is observed resembling the
2214
S. R. Coats et al.
>280/290 kDa doublet seen for the fibroblast protein24 (Fig. 6D). Only the upper band is detected by the anti-SSeCKS monoclonal antibody (Fig. 6D). Based upon these data, the higher mobility SSeCKS protein band in RASM cells appears to lack the amino-terminal amino acid residues that are included within the region that is reactive to the monoclonal antibody.
SSeCKS influences PAI-1 promoter activity in Cos-1 cells As reviewed in the introduction of this report, the activation of smooth muscle cells with proatherogenic molecules, such as Ang II, leads to rapid activation of transcription of several classes of cellular products including the protease inhibitor PAI-1. We hypothesized that SSeCKS influences PAI-1 promoter activity due to the correlation of gene expression patterns observed for SSeCKS and PAI-1 mRNAs following the Ang II-induced stimulation of RASM cells (Fig. 3), and due to the evidence that the regulation of PAI-1 gene expression involves intracellular kinases that are capable of interacting with SSeCKS.19,36,37 To test this hypothesis, plasmids bearing cDNAs for alternative forms of recombinant-flag epiptope-tagged-SSeCKS were transiently co-transfected into Cos-1 cells with a plasmid bearing 6.4 kb fragment of the human PAI1 promoter fused to an ORF encoding luciferase (Fig. 7A). Ectopically expressed SSeCKS activates the PAI-1 promoter relative to the ectopically expressed negative control -galactosidase (pLacZ) in both growing or serum deprived Cos-1 cells (Fig. 7B and data not shown). In addition, the construct pNSSeCKS yielded the most potent PAI-1-promoter-activating fragment, while the construct pCSSeCKS yielded the least potent PAI-1-promoter-activating fragment (Fig. 7B). The full-length protein generated from pFLSSeCKS activated the PAI-1 promoter with a potency that was similar to the amino-terminal fragment. These data indicate that SSeCKS is capable of influencing PAI-1 promoter activity, presumably by interacting with cytoplasmic factors that modulate nuclear transcriptional activity.
RASM-cell-type SSeCKS influences cell-spreading activity in KNRK cells We examined growing and quiescent RASM cells for the presence of SSeCKS protein via indirect
immunofluorescence microscopy using affinitypurified polyclonal anti-SSeCKS antibodies. In growing RASM cells, SSeCKS is expressed in a fashion that is consistent with the expected cortical-cytoskeletal distribution and perinuclear localization of the protein (data not shown). Since one of the major recognized functional attributes of fibroblast-type SSeCKS is to control cytoskeletal architecture and cellular morphology,24,26,27,29,38 we examined the ability of RASM cell-type SSeCKS to elicit similar cytoskeletal responses. For this purpose, we used ras-transformed rat kidney fibroblast (KNRK) cells to examine the function of ectopically-expressed RASM-cell-type SSeCKS. KNRK cells exhibit a round cell morphology phenotype compared to normal rat kidney fibroblast cells and RASM cells, each type being relatively spread and flattened in morphology. In addition, KNRK cells exhibit a significant reduction in both SSeCKS mRNA levels and PAI-1 mRNA levels relative to the corresponding mRNA levels in normal rat kidney fibroblasts (data not shown). Transfection analysis in KNRK cells was performed using pLacZ, pFLSSeCKS, pNSSeCKS, and pCSSeCKS (Fig. 8). The results of these experiments demonstrate that pFLSSeCKS (Fig. 8D, E and F) and pCSSeCKS (Fig. 8J, K and L) are able to modulate cytoskeletal architecture of the KNRK cell, resulting in a spread or flattened phenotype, whereas pLacZ (Fig. 8A, B and C) and pNSSeCKS (Fig. 8G, H and I) are unable to substantially modulate the rounded morphology of the transformed KNRK cell. These data demonstrate that the amino-terminal fragment of SSeCKS (amino acid residues 5–626) confers the cell-speading activity of SSeCKS observed in these experiments. These data also reveal that the differential modulation of cell-spreading activity elicited by the SSeCKS constructs in KNRK cells (Fig. 8) correlates with the differential modulation of PAI-1 promoter activity elicited by these same constructs in Cos-1 cells (Fig. 7). This point is most clearly illustrated by comparing the transcriptional indices of FLSSeCKS and CSSeCKS with the index of NSSeCKS (Fig. 7). The lower transcriptional index in this situation correlates with the “normal” activity of FLSSeCKS or CSSeCKS to induce cell-spreading in a transformed cell-line (Fig. 8). Conversely, the higher transcriptional index of NSSeCKS correlates with the reduced ability of the protein to elicit cellspreading in a transformed cell-line, and suggests that the promoter-activating functions and the cell-spreading functions of SSeCKS are encoded within different regions of the molecule.
Ang II Control of SSeCKS Gene Expression
2215
Figure 7 Differential modulation of PAI-1 promoter activity by alternative forms of recombinant SSeCKS in Cos-1 cells. (A) Schematic representation of recombinant SSeCKS proteins expressed in transient transfection assays, and (B) a Western blot of the transiently expressed recombinant SSeCKS proteins from the cell lysates used for the luciferase assay. The blot was probed with a monoclonal anti-flag epitope antibody. Black box represents the flag epitope, open box represents the amino-terminal fragment of SSeCKS, and stippled box represents the carboxy-terminal fragment of SSeCKS. (B) Corresponding luciferase assay illustrating the relative influence of LacZ or SSeCKS constructs upon PAI1 promoter/luciferase activity. Error bars represent standard deviations derived from samples performed in triplicate. This data is representative of at least six independent experiments.
Discussion In the present study we demonstrated the ability of Ang II to induce a significant increase in the steady-state level of SSeCKS mRNA in RASM cells (Figs 1, 2 and 3). Our experiments were subsequently designed to further explore the potential of SSeCKS coupling to the Ang II system, correlating this data with experimental data from the fibroblast model system.22–24,26,27,29 Experiments using the AT1 receptor antagonist Dup753 and the angiotensin converting enzyme inhibitor, captopril, demonstrate that the renin–angiotensin system represents a significant component of the serum activity that induces SSeCKS gene expression in serum-starved RASM cells (Fig. 4A) and growing RASM cells (Fig. 4B). In addition, the activation of SSeCKS gene expression involves tyrosine kinase activation and/ or estrogen receptor-like pathways as determined
by the ability of genistein to reduce the serum response (Fig. 4A). The present study also suggests that serum factors, in addition to Ang II, are necessary to induce SSeCKS expression maximally in RASM cells (Fig. 3). We infer from the observed cell confluency effect that SSeCKS gene expression in smooth muscle cells is influenced combinatorily by specific autocrine factors (such as Ang II), and extracellular matrix components. We conclude that multiple factors are capable of influencing SSeCKS expression in RASM cells, but at the present time the hierarchy of regulatory factors is unknown. Further studies will be required to address this question. A significant finding of this study is that SSeCKS protein levels are slightly, but not dramatically, increased relative to FAK in RASM cells treated with Ang II. Furthermore, the time course for these changes of protein (12 and 24 h) is somewhat
2216
S. R. Coats et al.
Figure 8 Differential modulation of cell-spreading by alternative forms of recombinant SSeCKS in KNRK cells. KNRK cells were transfected with the indicated plasmid constructs (left). (A, D, G, J) Phase-contrast images; (B) second antibody cy-3 conjugate detection of the first antibody (anti--galactosidase); (E, H, K) second antibody cy-3 conjugate detection of the first antibody (anti-flag epitope); (C, F, I, L) second antibody cy-2 conjugate detection of the first antibody (polyclonal anti-SSeCKS antibody). Note that, in panel L, the pCSSeCKS-producing cells are not detected with the polyclonal anti-SSeCKS antibody due to the lack of reactive residues in this deletion construct.
delayed relative to the initial increases in SSeCKS mRNA levels (3.5 h). This suggests that SSeCKS protein function is likely to involve cellular changes that are prompted by Ang II during the initial 24 h following ligand stimulation. The observation that the steady-state levels of SSeCKS protein are not influenced by Ang II is in agreement with previous studies that explore the influence of serum or phorbol esters on SSeCKS expression in fibroblasts.27,28 In these studies, both serum factors and phorbol ester substantially altered SSeCKS mRNA levels and phospho-protein levels without comparably altering the steady state levels of the total SSeCKS protein. Based upon these observations, we propose that the changes in the levels of SSeCKS mRNA in RASM
cells are likely to reflect phosphorylation state changes in SSeCKS induced by Ang II by a cellular mechanism that may involve increased turnover rates of the protein. Additional studies using protein synthesis inhibitors and phosphorylation-state sensitive antibodies will be required to resolve these possibilities. Several lines of evidence support the possibility that SSeCKS can modulate cytoskeletal or transcriptional pathways. For example, increases in SSeCKS protein levels can modulate ERK-2 activation.26,29 Furthermore, prior studies have indicated that SSeCKS interacts directly with PKC, and with the RII subunit of cAMP-dependent protein kinase A.22,23,31 The experiments presented here
Ang II Control of SSeCKS Gene Expression
have demonstrated the ability of multiple forms of SSeCKS, including the full-length version of the protein, to modulate the rate of transcriptional activity of a human PAI-1 promoter-reporter construct in starved or growing Cos-1 cells (Fig. 7). The outcome of these experiments supports our hypothesis that an aspect of SSeCKS function couples to intracellular signaling pathways that influence the activation of gene targets such as PAI-1 in response to trophic stimuli such as Ang II. These experiments also suggest that in vivo mis-expression or deregulation of SSeCKS may lead to the deregulation of PAI-1 or other genes that are influenced by SSeCKS-linked cell signaling pathways. For example, the carboxyterminal fragment of SSeCKS, NSSeCKS, exhibited an increased ability to activate the PAI-1 promoter activity relative to the full-length fragment or aminoterminal fragment of SSeCKS (Fig. 7). Furthermore, these same constructs reveal the ability of the aminoterminal fragment (pCSSeCKS) of SSeCKS to recapitulate the control of cytoskeletal architecture exhibited by the full-length protein (Fig. 8). However, the carboxy-terminal fragment (pNSSeCKS) appears to be deficient in its ability to control cytoskeletal architecture (Fig. 8). The hypothetical deregulation of SSeCKS provided by our model system has not been reported to correlate with known vascular disorders in rodents or humans. However, it is noteworthy that in approximately 30% of the clinical cases of the human autoimmune disorder, myasthenia gravis, a carboxy-terminal fragment of the SSeCKS-homologue, gravin, is detected by autoantibodies in the patients’ serum.39 It may be useful to determine if the cellular pathology of these subtypes of myasthenia gravis or related autoimmune disorders involve perturbations in cell-signaling, cytoskeletal remodeling, and extracellular matrix remodeling that are due to the deregulation of SSeCKS/ gravin. The precise function of SSeCKS in vivo remains uncertain, although the available in vitro data strongly argues for a role of the protein in celladhesion, cell-spreading and mitogenic potential.24, 26,27,29,40 In addition, recent studies of the human protein, gravin, suggest a fundamental role of gravin/SSeCKS in organizing G-protein coupled-receptor signaling modules.30 Therefore, AT1 receptordependent activation of SSeCKS gene expression in RASM cells is consistent with our hypothesis that SSeCKS plays a role in AngII-mediated signaling. Accordingly, we view the genomic changes reported in this study as a molecular hallmark of SSeCKS participation in cytoskeletal changes that occur within minutes to hours following AT1 receptormediated signaling.
2217
In conclusion, Ang II stimulation of SSeCKS gene expression in RASM cells, and the ability of SSeCKS to modulate PAI-1 promoter activity in Cos-1 cells or to modulate cell-spreading in KNRK cells suggest a role for SSeCKS function in signaling pathways that regulate cytoskeletal remodeling and extracellular matrix remodeling. In the context of vascular smooth muscle cells, we hypothesize that SSeCKS function relates to molecular pathways that are activated during vascular responses to mechanical injury, hypertension or atherosclerosis.
Acknowledgements We thank Dr David M. Bader’s laboratory for outstanding technical support during the course of these studies. We also acknowledge the assistance of Dr Peng Liang and Dr David Kerins with differential display. We appreciate the assistance of Dr Heather T. Roselli for reference preparation and the VUMC Cell Imaging Resource Facility for assistance with printing the figures. This work was supported in part by NIHLBI R01 #51387 (DEV) and by NRSA #NS10040 (SRC).
References 1. G TL, E ME, C KJ. Angiotensin receptors and their antagonists. N Engl J Med 1996; 334: 1649–1654. 2. S CP, A AJ, S BL, O EH. Angiotensin type 1 receptors mediate smooth muscle proliferation and endothelin biosynthesis in rat vascular smooth muscle. J Pharmacol Exper Ther 1994; 271: 429–437. 3. P SB, W SS, P RL. Pressure mediates angiotensin II-induced arterial hypertrophy and PDGF-A expression. Hypertension 1998; 32: 452– 458. 4. H JC, H M, T MM, R LI, H TA, O GK. Angiotensin IIinduced hypertrophy of rat vascular smooth muscle is associated with increased 18 S rRNA synthesis and phosphorylation of the rRNA transcription factor, upstream binding factor. J Biol Chem 1995; 270: 25096–25101. 5. W H, T DS, M CJ. Angiotensin II induces delayed mitogenesis and cellular proliferation in rat aortic smooth muscle cells. Correlation with the expression of specific endogenous growth factors and reversal by suramin. J Clin Invest 1994; 93: 788–798. 6. M JB, D R N, P D, A S, S JL, L B. Pathophysiological role of the vascular smooth muscle cell. J Cardiovasc Pharmacol 1990; 16 (Suppl. 1): S4–S11. 7. C JH, T G, B MJ, C G,
2218
8.
9.
10.
11.
12. 13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
S. R. Coats et al.
C GR. Molecular biology of vascular hypertrophy. Basic Res Cardiol 1991; 86 (Suppl. 1): 3–11. H AD, Q WC, G JB, F EP. Angiotensin-converting enzyme inhibition suppresses plasminogen activator inhibitor-1 expression in the neointima of balloon-injured rat aorta. Circulation 1996; 93: 1073–1078. S NJ. Molecular biology of the renin-angiotensin system: implications for hypertension and beyond. J Cardiovasc Pharmacol 1991; 18 (Suppl. 2): S1–S6. L EM, Y S, J P, M TJ, T KK, B CR, P B. Emerging role of angiotensinconverting enzyme inhibitors in cardiac and vascular protection. Circulation 1994; 90: 2056–2069. S B, B KE, M MB. The role of tyrosine phosphorylation in angiotensin II mediated intracellular signaling and cell growth. J Mol Med 1996; 74: 85–91. A RW, G KK. Signal transduction in vascular smooth muscle. J Hypertens 1996; 14 (Suppl. 14(5)): S51–S54. T DS, C X, P JE, W AR, F P, M CJ. Epiregulin is a potent vascular smooth muscle cell-derived mitogen induced by angiotensin II, endothelin-1, and thrombin. Proc Nat Acad Sci USA 1999; 96: 1633–1638. D JL, B BC, C MA. Angiotensin II stimulates the pp44 and pp42 mitogen-activated protein kinases in cultured rat aortic smooth muscle cells. Biochem Biophys Res Comm 1992; 188: 257–264. H H, Q P, L C, L FC, D A. Platelet-derived growth factor and angiotensin II induce different spatial distribution of protein kinase C-alpha and -beta in vascular smooth muscle cells. Hypertension 1994; 23: 848–852. N AJ, P RE, E CS, L HL, D VJ. Angiotensin II induces c-fos expression in smooth muscle via transcriptional control. Hypertension 1989; 13: 706–711. N AJ, P RE, D VJ. Induction of platelet-derived growth factor A-chain and c-myc gene expressions by angiotensin II in cultured rat vascular smooth muscle cells. J Clin Invest 1989; 83: 1419– 1424. D JL, M MB, P WG, C CH, L LF, B KE, B BC. Angiotensin II induces 3CH134, a protein-tyrosine phosphatase, in vascular smooth muscle cells. J Biol Chem 1993; 268: 26037–26040. F EP, N JM, A LP, K GL. Angiotensin II induces plasminogen activator inhibitor1 and -2 expression in vascular endothelial and smooth muscle cells. J Clin Invest 1995; 95: 1353– 1362. L BC, G MR. Angiotensin II stimulates system y+ and cationic amino acid transporter gene expression in cultured vascular smooth muscle cells. J Biol Chem 1995; 270: 27577–27583. C XL, T PE, O MT, A RW, M RM. Angiotensin II induces monocyte chemoattractant protein-1 gene expression in rat vascular smooth muscle cells. Circ Res 1998; 83: 952–959. L X, N PJ, F B, T E, J R, G IH. Isolation and characterization of a
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34. 35.
36.
novel mitogenic regulatory gene, 322, which is transcriptionally suppressed in cells transformed by src and ras. Mol Cell Biol 1995; 15: 2754–2762. C C, M B, R K, D S, L Y, K SC, J S. Identification of a major protein kinase C-binding protein and substrate in rat embryo fibroblasts. Decreased expression in transformed cells. J Biol Chem 1996; 271: 6417–6422. L X, T E, N PJ, R M, G IH. A novel src- and ras-suppressed protein kinase C substrate associated with cytoskeletal architecture. J Biol Chem 1996; 271: 28430–28438. N JB, K TM, L LK, S JD. Gravin, an autoantigen recognized by serum from myasthenia gravis patients, is a kinase scaffold protein. Curr Biol 1997; 7: 52–62. L X, G IH. Reexpression of the major protein kinase C substrate, SSeCKS, suppresses v-src-induced morphological transformation and tumorigenesis [published errata appear in Cancer Res 1997; 57: 3068 and 1998; 58: 1770]. Cancer Res 1997; 57: 2304–2312. C C, C J, T H, H J, C J, J S. A major, transformation-sensitive PKCbinding protein is also a PKC substrate involved in cytoskeletal remodeling. J Biol Chem 1998; 273: 19482–19489. N PJ, G IH. Cell-cycle regulated expression and serine phosphorylation of the myristylated protein kinase C substrate, SSeCKS: correlation with culture confluency, cell cycle phase and serum response. Mol Cell Biochem 1997; 175: 233–241. G IH, L K, T E, G R, L X. Control of cytoskeletal architecture by the src-suppressed C kinase substrate, SSeCKS. Cell Mot Cytoskel 1998; 41: 1–17. S M, L F, S JD, W H-Y, M CC. Dynamic complexes of 2-adrenergic receptors with protein kinases and phosphatases and the role of gravin. J Biol Chem 1999; 274: 1588–1595. E J, G-J R, Z S, M X, O GA. Developmental expression of the protein kinase C substrate/binding protein (clone 72/ SSeCKS) in rat testis identification as a scaffolding protein containing an A-kinase-anchoring domain which is expressed during late-stage spermatogenesis. Eur J Biochem 1999; 263: 797–805. V DE, L SA, T K. Angiotensin II regulates the expression of plasminogen activator inhibitor-1 in cultured endothelial cells. A potential link between the renin-angiotensin system and thrombosis. J Clin Invest 1995; 95: 995–1001. C YQ, S M, W RR, H Q, C JW, V DE. Sp1 sites mediate activation of the plasminogen activator inhibitor-1 promoter by glucose in vascular smooth muscle cells. J Biol Chem 1998; 273: 8225–8231. G J, C LH, S MG, A SJ. Direct-rapid (DR) mutagenesis of large plasmids using PCR. Biotechniques 1995; 19: 559–564. G BD, B R, G T, Z G, G MH. Restricted endothelial cell expression of gravin in vivo. Anatom Record 1994; 239: 231– 242. F EP, X P, I T, S T, K M,
Ang II Control of SSeCKS Gene Expression K GL. Role of protein kinase C in glucose- and angiotensin II-induced plasminogen activator inhibitor expression. Contrib Nephrol 1996; 118: 180– 187. 37. K H, O T, R A, U P, C L, A PA. A common response element mediates differential effects of phorbol esters and forskolin on type-1 plasminogen activator inhibitor gene expression in human breast carcinoma cells. Eur J Biochem 1994; 220: 63–74. 38. N AJ. Role of the tissue renin-angiotensin system in vascular remodeling and smooth muscle
2219
cell growth. Curr Opin Nephrol Hypertens 1994; 3: 218–227. 39. G T, G B, L JC, , O’T T, MM R, L J, G MH. Molecular cloning and preliminary characterization of a novel cytoplasmic antigen recognized by myasthenia gravis sera. J Clin Invest 1992; 90: 992–999. 40. C YQ, G DM, R B, N AJ. Multiple enhancer elements mediate induction of cfos in vascular smooth muscle cells. Hypertension 1996; 27: 1224–1233.