- Email: [email protected]
SSR fingerprinting Chinese peach cultivars and landraces (Prunus persica) and analysis of their genetic relationships
Scientia Horticulturae 120 (2009) 188–193
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
SSR fingerprinting Chinese peach cultivars and landraces (Prunus persica) and analysis of their genetic relationships Zhongping Cheng a,b, Hongwen Huang a,c,* a
Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, Hubei 430074, P.R. China Key Laboratory for Protection of Huazhong Plant Resources and Sustainable Utility, Wuhan, Hubei 430074, P.R. China c South China Botanical Garden, Chinese Academy of Sciencs, Guangzhou, Guangdong 510650, P.R. China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 2 July 2008 Received in revised form 13 October 2008 Accepted 18 October 2008
Thirty-two Chinese peach landraces/cultivars, a major subset of the core Chinese peach collection, were fingerprinted using seven pairs of SSR primers to assess their genetic diversity and relatedness. The seven primer pairs detected eight loci and revealed an allele richness of 3.125 (average alleles per locus), an expected heterozygosity (He) of 0.450, and a Shannon index of 0.728 among the landraces/cultivars. This level of genetic diversity is lower compared to other fruit trees and Prunus congenus species (cherry and apricot), but it is comparable to previous reports in peaches. A greater level of genetic diversity was observed in landraces than in cultivars, indicating that peach landraces are valuable for germplasm collection. All cultivars and landraces, except two, were unambiguously identified based on multi-locus genotypes. Eight unique alleles were detected among this group of Chinese peaches. UPGMA clustering analysis separated the 32 cultivars/landraces into two distinct groups, which is generally in accordance with the known pedigree information. The results provide accurate genetic information for defined acquisition policy in the repositories, improving the integrity and efficiency of germplasm management and giving evidences for protection of breeder’s intellectual rights. ß 2008 Published by Elsevier B.V.
Keywords: Molecular marker Microsatellite Cultivar identification Genetic diversity
1. Introduction Peach [Prunus persica (L.) Batsch.] has been widely grown in the world, from cold temperate zones to subtropical zones in both hemispheres. It is an important member of Rosaceae and has been an economically important fruit tree crop. Peach originated in China (Wang and Zhuang, 2001), and China has the longest history of peach cultivation in the world (Huang et al., 2008). Domestication and cultivation of peach in China can date back to as early as 4000 years ago. Since then, Chinese have made extensive efforts on selection and cultivation of natural mutants and chance seedlings (Huang et al., 2008). This has resulted in a very large number (>800) of peach landraces and cultivars in China (Wang et al., 1989; Guan and Wang, 1993). These landraces and cultivars show a great diversity in fruit
* Corresponding author at: South China Botanical Garden/South China Institute of Botany, Chinese Academy of Sciences, Xinke Road 723, Tianhe District, Guangzhou 510650, P.R. China. E-mail address: [email protected] (H. Huang). Abbreviations: SSR, simple sequence repeat; UPGMA, un-weighted pair group method with arithmetic average; CTAB, hexadecyltrimethyl ammonium bromide; PVP, polvinylpyrrolidone. 0304-4238/$ – see front matter ß 2008 Published by Elsevier B.V. doi:10.1016/j.scienta.2008.10.008
characteristics, adaptability and market values (Wang, 1990; Wang and Zhuang, 2001). It is common to see drastically different cultivars in different Chinese peach production regions, even within certain provinces. To conserve these landraces and cultivars, three national peach germplasm repositories have been established in China: Beijing (Northern China), Zhengzhou (Central China), and Nanjing (Eastern China). In order to efficiently manage these ex situ conserved germplasm resources and to discover new genotypes for developing novel peach varieties, it is necessary to characterize the genetic diversity existing in landraces, selections, cultivars and even in native populations and to understand the genetic relationships among these genetic resources. Information gained in these resources will be very valuable for future breeding and germplasm collection efforts. Similar to most old domesticated fruit trees with poorly documented selection and/or breeding history and missing records, cultivar identification of Chinese peach based on morphological differences alone has proven to be difficult (Huang et al., 2008). Efforts need to be made to note morphological differences so that commercial nurseries can maintain strong quality control of cultivar identities through the clonal propagation process. Molecular fingerprinting can provide accurate genetic
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
information for future breeding and germplasm collection efforts (Hokanson et al., 1998; Cantini et al., 2001). Improving the integrity and efficiency of germplasm management is a long-term commitment to ex situ conserved genetic resource of fruit tree germplasm. Simple sequence repeats (SSRs) have been used successfully as genetic markers for identifying cultivars and germplasm accessions in many fruit trees, such as grape (Vitis sp.) (Lamboy and Alpha, 1998), tea crabapples (Malus hupehensis (Damp.) Rehd.) (Benson et al., 2001), citrus (Gulsen and Roose, 2001), sour cherry (P. cerasus L.) (Cantini et al., 2001) and kiwifruit (Actinidia Lindl.) (Zhen et al., 2004). SSR markers offer some advantages over other molecular markers, including their co-dominant inheritance, hypervariability, and high cross-species transferability (Tauraz, 1989; Bell and Ecker, 1994; Guilford et al., 1997; Sosinski et al., 2000). Currently, more than 100 SSRs have been isolated and characterized in peach (Cipriani et al., 1999; Sosinski et al., 2000; Testolin et al., 2000; Aranzana et al., 2002; Dirlewanger et al., 2002; Wang et al., 2002; Aranzana et al., 2003); they have provided a very useful and convenient tool for analyzing genetic diversity in peach. However, few Chinese peach cultivars and landraces have been analyzed using SSR markers, probably due to the fact that the majority of the old cultivars and landraces are still restricted to China. In this study, we fingerprinted 32 old landraces or modern cultivars, a subset of the Chinese core collection, using seven genetically defined SSR markers developed by Wang et al. (2002), with three particular objectives: (1) to identify (or differentiate) cultivars, especially those of similar morphological characteristics and pedigrees; (2) to assess genetic diversity among these landraces and cultivars and to compare contemporary cultivars against old landraces in genetic diversity; and (3) to discover
189
unique alleles and understand the genetic relationships among these landraces and cultivars. 2. Materials and methods 2.1. Plant materials and DNA extraction Thirty-two cultivars and landraces were sampled as a subset core collection from the national peach repository at Zhenzhou Fruit Research Institute and Wuhan Fruit and Forestry Extension Station. Detail information of cultivars and landraces is shown in Table 1. Total genomic DNA was extracted from about 500 mg of fresh bark of young shoots using the modified CTAB extraction (Doyle and Doyle, 1987) containing 10% polvinylpyrrolidone (PVP), 3% hexadecyltrimethyl ammonium bromide (CTAB) and 2% Na2S2O5. DNA was dissolved in 200 ml of TE buffer, and treated with 5 ml RNase A (5 mg ml1) at 378 for 30 min. DNA concentration was quantified by spectrophotometry (GENEQUANT, Eppendorf, Germany) and DNA at 10 ng ml1 was used as template for PCR amplification. 2.2. PCR amplification and data analysis Seven SSRs (Table 2), pchgms1, pchgms2, pchgms12, pchgms25, pchgms27, pchgms36, and pchgms40 reported by Wang et al. (2002), were used for genotyping the cultivars and landraces. PCR reactions were performed in a final volume of 10 ml containing 14 ng of genomic DNA, 1 PCR buffer (10 mM Tris–HCl, pH 9.0; 50 mM KCl; 1.5 mM MgCl2), 200 mM of each dNTP, 1.5 pmol of each primer and 0.25 unit of Ampli Taq DNA
Table 1 A subset of core collection of Chinese peach cultivars and landraces. Common name
Scientific name
Background of pedigree
81-8-38 Baimangpantao Daguanshan1 Daguanshan3 Dahongpao Dahongtao Danmo Daxiantao Hongchongban Hongchuizhi Hongshanhu JingshanZaohong Jingyu Qingzhoubaimi Ruiguang11 Ruiguang19 Ruiguang2 Ruiguang3 Ruiguang5 Ruiguang7 Sahuahongpantao Shanghaishumi Shuguang Xiahui Yanguang Youtao5-7 Zaofengwang Zaohongyan Zaohongzhu Zaokuimipantao Zaolupantao Zaosuomipantao
P. persica
Zhaohui (Baihua Juzaosheng) Yuhualu Landrace (original place: Shanghai) Mutant of bumozaosheng (a seedling from seeds mixed cultivation with Baitao, Lihe, Dajubao and Gangshanzaosheng) Mutant of bumoZaosheng (a seedling from seeds mixed cultivation with Baitao, Lihe, Dajubao and GangshanZaosheng) Landrace (original place: Hubei) Landrace (original place: Beijing) [Jingyu (Dajiubao Xingjingyoutao) NJN76] Zaohong2 Mutant of Dajiubao Unkonwn Unkonwn Qiuyu (Dajiubao Xingjingyoutao) NJN76 Zaohongbaoshi Ruiguang2 Dajiubao Xingjingyoutao Landrace (original place: Shandong) Jingyu (Dajiubao Xingjingyoutao) NJN76 Legrand 81-25-6 Jingyu (Dajiubao Xingjingyoutao) NJN76 Jingyu (Dajiubao Xingjingyoutao) NJN76 Jingyu (Dajiubao Xingjingyoutao) NJN76 Jingyu (Dajiubao Xingjingyoutao) B7R2T129 Landrace (original place: Zhejiang) Landrace (original place: Shanghai) Legrand Ruiguang2 Zhaohui (Baihua Juzhaosheng) Zhaox (Baihua Chuxiangmei) Ruiguan3 Armking 2517 NJN78 Mutant of Zaofengtao [Baifeng (Baitao Juzhaosheng) Juzhaosheng] 262 NJN72 Jinyu A369 Wanpantao Yangzhou124 (Dabanhongpantao Zaoshengshuimi) Sahuahongpantao Zaoxiangyu (Dajiubao Chuxiangmei) Baimangpantao Zhaoxia (Baihua Chuxiangmei)
Shantao Maoyingtao
P. davidiana P. tomentosa
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
190
Table 2 Polymorphisms and heterozygosities of the seven peach SSRs used in this study. SSR locus
Primer sequence
Naa
Neb
Ic
Hed
pchgms1
50 GGGTAAATATGCCCATTGTGCAATC30 50 GGATCATTGAACTACGTCAATCCTC30 50 GTCAATGAGTTCAGTGTCTACACTC30 50 AATCATAACATCATTCAGCCACTGC30 50 CGACACTTAGCTAGAAGTTGCCTTA30 50 TCAAGCTCAAGGTACCAGCA30 50 GCCAGGAGGCTTTAACCTGT30 50 TCAGACCCCCTTTCATCATC30 50 GGCTTTGTGTGGTTGAGGTT30 50 GCCCAAGTCAACTCGTAAGG30 50 GGTGACGCCAACCAAGTATT30 50 GGAAGCTCGCCACTAGTCAG30 50 TCAAGCTCAAGGTACCAGCA 30 50 AAGGCACTCTCCCTCTCCTC30 50 TCAAGCTCAAGGTACCAGCA 30 50 AAGGCACTCTCCCTCTCCTC30
4.000
1.615
0.671
0.381
3.000
2.062
0.763
0.515
2.000
1.454
0.491
0.312
4.000
2.147
0.927
0.534
2.000
1.991
0.691
0.498
4.000
1.954
0.850
0.488
3.000
1.743
0.669
0.426
3.000
1.808
0.761
0.447
3.125
1.847
0.728
0.450
pchgms2 pchgms12 pchgms25 pchgms27 pchgms36 pchgms40-1 pchgms40-2
Mean a b c d
Number of alleles per locus. Effective number of alleles (Kimura and Crow, 1964). Shannon’s Information index (Lewontin, 1972). Expected heterozygosity (Nei, 1973).
polymerase (PerkinElmer/Cetus). The 50 end of the forward primer was labeled with g33-P [ATP] (NEN) using T4 polynucleotide kinase (Promega, Madison, WI). The PCR amplification was conducted in the Thermocycler (Mastercycler gradient, Eppendorf, Germany) using the following thermal profile 4 min denaturation at 948 followed by 35 cycles of 30 s at 94 8C, 60 s at the annealing temperature depending on the different primers (Wang et al., 2002), 2 min at 72 8C, and a final extension at 72 8C for 10 min. The reaction products were denatured at 94 8C for 4 min and mixed with equal volume of formamide loading buffer (98% formamide, 10 mM of EDTA, 0.25% each of bromphenol blue and xylene cyanol). The amplification products were then electrophoresed on 6.0% denaturing gels (20:1 acrylamide–bisacrylamide, 7.5 M urea) using a BioMax STS-451 vertical sequencing gel electrophoresis unit (Kodak, Rochester, NY). Gels were run at constant power (70 V) for 2.5–4 h, depending on the fragment sizes, then vacuum dried, and exposed to BioMax MR film (Kodak, Rochester, NY) for 2–4 d. A DNA ladder ranging from 30 to 330 bp (Invitrogen) in length of 10 bp increments was used to determine the size of amplified DNA fragments. Alleles for a given locus were designated sequentially by letter starting with ‘a’ for the smallest fragment, and all genotypes were recorded (Table 3). Number of alleles per locus (Na), effective number of alleles (Ne), percentage of polymorphic loci (P), Shannon index (I) and Nei’s expected heterozygosity (He) of primers and peach cultivars were estimated using the program POPGENE version 3.2. Nei’s genetic identity (H) and genetic distance (D) were calculated for all pairwise combinations of cultivars and landraces. A dendrogram was constructed based on the matrix of the genetic identities using UPGMA (unweighted pair-group method using arithmetic average). Two species P. davidiana and P. tomentosa were used as outgroups for revealing relationship analysis.
amplification of fragments were found at three loci of primer pchgms1, pchgms12 and pchgms27 across 32 cultivars and landraces. Two sites without bands were found in the two outgroup accessions, Shantao (P. davidiana) and Maoyingtao (P. tomentosa). The allele richness (average number of alleles per locus) at the eight SSR loci was 3.125; the effective number of alleles per locus ranged from 1.454 for pchgms12 to 2.147 for pchgms25, with an average of 1.847; and the Shannon index ranged from 0.491 for pchgms12 to 0.927 for pchgms25, with an average of 0.728. The expected heterozygosity (Nei, 1973) across loci ranged from 0.312 for pchgms12 to 0.534 for pchgms25, with an average of 0.450 (Table 2). 3.2. Genetic variability, allele uniqueness and fingerprinting Chinese peach cultivars and landraces
3. Results
The mean number of alleles per locus (Na), percentage of polymorphic loci (P) and Shannon index (I), and the expected heterozygosity (He) assessed for each genotypes over all loci revealed differences among the 32 cultivars or landraces (Table 3). On average, Na = 1.461, P = 45.3%, I = 0.319 and He = 0.230, ranging from Na = 1.125, P = 12.5%, I = 0.087, and He = 0.063 for Qingzhoubaimi to Na = 1.750, P = 75.0%, I = 0.520, and He = 0.375 for Dahongtao, Sahuahongpantao Baimangpantao and Ruiguang19, respectively. Obviously, Dahongtao, Sahuahongpantao, Baimangpantao and Ruiguang19 contains greater genetic variability diverse than other cultivars. Several unique alleles were detected among this group of Chinese peaches, such as ‘c’ allele of pchgms36, ‘g’ and ‘h’ alleles of pchgms1 were exclusively in Hongchongban, ‘c’ allele of pchgms2 in Hongchuizhi, and ‘d’ allele of pchgms36 in Qingzhoubaimi. All cultivars or landraces can be unambiguously identified by multi-loci genotypes characterized by combinations of the eight SSR locus codes except Sahuahongpantao and Baimangpantao.
3.1. SSR polymorphisms and heterozygosity
3.3. Genetic relationships among accessions
The seven SSR primer pairs revealed a total of eight loci. The number of alleles per locus ranged from 2 for pchgms27 and pchgms12 to 4 for pchgms1, pchgms25 and pchgms36 (Table 3). The fragment sizes of observed alleles ranged from 133 bp (pchgms40-2) to 430 bp (pchgms12). Only four without
The genetic relationships among 32 peach cultivars or landraces and two outgroup related species Shantaoand (P. davidiana) and Maoyingtao (P. tomentosa) were analyzed by UPGMA clustering method, as presented in Fig. 1. For further examination of genetic relationships among these accessions, a cut-off point (H = 0.70)
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
191
Table 3 Genetic variability and SSR fingerprinting for a subset of core collection of Chinese peach cultivars and landraces. Cultivar/landrace
Naa
P (%)b
Ic
Hed
SSR locus code pchgms2
pchgms25
pchgms36
pchgms1
pchgms27
pchgms12
pchgms40-1
pchgms40-2
81-8-38 Baimangpantao Daguanshan1 Daguanshan3 Dahongpao Dahongtao Danmo Daxiantao Hongchongban Hongchuizhi Hongshanhu JingshanZaohong Jingyu Qingzhoubaimi Ruiguang11 Ruiguang19 Ruiguang2 Ruiguang3 Ruiguang5 Ruiguang7 Sahuhongpantao Shanghaishumi Shuguang Xiahui Yanguang Youtao5-7 Zaofengwang Zaohongyan Zaohongzhu Zaokuimipantao Zaolupantao Zaosuomipantao
1.625 1.750 1.375 1.500 1.500 1.750 1.500 1.375 1.500 1.286 1.250 1.375 1.500 1.125 1.250 1.750 1.286 1.250 1.375 1.250 1.750 1.250 1.375 1.714 1.625 1.375 1.714 1.500 1.375 1.625 1.375 1.500
62.5 75.0 37.5 50.0 50.0 75.0 50.0 37.5 50.0 25.0 25.0 37.5 50.0 12.5 25.0 75.0 25.0 25.0 37.5 25.0 75.0 25.0 37.5 62.5 62.5 37.5 62.5 50.0 37.5 62.5 37.5 50.0
0.433 0.520 0.260 0.347 0.347 0.520 0.347 0.260 0.347 0.198 0.173 0.260 0.347 0.087 0.173 0.520 0.198 0.173 0.260 0.173 0.520 0.173 0.260 0.495 0.433 0.260 0.495 0.347 0.260 0.433 0.260 0.347
0.313 0.375 0.188 0.250 0.250 0.375 0.250 0.188 0.250 0.143 0.125 0.188 0.250 0.063 0.125 0.375 0.143 0.125 0.188 0.125 0.375 0.125 0.188 0.357 0.313 0.188 0.357 0.250 0.188 0.313 0.188 0.250
ab ab ab ab ab ab ab ab ab ac ab bb ab ab ab ab ab ab ab ab ab ab bb ab ab ab ab ab ab ab ab ab
ab ac ab aa cd ab ab ab aa aa bb ab ab aa aa ab ab ab aa aa ac ab ab ab ab ab ab aa aa ab ac ac
bb bb bb bb bb bb ab bb cc bb aa ab ab dd ab ab aa aa ab aa bb bb bb bb aa ab bb bb aa bb bb bb
ab ab ab bb bb ab bb bb gh n bb ab ab bb bb bb bb bb bb bb ab aa ab bb bb bb ab bb bb ab bb ab
aa aa bb ab ab aa ab ab ab ab bb bb bb bb bb aa n bb ab ab aa aa bb n ab bb aa ab bb aa ab ab
aa ab aa aa ab ab aa aa aa aa ab aa aa aa aa ab aa aa aa aa ab aa aa ab aa aa n aa aa ab bb bb
ab ab aa ab aa ab aa aa ab bb aa aa aa aa aa ac aa aa aa aa ab aa aa ab ab aa ab ab ab ab bb bb
ab ab aa ab aa ab aa aa bb bb aa aa aa aa aa ac aa aa aa aa ab aa aa ab ac aa ab ac ac aa bb bb
Mean
1.461
45.3
0.319
0.230 de ne
ff ee
be ff
cd ef
n bc
n dc
ad ad
bb n
Shantao (P. davidiana) Maoyingtao (P. mentosa) a b c d e
Number of alleles per locus. Percentage of polymorphic loci. Shannon’s Information index (Lewontin, 1972). Expected heterozygosity (Nei, 1973). No amplification.
was determined according to Xu and Li’s (1983) method for grouping accessions. The dendrogram distinctly separated 34 accessions into four groups. The groups I and II represented two outgroup genotype Maoyingtao (P. tomentosa) and Shantao (P. davidiana), respectively. The group III consisted of Zaosuomipantao, Zaolupantao, Hongchongban and Hongchuizhi. The group IV included all the other cultivars which could be divided into two subgroups with 16 and 12 cultivars, respectively. Two related species, P. tomentosa and P. davidiana represented themselves as independent individual cluster, are well in accordance with the taxonomic and genetic dissimilarity from other cultivars or landraces of P. persica. Two closely related cultivars Zaolupantao and Zaosuomipantao clustered in the group III because they came from ‘chuxiangmei’ which was one of their parent. The two ornamental peaches, Hongchuizhi and Hongchongban with unknown pedigree, are also clustered in the group III, suggesting a possible genetic relatedness between them. Most cultivars in subgroup IV-1 of the group IV were more or less associated with Dajiubao, Xingjingyoutao and NJN76 in their breeding pedigree, except for Qingzhoubaimi and Youtao5-7 which had no recorded pedigree information. The second subgroup IV-2 comprised the other landraces and cultivars, of which only 81-8-38, Xiahui and Zhaofengwang were known sharing pedigree involved in Baihua
and Juzhaosheng, but it is highly possible that some landraces in the group had association with the breeding pedigree. 4. Discussion In the present study, the average value of 3.125 for number of alleles per locus (Table 2) is quite low in comparison to other species in genus Prunus, such as almond (P. Communis Fritsch.) with mean value of 6.64 (Shiran et al., 2007). In comparison with other studies in P. persica, this value is in agreement with a previous report of the average 3.0 alleles per locus observed in 28 cultivars (Sosinski et al., 2000), but slightly less than the value of 4.5 alleles per locus in 50 peach cultivars (Testolin et al., 2000) and more less than the value of 7.3 alleles per locus observed in a set of 212 peach cultivars using 16 polymorphic SSR markers (Aranzana et al., 2002). It is obviously that the average number of alleles per locus is associated with number of samples and number of SSRs used in the study. On the other hand, the average heterozygosity of 0.450 revealed in the present study, compared with other species within the genus, was lower than that of apricot (P. armeniaca L.) with 0.517 (Zhebentyayeva et al., 2003) and cherry with 0.946 (Cantini et al., 2001). In general, the allele richness and genetic heterozygosity revealed in these peach landraces and cultivars are
192
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
Fig. 1. Cluster of cultivars and landraces in Prunus persica and related species.
relatively poor compared to other fruit trees (Lamboy and Alpha, 1998; Benson et al., 2001; Zhen et al., 2004), but it is well in agreement with previous characterization of these SSR loci originally reported by Wang et al. (2002). The difference may reflect roles of different breeding systems and ploid levels on the overall genomic diversity between different Prunus species because P. persica is predominantly selfing and diploid. However, in comparisons within the P. persica, the average value of 0.450 was higher than 0.35 reported by Aranzana et al. (2002) and 0.32 by Cipriani et al. (1999). The reason for the higher heterozygosity in this study was probably due to the fact that some divers landraces such as Dahongtao, Dahongpao, Shanghaishumi, Sahuhongpantao, Baimangpantao, and ornamental types of Hongchongban and Hongchuizhi were wider geographic origin, of which Dahongtao originated from Beijing in Northern China; Dahongpao from Hubei in Central China; Sahuhongpantao, Baimangpantao from Shanghai and Zhejiang in Eastern China. They vary in characteristics of color, texture, flavor, harvesting date, flower structure (Hongchongban with double red petals) and tree form (Hongchuizhi with weeping growth) (Wang and Zhuang, 2001). In examination of genetic diversity for each Chinese peach assessed by number of alleles per locus, percentage of polymorphic loci, Shannon index and heterozygosity, Dahongtao, Sahuahongpantao, Baimangpantao and Ruiguang19 apparently had higher genetic diversity, which may be well explained as the fact that the first three cultivars were old landraces, but last one shared 1/2
landrace in its pedigree. It suggests that landraces are more genetically diverse and valuable in the germplasm collection. A typical example is Shanghaishumi (Chinese cling) which had been widely used as breeding parent both in China and in western countries and passed genes to most cultivars revealed by RAPD markers (Cheng, 2007a,b). Another study including 45 cultivars and rootstocks from USA, China, France, and Canada was carried by Martinez-gomezp et al. (2003) using SSR markers, disclosing Chinese cling had highest heterozygosity among them and clustering an exclusive group. Therefore, extensive evaluation using new research tools is prerequisite for conversation efficiency and improvement of germplasm management. Meanwhile, background genetic data of germplasm accessions should also be considered for integrated application in the contemporary breeding for cultivar improvement. Furthermore, unique alleles revealed in some cultivars, such as Hongchongban, Hongchuizhi and Qingzhoubaimi in this study should be emphasized in germplasm repository. The alleles of eight loci have unambiguously distinguished 30 out of 32 cultivars, even some cultivars such as Ruiguang2, Ruiguang3, Ruiguang5 and Ruiguang11 were derived from the same parents, furthermore, unique alleles detected in these cultivars provides good tool for protection of breeder’s rights and quality control of cultivar identities operated in commercial nurseries. Codominant SSR is considered as an excellent genetic marker system for pedigree analysis (Aranzana et al., 2002). Thirty-two
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
cultivars examined in the present study demonstrated that most cultivars with background information of pedigree clustered together and their relationships revealed were consistent with known pedigrees, however, the only exception is the relationship between Daguanshan 1 and Daguanshan 3. According to record, they were sports from the same parent tree, but they were divided into two different subgroups (Fig. 1). It is widely evidenced that cultivars from mutants were difficult to be distinguished in pear (Yamamoto et al., 2001), in apple (Hokanson et al., 1998), and in peach (Aranzana et al., 2002). Based on the suspicion raised in the present study, it is highly doubtful that these two cultivars named in this study are true sports from the same parent tree. This study also proved to be an improved discriminating tool over isozyme markers for the assessment of genetic diversity and relatedness. SSR fingerprinting data and assessment of genetic diversity and relatedness in this subset of core collection of Chinese peaches obtained in this study, although in limited number of cultivars and SSRs employed, should provide a useful reference for peach germplasm curators who must make acquisition policy and manage germplasm repositories and for peach breeders who are constantly facing decisions of selecting parents for breeding programs, as well as for protection of breeder’s intellectual rights. Acknowledgements This work was partially funded by the Chinese Academy of Sciences (KSCX2-YW-N-032), Wuhan municipal project and the Chenguang Young Scholar program of the Wuhan municipal government (985003074). We likewise acknowledge BCSU No. 080214 of Laboratory of Biodiversity Conservation and Sustainable Utilization, SCBG-CAS. We thank Dr. Ying Wang for technical assistance in the lab work. We are grateful to Z.B. Chen and Z.A. Deng for review and suggestions on the manuscript. References Aranzana, M.J., Garcia-Mas, J., Carbo´, J., Aru´s, P., 2002. Development and variability analysis of microsatellite markers in peach. Plant Breeding 121, 87–92. Aranzana, M.J., Pineda, A., Cosson, P., Dirlewanger, E., Ascasibar, J., Cipriani, G., Ryder, C.D., Testolin, R., Abbott, A., King, G.J., Iezzoni, A.F., Aru´s, P., 2003. A set of simple-sequence repeat (SSR) markers covering the Prunus genome. Theor. Appl. Genet. 106, 819–825. Bell, C.J., Ecker, J.R., 1994. Assignment of 30 SSR loci to the linkage map of Arabidopsis. Genomics 19, 137–144. Benson, L.L., Lamboy, W.F., Zimmerman, R.H., 2001. Molecular identification of Malus hupehensis (tea crabapple) accessions using simple sequence repeats. HortScience 36, 961–966. Cantini, C., Iezzoni, A.F., Lamboy, W.F., Boritzki, M., Struss, D., 2001. DNA fingerprinting of tetraploid cherry germplasm using simple sequence repeats. J. Am. Soc. Hortic. Sci. 126, 205–209. Cheng, Z.P., 2007a. Molecular biological study on phylogeny of subgenus Amygdalus and genetic diversity of Prunus persica. PhD Dissertation (in Chinese). Cheng, Z.P., 2007b. Genetic characterization of different demes in Prunus persica revealed by RAPD markers. Sci. Hortic. 111, 242–247. Cipriani, G., Lot, G., Huang, W.G., Peterlunger, E., Testolin, R., 1999. AC/GT and AG/ CT microsatellite repeats in peach [Prunus persica (L.) Batsch]: isolation,
193
characterization and cross-species amplification in Prunus. Theor. Appl. Genet. 99, 65–72. Dirlewanger, E., Cosson, P., Tavaud, M., Aranzana, M.J., Poizat, C., Zanetto, A., Aru´s, P., Laigret, F., 2002. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry. Theor. Appl. Genet. 105, 127–138. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19, 11–15. Guilford, P., Prakash, S., Zhu, J.M., Rikkerink, E., Gardiner, S., Bassett, H., Forster, R., 1997. Microsatellites in Malus domestica (apple): abundance, polymorphism and cultivar identification. Theor. Appl. Genet. 94, 249–254. Gulsen, O., Roose, M.L., 2001. Lemon: diversity and relationships with selected Citrus genotypes as measured with nuclear genome markers. J. Am. Soc. Hortic. Sci. 126, 309–317. Guan, H.R., Wang, X.S., 1993. Present situation of peach resource and development trends in China. Land Nat. Resour. Res. 2, 62–65 (in Chinese). Hokanson, S.C., Szewc-McFadden, A.K., Lamboy, W.F., McFerson, J.R., 1998. Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus domestica Borkh. core subset collection. Theor. Appl. Genet. 97, 671–683. Huang, H.W., Cheng, Z.P., Zhang, Z.H., Wang, Y., 2008. History of cultivation and trends in China. In: Layne, D.R. (Eds.), The Peach: Botany, Production and Uses (chapter 2). CABI, Wallingford, Oxfordshire, UK. Kimura, M., Crow, J.F., 1964. The number of alleles that can be maintained in a finite population. Genetics 49, 725–738. Lamboy, W.F., Alpha, C.G., 1998. Using simple sequence repeats (SSRs) for fingerprinting germplasm accessions of grape (Vitis L.) species. J. Am. Soc. Hortic. Sci. 123, 182–188. Lewontin, R.C., 1972. The apportionment of human diversity. Evol. Biol. 6, 381–398. Martinez-gomezp, P., Arulsekar, S., Potter, D., Gradziel, T.M., 2003. An extended interspecific gene pool available to peach and almond breeding as characterized using simple sequence repeat (SSR) markers. Euphytica 131, 313–322. Nei, M., 1973. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. U.S.A. 70, 3321–3323. Shiran, B., Amirbakhtiar, N., Kiani, S., Mohammadi, S., Sayed-Tabatabaei, B.E., Moradi, H., 2007. Molecular characterization and genetic relationship among almond cultivars assessed by RAPD and SSR markers. Sci. Hortic. 111, 280–292. Sosinski, B., Gannavarapu, M., Hager, L.D., Beck, L.E., King, G.J., Ryder, C.D., Rajapaskse, S., Baird, W.V., Ballard, R.E., Abbott, A.G., 2000. Characterization of microsatellite markers in peach [Prunus persica (L.) Batsch] Theor. Appl. Genet. 101, 421–428. Tauraz, D., 1989. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res. 17, 6463–6471. Testolin, R., Marrazzo, T., Cipriani, G., 2000. Microsatellite DNA in peach [Prunus persica (L.) Batsch] and its use in fingerprinting and testing the genetic origin of cultivars. Genome 43, 512–520. Wang, Z.H. (Ed.), 1990. Peach Cultivars. China Agricultural Press, Beijing (in Chinese). Wang, Z.H., Lu, Z.Y., Hu, Z.L., Zhang, K.B., 1989. Peach. Agricultural Science and Technology Achievements in Forty Years in China. China Agricultural Press, Beijing, pp. 179–184 (in Chinese). Wang, Y., Georgi, L.L., Zhebentyayeva, T.N., Reighard, G.L., Scorza, R., Abbott, A.G., 2002. High throughput targeted SSR marker development in peach [Prunus persica (L.) Batsch] Genome 45, 319–328. Wang, Z.H., Zhuang, E.J. as chief editor, 2001. Fruit annals in China-Scroll of peach and nectarine. China Forestry Publishing House, Beijing (in Chinese). Xu, K.R., Li, D.Z., 1983. A preliminary research on the numerical classification of the genus Panax from China. Acta Phytotaxon. Sin. 21, 34–43 (in Chinese). Yamamoto, T., Kimura, T., Sawamura, Y., Kotobuki, K., Ban, Y., Hayashi, T., Matsuta, N., 2001. SSRs isolated from apple can identify polymorphism and genetic diversity in pear. Theor. Appl. Genet. 102, 865–870. Zhebentyayeva, T.N., Reighard, G.L., Gorina, V.M., Abbott, A.G., 2003. Simple sequence repeat (SSR) analysis for assessment of genetic variability in apricot germplasm. Theor. Appl. Genet. 106, 435–444. Zhen, Y., Li, Z., Huang, H., 2004. Molecular characterization of kiwifruit (Actinidia) cultivars and selections using SSR markers. J. Am. Soc. Hortic. Sci. 129, 374–382.
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
SSR fingerprinting Chinese peach cultivars and landraces (Prunus persica) and analysis of their genetic relationships Zhongping Cheng a,b, Hongwen Huang a,c,* a
Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, Hubei 430074, P.R. China Key Laboratory for Protection of Huazhong Plant Resources and Sustainable Utility, Wuhan, Hubei 430074, P.R. China c South China Botanical Garden, Chinese Academy of Sciencs, Guangzhou, Guangdong 510650, P.R. China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 2 July 2008 Received in revised form 13 October 2008 Accepted 18 October 2008
Thirty-two Chinese peach landraces/cultivars, a major subset of the core Chinese peach collection, were fingerprinted using seven pairs of SSR primers to assess their genetic diversity and relatedness. The seven primer pairs detected eight loci and revealed an allele richness of 3.125 (average alleles per locus), an expected heterozygosity (He) of 0.450, and a Shannon index of 0.728 among the landraces/cultivars. This level of genetic diversity is lower compared to other fruit trees and Prunus congenus species (cherry and apricot), but it is comparable to previous reports in peaches. A greater level of genetic diversity was observed in landraces than in cultivars, indicating that peach landraces are valuable for germplasm collection. All cultivars and landraces, except two, were unambiguously identified based on multi-locus genotypes. Eight unique alleles were detected among this group of Chinese peaches. UPGMA clustering analysis separated the 32 cultivars/landraces into two distinct groups, which is generally in accordance with the known pedigree information. The results provide accurate genetic information for defined acquisition policy in the repositories, improving the integrity and efficiency of germplasm management and giving evidences for protection of breeder’s intellectual rights. ß 2008 Published by Elsevier B.V.
Keywords: Molecular marker Microsatellite Cultivar identification Genetic diversity
1. Introduction Peach [Prunus persica (L.) Batsch.] has been widely grown in the world, from cold temperate zones to subtropical zones in both hemispheres. It is an important member of Rosaceae and has been an economically important fruit tree crop. Peach originated in China (Wang and Zhuang, 2001), and China has the longest history of peach cultivation in the world (Huang et al., 2008). Domestication and cultivation of peach in China can date back to as early as 4000 years ago. Since then, Chinese have made extensive efforts on selection and cultivation of natural mutants and chance seedlings (Huang et al., 2008). This has resulted in a very large number (>800) of peach landraces and cultivars in China (Wang et al., 1989; Guan and Wang, 1993). These landraces and cultivars show a great diversity in fruit
* Corresponding author at: South China Botanical Garden/South China Institute of Botany, Chinese Academy of Sciences, Xinke Road 723, Tianhe District, Guangzhou 510650, P.R. China. E-mail address: [email protected] (H. Huang). Abbreviations: SSR, simple sequence repeat; UPGMA, un-weighted pair group method with arithmetic average; CTAB, hexadecyltrimethyl ammonium bromide; PVP, polvinylpyrrolidone. 0304-4238/$ – see front matter ß 2008 Published by Elsevier B.V. doi:10.1016/j.scienta.2008.10.008
characteristics, adaptability and market values (Wang, 1990; Wang and Zhuang, 2001). It is common to see drastically different cultivars in different Chinese peach production regions, even within certain provinces. To conserve these landraces and cultivars, three national peach germplasm repositories have been established in China: Beijing (Northern China), Zhengzhou (Central China), and Nanjing (Eastern China). In order to efficiently manage these ex situ conserved germplasm resources and to discover new genotypes for developing novel peach varieties, it is necessary to characterize the genetic diversity existing in landraces, selections, cultivars and even in native populations and to understand the genetic relationships among these genetic resources. Information gained in these resources will be very valuable for future breeding and germplasm collection efforts. Similar to most old domesticated fruit trees with poorly documented selection and/or breeding history and missing records, cultivar identification of Chinese peach based on morphological differences alone has proven to be difficult (Huang et al., 2008). Efforts need to be made to note morphological differences so that commercial nurseries can maintain strong quality control of cultivar identities through the clonal propagation process. Molecular fingerprinting can provide accurate genetic
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
information for future breeding and germplasm collection efforts (Hokanson et al., 1998; Cantini et al., 2001). Improving the integrity and efficiency of germplasm management is a long-term commitment to ex situ conserved genetic resource of fruit tree germplasm. Simple sequence repeats (SSRs) have been used successfully as genetic markers for identifying cultivars and germplasm accessions in many fruit trees, such as grape (Vitis sp.) (Lamboy and Alpha, 1998), tea crabapples (Malus hupehensis (Damp.) Rehd.) (Benson et al., 2001), citrus (Gulsen and Roose, 2001), sour cherry (P. cerasus L.) (Cantini et al., 2001) and kiwifruit (Actinidia Lindl.) (Zhen et al., 2004). SSR markers offer some advantages over other molecular markers, including their co-dominant inheritance, hypervariability, and high cross-species transferability (Tauraz, 1989; Bell and Ecker, 1994; Guilford et al., 1997; Sosinski et al., 2000). Currently, more than 100 SSRs have been isolated and characterized in peach (Cipriani et al., 1999; Sosinski et al., 2000; Testolin et al., 2000; Aranzana et al., 2002; Dirlewanger et al., 2002; Wang et al., 2002; Aranzana et al., 2003); they have provided a very useful and convenient tool for analyzing genetic diversity in peach. However, few Chinese peach cultivars and landraces have been analyzed using SSR markers, probably due to the fact that the majority of the old cultivars and landraces are still restricted to China. In this study, we fingerprinted 32 old landraces or modern cultivars, a subset of the Chinese core collection, using seven genetically defined SSR markers developed by Wang et al. (2002), with three particular objectives: (1) to identify (or differentiate) cultivars, especially those of similar morphological characteristics and pedigrees; (2) to assess genetic diversity among these landraces and cultivars and to compare contemporary cultivars against old landraces in genetic diversity; and (3) to discover
189
unique alleles and understand the genetic relationships among these landraces and cultivars. 2. Materials and methods 2.1. Plant materials and DNA extraction Thirty-two cultivars and landraces were sampled as a subset core collection from the national peach repository at Zhenzhou Fruit Research Institute and Wuhan Fruit and Forestry Extension Station. Detail information of cultivars and landraces is shown in Table 1. Total genomic DNA was extracted from about 500 mg of fresh bark of young shoots using the modified CTAB extraction (Doyle and Doyle, 1987) containing 10% polvinylpyrrolidone (PVP), 3% hexadecyltrimethyl ammonium bromide (CTAB) and 2% Na2S2O5. DNA was dissolved in 200 ml of TE buffer, and treated with 5 ml RNase A (5 mg ml1) at 378 for 30 min. DNA concentration was quantified by spectrophotometry (GENEQUANT, Eppendorf, Germany) and DNA at 10 ng ml1 was used as template for PCR amplification. 2.2. PCR amplification and data analysis Seven SSRs (Table 2), pchgms1, pchgms2, pchgms12, pchgms25, pchgms27, pchgms36, and pchgms40 reported by Wang et al. (2002), were used for genotyping the cultivars and landraces. PCR reactions were performed in a final volume of 10 ml containing 14 ng of genomic DNA, 1 PCR buffer (10 mM Tris–HCl, pH 9.0; 50 mM KCl; 1.5 mM MgCl2), 200 mM of each dNTP, 1.5 pmol of each primer and 0.25 unit of Ampli Taq DNA
Table 1 A subset of core collection of Chinese peach cultivars and landraces. Common name
Scientific name
Background of pedigree
81-8-38 Baimangpantao Daguanshan1 Daguanshan3 Dahongpao Dahongtao Danmo Daxiantao Hongchongban Hongchuizhi Hongshanhu JingshanZaohong Jingyu Qingzhoubaimi Ruiguang11 Ruiguang19 Ruiguang2 Ruiguang3 Ruiguang5 Ruiguang7 Sahuahongpantao Shanghaishumi Shuguang Xiahui Yanguang Youtao5-7 Zaofengwang Zaohongyan Zaohongzhu Zaokuimipantao Zaolupantao Zaosuomipantao
P. persica
Zhaohui (Baihua Juzaosheng) Yuhualu Landrace (original place: Shanghai) Mutant of bumozaosheng (a seedling from seeds mixed cultivation with Baitao, Lihe, Dajubao and Gangshanzaosheng) Mutant of bumoZaosheng (a seedling from seeds mixed cultivation with Baitao, Lihe, Dajubao and GangshanZaosheng) Landrace (original place: Hubei) Landrace (original place: Beijing) [Jingyu (Dajiubao Xingjingyoutao) NJN76] Zaohong2 Mutant of Dajiubao Unkonwn Unkonwn Qiuyu (Dajiubao Xingjingyoutao) NJN76 Zaohongbaoshi Ruiguang2 Dajiubao Xingjingyoutao Landrace (original place: Shandong) Jingyu (Dajiubao Xingjingyoutao) NJN76 Legrand 81-25-6 Jingyu (Dajiubao Xingjingyoutao) NJN76 Jingyu (Dajiubao Xingjingyoutao) NJN76 Jingyu (Dajiubao Xingjingyoutao) NJN76 Jingyu (Dajiubao Xingjingyoutao) B7R2T129 Landrace (original place: Zhejiang) Landrace (original place: Shanghai) Legrand Ruiguang2 Zhaohui (Baihua Juzhaosheng) Zhaox (Baihua Chuxiangmei) Ruiguan3 Armking 2517 NJN78 Mutant of Zaofengtao [Baifeng (Baitao Juzhaosheng) Juzhaosheng] 262 NJN72 Jinyu A369 Wanpantao Yangzhou124 (Dabanhongpantao Zaoshengshuimi) Sahuahongpantao Zaoxiangyu (Dajiubao Chuxiangmei) Baimangpantao Zhaoxia (Baihua Chuxiangmei)
Shantao Maoyingtao
P. davidiana P. tomentosa
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
190
Table 2 Polymorphisms and heterozygosities of the seven peach SSRs used in this study. SSR locus
Primer sequence
Naa
Neb
Ic
Hed
pchgms1
50 GGGTAAATATGCCCATTGTGCAATC30 50 GGATCATTGAACTACGTCAATCCTC30 50 GTCAATGAGTTCAGTGTCTACACTC30 50 AATCATAACATCATTCAGCCACTGC30 50 CGACACTTAGCTAGAAGTTGCCTTA30 50 TCAAGCTCAAGGTACCAGCA30 50 GCCAGGAGGCTTTAACCTGT30 50 TCAGACCCCCTTTCATCATC30 50 GGCTTTGTGTGGTTGAGGTT30 50 GCCCAAGTCAACTCGTAAGG30 50 GGTGACGCCAACCAAGTATT30 50 GGAAGCTCGCCACTAGTCAG30 50 TCAAGCTCAAGGTACCAGCA 30 50 AAGGCACTCTCCCTCTCCTC30 50 TCAAGCTCAAGGTACCAGCA 30 50 AAGGCACTCTCCCTCTCCTC30
4.000
1.615
0.671
0.381
3.000
2.062
0.763
0.515
2.000
1.454
0.491
0.312
4.000
2.147
0.927
0.534
2.000
1.991
0.691
0.498
4.000
1.954
0.850
0.488
3.000
1.743
0.669
0.426
3.000
1.808
0.761
0.447
3.125
1.847
0.728
0.450
pchgms2 pchgms12 pchgms25 pchgms27 pchgms36 pchgms40-1 pchgms40-2
Mean a b c d
Number of alleles per locus. Effective number of alleles (Kimura and Crow, 1964). Shannon’s Information index (Lewontin, 1972). Expected heterozygosity (Nei, 1973).
polymerase (PerkinElmer/Cetus). The 50 end of the forward primer was labeled with g33-P [ATP] (NEN) using T4 polynucleotide kinase (Promega, Madison, WI). The PCR amplification was conducted in the Thermocycler (Mastercycler gradient, Eppendorf, Germany) using the following thermal profile 4 min denaturation at 948 followed by 35 cycles of 30 s at 94 8C, 60 s at the annealing temperature depending on the different primers (Wang et al., 2002), 2 min at 72 8C, and a final extension at 72 8C for 10 min. The reaction products were denatured at 94 8C for 4 min and mixed with equal volume of formamide loading buffer (98% formamide, 10 mM of EDTA, 0.25% each of bromphenol blue and xylene cyanol). The amplification products were then electrophoresed on 6.0% denaturing gels (20:1 acrylamide–bisacrylamide, 7.5 M urea) using a BioMax STS-451 vertical sequencing gel electrophoresis unit (Kodak, Rochester, NY). Gels were run at constant power (70 V) for 2.5–4 h, depending on the fragment sizes, then vacuum dried, and exposed to BioMax MR film (Kodak, Rochester, NY) for 2–4 d. A DNA ladder ranging from 30 to 330 bp (Invitrogen) in length of 10 bp increments was used to determine the size of amplified DNA fragments. Alleles for a given locus were designated sequentially by letter starting with ‘a’ for the smallest fragment, and all genotypes were recorded (Table 3). Number of alleles per locus (Na), effective number of alleles (Ne), percentage of polymorphic loci (P), Shannon index (I) and Nei’s expected heterozygosity (He) of primers and peach cultivars were estimated using the program POPGENE version 3.2. Nei’s genetic identity (H) and genetic distance (D) were calculated for all pairwise combinations of cultivars and landraces. A dendrogram was constructed based on the matrix of the genetic identities using UPGMA (unweighted pair-group method using arithmetic average). Two species P. davidiana and P. tomentosa were used as outgroups for revealing relationship analysis.
amplification of fragments were found at three loci of primer pchgms1, pchgms12 and pchgms27 across 32 cultivars and landraces. Two sites without bands were found in the two outgroup accessions, Shantao (P. davidiana) and Maoyingtao (P. tomentosa). The allele richness (average number of alleles per locus) at the eight SSR loci was 3.125; the effective number of alleles per locus ranged from 1.454 for pchgms12 to 2.147 for pchgms25, with an average of 1.847; and the Shannon index ranged from 0.491 for pchgms12 to 0.927 for pchgms25, with an average of 0.728. The expected heterozygosity (Nei, 1973) across loci ranged from 0.312 for pchgms12 to 0.534 for pchgms25, with an average of 0.450 (Table 2). 3.2. Genetic variability, allele uniqueness and fingerprinting Chinese peach cultivars and landraces
3. Results
The mean number of alleles per locus (Na), percentage of polymorphic loci (P) and Shannon index (I), and the expected heterozygosity (He) assessed for each genotypes over all loci revealed differences among the 32 cultivars or landraces (Table 3). On average, Na = 1.461, P = 45.3%, I = 0.319 and He = 0.230, ranging from Na = 1.125, P = 12.5%, I = 0.087, and He = 0.063 for Qingzhoubaimi to Na = 1.750, P = 75.0%, I = 0.520, and He = 0.375 for Dahongtao, Sahuahongpantao Baimangpantao and Ruiguang19, respectively. Obviously, Dahongtao, Sahuahongpantao, Baimangpantao and Ruiguang19 contains greater genetic variability diverse than other cultivars. Several unique alleles were detected among this group of Chinese peaches, such as ‘c’ allele of pchgms36, ‘g’ and ‘h’ alleles of pchgms1 were exclusively in Hongchongban, ‘c’ allele of pchgms2 in Hongchuizhi, and ‘d’ allele of pchgms36 in Qingzhoubaimi. All cultivars or landraces can be unambiguously identified by multi-loci genotypes characterized by combinations of the eight SSR locus codes except Sahuahongpantao and Baimangpantao.
3.1. SSR polymorphisms and heterozygosity
3.3. Genetic relationships among accessions
The seven SSR primer pairs revealed a total of eight loci. The number of alleles per locus ranged from 2 for pchgms27 and pchgms12 to 4 for pchgms1, pchgms25 and pchgms36 (Table 3). The fragment sizes of observed alleles ranged from 133 bp (pchgms40-2) to 430 bp (pchgms12). Only four without
The genetic relationships among 32 peach cultivars or landraces and two outgroup related species Shantaoand (P. davidiana) and Maoyingtao (P. tomentosa) were analyzed by UPGMA clustering method, as presented in Fig. 1. For further examination of genetic relationships among these accessions, a cut-off point (H = 0.70)
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
191
Table 3 Genetic variability and SSR fingerprinting for a subset of core collection of Chinese peach cultivars and landraces. Cultivar/landrace
Naa
P (%)b
Ic
Hed
SSR locus code pchgms2
pchgms25
pchgms36
pchgms1
pchgms27
pchgms12
pchgms40-1
pchgms40-2
81-8-38 Baimangpantao Daguanshan1 Daguanshan3 Dahongpao Dahongtao Danmo Daxiantao Hongchongban Hongchuizhi Hongshanhu JingshanZaohong Jingyu Qingzhoubaimi Ruiguang11 Ruiguang19 Ruiguang2 Ruiguang3 Ruiguang5 Ruiguang7 Sahuhongpantao Shanghaishumi Shuguang Xiahui Yanguang Youtao5-7 Zaofengwang Zaohongyan Zaohongzhu Zaokuimipantao Zaolupantao Zaosuomipantao
1.625 1.750 1.375 1.500 1.500 1.750 1.500 1.375 1.500 1.286 1.250 1.375 1.500 1.125 1.250 1.750 1.286 1.250 1.375 1.250 1.750 1.250 1.375 1.714 1.625 1.375 1.714 1.500 1.375 1.625 1.375 1.500
62.5 75.0 37.5 50.0 50.0 75.0 50.0 37.5 50.0 25.0 25.0 37.5 50.0 12.5 25.0 75.0 25.0 25.0 37.5 25.0 75.0 25.0 37.5 62.5 62.5 37.5 62.5 50.0 37.5 62.5 37.5 50.0
0.433 0.520 0.260 0.347 0.347 0.520 0.347 0.260 0.347 0.198 0.173 0.260 0.347 0.087 0.173 0.520 0.198 0.173 0.260 0.173 0.520 0.173 0.260 0.495 0.433 0.260 0.495 0.347 0.260 0.433 0.260 0.347
0.313 0.375 0.188 0.250 0.250 0.375 0.250 0.188 0.250 0.143 0.125 0.188 0.250 0.063 0.125 0.375 0.143 0.125 0.188 0.125 0.375 0.125 0.188 0.357 0.313 0.188 0.357 0.250 0.188 0.313 0.188 0.250
ab ab ab ab ab ab ab ab ab ac ab bb ab ab ab ab ab ab ab ab ab ab bb ab ab ab ab ab ab ab ab ab
ab ac ab aa cd ab ab ab aa aa bb ab ab aa aa ab ab ab aa aa ac ab ab ab ab ab ab aa aa ab ac ac
bb bb bb bb bb bb ab bb cc bb aa ab ab dd ab ab aa aa ab aa bb bb bb bb aa ab bb bb aa bb bb bb
ab ab ab bb bb ab bb bb gh n bb ab ab bb bb bb bb bb bb bb ab aa ab bb bb bb ab bb bb ab bb ab
aa aa bb ab ab aa ab ab ab ab bb bb bb bb bb aa n bb ab ab aa aa bb n ab bb aa ab bb aa ab ab
aa ab aa aa ab ab aa aa aa aa ab aa aa aa aa ab aa aa aa aa ab aa aa ab aa aa n aa aa ab bb bb
ab ab aa ab aa ab aa aa ab bb aa aa aa aa aa ac aa aa aa aa ab aa aa ab ab aa ab ab ab ab bb bb
ab ab aa ab aa ab aa aa bb bb aa aa aa aa aa ac aa aa aa aa ab aa aa ab ac aa ab ac ac aa bb bb
Mean
1.461
45.3
0.319
0.230 de ne
ff ee
be ff
cd ef
n bc
n dc
ad ad
bb n
Shantao (P. davidiana) Maoyingtao (P. mentosa) a b c d e
Number of alleles per locus. Percentage of polymorphic loci. Shannon’s Information index (Lewontin, 1972). Expected heterozygosity (Nei, 1973). No amplification.
was determined according to Xu and Li’s (1983) method for grouping accessions. The dendrogram distinctly separated 34 accessions into four groups. The groups I and II represented two outgroup genotype Maoyingtao (P. tomentosa) and Shantao (P. davidiana), respectively. The group III consisted of Zaosuomipantao, Zaolupantao, Hongchongban and Hongchuizhi. The group IV included all the other cultivars which could be divided into two subgroups with 16 and 12 cultivars, respectively. Two related species, P. tomentosa and P. davidiana represented themselves as independent individual cluster, are well in accordance with the taxonomic and genetic dissimilarity from other cultivars or landraces of P. persica. Two closely related cultivars Zaolupantao and Zaosuomipantao clustered in the group III because they came from ‘chuxiangmei’ which was one of their parent. The two ornamental peaches, Hongchuizhi and Hongchongban with unknown pedigree, are also clustered in the group III, suggesting a possible genetic relatedness between them. Most cultivars in subgroup IV-1 of the group IV were more or less associated with Dajiubao, Xingjingyoutao and NJN76 in their breeding pedigree, except for Qingzhoubaimi and Youtao5-7 which had no recorded pedigree information. The second subgroup IV-2 comprised the other landraces and cultivars, of which only 81-8-38, Xiahui and Zhaofengwang were known sharing pedigree involved in Baihua
and Juzhaosheng, but it is highly possible that some landraces in the group had association with the breeding pedigree. 4. Discussion In the present study, the average value of 3.125 for number of alleles per locus (Table 2) is quite low in comparison to other species in genus Prunus, such as almond (P. Communis Fritsch.) with mean value of 6.64 (Shiran et al., 2007). In comparison with other studies in P. persica, this value is in agreement with a previous report of the average 3.0 alleles per locus observed in 28 cultivars (Sosinski et al., 2000), but slightly less than the value of 4.5 alleles per locus in 50 peach cultivars (Testolin et al., 2000) and more less than the value of 7.3 alleles per locus observed in a set of 212 peach cultivars using 16 polymorphic SSR markers (Aranzana et al., 2002). It is obviously that the average number of alleles per locus is associated with number of samples and number of SSRs used in the study. On the other hand, the average heterozygosity of 0.450 revealed in the present study, compared with other species within the genus, was lower than that of apricot (P. armeniaca L.) with 0.517 (Zhebentyayeva et al., 2003) and cherry with 0.946 (Cantini et al., 2001). In general, the allele richness and genetic heterozygosity revealed in these peach landraces and cultivars are
192
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
Fig. 1. Cluster of cultivars and landraces in Prunus persica and related species.
relatively poor compared to other fruit trees (Lamboy and Alpha, 1998; Benson et al., 2001; Zhen et al., 2004), but it is well in agreement with previous characterization of these SSR loci originally reported by Wang et al. (2002). The difference may reflect roles of different breeding systems and ploid levels on the overall genomic diversity between different Prunus species because P. persica is predominantly selfing and diploid. However, in comparisons within the P. persica, the average value of 0.450 was higher than 0.35 reported by Aranzana et al. (2002) and 0.32 by Cipriani et al. (1999). The reason for the higher heterozygosity in this study was probably due to the fact that some divers landraces such as Dahongtao, Dahongpao, Shanghaishumi, Sahuhongpantao, Baimangpantao, and ornamental types of Hongchongban and Hongchuizhi were wider geographic origin, of which Dahongtao originated from Beijing in Northern China; Dahongpao from Hubei in Central China; Sahuhongpantao, Baimangpantao from Shanghai and Zhejiang in Eastern China. They vary in characteristics of color, texture, flavor, harvesting date, flower structure (Hongchongban with double red petals) and tree form (Hongchuizhi with weeping growth) (Wang and Zhuang, 2001). In examination of genetic diversity for each Chinese peach assessed by number of alleles per locus, percentage of polymorphic loci, Shannon index and heterozygosity, Dahongtao, Sahuahongpantao, Baimangpantao and Ruiguang19 apparently had higher genetic diversity, which may be well explained as the fact that the first three cultivars were old landraces, but last one shared 1/2
landrace in its pedigree. It suggests that landraces are more genetically diverse and valuable in the germplasm collection. A typical example is Shanghaishumi (Chinese cling) which had been widely used as breeding parent both in China and in western countries and passed genes to most cultivars revealed by RAPD markers (Cheng, 2007a,b). Another study including 45 cultivars and rootstocks from USA, China, France, and Canada was carried by Martinez-gomezp et al. (2003) using SSR markers, disclosing Chinese cling had highest heterozygosity among them and clustering an exclusive group. Therefore, extensive evaluation using new research tools is prerequisite for conversation efficiency and improvement of germplasm management. Meanwhile, background genetic data of germplasm accessions should also be considered for integrated application in the contemporary breeding for cultivar improvement. Furthermore, unique alleles revealed in some cultivars, such as Hongchongban, Hongchuizhi and Qingzhoubaimi in this study should be emphasized in germplasm repository. The alleles of eight loci have unambiguously distinguished 30 out of 32 cultivars, even some cultivars such as Ruiguang2, Ruiguang3, Ruiguang5 and Ruiguang11 were derived from the same parents, furthermore, unique alleles detected in these cultivars provides good tool for protection of breeder’s rights and quality control of cultivar identities operated in commercial nurseries. Codominant SSR is considered as an excellent genetic marker system for pedigree analysis (Aranzana et al., 2002). Thirty-two
Z. Cheng, H. Huang / Scientia Horticulturae 120 (2009) 188–193
cultivars examined in the present study demonstrated that most cultivars with background information of pedigree clustered together and their relationships revealed were consistent with known pedigrees, however, the only exception is the relationship between Daguanshan 1 and Daguanshan 3. According to record, they were sports from the same parent tree, but they were divided into two different subgroups (Fig. 1). It is widely evidenced that cultivars from mutants were difficult to be distinguished in pear (Yamamoto et al., 2001), in apple (Hokanson et al., 1998), and in peach (Aranzana et al., 2002). Based on the suspicion raised in the present study, it is highly doubtful that these two cultivars named in this study are true sports from the same parent tree. This study also proved to be an improved discriminating tool over isozyme markers for the assessment of genetic diversity and relatedness. SSR fingerprinting data and assessment of genetic diversity and relatedness in this subset of core collection of Chinese peaches obtained in this study, although in limited number of cultivars and SSRs employed, should provide a useful reference for peach germplasm curators who must make acquisition policy and manage germplasm repositories and for peach breeders who are constantly facing decisions of selecting parents for breeding programs, as well as for protection of breeder’s intellectual rights. Acknowledgements This work was partially funded by the Chinese Academy of Sciences (KSCX2-YW-N-032), Wuhan municipal project and the Chenguang Young Scholar program of the Wuhan municipal government (985003074). We likewise acknowledge BCSU No. 080214 of Laboratory of Biodiversity Conservation and Sustainable Utilization, SCBG-CAS. We thank Dr. Ying Wang for technical assistance in the lab work. We are grateful to Z.B. Chen and Z.A. Deng for review and suggestions on the manuscript. References Aranzana, M.J., Garcia-Mas, J., Carbo´, J., Aru´s, P., 2002. Development and variability analysis of microsatellite markers in peach. Plant Breeding 121, 87–92. Aranzana, M.J., Pineda, A., Cosson, P., Dirlewanger, E., Ascasibar, J., Cipriani, G., Ryder, C.D., Testolin, R., Abbott, A., King, G.J., Iezzoni, A.F., Aru´s, P., 2003. A set of simple-sequence repeat (SSR) markers covering the Prunus genome. Theor. Appl. Genet. 106, 819–825. Bell, C.J., Ecker, J.R., 1994. Assignment of 30 SSR loci to the linkage map of Arabidopsis. Genomics 19, 137–144. Benson, L.L., Lamboy, W.F., Zimmerman, R.H., 2001. Molecular identification of Malus hupehensis (tea crabapple) accessions using simple sequence repeats. HortScience 36, 961–966. Cantini, C., Iezzoni, A.F., Lamboy, W.F., Boritzki, M., Struss, D., 2001. DNA fingerprinting of tetraploid cherry germplasm using simple sequence repeats. J. Am. Soc. Hortic. Sci. 126, 205–209. Cheng, Z.P., 2007a. Molecular biological study on phylogeny of subgenus Amygdalus and genetic diversity of Prunus persica. PhD Dissertation (in Chinese). Cheng, Z.P., 2007b. Genetic characterization of different demes in Prunus persica revealed by RAPD markers. Sci. Hortic. 111, 242–247. Cipriani, G., Lot, G., Huang, W.G., Peterlunger, E., Testolin, R., 1999. AC/GT and AG/ CT microsatellite repeats in peach [Prunus persica (L.) Batsch]: isolation,
193
characterization and cross-species amplification in Prunus. Theor. Appl. Genet. 99, 65–72. Dirlewanger, E., Cosson, P., Tavaud, M., Aranzana, M.J., Poizat, C., Zanetto, A., Aru´s, P., Laigret, F., 2002. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry. Theor. Appl. Genet. 105, 127–138. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19, 11–15. Guilford, P., Prakash, S., Zhu, J.M., Rikkerink, E., Gardiner, S., Bassett, H., Forster, R., 1997. Microsatellites in Malus domestica (apple): abundance, polymorphism and cultivar identification. Theor. Appl. Genet. 94, 249–254. Gulsen, O., Roose, M.L., 2001. Lemon: diversity and relationships with selected Citrus genotypes as measured with nuclear genome markers. J. Am. Soc. Hortic. Sci. 126, 309–317. Guan, H.R., Wang, X.S., 1993. Present situation of peach resource and development trends in China. Land Nat. Resour. Res. 2, 62–65 (in Chinese). Hokanson, S.C., Szewc-McFadden, A.K., Lamboy, W.F., McFerson, J.R., 1998. Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus domestica Borkh. core subset collection. Theor. Appl. Genet. 97, 671–683. Huang, H.W., Cheng, Z.P., Zhang, Z.H., Wang, Y., 2008. History of cultivation and trends in China. In: Layne, D.R. (Eds.), The Peach: Botany, Production and Uses (chapter 2). CABI, Wallingford, Oxfordshire, UK. Kimura, M., Crow, J.F., 1964. The number of alleles that can be maintained in a finite population. Genetics 49, 725–738. Lamboy, W.F., Alpha, C.G., 1998. Using simple sequence repeats (SSRs) for fingerprinting germplasm accessions of grape (Vitis L.) species. J. Am. Soc. Hortic. Sci. 123, 182–188. Lewontin, R.C., 1972. The apportionment of human diversity. Evol. Biol. 6, 381–398. Martinez-gomezp, P., Arulsekar, S., Potter, D., Gradziel, T.M., 2003. An extended interspecific gene pool available to peach and almond breeding as characterized using simple sequence repeat (SSR) markers. Euphytica 131, 313–322. Nei, M., 1973. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. U.S.A. 70, 3321–3323. Shiran, B., Amirbakhtiar, N., Kiani, S., Mohammadi, S., Sayed-Tabatabaei, B.E., Moradi, H., 2007. Molecular characterization and genetic relationship among almond cultivars assessed by RAPD and SSR markers. Sci. Hortic. 111, 280–292. Sosinski, B., Gannavarapu, M., Hager, L.D., Beck, L.E., King, G.J., Ryder, C.D., Rajapaskse, S., Baird, W.V., Ballard, R.E., Abbott, A.G., 2000. Characterization of microsatellite markers in peach [Prunus persica (L.) Batsch] Theor. Appl. Genet. 101, 421–428. Tauraz, D., 1989. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res. 17, 6463–6471. Testolin, R., Marrazzo, T., Cipriani, G., 2000. Microsatellite DNA in peach [Prunus persica (L.) Batsch] and its use in fingerprinting and testing the genetic origin of cultivars. Genome 43, 512–520. Wang, Z.H. (Ed.), 1990. Peach Cultivars. China Agricultural Press, Beijing (in Chinese). Wang, Z.H., Lu, Z.Y., Hu, Z.L., Zhang, K.B., 1989. Peach. Agricultural Science and Technology Achievements in Forty Years in China. China Agricultural Press, Beijing, pp. 179–184 (in Chinese). Wang, Y., Georgi, L.L., Zhebentyayeva, T.N., Reighard, G.L., Scorza, R., Abbott, A.G., 2002. High throughput targeted SSR marker development in peach [Prunus persica (L.) Batsch] Genome 45, 319–328. Wang, Z.H., Zhuang, E.J. as chief editor, 2001. Fruit annals in China-Scroll of peach and nectarine. China Forestry Publishing House, Beijing (in Chinese). Xu, K.R., Li, D.Z., 1983. A preliminary research on the numerical classification of the genus Panax from China. Acta Phytotaxon. Sin. 21, 34–43 (in Chinese). Yamamoto, T., Kimura, T., Sawamura, Y., Kotobuki, K., Ban, Y., Hayashi, T., Matsuta, N., 2001. SSRs isolated from apple can identify polymorphism and genetic diversity in pear. Theor. Appl. Genet. 102, 865–870. Zhebentyayeva, T.N., Reighard, G.L., Gorina, V.M., Abbott, A.G., 2003. Simple sequence repeat (SSR) analysis for assessment of genetic variability in apricot germplasm. Theor. Appl. Genet. 106, 435–444. Zhen, Y., Li, Z., Huang, H., 2004. Molecular characterization of kiwifruit (Actinidia) cultivars and selections using SSR markers. J. Am. Soc. Hortic. Sci. 129, 374–382.