Stability of the ligand-estrogen receptor interaction depends on estrogen response element flanking sequences and cellular factors

ft. Steroid Biochem. MoIec. Biol. Vol. 59, No. 5/6, pp. 413-429, 1996

Pergamon

PII: S0960-0760(96)00129-X

Copyright © 1996 Elsevier Science Ltd. All rights reserved Printed in Great Britain 0960-0760/96 $15.00 + 0.00

Stability of the Ligand-estrogen Receptor Interaction Depends on Estrogen Response Element Flanking Sequences and Cellular Factors Jennifer H. Anolik, Carolyn M. Klinge*, Colleen L. Brolly, Robert A. Bambara and Russell Hilf Department of Biochemistry and the Cancer Center, The University of Rochester School of Medicine and Dentistry, Rochester, N Y 14642, U.S.A.

T o d e t e r m i n e w h e t h e r a c c e s s o r y p r o t e i n s m e d i a t e t he ligand- a n d DNA s e q u e n c e - d e p e n d e n t specificity o f e s t r o g e n r e c e p t o r (ER) i n t e r a c t i o n with DNA, the b i n d i n g o f p a r t l y p u r i f i e d vs highly p u r i fied b o v in e E R to v a r i o u s e s t r o g e n r e s p o n s e e l e m e n t s (EREs) was m e a s u r e d in t he p r e s e n c e o f d i f f e r e n t E R ligands. P a r t l y p u r i f i e d e s t r a d i o l - l i g a n d e d E R (Ee-ER) bi nds c o o p e r a t i v e l y to s t e r e o a ligned t a n d e m E R E s flanked b y n a t u r a l l y o c c u r r i n g A T - r i c h sequences, with a s t o i c h i o m e t r y o f one E e - E R d i m e r p e r E R E . In c o n t r a s t , highly p u r i f i e d E e - E R bi nds with a 10-fold l ow er affinity a n d n o n - c o o p e r a t i v e l y to E R E s flanked by t he A T - r i c h region. M o r e o v e r , t he b i n d i n g s t o i c h i o m e t r y o f highly p u r i f i e d E e - E R was 0.5 E e - E R d i m e r , o r one m o n o m e r p e r E R E , i n d e p e n d e n t o f t he E R E flanking s e q u e n c e . I nt e r es t i ngl y, the b i n d i n g o f E R l i ganded with t he a n t i e s t r o g e n 4 - h y d r o x y t a m o x i fen ( 4 - O H T - E R ) was n o n - c o o p e r a t i v e with an a p p a r e n t s t o i c h l o m e t r y o f 0.5 4 - O H T - E R d l m e r p e r E R E , r e g a r d l e s s o f E R p u r i t y or E R E flanking s e q u e n c e . We r e c e n t l y showed t h a t w h e n 4 - O H T - E R binds DNA, one m o l e c u l e o f 4 - O H T dissociates f r o m t he d i m e r i c 4 - O H T - E R - E R E c o m p l e x , a c c o u n t i n g f o r t he r e d u c e d a p p a r e n t b i n d i n g s t o i c h i o m e t r y . In c o n t r a s t , E R covalently b o u n d b y t a m o x i f e n a z i r i d i n e (TAz) gave an E R E b i n d i n g s t o i c h l o m e t r y o f one T A z - E R d i m e r p e r E R E , a n d T A z - E R b in d s c o o p e r a t i v e l y to m u l t i p l e A T - r i c h E R E s , r e g a r d l e s s o f t he p u r i t y o f t he r e c e p t o r . We h a v e o b t a i n e d e v i d e n c e t h a t p u r i f i c a t i o n o f E R r e m o v e s an a c c e s s o r y p r o t e i n ( s ) t h a t i n t e r a c t s with E R in a s e q u e n c e - a n d / o r D N A c o n f o r m a t i o n a l - d e p e n d e n t m a n n e r , resul t i ng in stabiliTation o f E 2 , b u t n o t 4 - O H T , in t he ligand b i n d i n g d o m a i n w h e n the r e c e p t o r binds to DNA. We p o s t u l a t e t h a t r e t e n t i o n o f ligand by E R m a i n t a i n s the r e c e p t o r in a c o n f o r m a t i o n n e c e s s a r y to achieve high-affinity, c o o p e r a t i v e E R E bi ndi ng. C o p y r i g h t © 1996 E l sevi er Sci ence Ltd.

J. Steroid Biochem. MoZec. Biol., Vol. 59, No. 5/6, pp. 413-429, 1996

INTRODUCTION Estrogen receptor (ER) is a member of the steroid/ thyroid superfamily of proteins that act as hormoneinducible transcription factors [1]. Ligands, e.g. estradiol (E2), enter the cell nucleus and bind to the hormone binding domain (HBD) of ER, inducing J.H.A. and C . M . K . should be considered equal first authors on this work. C u r r e n t address: Dept. Biochemistry, University of Louisville School of Medicine, Louisville, KY 40292, U.S.A. *Correspondence to C. M. Klinge. Tel: +1 716 275 7751; Fax: +1 716 271 2683. Received 26 Feb. 1996; accepted 14 Jun. 1996. 413

conformational changes in ER that include dimerization and phosphorylation, leading to high-affinity ER binding to specific DNA sequences: estrogen response elements (EREs). By a still unknown mechanism, liganded ER binding to EREs alters the transcription of specific genes. Although ER can activate transcription from a minimal promoter containing a single ERE inverted repeat and T A T A box, maximal hormonal stimulation by ER in naturally occurring estrogen-responsive genes requires DNA flanking sequences that contain binding sites for other proteins [2]. Various transcription factors synergize with ER. For example, NF-1

414

J.H. Anolik et aL

binding to its site in the Xenopus vitellogenin B1 promoter acts in synergy with the EREs located 220 bp upstream, to confer maximal transcriptional activity [2], and four Pit-1 binding sites synergize with a single variant ERE in the rat prolactin gene [3]. Additionally, adaptor or bridging proteins have been postulated to modulate receptor-DNA binding and/or transactivation by interaction with ER but not with DNA [1]. Among the candidate adaptor proteins identified to date are: ERAP160, that interacts with E2-ER but not with 4-OHT-ER in vitro [4]; RIP140, [5]; SRC-1, a protein that enhances the transcriptional activity of several steroid receptors, including PR and ER [6]; SPT6, [7]; and TIF1, [8]. Accessory proteins have been reported to enhance the DNA binding of progesterone receptor (PR) [6, 9], thyroid hormone receptor (TR) [10, 11], retinoic acid receptor (RAR) [8, 12], and ER [13]. Very little is known, however, about the mechanisms by which these proteins mediate receptor function. Some have reported that ER can specifically bind EREs in vitro in the absence of any other protein [14]. However, maximal interaction of highly purified ER with EREs in vitro was reported in the presence of four distinct ER-associated proteins: hsp70, p55, p48, and p45 [15]. Whether the ER-associated p45 is identical to the p45 single-stranded DNA-binding protein (SSB), characterized by Mukherjee and Chambon [13] as necessary for binding of DNA affinity purified ER with EREs in vitro, is unknown. Others have identified additional proteins to be associated with ER, but their role in ER function is not clear [16, 17]. We reported that estradiol-liganded ER (E2-ER) binds cooperatively to stereoaligned EREs that are surrounded by naturally occurring AT-rich flanking sequences [18-24]. In contrast, EREs lacking these flanking sequences did not bind ER cooperatively, regardless of ERE spacing or stereoalignment [19, 20]. Cooperativity of ER-ERE binding thus depends on the presence of specific flanking sequences that may facilitate ER-induced DNA bending, or that provide recognition sites for other proteins to enhance ER-ERE binding [19, 20]. Putative accessory proteinflanking DNA interactions may be of low affinity or confined to the area immediately adjacent to the ERE inverted repeat, as DNase I footprinting experiments showed that our ER preparation protected no regions beyond the 22bp centering on the ERE inverted repeat [25]. ERE flanking sequences critical for cooperative binding of E2-ER also increased ER binding affinity as well as the saturation binding capacity of ER for the ERE. When ER was liganded with 4hydroxytamoxifen (4-OHT), the active metabolite of the widely used therapeutic antiestrogen tamoxifen (TAM), the 4-OHT-ER complex bound EREs noncooperatively and with reduced binding capacity, regardless of spacing or flanking sequence [18-22]. We reported that one molecule of 4-OHT dissociates

from the 4-OHT-ER dimer when it binds to DNA in vitro, thus accounting for the lower apparent ERE binding stoichiometry [21-24]. We postulated that ligand dissociation alters the ER dimer conformation in such a way that cooperative ERE binding is obviated. In the present study, we asked whether accessory protein(s) are responsible for the stabilization of ligand binding to ER and subsequent high-affinity ER binding to EREs flanked by certain DNA sequences. Compared to partly purified E2-ER, the highly purified E2-ER binds with 10-fold lower affmity, at 50% of the saturation binding level of partly purified E2ER (stoichiometry of 0.5 E2-ER dimers/ERE), and non-cooperatively to EREs flanked by the AT-rich region. In contrast, 4-OHT-ER binds EREs noncooperatively with a stoichiometry of 0.5 4-OHT-ER dimers per ERE, regardless of ER purity. However, when ER is covalently liganded with tamoxifen aziridine (TAz), the stoichiometry of TAz-ER-ERE binding is always one TAz-ER dimer, bound by two molecules of TAz, regardless of ER purity. Moreover, binding of TAz-ER to multiple tandem EREs is cooperative. These results provide evidence that accessory protein(s) interact with the appropriate flanking sequences to stabilize the ligand upon E2-ER-, but not 4-OHT-ER-, ERE binding. In turn, the stability of the ligand interaction with ER has a critical impact on DNA binding parameters. This is the first quantitative report of putative accessory protein(s) affecting the affinity and cooperativity of binding of ER to EREs.

MATERIALS AND METHODS

Preparation of E R E containing plasmids Sequences of select synthetic ERE oligonucleotides are given in Table 1 with nomenclature definitions. Note that (+) and (-) refer to with and without a consensus AT-rich region [26], respectively, and the numbers indicate the ERE center-to-center helical spacing in ERE dimers (assuming 10.5 bp/turn in Bform DNA [27]). Double-stranded ERE oligomers, of the length indicated in Table 1, were cloned into the plasmid pGEM-7Zf(+) (Promega, Madison, WI, U.S.A.) as described [18-20]. Although the insert lengths vary, linearized plasmid DNA was used for the microtiter plate assay experiments described below, obviating the small differences in insert length. Preparation of estrogen receptor ER was partly purified from calf uterus as previously described [18]. The ammonium sulfate cytosol fraction (0-30%) was further purified by heparin agarose (Affi-Gel Heparin, BioRad, Richmond, CA, U.S.A.) affinity chromatography and liganded with either 17fl-[2,4,6,7,16,17-3H]E2 (142Ci/mmol from

ER-ERE Binding Depends on other Proteins

415

Table 1. Sequences of ERE constructs Name a EREc(+) EREm(-) ERE7.2(+)

ERE7.2(-)

GCEREc ERE2(-)

DNA sequence 5'-CCAGGTCAGAGTGACCTGAGCTAAAATAACACATTCAG-3' 5'-CTGGTCACTCTGACC-3' 5'-TCAGGTCAGAGTGACCTGAGCTAAAATAACACATI'CAGCTAGCACTGACGCTAGCGAGCTAAAATAACACATTCAGCCAGGTCAGAGTGACCTGAGCTAAAATAACACATI'CAA-3' 5'-CCTGGTCACTCTGACCGGGGTTGGAAATCGATAAGCTTGTTACAAGCTFGGATCCGGAGAGCTCCCAACGCGTTGGATGCAGGTCACTCTGACCTGGTGCA-3' 5'-CCAGGTCAGAGTGACCTGAGCTGACAGGACTCGACCAG-3' 5'-CCGGTCACTCTGACCACTGACTGGTCACTCTGACC-3'

a c, 17 bp consensus; cxx, 13 bp consensus; GCERE, GC-rich; (+), AT-rich; (-), AT-lacking; numbers indicate ERE center-to-center helical spacing. N E N ) , Z-4[N-methyl--3H 4 - O H T (71 Ci/mmol from Amersham, Arlington Heights IL, U.S.A.), or [ring-3H]tamoxifen aziridine ([3H]TAz, 23 Ci/mmol from Amersham). For the partly purified receptor, the pooled ER-containing fractions were diluted with T D P buffer (40 m M T r i s - H C l , p H 7.5, 1 m M D T T , 0.5 m M P M S F ) containing 40% glycerol to 111 m M KC1, and the concentration of E R was determined by adsorption to hydroxylapatite (HAP) [28]. All receptor concentrations refer to dimeric E R (i.e. with two molecules of ligand bound). All referrals to "partly purified" E R herein indicate the diluted post-heparin agarose ER. When using 4 - O H T , the [ 3 H ] 4 - O H T - E R was protected from exposure to light.

Purification of ER by DNA affinity chromatography T h e peak of ligand-binding activity eluted from a heparin-agarose column was pooled and purified by ERE affinity chromatography, as described previously [29]. T h e peak of ligand-binding activity eluted from the affinity column was pooled and diluted to 111 m M KCI with T D P G E + buffer ( T D P plus 20% glycerol, 0.1 m M E D T A , and 0.1% NP-40). Insulin (Clonetics, Palo Alto, CA.) and leupeptin (Sigma, St. Louis, MO, U.S.A.) were added to a final concentration of 100/~g/ml and 0.1 mM, respectively [30].

Sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE), fluorography, and Western blotting Proteins present at various stages of E R purification were analysed on 8% SDS-polyacrylamide mini gels. Protein molecular weight standards, (SeeBlue prestained standards; M a r k l 2 , and MultiMark multicolored standards from Novex, San Diego, CA, U.S.A., or Kaleidoscope standard from BioRad, Hercules, CA, U.S.A.) were run in parallel with experimental samples. T h e gels were run in 25 m M "Iris, 192 m M glycine, 0.1% SDS at 200 volts for 1 h, fixed, and silver stained using the Bio-Rad Silver Stain Plus kit as per the manufacturer's instructions. For fluorography,

the S D S - P A G E gel was fixed and treated with E N T E N S I F Y (DuPont, Boston, MA, U.S.A.), dried, and exposed to Kodak X - O m a t AR film for 6 days at -80°C. For Western blotting, two identical 8% S D S P A G E gels were run as above. One gel was silver stained and proteins in the other gel were electroblotted onto nitrocellulose. In separate experiments, the nitrocellulose membranes were incubated with a t:1000 dilution of H222 anti-ER monoclonal antibody (a gift of Abbott Laboratories), or a 1:100 dilution of AER314, an N-terminal-specific mouse monoclonal antibody raised against calf uterine E R (a gift of Neomarkers, Fremont, CA, U.S.A.; [31]). T h e appropriate secondary antibody was added and the membranes were processed for E C L detection according to the instructions from Amersham. T h e nitrocellolose blots were exposed to Reflection film (DuPont) for 15-120 s prior to processing.

Microtiter well plate assay of ER binding to plasmid DNA T h e microtiter (well) plate assay for measuring [3H]liganded-ER binding to D N A has been described [32]. This is an equilibrium binding assay that quantitates E R - E R E binding based on [3H]ligand and [35S]DNA retention in specially treated microtiter wells. For each of the experiments presented here, plasmid D N A was linearized with EcoRI. Aliquots of EcoRI-digested plasmid D N A were labelled by incorporation of [35S]dATP (>600 Ci/mmol, N E N ) at the recessed 3' termini using the Klenow fragment of Escherichia coli D N A polymerase I (New England Biolabs, Beverly, MA, U.S.A.) and mixed with unlabelled EcoRI-digested D N A for the desired final concentration. Briefly, for saturation binding analysis, various concentrations of heparin agarose or ERE-Sepharose affinity purified [3H]E2-ER, [3H]4-OHT-ER, or [3H]TAz-ER were preincubated with one concentration (approximately 0.22 nM) of [35S]DNA

416

J.H. Anolik et al.

(plasmid DNA with or without ERE) for 2.5 h at 4°C, with shaking, in T D P K 100 buffer (TDP buffer containing 100raM KCI) containing 0.1% NP-40. Fifty-milliliter aliquots of the receptor-DNA equilibrium mixture were then incubated in histone/gelatincoated microtiter wells (EIA/RIA 8-well strips, cat. no. 2580; Costar, Cambridge, MA, U.S.A.) for 2.5 h at 4°C with shaking. Wells were rinsed, and the radioactivity remaining in the wells was counted using EcoScint A (National Diagnostics, Atlanta, GA, U.S.A.). Calculation of specific [3H]E2-ER, [3H]4OHT-ER, or [3H]TAz-ER binding to EREs was previously described, with binding to pGEM-7Zf(+) parental plasmid alone subtracted from binding to plasmid containing an ERE construct [18-20]. Gel mobility shift assay Gel mobility shift assays were performed as described [19, 20], with the following [32p]labelled DNA oligomers, obtained by E c o R I - B a m H I digestion of insert-containing pGEM-7Zf(+): EREc(+) monomer (77 bp), EREc(+) and GCERE dimers (115 bp), E R E m ( - ) (54 bp), E R E 2( - ) (74 bp) and ERE7.2(+) (145 bp). The size of the oligomers thus reflects the ERE plus the flanking pGEM-7Zf(+) DNA. Typical binding reactions contained 10fmol (25,000dpm) [32p]labelled DNA and ER and other reaction components in the amounts indicated in the Figure legends. Binding reactions were incubated on ice for 2.5-3 h before 40 #1 aliquots were loaded on 4% nondenaturing PAGE gels and electrophoresed at 150200 V in 0.5X TBE (0.05 M Tris, 41 mM boric acid, 0.5 mM EDTA, p H 8 . 3 ) at 4°C. Gels were dried under vacuum and autoradiographed on Kodak XOmat film (Eastman Kodak Co., Rochester, NY, U.S.A.) with an intensifying screen (Lightning Plus from DuPont, Wilmington, DE, U.S.A.). One microliter of 1:10 diluted ER antibody H222 was added to selected samples in each experiment to confirm the identity of ER protein in the retarded ER-ERE complexes. Monoclonal antibody N M T - 1, a generous gift of Dr Abdulmagad M. Traish, Boston University, was generated against a synthetic peptide corresponding to aa 140-154 in the A/B domain of hER and is specific for ER [33]. Ligand dissociation assay Experiments designed to reconstitute the ligand-stabilizing activity present in the partly purified, postheparin agarose, E2-ER were performed. Purified E2ER was preincubated for 1 h at 4°C, with either the "flow-through" (FT) fraction, fractions eluted from the ERE-Sepharose column prior to elution of the receptor, or [3H]Ez in the presence or absence of fivefold excess (molar ratio) EcoRI-linearized pGEM7Zf(+) plasmid DNA containing four tandem repeats of the EREc(+) sequence. After this preincubation period, aliquots (in triplicate) were removed to 400 #1

of a 10% HAP solution at 4°C and 200-fold excess cold E2, or an equal volume of 95% ethanol, was added. The amount of specific [3H]ligand remaining bound to ER at each time point was determined by HAP assay. At the time of E2 or ethanol addition, the tubes were vortexed briefly and placed in a 28°C waterbath. For a single time point assay, after 20 min of incubation, aliquots (in triplicate) were removed for HAP assay and direct counts were taken from the remaining reaction mixture [34].

RESULTS

Effect of ligand on E R purification by E R E affinity chromatography We previously reported that AT-rich sequences flanking the ERE are required for high-affinity, cooperative binding of ER [19, 20]. One explanation for this result is the presence of proteins that may interact with the appropriate flanking regions and, in turn, stabilize the ER-ERE interaction. However, DNase I footprinting showed no evidence of proteins binding stably to regions other than the inverted repeat of the ERE in our constructs [25]. As an alternative to detect the influence of accessory proteins on ER, the ER was purified to homogeneity and its binding compared to that of partly purified ER using ERE constructs that exhibit differential ER binding kinetics and stoichiometry. ER was purified from calf uterus by ammonium sulfate fractionation and sequential heparin-agarose and ERE affinity chromatography [28]. ER, liganded with E2, 4-OHT, or TAz, eluted from the ERESepharose column as a single peak between 325375 m M KC1 (data not shown). S D S - P A G E analysis of the purified [3H]TAz-ER revealed a doublet major band migrating with a molecular weight of 66 kDa (Fig. 1A). Identical results were obtained for 4-OHTER and E2-ER (data not shown). In addition, silver staining revealed three minor bands corresponding to 61-63 and 47 kDa that are truncated ER proteins resulting from proteolysis during sample preparation. This was demonstrated in a fluorograph of a S D S PAGE gel of affinity purified [3H]TAz-ER (data not shown). The autoradiograph showed that all four bands detected on the silver-stained gel are liganded with [3H]TAz. Similar results were reported by Maaroufi et al. for mouse uterine ER [35]. Western analysis of ERE-Sepharose purified E2-ER or TAz-ER showed that the top three bands were recognized by H222 anti-ER antibody (Fig. 1B). However, only the 66 and 63 kDa bands were recognized by the N-terminal specific monoclonal antibody AER304 (data not shown). The 61 kDa protein band is thus probably an N-terminal truncated ER. Although the 47 kDa protein is liganded with [3H]TAz, it does not react with H222, AER 304, NMT-1, or any other Neomarker

ER-ERE Binding Depends on other Proteins

417

A kDa

66.2 55

lane 2 MW kDa

3

4

5

I hep. ag. I

6

7

[ ERE AFF. [B

66.2-55 45lane 1

2

3

4

567

Fig. 1. S D S - P A G E and W e s t e r n analysis o f E R purification. A. Silver stained gel o f an 8% polyacrylamide S D S - P A G E gel o f purified TAz-ER. Lane 2 contains 262 Emol o f T A z - E R eluted f r o m a h e p a r i n agarose colu m n . Lane 3 contains Mark 12 p r o t e i n s t a n d a r d o f the sizes indicated at the left (in kDa). T h e o p e n arrow points to the E R - d o u b l e t o f 67 kDa. Lanes 4, 5, 6, a n d 7 contain 685, 514, 133, a n d 100 fmol (respectively) o f E R E affinity purified T A z - E R . B. W e s t e r n blot o f a gel identical to the 8% polyacrylamide S D S - P A G E gel in p a r t A. The nitrocellulose filter was p r o b e d with H222 m o n o c l o n a l a n t i - E R antibody a n d p r o c e s s e d b y ECL detection as d e s c r i b e d in Materials a n d Methods. Lanes 1 a n d 2 contain 1108 a n d 262 fmol (respectively) TAzE R following h e p a r i n agarose purification. Lane 3 contains protein M W m a r k e r s o f the sizes i n d i c a t e d at the left o f the a u t o r a d i o g r a p h (in kDa). Lanes 4, 5, 6, a n d 7 contain E R E affinity purified T A z - E R as in p a r t A.

E R antibody (data not shown). T h e occasional appearance of a faint broad band of approximately 100 kDa was not seen when the purified E R was flanked by blank lane,,;. T h e partly purified E R is 5 - 1 0 % pure. ERE-affinity purified E R is greater than 95% pure, representing a more than 6000-fold enrichment in the estradiolbinding specific activity of the ER, with a yield of 3%.

Dissociation of ER ligand during ERE af-fini~y purification T o examine the fate of each ligand molecule as the dimeric liganded E R binds the ERE-Sepharose colu m n and is eluted by KC1, the amount of proteinbound [3H]ligand was quantitated by H A P assay [27]. Aliquots from the column flow-through (FT, the n o n - b o u n d receptor and ligand), rinsed, and each eluted fraction was counted and/or applied to HAP. In each of the affinity purifications performed (n = 20), all (99.7 + 1.7%) of the [3H] counts were recovered. If all [3H]ligand remained bound to ER, then all [3H] counts would be b o u n d to HAP, which

was the case for [3H]TAz-ER with 100% of the [3H]TAz recovered bound to H A P in 11 separate purifications. In contrast, upon binding of [3H]E2-ER to the ERE-Sepharose column, between 38 and 54% of the [3H]E2 dissociated from the E R E - b o u n d ER. In three purifications of [3H]4-OHT-ER, 3 7 - 5 0 % of the [3H] 4 - O H T dissociated from the E R E - b o u n d ER. Non-covalently attached [3H]E2 and [ 3 H ] 4 - O H T thus dissociate from the E R upon ERE-Sepharose binding and the removal of n o n - E R proteins during the receptor preparation.

Gel shift assay of ER-ERE interaction Gel shift experiments demonstrated that ERE-affinity purified bovine E R binds to EREs in the absence of potential ER-associated proteins present in the partly purified receptor preparation. However, the intensity of the E R - E R E complex formed for highly purified E R was significantly less than for an equal concentration of partly purified receptor (data not shown), suggesting a lower affinity interaction. Insulin, added to stabilize the affinity purified ER

418

J.H. Anolik et al.

Ab[ aeetyl.BSA

(~g)

0

none luL NMT-1 0 20 40 70 100120 0 20 40 7 0 1 0 0 1 2 0 70 70 70 70 70 70

(ER-ERE) (ER-ERE)

EREc(+) Fig. 2. Gel mobility shift assay o f ERE-affinity purified E2-ER-ERE binding. [32p]oligomers (25,000 d p m per reaction) containing one copy o f EREc(+) were incubated with ERE-affinity purified E2-ER (10.6 fmol/lane) plus the indicated a m o u n t s o f acetylated bovine serum albumin (acetyl B S A ) alone or with I pl m o n o c l o n a l antibody NMT-1, or with increasing concentrations (0.002-0.1 pl) H222 for 2.5 h at 4°C. 40 pl aliquots o f the reaction mixture were loaded onto 4% polyacrylamide gels and gel mobility shift analysis was p e r f o r m e d as described in Materials and Methods. Each lane contained 10 fmol D N A .

[29], had no effect on the ability of the receptor to bind ERE in vitro (data not shown). Fig. 2 shows that the addition of increasing amounts of acetylated bovine serum albumin (BSA), alone or together with the ER-specific monoclonal antibody, N M T - 1 , enhanced the amount of ER-ERE complex detected, reaching a maximum with the addition of 70 #g BSA/ reaction volume (final, 1 mg/ml). BSA may nonspecifically prevent denaturation of the highly purified E R under the gel shift assay conditions [36] or prevent sticking of E R into the polypropylene reaction tubes. In subsequent gel shift assays, BSA was added to the purified E R - E R E binding reactions. Addition of F T from the affinity column similarly stabilized affinity-purified E R binding (data not shown). Both E R - E R E complexes contain ER protein, because the addition of monoclonal anti-ER antibodies N M T - 1 or H222 caused a dose-dependent "supershift" in the mobility of the complex (Fig. 2). Both antibodies increased the amount of E R - E R E complexes detected and decreased the amount of free ERE. We attribute these effects to specific antibody stabilization of the E R - E R E complex. As noted previously, ER-specific antibodies enhance ER-ERE binding, presumably by stabilizing dimeric E R (reviewed in [37]). Additionally, the specificity of

both E R - E R E complexes was demonstrated by the dose-dependent reduction in complex formation by the addition of excess unlabelled EREc(+), but not salmon sperm D N A or up to 1000-fold excess cold half-site ERE (data not shown). Among the most likely explanations for the appearance of multiple complexes are: E R binding as a m o n o m e r (lower band) and homodimer (upper band), differential phosphorylation of the ER, the presence of truncated forms of E R in the preparation, or association of other proteins with the E R [17]. Because affinity purified E R contains only ER, the latter explanation seems unlikely to account for the appearance of two E R - E R E complexes. Gel shift assays revealed virtually identical mobilities of retarded ER-EREc(+) complexes regardless of E R ligand and purity of the receptor (Fig. 2 and Fig. 3). T h e binding of partly vs affinity purified E R to various ERE dimers produced retarded ER-ERE complexes of apparent identical mobility, although AT-lacking EREs b o u n d E R with lower affinity (i.e., E R E 2 ( - ) , E R E 7 . 2 ( - ) , E R E m ( - ) in Fig. 3). This is in accord with our previous report [20]. In agreement with other reports [reviewed in [23]], we observed that the mobility of TAz-ER-EREc(+) complexes was

ER-ERE Binding Depends on other Proteins

419

H

2(ER-ERE)

I(ER-ERE)

lane

1

2

3

4

5

6

7

8

9

10

11

12

Fig. 3. Gel mobility shift analysis o f liganded E R binding tO single or two t a n d e m copies o f sequence variant EREs. The indicated [32p]EREs (25,000 d p m per reaction) were incubated with either partly purified (postheparin agarose) [3H]TAz-ER (89 Emol/lane in lanes 1-6) or purified (post-ERE-affinity) [3H]TAz-ER (81 fmol/ lane in lanes 7-12) under conditions identical to those described in Fig. 2. Reactions in lanes 1 and 7 included 0 . 1 / d o f anti-ER antibody H222. EREs in lanes 1-3 and 7-9 contain a single palindromic ERE. EREs in lanes 4-6 and 10-12 contain two t a n d e m palindromic EREs. 2(ER-ERE) indicates the binding o f two E R dimers to two EREs and 1 (ER-ERE) indicates the binding o f a single ER dimer to one ERE. S e q u e n c e s o f the indicated EREs are given in Table 1.

slightly less than that of the Ez-ER-EREc(+) complex.

Saturation analysis of affinity purified Ee-ER binding to AT-rich EREs To determine whether the ER-ERE binding kinetics are altered for purified ER, we used an equilibrium binding assay [32] to quantitate the stoichoimetry and affinity of purified [3H]E2-ER binding to one (monomer), two (dimer), three (trimer), or four (tetramer) tandem copies of EREc(+). The affinity purified [3H]Ez-ER binding at saturation was reduced by 50% compared to the partly purified [3H]Ez-ER preparation (Figs 4-6, Table 2). Based on an input of 11 fmol DNA, the stoichiometry of binding is one

[3H]E2-ER dimer bound per ERE for partly purified E2-ER (Table 2), whereas, for purified E2-ER, the stoichiometry of binding is 0.5 [3H]E2-ER dimer or one [3H]E2-ER monomer per ERE. The reduced binding capacity of purified E2-ER approximated the binding of partly purified 4-OHT-ER to the same EREs (Fig. 5, Table 2). We demonstrated that the apparent reduction in ERE binding of 4-OHT-ER was actually due to dissociation of one 4O H T ligand molecule from the dimeric 4-OHT-ERERE complex [21-24]. Likewise, this explanation may apply to the affinity purified Ez-ER resulting in an apparent decrease in saturation binding capacity. Taken together, we propose that a protein(s) present in the partly purified ER preparation may stabilize the

J.H. Anolik et al.

420

2o

40, 35

[

~1

•

= 0.8[-

30 25

sent in the partly purified ER preparation that stabilize E2 ligand binding in the HBD.

o.4

\.

0

10 20 BOUND

I h e p . ag. E R x

3

2o

5 0 0

20

40 60 80 E2-ER ADDED (fmol)

100

Fig. 4. Saturation analysis of affinity-purified vs heparinpurified [3H]Ee-ER binding to EREc(+) dimer. EcoRI-linearized [3sS]dATP-end labelled plasmid DNA, either the parental plasmid alone or plasmid containing construct EREc(+) dimer was incubated with increasing concentrations of affinity-purified (open circles) or heparin-purified (closed circles) [3H]E2-ER. The data points shown are the average of quadruplicate determinations + SEM from 3 to 7 representative plate assay experiments, and are calculated for binding to 11 fmol of DNA/well as described in Materials and Methods. The inset graph shows the data plotted according to the method of Scatchard. The fines were calculated by least squares regression analysis. Kd--1.80 nM for affinitypurified E2-ER binding and 0.23 for heparin-purified E2-ER binding.

E2 ligand, but not the 4-OHT ligand, in the dimeric ER-ERE complex. An alternative is that this putative protein(s) may stabilize the dimeric structure of ER necessary for high-affinity ERE binding. However, the gel shift assays showed identical mobilities of the ERERE complexes despite the apparent reduction in [3H]liganded ER stoichiometry, thus refuting this latter explanation (data not shown). A 50% decrease in saturation binding capacity of purified E2-ER was also detected for ERE7.2(+), an ERE dimer flanked by an AT-rich sequence with the EREs 7.2 helical turns apart (reproducing the spacing between alternate ERE IRs in the EREc(+) series), as well as for the GCEREc dimer, an ERE flanked by a GC-rich sequence with the EREs 3.6 helical turns apart (Table 1 and Fig. 5). Whereas both of these constructs bind partly purified E2-ER with a stoichiometry of one E2-ER dimer/ERE, a stoichiometry of 0.5 4-OHT-ER dimer/ERE was observed regardless of ER purity (Table 2). E2-ER, but not 4-OHT-ER, thus appears to interact with accessory proteins pre-

Affinity purification decreases the E2-ER-ERE binding affinity Concomitant with the apparent decrease in binding stoichiometry, purified ER displayed reduced ERE binding affinity. This is seen in the right-shifted saturation binding plot and by the lower slope in the Scatchard plot for affinity vs partly purified E2-ER binding to the EREc(+) dimer (Fig. 4) and monomer (Fig. 6). In fact, highly purified E2-ER binds with sixto 10-fold lower affinity to each of the AT-rich EREs examined (Table 3). Scatchard plots of purified [3H]E2-ER binding to monomer and dimer constructs of the EREc(+) series are linear (Fig. 4, Fig. 6), but those for binding to trimet and tetramer appear convex (data not shown). However, because the calculated Hill coefficients are 1.18 and 1.08 for purified [3H]E2-ER binding to trimer and tetramer, respectively (Table 3), the binding of highly purified E2-ER to these constructs is noncooperative. Likewise, the Hill coefficient of 1.26 for purified E2-ER binding to ERE7.2(+) indicates noncooperative binding (data not shown, but summarized in Table 3). These data contrast with the cooperative binding of partly purified E2-ER to the EREc(+) trimer and tetramer, in which alternate ERE IRs are positioned on the same side of the DNA helix, 7.2 helical turns apart, and ERE7.2(+), as previously reported [18, 20]. Hence, ERE affinity purification of E2-ER removes proteins that stabilize E2 binding in the HBD, enhance the affinity of E2-ER binding to EREs, and are probably responsible for cooperative E2-ER binding to EREs flanked by AT-rich sequences. Saturation analysis of affinity purified E2-ER binding to A T-lacking EREs Partly purified E2-ER binds non-cooperatively and with lower affinity to ERE dimers lacking the AT-rich region [ERE2(-), ERE7.2(-)] (Tables 3 and 4) with saturation binding levels reduced by 50% compared to EREc(+), giving a stoichiometry of 0.5 E2-ER dimers/ERE (Table 2) [19, 20]. Interestingly, highly purified ER-ERE binding saturation levels, stoichiometries, and affinities for these EREs are similar, regardless of flanking sequence (Fig. 5, Tables 2-4). Unlike the AT-rich EREs, which have reduced binding levels when E2-ER is affinity purified, the saturation binding capacities for the AT-lacking EREs [ERE2(-) and ERE7.2(-)] are identical, regardless of ligand or the degree of purity of the ER preparation. Hence, the reduction in purified E2-ER binding stoichiometries observed for the AT-rich EREs is a sequence-specific effect. This finding lends support to the hypothesis that an accessory protein(s) interacts with appropriate flanking sequences to stabilize ligand

ER-ERE Binding Depends on other Proteins

421

25 @

~20 ~15 m

i10 5

EREc+(1) EREc+(2)

EREm(-)

ERE2(-)

ERE72(-) ERE7~2(+) EREGC

EREc+(1)

EREm(-) ERE2(-) ERE

ERE72(.) ERE7~2(+) EREGC

25 o

Z ~15

EREc+(2)

Fig. 5. C o m p a r i s o n o f b i n d i n g o f partly purifed vs E R E affinity purified E R at s a t u r a t i o n to a series o f EREs. A. The E R E b i n d i n g o f partly purified ( p o s t - h e p a r i n agarose) [3H]E2-ER (solid bars), [3H]4-OHT-ER (shaded bars), o r E R E affinity purified [3H]E2-ER ( h a t c h e d bars), [3H]4-OHT-ER (vertically s t r i p e d bars), was m e a s u r e d at s a t u r a t i o n (80-120 fmol r e c e p t o r d i m e r added) to the indicated E R E s constructs i n s e r t e d into p l a s m i d using the plate assay as d e s c r i b e d in Materials a n d m e t h o d s . B. The E R E b i n d i n g o f partly purified ( p o s t - h e p a r i n agarose) [3H]TAz-ER (solid bars) or ERE affinity purified [3H]TAz-ER (hatched bars), was m e a s u r e d at saturation (90-120 frnol r e c e p t o r d i m e r added) to the indicated E R E s using the plate assay as d e s c r i b e d in Materials a n d Methods. The E R E sequences are shown in Table 1. The data s h o w n are the average o f quadruplicate d e t e r m i n a t i o n s 4- S E M a n d are calculated for binding to 11 fmol DNA/well.

association upon E2-ER-ERE binding and promotes full occupancy of all available ERE sites. Effect of E R purity on T A z - E R binding to ERE(+) construct$

To ascertain whether ligand dissociation correlates with the apparent decreased ER-ERE binding seen with purified ER, the ERE-binding of purified TAzER was quantitated and compared to that of partly purified TAz-ER to one or two copies of EREc(+) (Fig. 6, data for EREc(+) dimer summarized in Tables 2 and 4). TAz is an analog of tamoxifen that covalently binds to the ER [38]. The maximum binding of purified TAz-ER-EREc(+) was identical to that

of partly purified ER liganded with TAz o r E2, and was approximately two-fold higher than that of purified E2-ER-EREc(+) binding (Fig. 6). Regardless of ER purity, TAz-ER showed a stoichiometry of one TAz-ER dimer bound per EREc(+) (Table 2). However, Scatchard analysis revealed that purified TAz-ER bound to one EREc(+) with lower affinity than the partly purified TAz-ER (Fig. 6, Table 4). This suggests that ERE affinity chromatography removes a factor(s) that enhances the affinity of TAzER-ERE binding. Interestingly, the EREc(+) binding affinity of purified TAz-ER was higher than that of purified E2-ER (compare Tables 3 and 4), suggesting that E2 dis-

422

J . H . Anolik et aL

14 12 } 1" E2-ER(he~p~

6 l-

1

TAz'ER(AFF~']kI ,-, r I T

~ ' 0 TAz-ER(hep)

~ 0.6~..L_O'~

~ 4 f ¢ 0 - ~ m i i l t i E0.2 l ~ 0 "~ 2 ['// / I O E2-ER(AFF) 0 2 4 6 8 101214 ER BOUND 0 0 20 40 60 80 100 120 140 160 LIGANDED-ERADDED (fmol) Fig. 6. Saturation analysis of [3H]TAz-ER vs [3H]E2-ER binding to one copy o f EREc(+). EcoRI-linearized [3sS]dATP-end labelled plasmid D N A , either the parental p l a s m i d alone or p l a s m i d containing EREc(+) m o n o m e r was incubated with increasing concentrations o f partly purified (i.e. post-heparin-agarose, see Materials and Methods, open circles for E2-ER and closed circles for TAz-ER) or ERE-affinity-purified (open squares for E2-ER and closed squares for TAz-ER) ER. The data points s h o w n are the average o f quadruplicate determinations + S E M from eight representative plate assay experiments , and are calculated for binding to 11 fmol of DNA/well as described in the Methods. Inset: Saturation analysis plotted according to the m e t h o d o f Scatchard. The symbols are identical to those used in A. The lines were calculated by least squares regression analysis; K o = 0 . 2 7 n M for partly purified T A z - E R , 0 . 7 6 n M for ERE-affinity purified T A z - E R , 0.24 nM for partly purified E2-ER, and 1.74 nM for affinity purified E2-ER.

Table 2. Stoichiometric relationship of specific E2-ER, 4 - O H T - E R , or T A z - E R - E R E interaction a

Partly purified ER

ERE EREc(+) monomer EREc(+) dimer EREc(+) trimer EREc(+) tetramer EREm(-) ERE7.2(+) ERE7.2(-) ERE2(-) GCEREc

ERE-Sepharose affinity purified ER

RatiobE2-ERERE

Ratio 4-OHTER-ERE

RatioTAz-ERERE

ERE A F F ratio E2ER-ERE

ERE A F F ratio 4OHT-ER-ERE

ERE AFF ratio TAzER-ERE

0.97 1.09 1.05

0.41 0.52 0.59

1.01 0.97 1.00

0.45 0.41 0.42

0.46 0.48 ND c

1.04 1.09 1.00

1.10 0.52 1.03 0.68 0.53 0.99

0.54 0.40 0.52 0.52 0.54 0.53

1.00 1.00 1.01 0.86 0.87 1.01

0.48 0.50 0.58 0.53 0.54 0.55

ND 0.49 0.54 0.56 0.59 0.52

1.01 0.52 1.03 0.97 0.95 1.05

aSaturation analyses were performed using a fixed concentration of plasmid D N A and increasing concentrations of partly purified or ERE-Sepharose purified [3H]E2-ER, [3H]4-OHT-ER, or [3H]TAz-ER by plate assay as described in Materials and methods and Fig. 4. The binding ratios presented were calculated from values taken at saturation (77140 fmol/well [input 11 fmol DNA] [3H]Ez-ER, [3H]4-OHT-ER, or [3H]TAz-ER dimer added) from which background and non-specific binding to plasmid without inserts has been subtracted [18-20, 32]. tq'he ratio of ER:ERE represents the number of moles of ER dimer bound per mole of ERE, with non-specific binding subtracted. °Not determined.

423

E R - E R E Binding D e p e n d s on other Proteins

Table 3. Comparison of heparin-agarose or affinity purified E2-ER binding to E R E constructs Affinity purified E2-ER

Post-heparin E2-ER

ERE

na

Kd (nM)

Hill coefficient

n

o Kd (nM)

EREc(+) monomer E R E c ( + ) dimer E R E c ( + ) trimer EREc(+) tetramer EREm(-) ERE7.2(+) ERE7.2(-) ERE2(-) G C E R E c dimer

17

0.24 + 0.01

1.16 ± 0.03

16

1.74 ± 0.17 e

0.73 _ 0.12

12 14 32

0.23 + 0.03

1.24 +_ 0.04 2.17 _+ 0.46 ~ 1.86 ___0.17 d

21 13 12

1.27 +_ 0.35 e 7.18 ___0.34 3.34 ± 1.04

0.75 _ 0.08 1.18 _+ 0.04 y 1.08 _+ 0.07 g

15 28 24 36 18

0.81 + 0.04

<1 __. 0.20 d _ 0.01 ___0.01 ± 0.05

7 11 10 8

2.21 3.61 1.04 0.70

1.26 1.05 1.41 1.19

1.89 0.87 0.58 1.03

0.50 ± 0.02 b 0.58 + 0.06 b 0.32 ± 0.03

_ 0.04 ~ _ 0.96 ~ + 0.08 e q- 0.02 ~

Hill coefficient

_+ 0.002 g _+ 0.03 ___0.05 e ± 0.04

Saturation analyses were performed using the microtiter well plate assay, at a fixed concentration of plasmid D N A (11 fmol/well) and increasing concentrations of [3H]E2-ER, purified by heparin-agarose chromatography (post-heparin) or further purified by D N A affinity chromatography as described in Materials and Methods. Data were plotted according to the m e t h o d of Scatchard and Hill to derive Kd values and Hill coefficients, respectively. T h e values shown were derived from two to four separate experiments for a total of n different concentrations of receptor. "n, n u m b e r of different concentrations of [3H]E2-ER assayed for D N A binding, each in quadruplicate. Significantly different from: bKd of post-heparin [3H]E2-ER binding to E R E c ( + ) m o n o m e r and dimer (P < 0.005). CHill coefficient of post-heparin [3H]E2-ER binding to E R E c ( + ) m o n o m e r and dimer (P < 0.05). dHill coefficient of post-heparin [3H]E2-ER binding to E R E c ( + ) m o n o m e r and dimer (P < 0.005). TXd of post-heparin [3H]Ez-ER binding to the same E R E (P < 0.005). fHill coefficient of post-heparin [3H]E2-ER binding to the same E R E (P < 0.025). CHill coefficient of post-heparin [3H]E2-ER binding to the same E R E (P < 0.005).

Table 4. Comparison of heparin-agarose or affinity purified T A z - E R binding to E R E constructs Post-heparin T A z - E R

ERE-affinity purified T A z - E R

DNA

na

Kd (nM)

Hill coefficient

n

Kd (nM)

Hill coefficient

EREc(+) monomer E R E c ( + ) dimer E R E c ( + ) trimer EREc(+) tetramer EREm(-) ERE7.2(+) ERE7.2(-) ERE2(-) G C E R E c dimer

15

0.27 ± 0.03

1.1 _ 0.3

9

0.76 _ 0.03 b

1.28 ___0.29

2.41 ___0.27 c 2.31 + 0.57 a 2.66 _+ 0.01 c

22 14 13

1.12+0.11 2.25 ___0.17 c 0.93+_0.12 1.14 _ 0.08 0.93 +__0.06

11 11 23 25 11

25 21 23 13 12 30 37 15

1.70 ± 0.33 b 0.87 _ 0.06 b 1.61 _ 0.24 b 0.58 +_ 0.05 b

1.91 _+ 0.11 2.78 ___0.07 1.94 ___0.03 1 . 8 4 _ 0.07 b 0.80 _ 0.07 b 3.44 ___0.17 be 4.04 ___0.23 be

0.96+0.06 1.80 ___0.10 1.11 ___0.04 1.47 ___0.16 0.99 ___0.03

Saturation analyses were performed using the microtiter well plate assay, at a fixed concentration of plasmid D N A (11 fmol/well) and increasing concentrations of partly purified (post-heparin) T A z - E R or ERE-affinity purified T A z - E R as described in Materials and Methods. Data were plotted according to the methods of Scatchard and Hill to derive K~ values and Hill coefficients, respectively. T h e values shown were derived from the binding data in 18 separate experiments for a total of n different concentrations of receptor. an, n u m b e r of different concentrations of [ 3 H ] T A z - E R assayed for D N A binding, each in quadruplicate. Significantly different from: bKd of post-heparin T A z - E R binding to E R E c ( + ) m o n o m e r (P < 0.005). CHill coefficient of post-lheparin T A z - E R binding to E R E c ( + ) m o n o m e r (P < 0.005). aHill coefficient of post-heparin T A z - E R binding to E R E c ( + ) m o n o m e r (P < 0.05). of post-heparin T A z - E R binding to the same E R E (P < 0.005).

424

J.H. Anolik et al.

sociation from the E R during purification lowers its subsequent ERE binding affinity. Regardless of purity, Scatchard plots for T A z - E R binding to two EREc(+) were curvilinear (data not shown). Hill coefficients (nil) (Table 4) of 2.41 and 1.91 for partly and highly purified TAz-ER, respectively, confirm the cooperative nature of T A z - E R binding to two ERE(+) sequences in vitro. Similarly, highly purified T A z - E R binding to three or four tandem copies of EREc(+) was also cooperative (Tables 2 and 4). T h e binding of partly purified E2-ER or T A z - E R to ERET.2(+) was cooperative and gave a stoichiometry of one E R dimer per ERE (Tables 2--4). Purification rendered E2-ER binding to ERE7.2(+) non-cooperative and of lower affinity, and reduced the binding capacity by 50%, giving a stoichiometry of one Ee-ER monomer, or 0.5 E2-ER dimer, per ERE (Tables 2 and 3). In contrast, T A z - E R binding to ERE7.2(+) was cooperative, regardless of receptor purity, and the binding stoichiometry was one T A z - E R dimer per ERE (Tables 2 and 4). We interpret these results to indicate that the retention of ligand by T A z - E R maintains the receptor in a conformation that facilitates cooperative binding. Saturation analysis of T A z - E R binding to E R E ( - ) constructs T o examine the effect of sequences flanking the ERE IR on T A z - E R - E R E interaction, we measured the binding of partly purified T A z - E R to E R E m ( - ) , a construct containing a single 13 bp IR lacking the AT-rich flanking region (Table 1). We found that T A z - E R - E R E m ( - ) binding was of approximately sixfold lower affinity compared to EREc(+) m o n o m e r (Table 4). Because covalent attachment of TAz to the E R prevents ligand dissociation, it was surprising that T A z - E R binding to E R E m ( - ) gave a stoichiometry of 0.5 T A z - E R dimer, or one T A z - E R m o n o m e r (Table 2). This is the only ERE sequence for which a binding stoichiometry of less than one T A z - E R dimer per ERE was detected. Affinity purification of TAzER had little effect on the affinity or stoichiometry of TAz-ER binding to E R E m ( - ) (Tables 2 and 4). Although T A z - E R binds E R E m ( - ) with greatly reduced affinity, the ER-ERE complexes formed in gel shift experiments are identical in mobility to those detected for TAz-ER-EREc(+) binding (Fig. 3). This suggests that the apparent reduction in TAz-ERE R E m ( - ) binding stoichiometry is not due to TAzE R binding as a monomer, but rather to the low affinity of this interaction. Data from saturation binding gel shift experiments using either partly purified or highly purified T A z - E R binding to EREc(+) show that TAz-ER binds E R E m ( - ) with a relative affinity 24% of that detected for binding to EREc(+) (data not shown). This approximates a Ka value of 1.2 M, which agrees with the Ka of 1.7 n M determined by plate assay analyses (Table 4).

Regardless of receptor purity, T A z - E R binds to the dimeric E R E 2 ( - ) construct with lower affinity compared to AT-rich EREs. Gel shift assays show that, irrespective of E R ligand, only one ER dimer appears bound to E R E 2 ( - ) , whereas at identical receptor concentrations, two E R dimers bind to two copies of EREc(+) or ERE7.2(+) (Fig. 3). In contrast to E2ER, the stoichiometry of T A z - E R - E R E 2 ( - ) binding by plate assay indicates that T A z - E R binds E R E 2 ( - ) as a single homodimer with two associated ligand molecules (Table 2). Additionally, the removal of proteins during purification lowers the affinity of TAzE R - E R E 2 ( - ) interaction. Similar to E2-ER, T A z - E R binding to E R E 2 ( - ) was non-cooperative. T h e affinity of T A z - E R binding to the dimeric E R E 7 . 2 ( - ) construct was not affected by ERE-affinity purification (Table 4). T A z - E R binds non-cooperatively to E R E 7 . 2 ( - ) (Table 4), in contrast to the binding of T A z - E R to ERE7.2(+). Interestingly, TAzE R binding to the G C E R E c dimer was also noncooperative, regardless of receptor purity. Purification decreased the affinity of T A z - E R binding to G C E R E c , but had no affect on the binding stoichiometry (Tables 2 and 4). T A z - E R binding affinities for E R E m ( - ) , E R E 2 ( - ) , E R E 7 . 2 ( - ) , and the G C E R E c dimer were all significantly reduced compared to the AT-rich EREc(+) series. Together these findings implicate the AT-rich region as necessary for high-affinity T A z - E R - E R E interaction and cooperativity. T h e mechanism for the AT-rich sequence effect may involve receptor-mediated D N A bending or other D N A structural effects [20]. Reconstitution of the ligand-stabilizing activity Ligand dissociation experiments were performed to assess the stability of E2 bound to highly purified E2E R alone, or following addition of the flow-through (FT), or n o n - E R containing fractions from the ERESepharose column (Fig. 7). Addition of the F T , but not an equal protein concentration of BSA, moderately enhanced (by 39%) [3H]E2 ligand retention by purified E2-ER following preincubation of the receptor either with or without D N A (compare solid and open bars for none vs F T addition in Fig. 7). This experiment also shows that preincubation of purified E2-ER with four tandem copies of EREc(+) for 1 h at 4°C had no effect on [3H]E2-ER binding (Fig. 7, compare closed and open bars). Moreover, addition of F T enhanced (2-2.5-fold) [3H]E2 ligand retention by purified E2-ER under dissociation conditions (compare hatched and horizontal striped bars for none vs F'I" addition in Fig. 7). We have also examined the ability of highly purified E2-ER to bind [3H]E2. As determined by H A P assay, incubation of purified E2-ER with two-fold molar excess [3H]E2 revealed a 37% increase in apparent ER concentration (from 2.49 + 0.06 to 3.41 + 0 . 0 4 n M ) . After saturation of the E R with

ER-ERE Binding Depends on other Proteins

40000

], +ONA

~ 35000 [] - DNA preincubation "-~

[] - DNA

0000 o

425

150

500

dissociation

400

s0

1

2'-°f

200

0,10, 202, 0

20000

I

15000 10000 5000 0 none

FT

BSA FR1 ADDITION

FR2

FR3

FR4

FR5

Fig. 7. Reconstitution o f ligand stability by the addition o f fractions f r o m the E R E - S e p h a r o s e c o l u m n u s e d to purify E2-ER. P u r i f i e d E 2 - E R w a s p r e i n c u b a t e d , for 1 h at 4°C, with either the " f l o w - t h r u " (FT), BSA (at a p r o t e i n c o n c e n t r a t i o n equal to t h a t in the F r = 104.5 ltglml), or the indicated fraction n u m b e r s (FR1-FR5) e l n t e d f r o m the E R E - S e p h a r o s e c o l u m n p r i o r to elution o f the receptor. P r e i n c u b a t i o n was in the p r e s e n c e (solid columns) or a b s e n c e ( o p e n columns) o f live-fold excess (molar ratio) EcoRI-linearized pGEM-7Zf(+) p l a s m i d DNA containing four t a n d e m r e p e a t s o f the EREc(+) sequence. Following the p r e i n c u b a t i o n , aliquots (in triplicate) w e r e r e m o v e d for H A P assay as d e s c r i b e d in Materials a n d Methods. D i s s o c i a t i o n w a s initiated b y addition o f 200-fold e x c e s s E2 a n d incubation at 28°C for 20 m i n . The a m o u n t o f specific [3H]llgand r e m a i n ing b o u n d to E R w i t h D N A ( h a t c h e d bars) or without DNA (horizontal stripes) w a s d e t e r m i n e d by H A P assay. E a c h b a r r e p r e s e n t s the m e a n _+S E M o f triplicate d e t e r m i n a t i o n s . Inset: E R E - S e p h a r o s e c o l u m n elution p r o file o f the [3H]E2-ER p r e p a r a t i o n used in this e x p e r i m e n t . T h e o p e n c i r c l e s r e p r e s e n t [3H]E 2 d p m a n d the c l o s e d c i r c l e s r e p r e s e n t KCI c o n c e n t r a t i o n (in m M ) d e t e r m i n e d by conductivity.

[3H]E2, we also observed that the addition of F T stabilized E2 ligand interaction with E R (data not shown). However, if F T was boiled prior to addition, no stabilization of ligand was observed, indicating that the activity responsible, is a protein(s).

DISCUSSION

Effect of ER purificatior,; on ERE binding parameters We report here that highly purified E2-ER binds AT-rich EREs with a six- to 10-fold lower affinity and at 50% lower saturation binding levels than that expected for dimeric liganded ER. This gives an apparent binding ratio of 0.5 E2-ER dimers, or one E2-ER m o n o m e r b o u n d per ERE. Additionally, purified E2-ER binds non-cooperatively to all EREs tested, regardless of the presence of the AT-rich flanking sequences that confer binding cooperativity to partly purified E2-ER [19, 20]. In contrast, when E R is covalently liganded with TAz, the highly purified T A z - E R binds multiple AT-rich EREs cooperatively. Moreover, TAz~-ER retains a saturation ERE binding stoichiometry equal to that of partly purified TAz- or E2-ER: one E R dimer bound per ERE. T h e r e are at least three plausible explanations for the observed 50% reduction in binding relative to the expected stoichiometric saturation binding value: (a)

ER binds as a m o n o m e r under certain ligand, receptor purity, and ERE flanking sequence conditions; (b) E R binds as a heterodimer consisting of one E R m o n o m e r plus an unknown protein [34, 39]; or (c) E R binds as a dimer but one ligand molecule dissociates from the E R dimer due to protein conformational changes upon D N A binding [21-24]. T h e evidence presented here argues compellingly that the lower ERE binding affinity and stoichiometry, and the loss of binding cooperativity of purified E2-ER is caused by E2 dissociation from the E R dimer. Six independent lines of evidence point to ligand dissociation and argue against monomeric E R - E R E binding as the explanation for our results. First, we observed that [3H]E2 dissociated from E2-ER during ERE-Sepharose chromatography resulting in E R dimers retaining, on average, one molecule of [3H]E2. It was not possible to distinguish between E R dimers that lack [3H]ligand, have one ligand molecule bound, or have two molecules of [3H]ligand bound. Experiments using fluorescent estrogens are currently underway to address this question. Second, comparable mobilities of ER-ERE complexes, regardless of E R purity or ligand, or ERE flanking sequences, were observed in gel shift experiments. Because an ERE b o u n d by a monomeric E R would migrate appreciably faster than a dimeric ER-

426

J.H. Anolik et al.

ERE complex, the observed mobilities do not support the hypothesis of an E R m o n o m e r - E R E complex. T h e reason for the apparent inconsistency in the amount of receptor bound to EREs ascertained by the plate assay vs the gel shift assay is that the latter identifies the ER-ERE complex based on its [32p]DNA binding and does not quantitate the receptor ligand. Because E R dimers are extremely stable [40, 41] and monomeric E R binds EREs with m u c h lower binding affinity [18, 42] than those measured here, monomeric ER-ERE binding can not account for the lower stoichiometry of E R - E R E binding. Indeed, sucrose density analysis of E2-ER, 4-OI-ITER, or T A z - E R revealed that the receptor remained a 5.2-5.3 S species even after incubation in histonegelatin-coated wells under plate assay conditions [21]. Third, recent DNase I footprinting experiments showed that partly purified E2-ER, 4 - O H T - E R , and TAz-ER, or affinity purified E2-ER protect an identical 22 bp stretch of D N A centering on the ERE IR in the EREc(+) constructs [25]. These results are consistent with two receptor monomers each bound to half of the IR and reduce the likelihood that the observed 50% difference in saturation binding between affinity purified E2-ER and T A z - E R is attributable solely to E2-ER binding as a monomer. Fourth, reconstitution experiments show that the F T from the ERE-Sepharose column contains a heatsensitive activity that stabilizes [3H]E2 binding to highly purified E2-ER in the presence or absence of DNA. T h e effect of the F T is specific because the addition of an identical protein concentration of BSA did not alter E2 dissociation kinetics from the affinity purified E2-ER. Further experiments to identify the protein(s) responsible for these effects on ligand binding stability are in progress, including reconstitution experiments. Fifth, we reported greater dissociation of [3H]4O H T compared to [3H]E2 from partly purified, liganded E R bound to EREc(+) during the plate assay [21-24]. This suggests that the accessory protein(s) specifically enhances the stability of E2, but not 4 - O H T , binding to the ER. Sixth, when E R is covalently liganded with TAz, the binding stoichiometry of T A z - E R is one E R dimer per ERE, regardless of receptor purity or ERE flanking sequences. We conclude that ERE binding results in E R conformational changes that destabilize ligand binding leading to ligand dissociation and a lower affinity, non-cooperative ER-ERE interaction. However, we also attribute the lower ERE binding affinity of purified E R to the removal of ER-associated proteins during the affinity column purification. This interpretation is based on our observation that purified TAzER interaction with ERE is also of lower affinity compared to that of partly purified TAz-ER, despite the covalent attachment of TAz to the ER.

There is a precedence for ligand dissociation from E R upon D N A binding. T h e binding of rat uterine ER to the vitellogenin A2 ERE was reported to cause a two-fold increase in the rate of E2 dissociation [34]. Furlow et aL observed a ratio of 1 mol of E R m o n o mer bound to 1 mol of ERE, based on [35S]DNA counts retained in an antibody-immunoprecipitation assay [39]. T h e y postulated that the active form of E R is a m o n o m e r or a heterodimer. In contrast, our data demonstrate that E R binds EREs as a homodimer, and we postulate that conformational changes occur in the receptor during this binding that enhance dissociation of one molecule of ligand [23]. These conformational changes induced by D N A binding may differ in magnitude depending on the ligand bound and/or the ERE flanking sequences. Recent experiments showed that ligand dissociation kinetics from androgen receptor depend not only on the type of ligand bound, but also depend on the presence of critical N-terminal amino acids [43]. D N A binding adds yet another dimension to the conformational changes possible for the ER. Further studies to address these possibilities are in progress. Effect of E R E flanking sequences on E R binding

T h e observations of dissociation of [3H]E2 from the receptor during ERE affinity chromatography and the ability of the ERE-Sepharose F T fraction to slow E2 dissociation strongly indicate that proteins present in the partly purified E2-ER preparation play a role in maintaining ligand binding. Based on the observations that: (a) the greatest difference between partly and affinity-purified ER-ERE binding was seen with constructs containing the AT-rich region, and (b) that purified E2-ER binds AT-rich EREs non-cooperatively, we suggest that accessory proteins interact not only with the ER, but also with the AT-rich region. These results correlate with our previous reports that partly purified E2-ER binds non-cooperatively and with lower binding affinity to AT-lacking EREs vs AT-rich EREs [19, 20]. We postulate that accessory proteins present in the partly purified E R preparation interact with both the AT-rich region and the E R to stabilize E2 ligand, but not 4 - O H T , in the H B D of the receptor. This, in turn, maintains the E R in a conformation that facilitates high-affinity, cooperative binding. Because TAz remains covalently liganded to the receptor, purification of T A z - E R does not affect the cooperativity of T A z - E R binding to EREs flanked by AT-rich sequences. Together with the observation that T A z - E R requires the presence of AT-rich flanking sequences for cooperative ERE binding, we conclude that ligand retention, and its effects on E R conformation, is not the sole criterion for cooperative binding; but that D N A sequence, and very probably D N A structure, are likewise critical. This raises the question of what discrete features of the ERE flanking

ER-ERE Binding Depends on other Proteins region are important for maximal ER-ERE interaction. For example, a number of the AT-lacking ERE constructs also contain shortened 13 bp ERE IRs. We previously reported that either extending the minimal 13bp ERE IR [EREm(-)] by two nucleotides on each side, thus creating a 17 bp IR, or adding an AT-rich flanking sequence to the 13 bp IR, enhanced the E2-ER-ERE binding stoichiometry to one Ez-ER dimer per ERE [20]. However, both elements were required ~br maximal E2-ER binding affinity. Results presented here provide further evidence for the importance of the AT-rich region (independently of the extended IR) in that TAz-ER binds with significantly reduced affinity and noncooperatively to the GCEREc dimer and ERE7.2(-), compared to EREc(+) dimer and ERE7.2(+). Experiments are underway to delineate further how the length of the ERE IR and which specific DNA flanking sequences or structural features are critical for maximal ER-ERE binding. Certain nucleotide sequences may favor a DNA conformation that enhances ER binding and likewise ER binding may induce a functionally important change in DNA conformation. AT-rich sequences form non-B DNA and are characterized by low melting temperatures, DNA bending, and promotion of cruciform formation when adjacent to inverted repeat sequences [44]. I_~annigan et al. [45] reported higher affinity binding of ER to the rat prolactin ERE when flanked by its natural sequences. Other results suggest the presence of an unusual intrinsic DNA structure in the rat prolactin gene regulatory region, leading to speculation that the ERE flanking sequences assume a unique DNA conformation that stabilizes ER-ERE binding [46, 47]. Additionally, DNA conformation was reported to impact the DNA binding of PR and GR in vitro [48]. Screening of more than 1,000,000 random oligonucleotides in hER-expressing yeast identified several half-site EREs combined with AT-rich sequences that conferred estrogen-responsiveness to host cells [49]. The AT-rich ERE flanking region used here is a consensus derived from three highly estrogen-inducible genes [26], including the Xenopus vitellogenin A2 gene which contains a stretch of AT-rich curved DNA 3' to the ERE [50]. This AT-rich region may contain an intrinsic DNA bend (J. H. Anolik, unpublished observation). Others reported that ER bends DNA upon binding EREs [51, 52]. It is possible that ER binds with higher affinity to regions of DNA that have unique intrinsic bends [53] or that require lower energy to be bent. Interactions between multiple protein binding sites, leading to cooperative binding, may be facilitated by the DNA deformability in the regions between the ER binding sites, as is strongly suggested by our results with TAz-ER.

427

Effect of ER-associated proteins on E R - E R E binding

The similar mobilities of ER-ERE complexes regardless of ER ligand, ERE flanking sequences, or the degree of purity of the receptor detected in gel shift assays imply that the protein-DNA composition of these complexes is identical. It is possible, however, that lower affinity or transient binding events that are not detected by either gel shift or DNase I protection assays are required for optimal ER-ERE binding. One example of such an event is the transitory DNA binding of HMG-1, that, in gel shift assays, enhanced PRPRE binding, but was not part of the retarded PRPRE complex [54, 55]. HMG-1 was reported to induce DNA-bending required for high-affinity PRPRE binding. Given the homology between members of the steroid receptor superfamily, it is possibile that HMG-l-related proteins, and/or other accessory proteins, facilitate intrinsic or ER-induced DNA bending that may be critical for high-affinity ER-ERE interaction. Our results with TAz-ER imply that accessory proteins are not essential for cooperative TAz-ERERE binding; rather, ERE flanking sequences appear more critical. However, accessory proteins may stabilize E2 ligand in the HBD of the receptor such that the ER is maintained in a conformation capable of high-affinity cooperative binding in the context of the appropriate DNA flanking sequence and structure. One might question why these proteins are not retained by the ERE-Sepharose column, consisting of eight tandem copies of EREc(+) linked covalenfly to Sepharose. However, because we suggest that the basis for the observed effects of the AT-rich region on ER-ERE binding and ligand dissociation involves intrinsic [56] and ER binding-induced alterations in DNA topology [51, 52], it is possible that the covalent attachment of the EREs to Sepharose prevents the DNA from assuming the appropriate conformation recognized by these ER-associated proteins. Moreover, because these proteins appear to interact only weakly with the AT-rich region, they are likely to dissociate from the ERE-Sepharose matrix at a lower salt concentration than that required to elute the ER. A number of reports indicate that cell-specific factors influence steroid receptor-DNA binding [8-13, 15, 57, 58]. For example, the binding of highly purified ER to an ERE in vitro required a 45 kDa singlestranded DNA-binding protein [13]. This is particularly interesting given the work of Lannigan and Notides [47] demonstrating selective binding of ER to the coding strand of the rat prolactin ERE and provides yet another potential mechanistic link between ER accessory proteins and DNA structure. Additionally, Landel et al. [15] reported that hsp70 and 45 and 48 kDa proteins were required for optimal ERE binding by ERE affinity purified human ER overexpressed in Chinese hamster ovary cells [15]. The physiological relevance for hsp70-ER interaction

428

J. H. Anolik et al.

and ERE binding is not clear. Preliminary experiments show that purified bovine ER, as used here, is not associated with nor does it require hsp70 for ERE binding in vitro (C. M. Klinge, unpublished observation). Overexpression of a protein in transfected ceils in culture may induce high levels of hsp expression. In contrast, the uterus expresses E R under normal physiological conditions. Further experiments will settle these questions. In summary, we have demonstrated that high-affinity, cooperative, E2-ER-ERE binding in vitro depends on natural AT-rich ERE flanking sequences and the presence of proteins present in the heparin agarose E R preparation that stabilize the binding of E2 ligand within the hormone binding pocket of ER. We suggest that E R binds weakly to these accessory proteins via the appropriate ERE flanking sequences. This interaction, in tum, results in enhanced ER D N A binding capacity, affinity, and cooperativity only when E R is liganded to an estrogen agonist, not an estrogen antagonist. Future work will focus on the identification and characterization of these accessory proteins and their role in ER-dependent signal transduction. Acknowledgements--This work was supported by N I H Grant H D 24459. J. H. A. was supported in part by N I H Medical Scientist Training Program Grant 5-T32-GM07356. We thank Dr Abdulmaged M. Traish of Boston University Medical Center for providing anti-ER antibody N M T - 1 . We thank Abbott Laboratories for their generous gift of anti-ER antibody H222. We thank Neomarkers, LabVision Corporation for their generous gift of the AER series of ER-specific antibodies. We thank April L. Studinski, Pieter Van Horn, and David Z. Tzeng for their contributions to certain experiments.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

REFERENCES 20. 1. Mangelsdorf D. J., T h u m m e l C., Beato M., Herrlich P., Schutz G., Umesono K., Blumberg B., Kastner P., Mark M., Chambon P. and Evans R. M.: The nuclear receptor superfamily: the second decade. Cell 83 (1995) 835-839. 2. Martinez E., Dusserre Y., Wahli W. and M e r m o d N.: Synergistic transcriptional activation by C T F / N F - I and the estrogen receptor involved stabilized interactions with a limiting target factor. Molec. Cell. Biol. 11 (1991) 2937-2945. 3. Nowakowski B. E. and Maurer R. A.: Multiple Pit-l-binding sites facilitate estrogen responsiveness of the prolactin gene. Molec. Endocr. 8 (1994) 1742-1749. 4. Halachmi S., Marden E., Martin G., MacKay H., Abbondanza C. and Brown M.: Estrogen receptor-associated proteins: possible mediators of hormone-induced transcription. Science 264 (1994) 1455-1458. 5. Cavailles V., Dauvois S., L'Horst F., Lopez G., Hoare S., Kushner P. J. and Parker M. G.: Nuclear factor RIP 140 modulates transcriptional activation by the estrogen receptor. E M B O J . 14 (1995) 3741-3751. 6. Onate S. A., Tsai S. Y., Tsai M.-J. and O'Malley B. W.: Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270 (1995) 1354-1357. 7. Baniahmad C., Nawaz Z., Baniahmad A., Gleeson M. A. G., Tsai M.-J. and O'Malley B. W.: Enhancement of human estrogen receptor activity by SPT6: a potential coactivator. Molec. Endocr. 9 (1995) 34-43. 8. LeDouarin B., Zechel C., Gamier J.-M., Lutz Y., Tora L., Pierrat B., Heery D., Gronemeyer H., C h a m b o n P. and

21.

22.

23.

24.

25.

26.

Losson R.: The N-terminal part of TIF1, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-tar in the oncogenic protein T18. E M B O J . 14 (1995) 2020-2033. Edwards D. P., Kuhnel B., Estes P. A. and Nordeen S. K.: H u m a n progesterone receptor binding to mouse mammary tumor virus deoxyribonuecleic acid: dependence on hormone and nonreceptor nuclear factors. Molec. Endocr. 3 (1989) 381391. Burnside J., Darling D. A. and Chin W. W.: A nuclear factor that enhances binding of thyroid hormone receptors to thyroid hormone response elements. ,7. BioL Chem. 265 (1990) 25002504. Lee J. W., Ryan F., Swaffield J. C., Johnston S. A. and Moore D. D.: Interaction of thyroid hormone receptor with a conserved transcriptional mediator. Nature 374 (1995) 91-94. Glass C. K., Lipkin S. M., Devary O. V. and Rosenfeld M. G.: Positive and negative regulation of gene transcription by a retinoic acid-thyroid hormone receptor heterodimer. Cell 59 (1989) 697-708. Mukherjee R. and C h a m b o n P.: A single-stranded DNA-binding protein promotes the binding of the purified oestrogen receptor to its responsive element. Nucl. Acids Res. 18 (1990) 5713-5716. Koszewski N. J. and Notides A. C.: Phosphate-sensitive binding of the estrogen receptor to its response elements. Molec. Endocr. 5 (1991) 1129-1136. Landel C. C., Kushner P. J. and Greene G. L.: The interaction of human estrogen receptor with D N A is modulated by receptor-associated proteins. Molec. Endocr. 8 (1994) 1407-1419. Feavers I. M., Jiricny J., Moncharmont B., Saluz H. P. and Jost J.R .: Interaction of two nonhistone proteins with the estradiol response element of the avian vitellogenin gene modulates the binding of estradiol-receptor complex. Proc. Nam. Acad. Sci. U.S,A. 84 (1987) 7453-7457. Geffroy-Roisne S., Duval J. and Thieulant M. L.: Multiple forms of affinity-labeled estrogen receptors in rat distinct pituitary cells. Endocrinology 131 (1992) 1503-1510. Klinge C. M., Peale F. V. Jr, Hilf R., Bambara R. A. and Zain S.: Cooperative estrogen receptor interaction with consensus or variant estrogen responsive elements in vitro. Cancer Res. 52 (1992) 1073-1081. Anolik J. H., Klinge C. M., Bambara R. A. and Hilf R.: Differential impact of flanking sequences on estradiol- versus 4-hydroxytamoxifen-liganded estrogen receptor binding to estrogen responsive element DNA. J. Steroid Biochem. Molec. Biol. 46 (1993) 713-730. Anolik J. H., Klinge C. M., Hilf R. and Bambara R. A.: Cooperative binding of estrogen receptor to D N A depends on spacing of binding sites, flanking sequence, and ligand. Biochemistry 34 (1995) 2511-2520. Klinge C. M., Traish A. M., Bambara R. A. and Hilf R.: Dissociation of 4-hydroxytamoxifen, but not estradiol or tamoxifen aziridine, from the estrogen receptor when the receptor binds estrogen response element DNA. J. Steroid Biochem. Molec. Biol. 57 (1996) 51-66. Klinge C. M., Traish A. M., Driscoll M. D., Hilf R. and Bambara R. A.: Site-directed estrogen receptor antibodies stabilize 4-hydroxytamoxifen ligand, but not estradiol, and indicate ligand-specific differences in the recognition of estrogen response element D N A in vitro. Steroids 61 (1996) 278-289. Klinge C. M., Bambara R. A. and Hilf R.: What differentiates antiestrogen-liganded versus estradiol-liganded estrogen receptor action?. Oncol. Res. 4 (1992) 137-144. Klinge C. M., Bambara R. A. and Hilf R.: Antiestrogenliganded estrogen receptor interaction with estrogen responsive element D N A in vitro. J. Steroid Biochem. Molec. Biol. 43 (1992) 249-262. Driscoll M. D., Klinge C. M., Hilf R. and Bambara R. A.: Footprint analysis of estrogen receptor binding to adjacent estrogen response elements, ft. Steroid Biochem. Molec. Biol. 58 (1996) 45-61. Peale F. V., Ludwig L. B., Zain S., Hill R. and Bambara R. A.: Properties of a high-affinity D N A binding site for estrogen receptor. Proc. Nam. Acad. Sci. U.S.A. 85 (1988) 1038-1042.

ER-ERE Binding Depends on other Proteins 27. Hayes J. J., Tullius T. D. and Wolffe A. P.: T h e structure of D N A in a nucleosome. Proc. Natn. Acad. Sci. U.S.A. 87 (1990) 7405-7409. 28. Pavlik E. J. and Coulson P. B.: Hydroxylapatite " b a t c h " assay for estrogen receptor: increased sensitivity over present receptor assays. J. Steroid Biochem. 7 (1976) 357-368. 29. Peale F. V. Jr., Ishibe Y., Klinge C. M., Zain S., Hilf R. and Bambara R. A.: Rapid purification of the estrogen receptor by sequence-specific D N A affinity chromatography. Biochemistry 28 (1989) 8671-8675. 30. Obourn J. D., Koszewski N. J. and Notides A. C.: Hormoneand DNA-binding mechanisms of the recombinant h u m a n estrogen receptor. Biochemistry 32 (1993) 6229-6236. 31. Abbondanza C., de Falco A., Nigro V., Medici N., Armetta I., Molinari A. M., Moncharmont B. and Puca G. A.: Characterization and epitope mapping of a new panel of monoclonal antibodies to estradiol receptor. Steroids 58 (1993) 4-12. 32. Ludwig L. B., Klinge C. M., Peale F. V. Jr., Bambara R. A., Zain S. and Hill R.: A microtiter well assay for quantitative measurement of estrogen receptor binding to estrogen-responsive elements. Molec. Endocr. 4 (1990) 1027-1033. 33. Traish A. M., A1-Fadhli S., Klinge C. M., Kounine M. and Quick T. C.: Identification of structurally-altered estrogen receptors in h u m a n breast cancer by site-directed monoclonal antibodies. Steroids 60 (1995) 467-474. 34. Fritsch M., Welch R. D., Murdoch F. E., Anderson I. and Gorski J.: D N A allosterically modulates the steroid binding domain of the estrogen receptor. J. Biol. Chem. 267 (1992) 1823-1828. 35. Maaroufi Y., Trivedi S. and LeClercq G.: Major molecular weight heterogeneity of estrogen receptor from breast cancer is not related to neoplasm. Cancer Biochem. Biophys. 15 (1995) 67-78. 36. Zhang X. Y., Asiedu C. K., Supakar P. C. and Ehrlich M.: Increasing the activity of affinity-purified DNA-binding proteins by adding high concentrations of nonspecific proteins. Analyt. Biochem. 201 (1992) 366-374. 37. Neff S., Sadowski C. and Kiksicek R. J.: Mutational analysis of cysteine residues within the hormone-binding domain of the human estrogen receptor identifies mutants that are defective in both DNA-binding and subcellular distribution. Molec. Endocr. 8 (1994) 1215-1223. 38. Robertson D. W., Wei L. L., Hayes J. R., Carlson K. E., Katzenellenbogen J. A. and Katzenellenbogen B. S.: Tamoxifen aziridines: effective inactivators of estrogen receptors. Endocrinology 109 (1981) 1298-1300. 39. Furlow J. D., Murdocln F. E. and Gorski J.: High affinity binding of the estrogen receptor to a D N A response element does not require homodimer formation or estrogen. J. Biol. Chem. 268 (1993) 12519-12525. 40. Sasson S. and Notides A. C.: Mechanism of the estrogen receptor interaction wilah 4-hydroxytamoxifen. Molec. Endocr. 2 (1988) 307-312. 41. Thole H. H.: The side chains responsible for the dimerization of the estradiol receptor by ionic bonds are lost in a 17 kDa fragment extending downstream from aa303. J. Steroid Biochem. Molec. Biol. 48 (1994) 463-466. 42. Fawell S. E., Lees J. A., White R. and Parker M. G.: Characterization and colocalization of steroid binding and dimerization activities in the mouse estrogen receptor. Cell 60 (1990) 953-962.

429

43. Zhou Z.-X., Lane M. S., Kemppainen J. A., French F. S. and Wilson E. M.: Specificity of ligand-dependent androgen receptor stabiization: receptor domain interactions influence ligand dissociation and receptor stability. Molec. Endocr. 9 (1995) 208-218. 44. Wang Y. and Sauerbier W.: AT-rich sequences may lower the activation energy of cruciform extrusion in supercoiled DNA. Biochem. Biophys. Res. Commun. 158 (1989) 423-431. 45. Lannigan D. A., Tamashek J. J., Obourn J. D. and Notides A. C.: Analysis of estrogen receptor interaction with tertiary-structured estrogen responsive elements. Biochem. Pharm. 45 (1993) 1921-1928. 46. Kladde M. P., D ' C u n h a J. and Gorski J.: Multiple transitions to non-B-DNA structures occur in the distal regulatory region of the rat prolactin gene. J. Molec. Biol. 229 (1993) 344-367. 47. Lannigan D. A. and Notides A. C.: Estrogen receptor selectively binds the "coding strand" of an estrogen responsive element. Proc. Nam. Acad. Sci. U.S.A. 86 (1989) 863-867. 48. Pina B., Hach6 R. J. G., Arnemann J., Chalepakis G., Slater E. P. and Beato M.: Hormonal induction of transfected genes depends on D N A topology. Molec. Cell. Biol. 10 (1990) 625633. 49. Dana S. L., Hoener P. A., Wheeler D. A., Lawrence C. B. and McDonnell D. P.: Novel estrogen response elements identified by genetic selection in yeast are differentially responsive to estogens and antiestrognes in mammalian cells. Molec. Endocr. 8 (1994) 1193-1207. 50. Dobbeling U., Rob K., Klein-Hitpass L., Morley C., Wagner U. and Ryffel G. U.: A cell-specific activator in the Xenopus A2 vitellogenin gene: promoter elements functioning with rat liver nuclear extracts. E M B O J . 7 (1988) 2495-2501. 51. Nardulli A. M. and Shapiro D. J.: Binding of the estrogen receptor DNA-binding domain to the estrogen response element induces D N A bending. Molec. Cell. Biol. 12 (1992) 2037-2042. 52. Nardulli A. M., Grobner C. and Cotter D.: Estrogen receptorinduced D N A bending: orientation of the bend and replacement of an estrogen response element with an intrinsic D N A bending sequence. Molec. Endocr. 9 (1995) 1064-1076. 53. Kahn J. D. and Crothers D. M.: Protein-induced bending and D N A cyclization. Proc. Nam. Acad. Sci. U.S.A. 89 (1989) 6343-6347. 54. Onate S., Prendergast P., Wagner J. P., Nissen M., Reeves R., Pettijohn D. E. and Edwards D. P.: The DNA-bending protein H M G - I enhances progesterone receptor binding to its target D N A sequences. Molec. Cell. Biol. 14 (1994) 3376-3391. 55. Prendergast P., Onate S. A., Christensen K. and Edwards D.: Nuclear accessory factors enhance the binding of progesterone receptor to specific target DNA. J. Steroid Biochem. Molec. Biol. 48 (1994) 1-13. 56. Iyer V. and Struhl K.: Poly(dA:dT), a ubiquitous promoter element that stimulates transcription via its intrinsic D N A structure. E M B O J . 14 (1995) 2570-2579. 57. Tora L., Gaub M. P., Mader S., Dierich A., Bellard M. and C h a m b o n P.: Cell-specific activity of a G G T C A half-palindromic oestrogen-responsive element in the chicken ovalbumin gene promoter. E M B O J . 7 (1988) 3771-3778. 58. Kupfer S. R., Marshke K. B., Wilson E. M. and French F. S.: Receptor accessory factor enhances specific D N A binding of androgen and glucocorticoid receptor. J. Biol. Chem. 268 (1993) 17519-17527.