- Email: [email protected]
Stable transformation of trypanosomatids through targeted chromosomal integration of the selectable marker gene encoding blasticidin S deaminase
FEMS Microbiology Letters 186 (2000) 287^291
www.fems-microbiology.org
Stable transformation of trypanosomatids through targeted chromosomal integration of the selectable marker gene encoding blasticidin S deaminase Darren R. Brooks b
a;1;
*, Richard McCulloch a;1 , Graham H. Coombs b , Jeremy C. Mottram a
a Wellcome Centre for Molecular Parasitology, University of Glasgow, The Anderson College, Glasgow G11 6NU, UK Division of Infection and Immunity, Institute of Biomedical and Life Sciences, University of Glasgow, Joseph Black Building, Glasgow G12 8QQ, UK
Received 23 February 2000; accepted 24 March 2000
Abstract The susceptibilities of the protozoan parasites Leishmania mexicana and Trypanosoma brucei to the nucleoside antibiotic blasticidin S were assessed. A concentration of 10 Wg ml31 was sufficient to cause cell death within 72 h of L. mexicana promastigotes and bloodstream forms of T. brucei in vitro. The gene encoding blasticidin S deaminase (BSD) was therefore incorporated into cassettes for targeting to the cysteine proteinase C locus of L. mexicana (CPC: :BSD) and the tubulin locus of T. brucei (tub: :RAD51-BSR). Following transfection of mutant parasites that contained other well-established selectable marker genes (HYG, NEO, BLE, PAC and SAT), clones resistant to 10 Wg ml31 blasticidin S were shown by PCR and Southern blotting to have integrated the cassettes by homologous recombination. The results confirm that BSD can be used as a selectable marker gene for targeted chromosomal integration during genetic manipulations of trypanosomatids. ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Leishmania mexicana ; Trypanosoma brucei; Transfection ; Blasticidin
1. Introduction Protozoan parasites of the genus Leishmania are responsible for a range of human diseases termed the leishmaniases, whilst sub-species of the related trypanosomatid, Trypanosoma brucei, are responsible for nagana in cattle and sleeping sickness in humans. The elucidation of gene function in these parasites is facilitated by reverse genetics, enabling mutants to be generated through well-established transfection methodologies that require the use of dominant selectable markers. A number of selectable markers
* Corresponding author. Tel. : +44 (141) 3303904; Fax: +44 (141) 3305422; E-mail : [email protected] 1
These two authors contributed equally to this work.
Abbreviations : BSD, HYG, NEO, BLE, PAC and SAT, genes encoding blasticidin S deaminase, hygromycin phosphotransferase, neomycin phosphotransferase, bleomycin resistance protein, puromycin N-acetyltransferase and streptothricin acetyltransferase ; CP, cysteine proteinase ; PCR, polymerase chain reaction; VSG, variant surface glycoprotein
have been used, with di¡ering success (reviewed in [1]), but additional markers are required to allow more extensive manipulation since Leishmania and trypanosomes are for experimental purposes asexual diploids. The generation of null mutants therefore requires the inactivation of two alleles by two rounds of transfection using constructs with independent selectable markers. Moreover, another independent selectable marker is then required to re-introduce the gene back into the mutant and so con¢rm gene function. The number of selectable marker genes required at one locus may be minimised through loss of heterozygosity [2]. Alternatively, the targeted integration of a negative selectable marker gene permits the possibility of its subsequent re-cycling through a `null-targeting' approach [2]. However, such approaches are not trivial and require numerous genetic manipulations to generate a null mutant. Consequently, the development of further independent selectable markers would increase the range of genetic manipulations that are possible with Leishmania and trypanosomes. To this end, we have investigated blasticidin S, a nucleoside analogue isolated from Streptomyces griseochromogenes [3] and used for selection with mam-
0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 0 0 ) 0 0 1 5 9 - 2
FEMSLE 9392 27-4-00
288
D.R. Brooks et al. / FEMS Microbiology Letters 186 (2000) 287^291
malian cells [4,5], Dictyostelium discoideum [6] and Plasmodium falciparum [7]. We have generated previously a cysteine proteinase (CP) double null mutant of Leishmania mexicana (vCPA/CPB) using independent selectable markers conferring resistance to hygromycin, phleomycin, puromycin and nourseothricin [8]. This mutant is able to progress through its entire life cycle, although it is not capable of forming lesions in mice [9]. To extend our studies on leishmanial CPs, we wished to generate a CP triple null mutant through targeted deletion of the single-copy CPC gene from vCPA/ CPB. As a ¢rst step to achieving this aim, we generated heterozygosity at the CPC locus by replacement of one CPC gene with the BSD selectable marker gene. In addition, we sought to test the e¤cacy of blasticidin S for the selection of transformed T. brucei. To do this, we used a transgenic strain of bloodstream-stage cells containing selectable markers for G418 and hygromycin within the actively transcribed expression site [10], and sought to introduce an ectopic copy of the RAD51 gene [11] into the tubulin locus by co-expression with the BSD gene. As with the leishmanial study, we wanted to ascertain whether or not BSD could be used in conjunction with the other available selectable markers described for T. brucei. Hence we performed the RAD51-BSD ectopic selection in a strain that had previously been disrupted in both RAD51 alleles by insertion of selectable markers conferring resistance to puromycin and phleomycin [11]. 2. Materials and methods
tion, G418 (Geneticin, Gibco BRL) was used as required at 5 Wg ml31 . Transfection was performed in 0.5 ml of Zimmerman Post-Fusion medium (132 mM NaCl, 8 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 0.5 mM Mg acetate, 0.09 mM Ca acetate, pH 7.0) supplemented with 1% (w/v) glucose, using a Bio-Rad gene pulser II set at 1.4^1.5 kV and 25 WF. The tub: :RAD51-BSR cassette was digested with XbaI and XhoI and 5 Wg used per transfection of 5.0U107 cells. Selection of blastidicin-resistant cells was performed as described in the text following overnight recovery in non-selective HMI-9 medium. 2.2. Constructs The blasticidin S deaminase gene (BSD), which encodes an enzyme that inactivates blasticidin, was ampli¢ed from the plasmid pcDNA6/V5-His (Invitrogen) by PCR using Pfu polymerase and oligonucleotides OL494 (ACTAGTATGGCCAAGCCTTTGTCT) and OL495 (GGATCCTTAGCCCTCCCACACATA). The resulting 410-bp PCR product was cloned into PCR-Script Amp (SK+) (Stratagene). Following sequence veri¢cation the BSD gene was released from the plasmid by SpeI and BamHI digestion and sub-cloned into plasmid pGL57 (used in deletion of the CPC gene from wild-type L. mexicana [14]), thereby replacing the SAT gene. This cloning procedure generated plasmid pGL437, from which recovery of the CPC: :BSD cassette was obtained by HindIII and XbaI digestion. Generation of tub: :RAD51-BSR has been described elsewhere [11].
2.1. Parasites
3. Results and discussion
L. mexicana (MNYC/BZ/62/M379) promastigotes were grown in HOMEM medium supplemented with 10% (v/v) heat-inactivated foetal calf serum (FCS), pH 7.5, at 25³C as described previously [12]. The required antibiotics were added, as needed, at the following concentrations : blasticidin S (Invitrogen) at 10 Wg ml31 , hygromycin B (Boehringer Mannheim) at 50 Wg ml31 , nourseothricin (ClonSat, Hans Knoll Institute, Germany) at 25 Wg ml31 , phleomycin (Cayla, France) at 10 Wg ml31 and puromycin (Calbiochem) at 10 Wg ml31 . Transfection of L. mexicana promastigotes was as described previously [13,14], using 10 Wg of the linearised and puri¢ed knockout cassette (CPC: :BSD) and 4U107 late-exponential-phase vCPA/CPB promastigotes. Following electroporation, cells were allowed to recover in 10 ml complete HOMEM medium for 24 h at 25³C and then transformants were selected by spreading cells on to 1% (w/v) bactoagar-HOMEM plates containing blasticidin S. T. brucei 221a bloodstream-stage trypanosomes (MITat1.2 transgenic strain 3174 [10]) were used and grown in HMI-9 medium [15] supplemented with the necessary antibiotics at the concentrations described above. In addi-
Initially we tested the sensitivity of L. mexicana promastigotes growing at 25³C in HOMEM supplemented with 10% (v/v) heat-inactivated FCS [12] to blasticidin S (Invitrogen). 10 Wg ml31 blasticidin S was su¤cient to kill both wild-type and vCPA/CPB mutant parasites within 72 h, indicating that there was no appreciable cross-resistance to the drug arising from the antibiotic resistance genes present in the double null mutant (HYG, BLE, PAC and SAT). L. mexicana vCPA/CPB promastigotes were therefore transformed with the CPC: :BSD knockout cassette excised and puri¢ed from pGL437. Transformants were selected following growth at 25³C as colonies on 1% (w/v) bactoagar-HOMEM/FCS plates containing blasticidin S at 10 Wg ml31 . Clones were transferred into complete HOMEM containing 10 Wg ml31 blasticidin S and incubated at 25³C to allow a period of growth prior to recovery of genomic DNA according to Medina-Acosta and Cross [16]. Con¢rmation that the knockout cassette had integrated at the CPC locus was then obtained by PCR analysis of this DNA using BSD-speci¢c oligonucleotides in combination with primers speci¢c to the CPC £ank
FEMSLE 9392 27-4-00
D.R. Brooks et al. / FEMS Microbiology Letters 186 (2000) 287^291
Fig. 1. Targeting of the BSD-containing CPC cassette to the CPC locus of L. mexicana by homologous recombination. The upper diagram shows the CPC locus, the BSD-containing CPC cassette (excised with HindIII (H3) and XbaI (Xb)) and the relative positions of oligonucleotides (designated by arrows) used for PCR analysis of transformants. The lower diagram is an agarose gel (0.8% w/v) of Taq DNA polymerase-generated PCR products con¢rming targeting of the BSD gene to the CPC locus of L. mexicana vCPA/CPB. Speci¢c PCR products of the expected sizes were generated using the primer pairs shown for the blasticidin-resistant (BSDr ) vCPA/CPB clone (lanes 2, 3, 6 and 7). The speci¢city of these ampli¢cation products was con¢rmed by repeating the PCR reactions with genomic DNA derived from the parent vCPA/ CPB (lanes 4, 5, 8 and 9). PCR cycling conditions for analysis of the 5P £ank region were 30 cycles of denaturation at 94³C for 30 s, annealing at 62³C for 30 s and extension at 72³C for 2 min in the presence of 5% (v/v) dimethyl sulfoxide. PCR cycling conditions for analysis of the 3P £ank region were as for the 5P region except that primer annealing was performed at 58³C. Markers (lane 1) are 1-kb ladder (Gibco BRL).
regions outside those incorporated into pGL437 (OL174 and OL563, Fig. 1). Homologous recombination at the 5P £ank region of CPC was con¢rmed by two independent PCR reactions using primer combinations OL174 (ACATGCGAACACGCACGCTC)-OL536 (TTGAGACAAAGGCTTGGCCAT) and OL174-OL495, generating speci¢c ampli¢cation products of 2.3 kb (lane 2) and 2.7 kb (lane 3), respectively. Correct targeting of the BSD cassette to the 3P £ank region of CPC was also con¢rmed by two independent PCR reactions, using primer combinations OL537 (GGTTATGTGTGGGAGGGCTAA)OL563 (GAGGTTCGCCTTTGCCTACT) and OL494OL563, giving speci¢c products of 2.0 kb (lane 6) and 2.4 kb (lane 7), respectively. No speci¢c products were generated using these primer combinations for PCR analysis of genomic DNA derived from vCPA/CPB (lanes 4,
289
5, 8 and 9). Thus this PCR-based analysis con¢rmed that blasticidin S had been successfully utilised as a positive selectable marker for gene-speci¢c deletion in L. mexicana. We have previously reported the generation of RAD51 null mutants using a transgenic derivative of T. brucei strain MITat1.2 that has HYG and NEO antibiotic resistance genes in its active VSG expression site (RAD51wt [11]). The two RAD51 alleles of RAD51wt were disrupted using cassettes containing BLE and PAC antibiotic resistance genes (to give mutant RAD51ko). Attempts were made to re-introduce a complete copy of RAD51 into RAD51ko by using BSD as a selectable marker. To this end, we generated a construct (tub: :RAD51-BSR, Fig. 2) in which BSD was cloned upstream of 2.27 kb of T. brucei genomic sequence encompassing RAD51 and the gene's 5P processing signals, and both genes were £anked by short regions of tubulin intergenic sequence [11]. Before attempting transformation with tub: :RAD51-BSR, both RAD51ko and RAD51wt bloodstream-stage T. brucei were tested for sensitivity to blasticidin S in vitro at 37³C in HMI-9 culture medium. Both cell lines were found to be sensitive to concentrations as low as 2 Wg ml31 , with the cells being killed between 48 and 72 h. Bloodstream forms of both cell lines (RAD51ko and RAD51wt) were transformed with 5 Wg of XbaI- and XhoI-digested tub: :RAD51-BSR using standard electroporation conditions. Transformants were selected using either semi-solid HMI-9 agarose plates or 10 ml liquid medium containing 2, 5 or 10 Wg ml31 blasticidin S. Blasticidin-resistant cells were recovered in similar numbers at all drug concentrations, and genomic DNA was prepared from the cells to check that the tub: :RAD51BSR construct had undergone stable integration at the tubulin locus. Fig. 2 shows a Southern blot of BamHIdigested DNA from blasticidin-resistant clones, isolated from both RAD51wt and RAD51ko transformations, probed with a fragment encompassing both BSD and RAD51. A 5.5-kb DNA fragment, which corresponds to the RAD51 gene, was detected with DNA from untransformed RAD51wt (lane 4). In contrast, the RAD51 gene was found on a 6.0-kb DNA fragment with the untransformed RAD51ko cells (lane 2). This is due to insertion of the BLE and PAC resistance genes. In the blasticidin-resistant clones, an additional band of 5.0 kb was seen (lanes 1 and 3). This is the size expected after homologous insertion of tub: :RAD51-BSR into the tubulin array. These data indicate that blasticidin S had successfully selected those cells that had integrated the BSD gene into the tubulin locus by homologous recombination. In summary, this study has demonstrated the e¡ective use of blasticidin S as a positive selectable marker for the integrative transformation of both L. mexicana promastigotes and bloodstream-form T. brucei. Our work has also con¢rmed that the compound is not inactivated by the enzymes encoded by the other ¢ve antibiotic resistance genes currently used as selectable markers in genetic ma-
FEMSLE 9392 27-4-00
290
D.R. Brooks et al. / FEMS Microbiology Letters 186 (2000) 287^291
Fig. 2. Introduction of an intact copy of the RAD51 gene into bloodstream-form T. brucei using the BSD gene as a selectable marker. The upper diagram shows the organisation of construct tub: :RAD51-BSR, which allows for integration of BSD-RAD51 into the tubulin locus replacing K tubulin. The Southern blot in the lower diagram shows the result of transformation of RAD51wt and RAD51ko cells with tub: :RAD51-BSR digested with XbaI (Xb) and XhoI (Xh). Genomic DNA from untransformed (3) and transformed (+) cells was digested with BamHI (B) and probed with a 2.7-kb BSDRAD51 PstI (P) fragment (see upper diagram). The bands of interest are labelled and the sizes in kb are given on the left.
nipulations of trypanosomatids. This study therefore complements that of Goyard and Beverley who showed recently that blasticidin S could be used for selection of episomes in L. donovani and L. major [17]. The e¤cacy of blasticidin S means that there are now six positive antibiotic selectable markers available for genetic manipulations of trypanosomatids. Acknowledgements We thank Mike Cross (The Netherlands Cancer Institute, Amsterdam) for supplying plasmid pTBT and Steve Beverley for discussions on the BSD gene as a selectable marker in Leishmania. A Royal Society University Research Fellowship supports R.M. J.C.M. is an MRC Senior Research Fellow. D.R.B. was supported by a MRC project grant. References [1] Clayton, C.E. (1999) Genetic manipulation of kinetoplastida. Parasitol. Today 15, 372^378.
[2] Gueiros-Filho, F.J. and Beverley, S.M. (1996) Selection against the dihydrofolate reductase-thymidylate synthase (DHFR-TS) locus as a probe of genetic alterations in Leishmania major. Mol. Cell. Biol. 16, 5655^5663. [3] Takeuchi, S., Hirayama, K., Ueda, K., Sakai, H. and Yonehara, H. (1958) Blasticidin S, a new antibiotic. J. Antibiot. Ser. A 12, 1^5. [4] Izumi, M., Miyazawa, H., Kamakura, T., Yamaguchi, I., Endo, T. and Hanaoka, F. (1991) Blasticidin S-resistance gene (Bsr) ^ A novel selectable marker for mammalian cells. Exp. Cell Res. 197, 229^233. [5] Kimura, M., Takatsuki, A. and Yamaguchi, I. (1994) Blasticidin-S deaminase gene from Aspergillus terreus (Bsd) ^ A new drug-resistance gene for transfection of mammalian cells. Biochim. Biophys. Acta 1219, 653^659. [6] Puta, F. and Zeng, C. (1998) Blasticidin resistance cassette in symmetrical polylinkers for insertional inactivation of genes in Dictyostelium. Folia Biol. 44, 185^188. [7] BenMamoun, C., Gluzman, I.Y., Goyard, S., Beverley, S.M. and Goldberg, D.E. (1999) A set of independent selectable markers for transfection of the human malaria parasite Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 96, 8716^8720. [8] Mottram, J.C., Souza, A.E., Hutchison, J.E., Carter, R., Frame, M.J. and Coombs, G.H. (1996) Evidence from disruption of the lmcpb gene array of Leishmania mexicana that cysteine proteinases are virulence factors. Proc. Natl. Acad. Sci. USA 93, 6008^6013. [9] Alexander, J., Coombs, G.H. and Mottram, J.C. (1998) Leishmania mexicana cysteine proteinase-de¢cient mutants have attenuated virulence for mice and potentiate a Th1 response. J. Immunol. 161, 6794^ 6801.
FEMSLE 9392 27-4-00
D.R. Brooks et al. / FEMS Microbiology Letters 186 (2000) 287^291 [10] McCulloch, R., Rudenko, G. and Borst, P. (1997) Gene conversions mediating antigenic variation in Trypanosoma brucei can occur in Variant Surface Glycoprotein expression sites lacking 70 bp repeat sequences. Mol. Cell. Biol. 17, 833^843. [11] McCulloch, R. and Barry, J.D. (1999) A role for RAD51 and homologous recombination in Trypanosoma brucei antigenic variation. Genes Dev. 13, 2875^2888. [12] Bates, P.A. (1994) The developmental biology of Leishmania promastigotes. Exp. Parasitol. 79, 215^218. [13] Souza, A.E., Bates, P.A., Coombs, G.H. and Mottram, J.C. (1994) Null mutants for the lmcpa cysteine proteinase gene in Leishmania mexicana. Mol. Biochem. Parasitol. 63, 213^220. [14] Bart, G., Frame, M.J., Carter, R., Coombs, G.H. and Mottram, J.C.
291
(1997) Cathepsin B-like cysteine proteinase-de¢cient mutants of Leishmania mexicana. Mol. Biochem. Parasitol. 88, 53^61. [15] Hirumi, H. and Hirumi, K. (1989) Continuous cultivation of Trypanosoma brucei bloodstream forms in a medium containing a low concentration of serum protein without feeder cell layers. J. Parasitol. 75, 985^989. [16] Medina-Acosta, E. and Cross, G.A.M. (1993) Rapid isolation of DNA from trypanosomatid protozoa using a simple mini-prep procedure. Mol. Biochem. Parasitol. 59, 327^329. [17] Goyard, S. and Beverley S.M. (2000) Blasticidin resistance : a new independent marker for stable transfection of Leishmania. Mol. Biochem. Parasitol. (in press).
FEMSLE 9392 27-4-00
www.fems-microbiology.org
Stable transformation of trypanosomatids through targeted chromosomal integration of the selectable marker gene encoding blasticidin S deaminase Darren R. Brooks b
a;1;
*, Richard McCulloch a;1 , Graham H. Coombs b , Jeremy C. Mottram a
a Wellcome Centre for Molecular Parasitology, University of Glasgow, The Anderson College, Glasgow G11 6NU, UK Division of Infection and Immunity, Institute of Biomedical and Life Sciences, University of Glasgow, Joseph Black Building, Glasgow G12 8QQ, UK
Received 23 February 2000; accepted 24 March 2000
Abstract The susceptibilities of the protozoan parasites Leishmania mexicana and Trypanosoma brucei to the nucleoside antibiotic blasticidin S were assessed. A concentration of 10 Wg ml31 was sufficient to cause cell death within 72 h of L. mexicana promastigotes and bloodstream forms of T. brucei in vitro. The gene encoding blasticidin S deaminase (BSD) was therefore incorporated into cassettes for targeting to the cysteine proteinase C locus of L. mexicana (CPC: :BSD) and the tubulin locus of T. brucei (tub: :RAD51-BSR). Following transfection of mutant parasites that contained other well-established selectable marker genes (HYG, NEO, BLE, PAC and SAT), clones resistant to 10 Wg ml31 blasticidin S were shown by PCR and Southern blotting to have integrated the cassettes by homologous recombination. The results confirm that BSD can be used as a selectable marker gene for targeted chromosomal integration during genetic manipulations of trypanosomatids. ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Leishmania mexicana ; Trypanosoma brucei; Transfection ; Blasticidin
1. Introduction Protozoan parasites of the genus Leishmania are responsible for a range of human diseases termed the leishmaniases, whilst sub-species of the related trypanosomatid, Trypanosoma brucei, are responsible for nagana in cattle and sleeping sickness in humans. The elucidation of gene function in these parasites is facilitated by reverse genetics, enabling mutants to be generated through well-established transfection methodologies that require the use of dominant selectable markers. A number of selectable markers
* Corresponding author. Tel. : +44 (141) 3303904; Fax: +44 (141) 3305422; E-mail : [email protected] 1
These two authors contributed equally to this work.
Abbreviations : BSD, HYG, NEO, BLE, PAC and SAT, genes encoding blasticidin S deaminase, hygromycin phosphotransferase, neomycin phosphotransferase, bleomycin resistance protein, puromycin N-acetyltransferase and streptothricin acetyltransferase ; CP, cysteine proteinase ; PCR, polymerase chain reaction; VSG, variant surface glycoprotein
have been used, with di¡ering success (reviewed in [1]), but additional markers are required to allow more extensive manipulation since Leishmania and trypanosomes are for experimental purposes asexual diploids. The generation of null mutants therefore requires the inactivation of two alleles by two rounds of transfection using constructs with independent selectable markers. Moreover, another independent selectable marker is then required to re-introduce the gene back into the mutant and so con¢rm gene function. The number of selectable marker genes required at one locus may be minimised through loss of heterozygosity [2]. Alternatively, the targeted integration of a negative selectable marker gene permits the possibility of its subsequent re-cycling through a `null-targeting' approach [2]. However, such approaches are not trivial and require numerous genetic manipulations to generate a null mutant. Consequently, the development of further independent selectable markers would increase the range of genetic manipulations that are possible with Leishmania and trypanosomes. To this end, we have investigated blasticidin S, a nucleoside analogue isolated from Streptomyces griseochromogenes [3] and used for selection with mam-
0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 0 0 ) 0 0 1 5 9 - 2
FEMSLE 9392 27-4-00
288
D.R. Brooks et al. / FEMS Microbiology Letters 186 (2000) 287^291
malian cells [4,5], Dictyostelium discoideum [6] and Plasmodium falciparum [7]. We have generated previously a cysteine proteinase (CP) double null mutant of Leishmania mexicana (vCPA/CPB) using independent selectable markers conferring resistance to hygromycin, phleomycin, puromycin and nourseothricin [8]. This mutant is able to progress through its entire life cycle, although it is not capable of forming lesions in mice [9]. To extend our studies on leishmanial CPs, we wished to generate a CP triple null mutant through targeted deletion of the single-copy CPC gene from vCPA/ CPB. As a ¢rst step to achieving this aim, we generated heterozygosity at the CPC locus by replacement of one CPC gene with the BSD selectable marker gene. In addition, we sought to test the e¤cacy of blasticidin S for the selection of transformed T. brucei. To do this, we used a transgenic strain of bloodstream-stage cells containing selectable markers for G418 and hygromycin within the actively transcribed expression site [10], and sought to introduce an ectopic copy of the RAD51 gene [11] into the tubulin locus by co-expression with the BSD gene. As with the leishmanial study, we wanted to ascertain whether or not BSD could be used in conjunction with the other available selectable markers described for T. brucei. Hence we performed the RAD51-BSD ectopic selection in a strain that had previously been disrupted in both RAD51 alleles by insertion of selectable markers conferring resistance to puromycin and phleomycin [11]. 2. Materials and methods
tion, G418 (Geneticin, Gibco BRL) was used as required at 5 Wg ml31 . Transfection was performed in 0.5 ml of Zimmerman Post-Fusion medium (132 mM NaCl, 8 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 0.5 mM Mg acetate, 0.09 mM Ca acetate, pH 7.0) supplemented with 1% (w/v) glucose, using a Bio-Rad gene pulser II set at 1.4^1.5 kV and 25 WF. The tub: :RAD51-BSR cassette was digested with XbaI and XhoI and 5 Wg used per transfection of 5.0U107 cells. Selection of blastidicin-resistant cells was performed as described in the text following overnight recovery in non-selective HMI-9 medium. 2.2. Constructs The blasticidin S deaminase gene (BSD), which encodes an enzyme that inactivates blasticidin, was ampli¢ed from the plasmid pcDNA6/V5-His (Invitrogen) by PCR using Pfu polymerase and oligonucleotides OL494 (ACTAGTATGGCCAAGCCTTTGTCT) and OL495 (GGATCCTTAGCCCTCCCACACATA). The resulting 410-bp PCR product was cloned into PCR-Script Amp (SK+) (Stratagene). Following sequence veri¢cation the BSD gene was released from the plasmid by SpeI and BamHI digestion and sub-cloned into plasmid pGL57 (used in deletion of the CPC gene from wild-type L. mexicana [14]), thereby replacing the SAT gene. This cloning procedure generated plasmid pGL437, from which recovery of the CPC: :BSD cassette was obtained by HindIII and XbaI digestion. Generation of tub: :RAD51-BSR has been described elsewhere [11].
2.1. Parasites
3. Results and discussion
L. mexicana (MNYC/BZ/62/M379) promastigotes were grown in HOMEM medium supplemented with 10% (v/v) heat-inactivated foetal calf serum (FCS), pH 7.5, at 25³C as described previously [12]. The required antibiotics were added, as needed, at the following concentrations : blasticidin S (Invitrogen) at 10 Wg ml31 , hygromycin B (Boehringer Mannheim) at 50 Wg ml31 , nourseothricin (ClonSat, Hans Knoll Institute, Germany) at 25 Wg ml31 , phleomycin (Cayla, France) at 10 Wg ml31 and puromycin (Calbiochem) at 10 Wg ml31 . Transfection of L. mexicana promastigotes was as described previously [13,14], using 10 Wg of the linearised and puri¢ed knockout cassette (CPC: :BSD) and 4U107 late-exponential-phase vCPA/CPB promastigotes. Following electroporation, cells were allowed to recover in 10 ml complete HOMEM medium for 24 h at 25³C and then transformants were selected by spreading cells on to 1% (w/v) bactoagar-HOMEM plates containing blasticidin S. T. brucei 221a bloodstream-stage trypanosomes (MITat1.2 transgenic strain 3174 [10]) were used and grown in HMI-9 medium [15] supplemented with the necessary antibiotics at the concentrations described above. In addi-
Initially we tested the sensitivity of L. mexicana promastigotes growing at 25³C in HOMEM supplemented with 10% (v/v) heat-inactivated FCS [12] to blasticidin S (Invitrogen). 10 Wg ml31 blasticidin S was su¤cient to kill both wild-type and vCPA/CPB mutant parasites within 72 h, indicating that there was no appreciable cross-resistance to the drug arising from the antibiotic resistance genes present in the double null mutant (HYG, BLE, PAC and SAT). L. mexicana vCPA/CPB promastigotes were therefore transformed with the CPC: :BSD knockout cassette excised and puri¢ed from pGL437. Transformants were selected following growth at 25³C as colonies on 1% (w/v) bactoagar-HOMEM/FCS plates containing blasticidin S at 10 Wg ml31 . Clones were transferred into complete HOMEM containing 10 Wg ml31 blasticidin S and incubated at 25³C to allow a period of growth prior to recovery of genomic DNA according to Medina-Acosta and Cross [16]. Con¢rmation that the knockout cassette had integrated at the CPC locus was then obtained by PCR analysis of this DNA using BSD-speci¢c oligonucleotides in combination with primers speci¢c to the CPC £ank
FEMSLE 9392 27-4-00
D.R. Brooks et al. / FEMS Microbiology Letters 186 (2000) 287^291
Fig. 1. Targeting of the BSD-containing CPC cassette to the CPC locus of L. mexicana by homologous recombination. The upper diagram shows the CPC locus, the BSD-containing CPC cassette (excised with HindIII (H3) and XbaI (Xb)) and the relative positions of oligonucleotides (designated by arrows) used for PCR analysis of transformants. The lower diagram is an agarose gel (0.8% w/v) of Taq DNA polymerase-generated PCR products con¢rming targeting of the BSD gene to the CPC locus of L. mexicana vCPA/CPB. Speci¢c PCR products of the expected sizes were generated using the primer pairs shown for the blasticidin-resistant (BSDr ) vCPA/CPB clone (lanes 2, 3, 6 and 7). The speci¢city of these ampli¢cation products was con¢rmed by repeating the PCR reactions with genomic DNA derived from the parent vCPA/ CPB (lanes 4, 5, 8 and 9). PCR cycling conditions for analysis of the 5P £ank region were 30 cycles of denaturation at 94³C for 30 s, annealing at 62³C for 30 s and extension at 72³C for 2 min in the presence of 5% (v/v) dimethyl sulfoxide. PCR cycling conditions for analysis of the 3P £ank region were as for the 5P region except that primer annealing was performed at 58³C. Markers (lane 1) are 1-kb ladder (Gibco BRL).
regions outside those incorporated into pGL437 (OL174 and OL563, Fig. 1). Homologous recombination at the 5P £ank region of CPC was con¢rmed by two independent PCR reactions using primer combinations OL174 (ACATGCGAACACGCACGCTC)-OL536 (TTGAGACAAAGGCTTGGCCAT) and OL174-OL495, generating speci¢c ampli¢cation products of 2.3 kb (lane 2) and 2.7 kb (lane 3), respectively. Correct targeting of the BSD cassette to the 3P £ank region of CPC was also con¢rmed by two independent PCR reactions, using primer combinations OL537 (GGTTATGTGTGGGAGGGCTAA)OL563 (GAGGTTCGCCTTTGCCTACT) and OL494OL563, giving speci¢c products of 2.0 kb (lane 6) and 2.4 kb (lane 7), respectively. No speci¢c products were generated using these primer combinations for PCR analysis of genomic DNA derived from vCPA/CPB (lanes 4,
289
5, 8 and 9). Thus this PCR-based analysis con¢rmed that blasticidin S had been successfully utilised as a positive selectable marker for gene-speci¢c deletion in L. mexicana. We have previously reported the generation of RAD51 null mutants using a transgenic derivative of T. brucei strain MITat1.2 that has HYG and NEO antibiotic resistance genes in its active VSG expression site (RAD51wt [11]). The two RAD51 alleles of RAD51wt were disrupted using cassettes containing BLE and PAC antibiotic resistance genes (to give mutant RAD51ko). Attempts were made to re-introduce a complete copy of RAD51 into RAD51ko by using BSD as a selectable marker. To this end, we generated a construct (tub: :RAD51-BSR, Fig. 2) in which BSD was cloned upstream of 2.27 kb of T. brucei genomic sequence encompassing RAD51 and the gene's 5P processing signals, and both genes were £anked by short regions of tubulin intergenic sequence [11]. Before attempting transformation with tub: :RAD51-BSR, both RAD51ko and RAD51wt bloodstream-stage T. brucei were tested for sensitivity to blasticidin S in vitro at 37³C in HMI-9 culture medium. Both cell lines were found to be sensitive to concentrations as low as 2 Wg ml31 , with the cells being killed between 48 and 72 h. Bloodstream forms of both cell lines (RAD51ko and RAD51wt) were transformed with 5 Wg of XbaI- and XhoI-digested tub: :RAD51-BSR using standard electroporation conditions. Transformants were selected using either semi-solid HMI-9 agarose plates or 10 ml liquid medium containing 2, 5 or 10 Wg ml31 blasticidin S. Blasticidin-resistant cells were recovered in similar numbers at all drug concentrations, and genomic DNA was prepared from the cells to check that the tub: :RAD51BSR construct had undergone stable integration at the tubulin locus. Fig. 2 shows a Southern blot of BamHIdigested DNA from blasticidin-resistant clones, isolated from both RAD51wt and RAD51ko transformations, probed with a fragment encompassing both BSD and RAD51. A 5.5-kb DNA fragment, which corresponds to the RAD51 gene, was detected with DNA from untransformed RAD51wt (lane 4). In contrast, the RAD51 gene was found on a 6.0-kb DNA fragment with the untransformed RAD51ko cells (lane 2). This is due to insertion of the BLE and PAC resistance genes. In the blasticidin-resistant clones, an additional band of 5.0 kb was seen (lanes 1 and 3). This is the size expected after homologous insertion of tub: :RAD51-BSR into the tubulin array. These data indicate that blasticidin S had successfully selected those cells that had integrated the BSD gene into the tubulin locus by homologous recombination. In summary, this study has demonstrated the e¡ective use of blasticidin S as a positive selectable marker for the integrative transformation of both L. mexicana promastigotes and bloodstream-form T. brucei. Our work has also con¢rmed that the compound is not inactivated by the enzymes encoded by the other ¢ve antibiotic resistance genes currently used as selectable markers in genetic ma-
FEMSLE 9392 27-4-00
290
D.R. Brooks et al. / FEMS Microbiology Letters 186 (2000) 287^291
Fig. 2. Introduction of an intact copy of the RAD51 gene into bloodstream-form T. brucei using the BSD gene as a selectable marker. The upper diagram shows the organisation of construct tub: :RAD51-BSR, which allows for integration of BSD-RAD51 into the tubulin locus replacing K tubulin. The Southern blot in the lower diagram shows the result of transformation of RAD51wt and RAD51ko cells with tub: :RAD51-BSR digested with XbaI (Xb) and XhoI (Xh). Genomic DNA from untransformed (3) and transformed (+) cells was digested with BamHI (B) and probed with a 2.7-kb BSDRAD51 PstI (P) fragment (see upper diagram). The bands of interest are labelled and the sizes in kb are given on the left.
nipulations of trypanosomatids. This study therefore complements that of Goyard and Beverley who showed recently that blasticidin S could be used for selection of episomes in L. donovani and L. major [17]. The e¤cacy of blasticidin S means that there are now six positive antibiotic selectable markers available for genetic manipulations of trypanosomatids. Acknowledgements We thank Mike Cross (The Netherlands Cancer Institute, Amsterdam) for supplying plasmid pTBT and Steve Beverley for discussions on the BSD gene as a selectable marker in Leishmania. A Royal Society University Research Fellowship supports R.M. J.C.M. is an MRC Senior Research Fellow. D.R.B. was supported by a MRC project grant. References [1] Clayton, C.E. (1999) Genetic manipulation of kinetoplastida. Parasitol. Today 15, 372^378.
[2] Gueiros-Filho, F.J. and Beverley, S.M. (1996) Selection against the dihydrofolate reductase-thymidylate synthase (DHFR-TS) locus as a probe of genetic alterations in Leishmania major. Mol. Cell. Biol. 16, 5655^5663. [3] Takeuchi, S., Hirayama, K., Ueda, K., Sakai, H. and Yonehara, H. (1958) Blasticidin S, a new antibiotic. J. Antibiot. Ser. A 12, 1^5. [4] Izumi, M., Miyazawa, H., Kamakura, T., Yamaguchi, I., Endo, T. and Hanaoka, F. (1991) Blasticidin S-resistance gene (Bsr) ^ A novel selectable marker for mammalian cells. Exp. Cell Res. 197, 229^233. [5] Kimura, M., Takatsuki, A. and Yamaguchi, I. (1994) Blasticidin-S deaminase gene from Aspergillus terreus (Bsd) ^ A new drug-resistance gene for transfection of mammalian cells. Biochim. Biophys. Acta 1219, 653^659. [6] Puta, F. and Zeng, C. (1998) Blasticidin resistance cassette in symmetrical polylinkers for insertional inactivation of genes in Dictyostelium. Folia Biol. 44, 185^188. [7] BenMamoun, C., Gluzman, I.Y., Goyard, S., Beverley, S.M. and Goldberg, D.E. (1999) A set of independent selectable markers for transfection of the human malaria parasite Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 96, 8716^8720. [8] Mottram, J.C., Souza, A.E., Hutchison, J.E., Carter, R., Frame, M.J. and Coombs, G.H. (1996) Evidence from disruption of the lmcpb gene array of Leishmania mexicana that cysteine proteinases are virulence factors. Proc. Natl. Acad. Sci. USA 93, 6008^6013. [9] Alexander, J., Coombs, G.H. and Mottram, J.C. (1998) Leishmania mexicana cysteine proteinase-de¢cient mutants have attenuated virulence for mice and potentiate a Th1 response. J. Immunol. 161, 6794^ 6801.
FEMSLE 9392 27-4-00
D.R. Brooks et al. / FEMS Microbiology Letters 186 (2000) 287^291 [10] McCulloch, R., Rudenko, G. and Borst, P. (1997) Gene conversions mediating antigenic variation in Trypanosoma brucei can occur in Variant Surface Glycoprotein expression sites lacking 70 bp repeat sequences. Mol. Cell. Biol. 17, 833^843. [11] McCulloch, R. and Barry, J.D. (1999) A role for RAD51 and homologous recombination in Trypanosoma brucei antigenic variation. Genes Dev. 13, 2875^2888. [12] Bates, P.A. (1994) The developmental biology of Leishmania promastigotes. Exp. Parasitol. 79, 215^218. [13] Souza, A.E., Bates, P.A., Coombs, G.H. and Mottram, J.C. (1994) Null mutants for the lmcpa cysteine proteinase gene in Leishmania mexicana. Mol. Biochem. Parasitol. 63, 213^220. [14] Bart, G., Frame, M.J., Carter, R., Coombs, G.H. and Mottram, J.C.
291
(1997) Cathepsin B-like cysteine proteinase-de¢cient mutants of Leishmania mexicana. Mol. Biochem. Parasitol. 88, 53^61. [15] Hirumi, H. and Hirumi, K. (1989) Continuous cultivation of Trypanosoma brucei bloodstream forms in a medium containing a low concentration of serum protein without feeder cell layers. J. Parasitol. 75, 985^989. [16] Medina-Acosta, E. and Cross, G.A.M. (1993) Rapid isolation of DNA from trypanosomatid protozoa using a simple mini-prep procedure. Mol. Biochem. Parasitol. 59, 327^329. [17] Goyard, S. and Beverley S.M. (2000) Blasticidin resistance : a new independent marker for stable transfection of Leishmania. Mol. Biochem. Parasitol. (in press).
FEMSLE 9392 27-4-00