- Email: [email protected]
Stam2 expression pattern during embryo development
Gene Expression Patterns 12 (2012) 68–76
Contents lists available at SciVerse ScienceDirect
Gene Expression Patterns journal homepage: www.elsevier.com/locate/gep
Stam2 expression pattern during embryo development Marija C´urlin a,⇑, Katarina Kapuralin a, Andres F. Muro b, Francisco E. Baralle b, Kamal Chowdhury c, Srec´ko Gajovic´ a a
Croatian Institute for Brain Research, School of Medicine, University of Zagreb, Croatia International Centre for Genetic Engineering and Biotechnology, Trieste, Italy c Max Planck Institute of Biophysical Chemistry, Department of Molecular Cell Biology, Goettingen, Germany b
a r t i c l e
i n f o
Article history: Received 13 August 2011 Received in revised form 19 November 2011 Accepted 21 November 2011 Available online 28 November 2011 Keywords: STAM2 Gene trap Mouse Embryo Expression X-gal staining Development
a b s t r a c t STAM2 is a tyrosine-phosphorylated protein suggested to be involved in cargo selection during endocytic pathway, regulation of exocytosis and intracellular signaling. Gene trap method was used to create via insertional mutagenesis a mutant mouse line with integration of promoterless bgeo (lacZ–neomycin phosphotransferase fusion) gene in the second intron of Stam2 gene, enabling analysis of its in vivo expression and function. The inserted b-galactosidase (lacZ) reporter gene was used to reveal Stam2 expression during development. Stam2 in situ RNA hybridization and immunostaining confirmed the observed b-galactosidase activity reflecting high Stam2 expression. The homozygous mutant mice showed no overt phenotypic alterations. Stam2 expression was detected after E9.5 in the gut, notochord, neural tube and heart. In the nervous system it was located in the floor, roof and basal plates of the developing neural tube, and in the developing cortex, hippocampus and olfactory bulbs. Toward the end of gestation, Stam2 expression appeared in the testis and ovary, lungs, nasal cavity epithelium, kidneys, urogenital sinus, intestine, pancreas, pituitary and adrenal glands, muscles, brown adipose tissue, skin and epithelium of the tongue and oral cavity. Ó 2011 Elsevier B.V. All rights reserved.
Proper cellular response in dynamic environment during development requires constant monitoring of the incoming signals, their subsequent processing and appropriate reaction. An important mechanism involved in this task is endocytosis, which through membrane transport regulates the cell sensitivity, modulates the duration of the signal, and assists in its intracellular processing. Molecules on the cell surface together with those from outside could be internalized into early endosomes, and either recycled back to the cell surface or degraded in lysosomes via multivesicular bodies (MVB). The sorting of the right cargo toward these two different pathways is not completely understood, but monoubiquitination and deubiquitination processes could play an important role (Raiborg et al., 2003; Kirkin and Dikic, 2007; Piper and Luzio, 2007). STAM1 and STAM2 (signal transduction adaptor molecules 1 and 2) are considered to be involved in the endosomal sorting of the ubiquitinated cargo proteins for trafficking toward the lysosome (Bache et al., 2003; Mizuno et al., 2003). Together with HRS (hepatocyte growth factor-regulated tyrosine kinase substrate) they form ESCRT-0 complex (Conibear, 2002; Hurley and Emr, ⇑ Corresponding author. Address: Croatian Institute for Brain Research, School of Medicine, University of Zagreb, Salata 12, 10000 Zagreb, Croatia. Tel.: +385 1 4566792; fax: +385 1 4596942. E-mail address: [email protected] (M. C´urlin). 1567-133X/$ - see front matter Ó 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.gep.2011.11.005
2006; Williams and Urbé, 2007; Ren et al., 2009), the first of the four protein complexes referred as ESCRT-0, -I, -II, and -III (i.e. endosomal sorting complexes required for transport). They recognize ubiquitinated membrane proteins and direct them toward the MVB pathway (Katzman et al., 2002; Luzio et al., 2009; Raiborg and Stenmark, 2009). Beside its suggested role in the membrane trafficking during endocytosis, STAM2 is involved in the regulation of exocytosis, as dominant-negative mutants of Stam2 significantly inhibited IgE receptor (FceRI)-triggered secretory response in RBL-2H3 mast cells (Murai and Kitamura, 2000). In addition, STAM2 seems to connect these processes with intracellular signaling. STAM2 is tyrosine-phosphorylated upon stimulation with a variety of cytokines and growth factors (Endo et al., 2000). Through its ITAM (immunoreceptor tyrosine-based activation motif) domain, STAM2 is associated with JAK2 and JAK3 tyrosine kinases, and it is involved in the regulation of intracellular signal transduction for DNA synthesis and c-myc induction mediated by IL-2 and GMCSF (Endo et al., 2000; Pandey et al., 2000; Hu et al., 2007). Loss of function of STAM2 in mouse did not result with any obvious abnormality (Yamada et al., 2002), while loss of STAM1 caused growth retardation in the third week after birth and disappearance of hippocampal CA3 pyramidal neurons (Yamada et al., 2001). Double knockout mice for both Stam1 and Stam2 were lethal by embryonic day 11.5 (E11.5), with a defect in ventral folding
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
morphogenesis (Yamada et al., 2002) implying that STAMs are indispensable for embryo development. To explore the possible function of STAM2 during mouse embryo development and to relate it to the observed embryo lethality, we analyzed in detail its in vivo expression pattern by tagging it endogenously with LacZ reporter via gene trap mutagenesis method. No phenotypic alterations were detected as a consequence of the gene trap mutation. However, the introduced in frame lacZ gene allowed us to analyze the developmental expression of Stam2 demonstrating high Stam2 expression in the heart and nervous tissue, particularly in the differentiating layers of the telencephalic cortex.
69
1.2. b-Galactosidase activity in the developing mutant mouse embryos To determine the expression pattern of Stam2 gene, wholemount histochemical X-gal staining to visualize b-galactosidase activity (i.e. to visualize in-frame-inserted lacZ expression pattern) was performed on the mutant and, as a control, on the wild type mouse embryos from E8.5 to E18.5 (Table 1, Fig. 2). Cryosections of E16.5 embryos were also prepared and stained by X-gal (Fig. 3B). 1.2.1. Stage E8.5 At stage E8.5, no b-galactosidase activity was found. 1.2.2. Stage E9.5 The earliest b-galactosidase activity was detected at E9.5, when it was present in the hindgut (Fig. 2A).
1. Results 1.1. Production and characterization of Stam2Gt1Gaj mouse line Gt1Gaj
The Stam2 mouse was produced using a large-scale gene trap approach (Gajovic´ et al., 1998). Gene trap vector used was pKC199bgeo (Thomas et al., 2000) containing the splice acceptor sequence from mouse Hoxc9 gene located upstream of the promoterless bgeo (fused lacZ and neoR), which generates both b-galactosidase reporter and neomycin resistance activities. The vector was introduced into mouse embryonic stem (ES) cells by electroporation. Chimeric animals were produced from modified ES cell clones, and genes of interest were chosen according to their restricted expression pattern in the developing nervous system at E11.5. The expression was visualized by histochemical detection of b-galactosidase, which was present in the tissue due to the introduced splice acceptor site located upstream of the lacZ gene and subsequent lacZ transcription driven by endogenous promoter of the modified gene. As the integration of gene trap vector into mouse ES cell genome is random, the endogenous gene affected by the gene trap mutation had to be identified. The known sequence of the inserted gene trap vector enabled us to amplify and identify the targeted gene by 50 and 30 RACE (rapid amplification of cDNA ends) methods (Frohman et al., 1988; C´urlin et al., 2002). BLAST search has shown that the obtained cDNA sequence represents an already known gene, referred as Stam2 (Genbank NM019667) or Hbp (Hrs binding protein; Genbank AB012611; Takata et al., 2000). According to the restricted expression pattern in the developing neural tube and heart, the mouse line with modified Stam2 gene was investigated further. Heterozygous carriers of the mutation were crossed to C57Bl/6NCrl mice, currently for 17 generations, in order to obtain a congenic mouse line that differs from the inbred strain only in the modified locus. Sequence analysis of the vector insertion site revealed that it was integrated in the second intron of Stam2 gene (Fig. 1A). Southern blot analysis with a vector specific probe excluded the possibility of multiple gene trap vector insertions and confirmed that the used mouse line contained only specific Stam2 mutation (Fig. 1B). As a consequence of the mutation, 86% of the C-terminal wild type STAM2 protein was expected to be missing from the mutant protein, leaving only 41 N-terminal amino acid residues (of the total of 523 amino acids; the product of the first two of total of 14 exons) fused to b-galactosidase and neomycin phosphotransferase protein encoded by the inserted bgeo gene. The homozygous carriers of the gene trap mutation were produced by intercrossing heterozygous mice. They were identified by Southern blotting with Stam2 specific probe or by PCR (Fig. 1A, C and D). Both heterozygous and homozygous Stam2Gt1Gaj mice carrying the gene trap mutation were born with the expected Mendelian ratio (v2 test p > 0.1), had no macroscopic abnormalities and were viable, fertile and had a normal life span.
1.2.3. Stage E10.5 At E10.5, the X-gal staining was not visible in the gut; however the b-galactosidase activity was present in the heart, where it persisted afterwards throughout gestation (Figs. 2B and C, 3A and B). 1.2.4. Stage E11.5 At E11.5, in addition to the heart, b-galactosidase was detected in the notochord and neural tube (Fig. 2B and D). In the neural tube it was located in the floor plate and its ventral part corresponding to the basal plates (Fig. 2D). 1.2.5. Stage E12.5 The basic pattern of b-galactosidase activity observed at stage E11.5 was slightly modified at stage 12.5 and later. At 12.5 the bgalactosidase activity was present in the heart and neural tube, but disappeared in the notochord. In the neural tube, the expression was present in the basal plates, floor plate and additionally in the roof plate. As a background the newly formed choroid plexus showed diffused positive X-gal staining. This background staining persisted afterwards throughout the gestation. 1.2.6. Stage E13.5 Together with the expression in the heart and developing spinal cord, b-galactosidase activity was detected in the floor plate of the brain stem (medulla oblongata and pons). In the developing spinal cord the expression included not only the floor plate but as well the future raphe region. It was not any more present in the basal plates. Low b-galactosidase activity was detected in the testes. Background X-gal staining appeared in the stomach and intestinal mucosa and continued there until the end of gestation. 1.2.7. Stage E14.5 At E14.5 b-galactosidase activity was present in the developing spinal cord (the floor plate, raphe region, the roof plate and weakly in the gray matter). In the medulla oblongata and pons, the bgalactosidase was present in the floor plate, in the most ventral part of the raphe and in the gray matter (Figs. 2E, 3A). At this stage a b-galactosidase activity appeared in the telencephalon, i.e. in the intermediate zone of the neopallial cortex, olfactory bulbs, trigeminal and dorsal root ganglia, pituitary, lungs, nasal cavity epithelium, pancreas, urogenital sinus, skin and muscles in the head and neck, tongue, back and limbs. The activity in the testes was visible in the future seminiferous tubules. 1.2.8. Stage E15.5 The regions of b-galactosidase activity in E15.5 embryos corresponded to the regions of its activity detected in E14.5 embryos, but the staining was generally stronger. The staining in the heart was more intensive in the atrium than in ventriculum.
70
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
Fig. 1. (A) Schematic diagram of bgeo insertion into intron sequence of Stam2 gene between the second and third exon of Stam2. DNA probes used for the Southern blot experiments and the primers used for the PCR genotyping were indicated. The insertion site between base 30139010 and 30139009 of the chromosome 2 (Genbank NT_039206) is indicated. (B) Insertion of gene trap vector occurred only once in Stam2 gene. Southern blot analysis shows hybridization of genomic DNA with a vector specific bgeo DNA probe. DNA was cut with restriction enzyme BglI. The 2.9 kb signal represents a mutant Stam2 allele, and is visible in homozygous (hm) and heterozygous (ht), but not in the wild type (wt) mice. (C) Southern blot detection of homozygous carriers of gene trap modification of Stam2 gene. Southern blot analysis shows hybridization of genomic DNA with Stam2 DNA probe. Genomic DNA was cut by restriction enzyme SacI. The 3.5 kb signal represents a mutant Stam2 allele (visible in homozygous (hm) and heterozygous (ht) mice) and the 1.4 kb signal represents a wild type allele (visible in heterozygous (ht) and wild type (wt) mice). (D) PCR-detection of homozygous carriers of gene trap modification of Stam2. Six hundred bp product is a result of the wild type DNA amplification using LOB31 and LOB5A primers, while 800 bp product corresponds to mutated allele and it is obtained by LOB31 and lac2 primers.
1.2.9. Stage E16.5 At this stage the b-galactosidase activity appeared in the ventricular and marginal zone and cortical plate of the cortex and in the hippocampus (Figs. 3B, 4A and C). The b-galactosidase activity was intense in the superficial intermediate zone, and weak in the marginal zone. In the roof plate of the developing spinal cord bgalactosidase activity disappeared, but persisted in the floor plate, raphe and gray matter. The staining in the gray matter, raphe and floor plate of the brain stem was extended to the ventral ventricular layer of the fourth ventricle. The b-galactosidase activity continued to be present in the heart (equally in the atrium as in the ventriculum), testes, olfactory bulbs, trigeminal and dorsal root ganglia, pituitary (both adenohypophysis and neurohypophysis), tongue, lungs, nasal cavity epithelium, pancreas, urogenital sinus, skin and muscles and appeared in the mucosa covering the tongue, kidneys, spleen, medulla of the adrenal glands and brown adipose tissue in the back region (Figs. 2J, 3B and C, 4A). 1.2.10. Stage E17.5 At E17.5 the strong b-galactosidase activity in the intermediate zone extended through the subplate zone and included the cortical plate of the telencephalon (Fig. 2F). The recently formed hippocampus showed strong b-galactosidase activity. The activity continued to be present in the raphe, floor plate and gray matter of the developing spinal cord and brain stem, and in the ventral ventricular layer of the fourth ventricle. b-Galactosidase activity was strong in all other b-galactosidase positive regions detected in the E16.5 embryos and was detected also in the ovaries. 1.2.11. Stage E18.5 At E18.5 the b-galactosidase activity occupied the whole region from the intermediate to the marginal zone (Fig. 2G). It disappeared from the raphe region and it was weaker in the floor plate of the developing spinal cord and brain stem, but got stronger in other regions of the nervous system that were positive at E17.5 (i.e. cortex, hippocampus and olfactory bulbs, gray matter of the spinal cord and pons). It got stronger also in the testes, ovaries,
lungs, kidneys, urogenital sinus (bladder), pituitary and adrenal glands (Fig. 2H, I, L and M). Besides skin and tongue mucosa it appeared in the oral cavity mucosa (Fig. 2K). 1.3. b-Galactosidase activity corresponded to Stam2 expression In order to confirm that the observed b-galactosidase activity pattern indeed reflects the endogenous Stam2 expression, in situ RNA hybridization using Stam2 specific probe and X-gal staining were compared on the cryo sections of E16.5 embryos. In situ RNA hybridization on the wild type embryos showed a weak ubiquitous Stam2 expression with distinguished higher expression in the nervous tissue, lungs, heart, digestive and endocrine system (Fig. 3B, Table 2). X-gal staining was more restricted than in situ RNA hybridization (Fig. 3A). The ubiquitous low level of Stam2 mRNA was not visible with X-gal staining, and the areas with high mRNA presence were wider than those outlined by X-gal. For example, a clear laminar distribution of b-galactosidase activity in the brain cortex was visible, while mRNA distribution in the cortex was rather diffused. In situ RNA hybridization revealed high Stam2 expression in the intestine which was undetectable due to the presence of high background by X-gal staining. Also, a weak signal in the area of the choroid plexus indicated Stam2 expression in this structure. The Stam2 expression revealed by X-gal staining matched the regions of high expression of Stam2 mRNA, i.e. it showed more restricted pattern than in situ RNA hybridization. Another verification of observed X-gal staining was obtained by immunohistochemistry using STAM2 and b-galactosidase antibodies on the heterozygous mutant E11.5 and E16.5 embryos. Immunohistochemistry of both antibodies revealed strong fluorescent signal in the Stam2 expressing regions identified by X-gal staining (Table 2). However, both were less restricted than X-gal staining, i.e. they demonstrated weak ubiquitous signal that was not visible by X-gal staining. As well as b-galactosidase activity, the STAM2 and b-galactosidase immunostainings were strong in the superficial intermediate zone of the telencephalic cortex in E16.5 embryos, but also were present throughout the cortex in the ventricular and
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
71
Table 1 Regional distribution of Stam2 expression assessed by X-gal staining. Only tissues and organs showing lacZ expression are outlined. b – Background staining; ‘‘’’ – no signal; ‘‘/ +’’, ‘‘+’’, ‘‘++’’ and ‘‘+++’’ – arbitrary estimated intensities of signal strength. Embryonic day
E9.5
E10.5
Notochord Nervous system Spinal cord (roof plate) Spinal cord (basal plates) Spinal cord (floor plate) Spinal cord (raphe) Spinal cord (gray matter) Oblongata, pons (floor plate) Oblongata, pons (raphe) Oblongata, pons (gray matter) Cortex (ventricular zone) Cortex (intermediate zone) Cortex (cortical plate) Cortex (marginal zone) Hippocampus Olfactory bulbs Trigeminal ganglia Dorsal root ganglia Choroid plexus Heart Atrium Ventriculum Spleen Lungs Nasal cavity mucosa Digestive system Hindgut Intestine and stomach Oral cavity mucosa Tongue Pancreas Urogenital system Kidneys Urogenital sinus Phalus
E11.5
E12.5
E13.5
E14.5
E15.5
E16.5
E17.5
E18.5
+ /+ +
+ + +
+
+ + + /+ + + /+ +
+ + + + + + + +
+ /+ /+ b
+ + + b
+ + + + + + /+ ++ /+ /+ /+ + + + b
+ + + + /+ + /+ + + + + + + + b
/+ + /+ + + + ++ + + + + + b
++ + /+ + +
++ + /+ + +
+
+ +
+ +
+ +
+ +
+ +
+ +
++ +
/+ /+
+ +
++ + /+ + +
+
b
b + /+
b + /+
b ++ +
b ++ +
b + ++ +
/+
+
/+ + +
+ + +
+ + +
/+
+
+
++
+
+
/+
+
+ + +++ ++ /+ +
+ + +++ + ++ /+ +
+ + +++ + ++ /+ +
Endocrine system Pituitary Adrenal glands (medulla) Testes Ovaries Skin Brown adipose tissue Muscles
intermediate zones (Fig. 3C and D). Similarly, the STAM2 and bgalactosidase immunostainings were strong in the ventral part of the neural tube of E11.5 embryos but also were present throughout the whole section of the neural tube. Other organs and tissues did not show significant difference between strong fluorescence signals and X-gal staining. The colocalization immunohistochemistry study of STAM2 protein and b-galactosidase revealed STAM2 and b-galactosidase in the same tissues and cells, but the intracellular distribution of those proteins was different. STAM2 was present in the cell bodies and cell processes, but the signal was very intense in punctuate structures in the cytoplasm and in some cells in the nucleus (Fig. 3E). The immunohistochemical signal of b-galactosidase was homogenous throughout the cytoplasm and it was not present in the nucleus. Tiny dots representing accumulations of b-galactosidase were visible in some cells as documented previously (Eyer and Peterson, 1994; Letournel et al., 2006).
2. Discussion The present study represents the first comprehensive mapping of Stam2 expression during mouse embryo development. X-gal
+
histochemistry of the molecularly tagged Stam2 gene in the Stam2Gt1Gaj mouse line allowed analysis of Stam2 expression pattern in the embryos. The location of gene trap vector within Stam2 gene was confirmed by Southern blot and PCR analyses (Fig. 1B), and the observed lacZ expression pattern was additionally verified by in situ RNA hybridization and immunohistochemistry (Fig. 3). In situ RNA hybridization and immunohistochemistry revealed two levels of Stam2 expression: low and ubiquitous vs. high and specific. Regions with strong signal observed by in situ RNA hybridization and immunohistochemistry overlapped the regions that showed b-galactosidase activity. The lower sensitivity of X-gal histochemistry was expected due to different detection levels of the three methods used (mRNA, protein, and enzyme activity). It has been shown that X-gal histochemistry underestimates the extent of gene expression while immunohistochemistry has the superior sensitivity (Pereira et al., 2006; Couegnas et al., 2007). In addition, the lower intensity of the X-gal staining could be due to possible instability of the mutant protein. Still identifying the regions with high levels of Stam2 expression by X-gal staining could be not considered a disadvantage, as it reveals restricted positive areas most relevant for the STAM2 function research.
72
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
Fig. 2. Visualization of b-galactosidase activity in the representative heterozygous mouse embryos by histochemical staining with X-gal. (A and B) Lateral views of E9.5 and E11.5 embryos, respectively, (C) the developing heart of E11.5 embryo, (D) cross section of the neural tube of E11.5 embryo, (E) sagital section of E14.5 embryo head, (F) sagital section of E17.5 embryo telencephalon, (G) transversal section of E18.5 brain, (H) the testis, and (I) the ovary at E18.5, (J) cryo section of the skin at E16.5, (K) the tongue and oral cavity epithelia at E18.5, (L) the pituitary, and (M) the adrenal gland at E18.5. AH – adenohypophysis, C – cortex, CP – cortical plate, FP – floor plate, H – heart, HC – hippocampus, HG – hindgut, IZ – intermediate zone, MA – medulla of adrenal gland, MO – medulla oblongata, NT – neural tube, N – notochord, NH – neurohypophysis, OCE – oral cavity epithelium, P – pons, SC – spinal cord, TE – tongue epithelium, TS – seminiferous tubules. White bars – 1 mm; black bars – 0.1 mm.
The endocytic pathway can be important for the embryonic development in several ways, but the most intriguing is the establishment of the gradient of morphogens via planar transcytosis, and their subsequent selective uptake and degradation. The candidate regions for these processes correspond to the regions of Stam2 expression and include the notochord, floor plate and roof plate of the neural tube, telencephalic cortex, hippocampus and the heart. STAM2 was as well suggested to participate in exocytic extrusion of synaptic and other secretory granules (Murai and Kitamura, 2000; Komada and Kitamura, 2001). One of the regions of Stam2 expression was the nervous tissue and the endocrine organs like pituitary and adrenal glands near the end of gestation, all of them at this stage already highly secretory active. Other regions of expression are polarized epithelial tissues in the skin, tongue and oral cavity, where sorting and correct delivery of the proteins to different membrane domains depends on accurate vesicle trafficking and sorting (Nelson and Yeaman, 2001; Altschuler et al., 2003).
In addition, Stam2 showed an intriguing strong and specific expression pattern in the cortex of the telencephalon (neopallial cortex). An appearance of strong Stam2 expression in the intermediate zone at the time of the cortex differentiation and zone stratification and further spreading of the expression into the cortical plate during the intensive neural migration and cortical layers formation indicate a possible Stam2 function in the processes of the cortex differentiation comprising complex cell specifications. When compared to other members of the ESCRT-0 complex, Hrs and STAM1, the observed Stam2 expression was more restricted than Hrs expression in mouse and rat embryos (Avantaggiato et al., 1995; Komada and Soriano, 1999; Tsujimoto et al., 1999; Yamada et al., 2001; Tamai et al., 2008). Furthermore, a comparison of our study on Stam2 and published data on Stam1 expression (Yamada et al., 2001) reveals that Stam2 and Stam1 mRNA distributions overlap. On the other hand our b-galactosidase activity study showed that Stam2 is expressed in the organs where Stam1 expression was
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
73
Fig. 3. Visualization of b-galactosidase activity in the representative cryosections of homozygous mouse embryos by histochemical staining with X-gal. Bar (the same for A, B and C) – 1 mm. (A) b-Galactosidase activity on the sagital cryosection of E14.5 embryo. (B) b-Galactosidase activity on the sagital cryosection of E16.5 embryo. (C) bGalactosidase activity on the transversal cryosections of E16.5 embryo. The locations of the sections are indicated by horizontal arrows in the B. IZ – intermediate zone of the neopallial cortex, P – pituitary, TG – grigeminal ganglion, MO – medulla oblongata, SC – spinal cord, DRG – dorsal root ganglion, T – tongue, M – skeletal muscles, BA – brown adipose tissue, Ht A – heart atrium, Ht V – heart ventriculum, N – nasal cavity mucosa, Lu – lungs, L – liver, G – gut, K – kidney, S – spleen, Pa – pancreas, US – urogenital sinus, Ph – phalus.
not reported: skin, oral and nasal cavity mucosa, urogenital sinus, pancreas, muscles, testis, ovary, adrenal glands and pituitary. Expression in the nasal cavity mucosa and olfactory bulbs is in accordance to the described Stam2 expression in the olfactory system in ˇ unko et al., 2008). adult mice (Furic´ C The insertion of the pKC199bgeo vector into the second intron of Stam2 gene was expected to impair its function. However, as mentioned above, no overt phenotype was detectable in the homozygotes. Similar result was also reported in the case of the complete loss of STAM2 function in homozygous mouse mutants generated by gene targeting mutagenesis (Yamada et al., 2002). The embryonic lethality of Stam1 and Stam2 double knockout indeed confirms that STAMs are important for the embryonic development. One of the reasons that the loss of STAM2 during development was not accompanied with phenotypic changes could be the compensation of its loss by STAM1. Although current data show differences in their expression pattern, they do posses several overlapping expression domains. Our data actually suggest for Stam2 two different expression levels, one low which could be detected as a low signal by in situ RNA hybridization and immunohistochemistry. This differs to stronger level of expression which was clearly detected by all three methods. If the same is valid for Stam1, we could speculate that these low levels of expression could help to compensate loss of either STAM1 or STAM2 in case of their individual loss of function, but in case of double loss of function, their importance for development is revealed and results with embryo lethality.
analyzes of the functional roles of the STAM proteins during development.
4. Experimental procedures 4.1. Animals This study was performed on heterozygous E9.5–E18.5 embryos from the gene trap mouse line Stam2Gt1Gaj and wild type inbred strain C57Bl/6NCrl. Gene trap vector pKC199bgeo, containing splice acceptor of Hoxc9 gene in frame with bgeo (lacZ/neomycin phosphotransferase fusion gene) upstream to the SV40 polyadenylation signal (Thomas et al., 2000), was used for transformation of ES cells by electroporation. After selection for 10 days by 250 mg/ml G418 (GIBCO BRL, Gaithersburg, MD), resistant clones were isolated and stained with X-gal for the presence of b-galactosidase. The positive clones were expanded; the chimeras were generated by morula aggregation and germ line transmission achieved by mating them with C57Bl/6 mice. The mouse line Stam2Gt1Gaj was selected for further investigation and kept as heterozygous through subsequent breeding with C57Bl/6NCrl mice. Homozygous animals of Stam2Gt1Gaj line were obtained by intercrossing of heterozygotes. All the experiments were approved by institutional Ethical Committee and were in agreement with the Croatian Society for Laboratory Animal Science and the International Council for Laboratory Animal Science.
3. Conclusions 4.2. Sequence determination of the trapped gene In conclusion, we provide new data revealing that the main regions of Stam2 expression during development are confined to the developing nervous system, heart, lungs, skin, tongue, oral cavity epithelia, intestine, pancreas, kidney, urogenital sinus, phalus, testis, ovary, pituitary and adrenal glands, muscles, and brown adipose tissue. These data provide additional information for further
The sequence of the trapped gene was obtained by 50 and 30 RACE (Frohman et al., 1988; C´urlin et al., 2002). The obtained sequence was compared to the known cDNA sequences by BLAST search at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov).
74
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
Fig. 4. Stam2 expression in E11.5 and E16.5 embryos detected by in situ RNA hybridization and immunohistochemistry confirmed the expression pattern obtained by X-gal staining. (A) b-Galactosidase activity on the cryosection of E16.5 embryo. (B) Stam2 in situ RNA hybridization on E16.5 embryos. Left – antisense (AS) Stam2 specific probe, right – sense (S) Stam2 specific probe, as negative control. Bars in (A) and (B) – 1 mm. (C) b-Galactosidase activity on the sagital section of the telencephalic cortex of E16.5 embryo, (D) STAM2 and b-galactosidase immunohistochemistry of the sagital section of the telecenphalic cortex of E16.5 embryo. Bars in (C) and (D) – 0.1 mm. (E) STAM2 and b-galactosidase immunohistochemistry colocalisation in the ventral part of the neural tube of E11.5 embryo, bar – 10 lm. Ct – neopallial cortex, P – pituitary, SC – spinal cord, DRG – dorsal root ganglion, NA – cartilage primordia of neural arches, T – tongue, M – skeletal muscles, Ht V – heart ventriculum, Ht A – heart atrium, Lu – lungs, L – liver, G – gut, K – kidney, AR – adrenal gland, MZ – marginal zone, CP – cortical plate, IZ – intermediate zone, VZ – ventricular zone.
4.3. Southern blotting and PCR DNA for Southern blot analysis was isolated from the adult liver mouse tissue and cut by restriction enzymes BglI or SacI (Promega). The digoxygenin (DIG-dUTP, Boehringer Mannheim) labeled DNA probes were produced by PCR using bgeo specific primers (50 TTGGCGTAAGTGAAGCGAC30 and 50 AGCGGCTGATGTTGAACTG30 ) and Stam2 gene specific primers (50 TGACAGGGTTGGAAGCACTC30 and 50 ATAAAGCTCTGACTCTCCG30 ). Both, bgeo and Stam2 DNA probes were approximately 500 bp long. The detection of the template – probe hybrids was performed using a chemiluminescence substrate ‘‘CDP Star’’ (Boehringer Mannheim). For PCR genomic DNA was isolated from the tail tips and three primers used for
genotyping were LOB31 (50 GCTTTACAGTGGGGATACAT30 ), LOB5A (50 TTATGGCTTTTAGGCAATCT30 ) and lac2 (50 CTGCAAGGCGATTAA GTTGG30 ). 4.4. Detection of b-galactosidase activity 4.4.1. Whole mount staining The heterozygous and wild type (negative control) embryos were obtained by mating heterozygous mutant males with females of C57Bl/6 strain. The morning of the vaginal plug was taken as stage E0.5. The isolated embryos were fixed in a mixture of 2% formaldehyde and 0.2% glutaraldehyde (Sigma) in phosphate buffered saline (PBS) for 1 h either as whole embryos (E8.5–E12.5) or cut
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C Table 2 Stam2 expressing regions identified by X-gal staining were confirmed by in situ RNA hybridization and immunohistochemistry. b – Background staining; ‘‘’’ – no signal; ‘‘/+’’, ‘‘+’’, ‘‘++’’ and ‘‘+++’’ – arbitrary estimated intensities of signal strength. Embryonic day
E11.5 IHC +
X-gal
ISH
IHC
Notochord
X-gal + + +
+ ++ +++
+ + + + + + /+ ++ /+ + /+ + +
+ + + + + + + + + ++ + + + + +
/+ /+ + + + + + + + +++ /+ + + + +
++ + + +
+ + + +
++ + + +
Digestive system Intestine and stomach Oral cavity mucosa Tongue Kidneys Urogenital sinus
b ++ + +
+ /+ + +
+ /+ + + +
Endocrine system Pituitary Testes Skin Muscles
+ +++ ++ +
+ + ++ +
+ + ++ +
Nervous system Spinal cord (roof plate) Spinal cord (basal plates) Spinal cord (floor plate) Spinal cord (raphe) Spinal cord (gray matter) Oblongata, pons (floor plate) Oblongata, pons (raphe) Oblongata, pons (gray matter) Cortex (ventricular zone) Cortex (intermediate zone) Cortex (cortical plate) Cortex (marginal zone) Hippocampus Olfactory bulbs Trigeminal ganglia Heart Atrium Ventriculum Lungs Nasal cavity mucosa
+ +
E16.5
+ +
sagitally or transversally (E13.5 and later). After fixation they were rinsed three times in PBS, and incubated overnight at 37 °C in the Xgal solution (1 mg/ml X-gal, 10 mM K3Fe(CN)6, 10 mM K4Fe(CN)6, and 2 mM MgCl2 in PBS), washed in PBS for 24 h and cleared in ascending concentrations of glycerol in PBS up to 70%. 4.4.2. Cryosection staining The homozygous and wild type embryos were obtained by mating heterozygous female with heterozygous male mouse. The genotype of the embryos was determined by PCR with DNA isolated from the embryonic tail. The isolated embryos were fixed for 1 h in a mixture of 2% formaldehyde and 0.2% glutaraldehyde (Sigma) in phosphate buffered saline (PBS), washed two times in the PBS and frozen to 80 °C by 1 min immersion in the prefreezed isopentane. The selected embryos were cut on a cryostat (Leica CM3000, Leica Instruments GmbH, Germany) into 40–50 lm thick sections, mounted on the glass slides, air-dried for 1–3 h, washed two times in PBS, incubated in the X-gal solution overnight at 37 °C. The stained sections were washed in PBS, dehydrated in ascending concentration of ethanol, cleared in Histo-Clear (National Diagnostics, USA) and covered with coverslips using mounting agent Histomount (National Diagnostics, USA). The micrographs of the sections were taken by computer scanning (EPSON EFFECTION 4870 PHOTO). 4.5. In situ hybridization In situ RNA hybridization for Stam2 gene was performed by a modified method described previously (Sperk et al., 1992). DNA
75
oligonucleotides complementary to mouse Stam2 gene (50 GGATGACAGTGACGCCAACTGGTGGCAAGGAGAAAATCACAGAGG30 ) were labeled with [35S] thio-dATP (Perkin–Elmer) using terminal deoxynucleotidyltransferase (Roche). Unfixed frozen mouse embryos at E16.5 were cut on a cryostat (Leica CM3000, Leica Instruments GmbH, Germany) into 20 lm thick sections and thaw-mounted on poly-L-lysine coated slides (Menzel–Glaser). After fixation by immersion in 2% paraformaldehyde, sections were rinsed in 0.1 M PBS (pH 7.4) and were acetylated with 0.25% acetic anhydride in triethanolamine (pH 8.2). The sections were further rehydrated in ascending series of alcohol. Hybridization was performed overnight at 53 °C in the hybridization buffer supplemented with dextran sulfate, dithiothreitol (Sigma), and the 35S labeled oligonucleotide probe. Next day the sections were washed with sodium citrate buffer at 60 °C and dipped in 70% ethanol. The sections were further exposed to Kodak BioMax MR Film for 2 weeks at room temperature. 4.6. Immunohistochemistry Two different stages of embryos were used for immunohistochemical analysis (E11.5 and E16.5). Whole embryos were fixed by immersion in 4% paraformaldehyde (Sigma) at 4 °C overnight. Embryos were rinsed in PBS and then transferred to 10% sucrose followed by 30% sucrose in PBS at 4 °C. Sagital sections were cut on a cryostat at 20 °C. Thickness of the sections was 30 lm for 16.5 day-old embryos and 40 lm for 11.5 day-old embryos. Sections were mounted on SuperFrost microscope slides (Menzel– Glaser). Section were further incubated with primary antibodies against STAM2 (Rabbit polyclonal, diluted 1:50, Abcam, ab63372) and bgalactosidase (Chicken polyclonal, diluted 1:50, Abcam, ab9361) at 4 °C overnight. Primary antibodies were diluted in PBS containing 0.2% Triton X-100 and 2% goat serum. Fluorescent secondary antibody incubation was carried out for 2.5 h at room temperature. The secondary antibodies were: Alexa Fluor 488 goat anti-rabbit (Invitrogen, A11008) and Alexa Fluor 546 goat anti-chicken (Invitrogen, A11040). All secondary antibodies were diluted in a PBS at a concentration 1:200. Sections were rinsed in PBS and coverslipped using Fluoromount (Sigma–Aldrich) mounting media. Fluorescent labeling was viewed using a confocal microscope Zeiss LSM 510 Meta. Acknowledgments This work was supported by Grants of Ministry of Science and Technology, Republic of Croatia (108-1081870-1902), and Unity for Knowledge Fund, Republic of Croatia (UKF 35/08). The production of the gene trap mutant mouse line was supported by the Max Planck Society, Germany. References Altschuler, Y., Hodson, C., Milgram, S.L., 2003. The apical compartment: trafficking pathways, regulators and scaffolding proteins. Curr. Opin. Cell Biol. 15, 423– 429. Avantaggiato, V., Torino, A., Wong, W.T., Di Fiore, P.P., Simeone, A., 1995. Expression of the receptor tyrosine kinase substrate genes eps8 and eps15 during mouse development. Oncogene 11, 1191–1198. Bache, K.G., Raiborg, C., Mehlum, A., Stenmark, H., 2003. STAM and Hrs are subunits of a multivalent ubiquitin-binding complex on early endosomes. J. Biol. Chem. 278, 12513–12521. Conibear, E., 2002. An ESCRT into the endosome. Mol. Cell. 10, 215–216. Couegnas, A., Schweitzer, A., Andrieux, A., Ghandour, M.S., Boehm, N., 2007. Expression pattern of STOP lacZ reporter gene in adult and developing mouse brain. J. Neurosci. Res. 85, 1515–1527. C´urlin, M., Kostovic´-Knezˇevic´, L., Gajovic´, S., 2002. Gene trap mutagenesis of three genes expressed during mouse embryo development. Periodicum. Biologorum. 104, 47–54.
76
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
Endo, K., Takeshita, T., Kasai, H., Sasaki, Y., Tanaka, N., Asao, H., Kikuchi, K., Yamada, M., Chenb, M., O’Shea, J.J., Sugamura, K., 2000. STAM2, a new member of the STAM family, binding to the Janus kinases. FEBS Lett. 477, 55–61. Eyer, J., Peterson, A., 1994. Neurofilament-deficient axons and perikaryal aggregates in viable transgenic mice expressing a neurofilament-beta-galactosidase fusion protein. Neuron 12, 389–405. Frohman, M.A., Dush, M.K., Martin, G.R., 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998–9002. Furic´ Cˇunko, V., Mitrecˇic´, D., Mavric´, S., Gajovic´, S., 2008. Expression pattern and functional analysis of mouse Stam2 in the olfactory system. Coll. Antropol. 1 (Suppl. 32), 59–63. Gajovic´, S., Chowdhury, K., Gruss, P., 1998. Genes expressed after retinoic acidmediated differentiation of embryoid bodies are likely to be expressed during embryo development. Exp. Cell. Res. 242, 138–143. Hu, X., Chen, J., Wang, L., Ivashkiv, L.B., 2007. Crosstalk among Jak-STAT, Toll-like receptor, and ITAM-dependent pathways in macrophage activation. J. Leukoc Biol. 82, 237–243. Hurley, J.H., Emr, S.D., 2006. The ESCRT complexes: structure and mechanism of a membrane-trafficking network. Annu. Rev. Biophys. Biomol. Struct. 35, 277–298. Katzmann, D.J., Odorizzi, G., Emr, S.D., 2002. Receptor downregulation and multivesicular-body sorting. Nat. Rev. Mol. Cell. Biol. 3, 893–905. Kirkin, V., Dikic, I., 2007. Role of ubiquitin- and Ubl-binding proteins in cell signaling. Curr. Opin. Cell Biol. 19, 199–205. Komada, M., Kitamura, N., 2001. Hrs and hbp: possible regulators of endocytosis and exocytosis. Biochem. Biophys. Res. Commun. 281, 1065–1069. Komada, M., Soriano, P., 1999. Hrs, a FYVE finger protein localized to early endosomes, is implicated in vesicular traffic and required for ventral folding morphogenesis. Genes Dev. 13, 1475–1485. Letournel, F., Bocquet, A., Perrot, R., Dechaume, A., Guinut, F., Eyer, J., Barthelaix, A., 2006. Neurofilament high molecular weight-green fluorescent protein fusion is normally expressed in neurons and transported in axons: a neuronal marker to investigate the biology of neurofilaments. Neuroscience 137, 103–111. Luzio, J.P., Parkinson, M.D., Gray, S.R., Bright, N.A., 2009. The delivery of endocytosed cargo to lysosomes. Biochem. Soc. Trans. 37, 1019–1021. Mizuno, E., Kawahata, K., Kato, M., Kitamura, N., Komada, M., 2003. STAM proteins bind ubiquitinated proteins on the early endosome via the VHS domain and ubiquitin-interacting motif. Mol. Biol. Cell. 14, 3675–3689. Murai, S., Kitamura, N., 2000. Involvement of hrs binding protein in IgE receptortriggered exocytosis in RBL-2H3 mast cells. Biochem. Biophys. Res. Commun. 277, 752–756. Nelson, W.J., Yeaman, C., 2001. Protein trafficking in the exocytic pathway of polarized epithelial cells. Trends. Cell. Biol. 11, 483–486.
Pandey, A., Fernandez, M.M., Steen, H., Blagoev, B., Nielsen, M.M., Roche, S., Mann, M., Lodish, H.F., 2000. Identification of a novel immunoreceptor tyrosine-based activation motif-containing molecule, STAM2, by mass spectrometry and its involvement in growth factor and cytokine receptor signaling pathways. J. Biol. Chem. 275, 38633–38639. Pereira, C., Maamar-Tayeb, M., Burke, A., Perez-Polo, R., Herndon, D.N., Jeschke, M.G., 2006. Immunohistochemical staining of transgenic beta-galactosidase in burned skin is a better indicator of transfection efficiency than histochemical techniques. J. Immunol. Methods 315, 75–79. Piper, R.C., Luzio, J.P., 2007. Ubiquitin-dependent sorting of integral membrane proteins for degradation in lysosomes. Curr. Opin. Cell Biol. 19, 459–465. Raiborg, C., Rusten, T.E., Stenmark, H., 2003. Protein sorting into multivesicular endosomes. Curr. Opin. Cell Biol. 15, 446–455. Raiborg, C., Stenmark, H., 2009. The ESCRT machinery in endosomal sorting of ubiquitylated membrane proteins. Nature 458, 445–452. Ren, X., Kloer, D.P., Kim, Y.C., Ghirlando, R., Saidi, L.F., Hummer, G., Hurley, J.H., 2009. Hybrid structural model of the complete human ESCRT-0 complex. Structure 17, 406–416. Sperk, G., Marksteiner, J., Gruber, B., Bellmann, R., Mahata, M., Ortler, M., 1992. Functional changes in neuropeptide Y- and somatostatin-containing neurons induced by limbic seizures in the rat. Neuroscience 50, 831–846. Takata, H., Kato, M., Denda, K., Kitamura, N., 2000. A hrs binding protein having a Src homology 3 domain is involved in intracellular degradation of growth factors and their receptors. Genes Cells 5, 57–69. Tamai, K., Toyoshima, M., Tanaka, N., Yamamoto, N., Owada, Y., Kiyonari, H., Murata, K., Ueno, Y., Ono, M., Shimosegawa, T., Yaegashi, N., Watanabe, M., Sugamura, K., 2008. Loss of hrs in the central nervous system causes accumulation of ubiquitinated proteins and neurodegeneration. Am. J. Pathol. 173, 1806–1817. Thomas, T., Voss, A.K., Chowdhury, K., Gruss, P., 2000. A new gene trap construct enriching for insertion events near the 50 end of genes. Transgenic Res. 9, 395– 404. Tsujimoto, S., Pelto-Huikko, M., Aitola, M., Meister, B., Vik-Mo, E.O., Davanger, S., Scheller, R.H., Bean, A.J., 1999. The cellular and developmental expression of hrs-2 in rat. Eur. J. Neurosci. 11, 3047–3063. Williams, R.L., Urbé, S., 2007. The emerging shape of the ESCRT machinery. Nat. Rev. Mol. Cell. Biol. 8, 355–368. Yamada, M., Takeshita, T., Miura, S., Murata, K., Kimura, Y., Ishii, N., Nose, M., Sakagami, H., Kondo, H., Tashiro, F., Miyazaki, J., Sasaki, H., Sugamura, K., 2001. Loss of hippocampal CA3 pyramidal neurons in mice lacking STAM1. Mol. Cell. Biol. 21, 3807–3819. Yamada, M., Ishii, N., Asao, H., Murata, K., Kanazawa, C., Sasaki, H., Sugamura, K., 2002. Signal-transducing adaptor molecules STAM1 and STAM2 are required for T-cell development and survival. Mol. Cell Biol. 22, 8648–8658.
Contents lists available at SciVerse ScienceDirect
Gene Expression Patterns journal homepage: www.elsevier.com/locate/gep
Stam2 expression pattern during embryo development Marija C´urlin a,⇑, Katarina Kapuralin a, Andres F. Muro b, Francisco E. Baralle b, Kamal Chowdhury c, Srec´ko Gajovic´ a a
Croatian Institute for Brain Research, School of Medicine, University of Zagreb, Croatia International Centre for Genetic Engineering and Biotechnology, Trieste, Italy c Max Planck Institute of Biophysical Chemistry, Department of Molecular Cell Biology, Goettingen, Germany b
a r t i c l e
i n f o
Article history: Received 13 August 2011 Received in revised form 19 November 2011 Accepted 21 November 2011 Available online 28 November 2011 Keywords: STAM2 Gene trap Mouse Embryo Expression X-gal staining Development
a b s t r a c t STAM2 is a tyrosine-phosphorylated protein suggested to be involved in cargo selection during endocytic pathway, regulation of exocytosis and intracellular signaling. Gene trap method was used to create via insertional mutagenesis a mutant mouse line with integration of promoterless bgeo (lacZ–neomycin phosphotransferase fusion) gene in the second intron of Stam2 gene, enabling analysis of its in vivo expression and function. The inserted b-galactosidase (lacZ) reporter gene was used to reveal Stam2 expression during development. Stam2 in situ RNA hybridization and immunostaining confirmed the observed b-galactosidase activity reflecting high Stam2 expression. The homozygous mutant mice showed no overt phenotypic alterations. Stam2 expression was detected after E9.5 in the gut, notochord, neural tube and heart. In the nervous system it was located in the floor, roof and basal plates of the developing neural tube, and in the developing cortex, hippocampus and olfactory bulbs. Toward the end of gestation, Stam2 expression appeared in the testis and ovary, lungs, nasal cavity epithelium, kidneys, urogenital sinus, intestine, pancreas, pituitary and adrenal glands, muscles, brown adipose tissue, skin and epithelium of the tongue and oral cavity. Ó 2011 Elsevier B.V. All rights reserved.
Proper cellular response in dynamic environment during development requires constant monitoring of the incoming signals, their subsequent processing and appropriate reaction. An important mechanism involved in this task is endocytosis, which through membrane transport regulates the cell sensitivity, modulates the duration of the signal, and assists in its intracellular processing. Molecules on the cell surface together with those from outside could be internalized into early endosomes, and either recycled back to the cell surface or degraded in lysosomes via multivesicular bodies (MVB). The sorting of the right cargo toward these two different pathways is not completely understood, but monoubiquitination and deubiquitination processes could play an important role (Raiborg et al., 2003; Kirkin and Dikic, 2007; Piper and Luzio, 2007). STAM1 and STAM2 (signal transduction adaptor molecules 1 and 2) are considered to be involved in the endosomal sorting of the ubiquitinated cargo proteins for trafficking toward the lysosome (Bache et al., 2003; Mizuno et al., 2003). Together with HRS (hepatocyte growth factor-regulated tyrosine kinase substrate) they form ESCRT-0 complex (Conibear, 2002; Hurley and Emr, ⇑ Corresponding author. Address: Croatian Institute for Brain Research, School of Medicine, University of Zagreb, Salata 12, 10000 Zagreb, Croatia. Tel.: +385 1 4566792; fax: +385 1 4596942. E-mail address: [email protected] (M. C´urlin). 1567-133X/$ - see front matter Ó 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.gep.2011.11.005
2006; Williams and Urbé, 2007; Ren et al., 2009), the first of the four protein complexes referred as ESCRT-0, -I, -II, and -III (i.e. endosomal sorting complexes required for transport). They recognize ubiquitinated membrane proteins and direct them toward the MVB pathway (Katzman et al., 2002; Luzio et al., 2009; Raiborg and Stenmark, 2009). Beside its suggested role in the membrane trafficking during endocytosis, STAM2 is involved in the regulation of exocytosis, as dominant-negative mutants of Stam2 significantly inhibited IgE receptor (FceRI)-triggered secretory response in RBL-2H3 mast cells (Murai and Kitamura, 2000). In addition, STAM2 seems to connect these processes with intracellular signaling. STAM2 is tyrosine-phosphorylated upon stimulation with a variety of cytokines and growth factors (Endo et al., 2000). Through its ITAM (immunoreceptor tyrosine-based activation motif) domain, STAM2 is associated with JAK2 and JAK3 tyrosine kinases, and it is involved in the regulation of intracellular signal transduction for DNA synthesis and c-myc induction mediated by IL-2 and GMCSF (Endo et al., 2000; Pandey et al., 2000; Hu et al., 2007). Loss of function of STAM2 in mouse did not result with any obvious abnormality (Yamada et al., 2002), while loss of STAM1 caused growth retardation in the third week after birth and disappearance of hippocampal CA3 pyramidal neurons (Yamada et al., 2001). Double knockout mice for both Stam1 and Stam2 were lethal by embryonic day 11.5 (E11.5), with a defect in ventral folding
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
morphogenesis (Yamada et al., 2002) implying that STAMs are indispensable for embryo development. To explore the possible function of STAM2 during mouse embryo development and to relate it to the observed embryo lethality, we analyzed in detail its in vivo expression pattern by tagging it endogenously with LacZ reporter via gene trap mutagenesis method. No phenotypic alterations were detected as a consequence of the gene trap mutation. However, the introduced in frame lacZ gene allowed us to analyze the developmental expression of Stam2 demonstrating high Stam2 expression in the heart and nervous tissue, particularly in the differentiating layers of the telencephalic cortex.
69
1.2. b-Galactosidase activity in the developing mutant mouse embryos To determine the expression pattern of Stam2 gene, wholemount histochemical X-gal staining to visualize b-galactosidase activity (i.e. to visualize in-frame-inserted lacZ expression pattern) was performed on the mutant and, as a control, on the wild type mouse embryos from E8.5 to E18.5 (Table 1, Fig. 2). Cryosections of E16.5 embryos were also prepared and stained by X-gal (Fig. 3B). 1.2.1. Stage E8.5 At stage E8.5, no b-galactosidase activity was found. 1.2.2. Stage E9.5 The earliest b-galactosidase activity was detected at E9.5, when it was present in the hindgut (Fig. 2A).
1. Results 1.1. Production and characterization of Stam2Gt1Gaj mouse line Gt1Gaj
The Stam2 mouse was produced using a large-scale gene trap approach (Gajovic´ et al., 1998). Gene trap vector used was pKC199bgeo (Thomas et al., 2000) containing the splice acceptor sequence from mouse Hoxc9 gene located upstream of the promoterless bgeo (fused lacZ and neoR), which generates both b-galactosidase reporter and neomycin resistance activities. The vector was introduced into mouse embryonic stem (ES) cells by electroporation. Chimeric animals were produced from modified ES cell clones, and genes of interest were chosen according to their restricted expression pattern in the developing nervous system at E11.5. The expression was visualized by histochemical detection of b-galactosidase, which was present in the tissue due to the introduced splice acceptor site located upstream of the lacZ gene and subsequent lacZ transcription driven by endogenous promoter of the modified gene. As the integration of gene trap vector into mouse ES cell genome is random, the endogenous gene affected by the gene trap mutation had to be identified. The known sequence of the inserted gene trap vector enabled us to amplify and identify the targeted gene by 50 and 30 RACE (rapid amplification of cDNA ends) methods (Frohman et al., 1988; C´urlin et al., 2002). BLAST search has shown that the obtained cDNA sequence represents an already known gene, referred as Stam2 (Genbank NM019667) or Hbp (Hrs binding protein; Genbank AB012611; Takata et al., 2000). According to the restricted expression pattern in the developing neural tube and heart, the mouse line with modified Stam2 gene was investigated further. Heterozygous carriers of the mutation were crossed to C57Bl/6NCrl mice, currently for 17 generations, in order to obtain a congenic mouse line that differs from the inbred strain only in the modified locus. Sequence analysis of the vector insertion site revealed that it was integrated in the second intron of Stam2 gene (Fig. 1A). Southern blot analysis with a vector specific probe excluded the possibility of multiple gene trap vector insertions and confirmed that the used mouse line contained only specific Stam2 mutation (Fig. 1B). As a consequence of the mutation, 86% of the C-terminal wild type STAM2 protein was expected to be missing from the mutant protein, leaving only 41 N-terminal amino acid residues (of the total of 523 amino acids; the product of the first two of total of 14 exons) fused to b-galactosidase and neomycin phosphotransferase protein encoded by the inserted bgeo gene. The homozygous carriers of the gene trap mutation were produced by intercrossing heterozygous mice. They were identified by Southern blotting with Stam2 specific probe or by PCR (Fig. 1A, C and D). Both heterozygous and homozygous Stam2Gt1Gaj mice carrying the gene trap mutation were born with the expected Mendelian ratio (v2 test p > 0.1), had no macroscopic abnormalities and were viable, fertile and had a normal life span.
1.2.3. Stage E10.5 At E10.5, the X-gal staining was not visible in the gut; however the b-galactosidase activity was present in the heart, where it persisted afterwards throughout gestation (Figs. 2B and C, 3A and B). 1.2.4. Stage E11.5 At E11.5, in addition to the heart, b-galactosidase was detected in the notochord and neural tube (Fig. 2B and D). In the neural tube it was located in the floor plate and its ventral part corresponding to the basal plates (Fig. 2D). 1.2.5. Stage E12.5 The basic pattern of b-galactosidase activity observed at stage E11.5 was slightly modified at stage 12.5 and later. At 12.5 the bgalactosidase activity was present in the heart and neural tube, but disappeared in the notochord. In the neural tube, the expression was present in the basal plates, floor plate and additionally in the roof plate. As a background the newly formed choroid plexus showed diffused positive X-gal staining. This background staining persisted afterwards throughout the gestation. 1.2.6. Stage E13.5 Together with the expression in the heart and developing spinal cord, b-galactosidase activity was detected in the floor plate of the brain stem (medulla oblongata and pons). In the developing spinal cord the expression included not only the floor plate but as well the future raphe region. It was not any more present in the basal plates. Low b-galactosidase activity was detected in the testes. Background X-gal staining appeared in the stomach and intestinal mucosa and continued there until the end of gestation. 1.2.7. Stage E14.5 At E14.5 b-galactosidase activity was present in the developing spinal cord (the floor plate, raphe region, the roof plate and weakly in the gray matter). In the medulla oblongata and pons, the bgalactosidase was present in the floor plate, in the most ventral part of the raphe and in the gray matter (Figs. 2E, 3A). At this stage a b-galactosidase activity appeared in the telencephalon, i.e. in the intermediate zone of the neopallial cortex, olfactory bulbs, trigeminal and dorsal root ganglia, pituitary, lungs, nasal cavity epithelium, pancreas, urogenital sinus, skin and muscles in the head and neck, tongue, back and limbs. The activity in the testes was visible in the future seminiferous tubules. 1.2.8. Stage E15.5 The regions of b-galactosidase activity in E15.5 embryos corresponded to the regions of its activity detected in E14.5 embryos, but the staining was generally stronger. The staining in the heart was more intensive in the atrium than in ventriculum.
70
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
Fig. 1. (A) Schematic diagram of bgeo insertion into intron sequence of Stam2 gene between the second and third exon of Stam2. DNA probes used for the Southern blot experiments and the primers used for the PCR genotyping were indicated. The insertion site between base 30139010 and 30139009 of the chromosome 2 (Genbank NT_039206) is indicated. (B) Insertion of gene trap vector occurred only once in Stam2 gene. Southern blot analysis shows hybridization of genomic DNA with a vector specific bgeo DNA probe. DNA was cut with restriction enzyme BglI. The 2.9 kb signal represents a mutant Stam2 allele, and is visible in homozygous (hm) and heterozygous (ht), but not in the wild type (wt) mice. (C) Southern blot detection of homozygous carriers of gene trap modification of Stam2 gene. Southern blot analysis shows hybridization of genomic DNA with Stam2 DNA probe. Genomic DNA was cut by restriction enzyme SacI. The 3.5 kb signal represents a mutant Stam2 allele (visible in homozygous (hm) and heterozygous (ht) mice) and the 1.4 kb signal represents a wild type allele (visible in heterozygous (ht) and wild type (wt) mice). (D) PCR-detection of homozygous carriers of gene trap modification of Stam2. Six hundred bp product is a result of the wild type DNA amplification using LOB31 and LOB5A primers, while 800 bp product corresponds to mutated allele and it is obtained by LOB31 and lac2 primers.
1.2.9. Stage E16.5 At this stage the b-galactosidase activity appeared in the ventricular and marginal zone and cortical plate of the cortex and in the hippocampus (Figs. 3B, 4A and C). The b-galactosidase activity was intense in the superficial intermediate zone, and weak in the marginal zone. In the roof plate of the developing spinal cord bgalactosidase activity disappeared, but persisted in the floor plate, raphe and gray matter. The staining in the gray matter, raphe and floor plate of the brain stem was extended to the ventral ventricular layer of the fourth ventricle. The b-galactosidase activity continued to be present in the heart (equally in the atrium as in the ventriculum), testes, olfactory bulbs, trigeminal and dorsal root ganglia, pituitary (both adenohypophysis and neurohypophysis), tongue, lungs, nasal cavity epithelium, pancreas, urogenital sinus, skin and muscles and appeared in the mucosa covering the tongue, kidneys, spleen, medulla of the adrenal glands and brown adipose tissue in the back region (Figs. 2J, 3B and C, 4A). 1.2.10. Stage E17.5 At E17.5 the strong b-galactosidase activity in the intermediate zone extended through the subplate zone and included the cortical plate of the telencephalon (Fig. 2F). The recently formed hippocampus showed strong b-galactosidase activity. The activity continued to be present in the raphe, floor plate and gray matter of the developing spinal cord and brain stem, and in the ventral ventricular layer of the fourth ventricle. b-Galactosidase activity was strong in all other b-galactosidase positive regions detected in the E16.5 embryos and was detected also in the ovaries. 1.2.11. Stage E18.5 At E18.5 the b-galactosidase activity occupied the whole region from the intermediate to the marginal zone (Fig. 2G). It disappeared from the raphe region and it was weaker in the floor plate of the developing spinal cord and brain stem, but got stronger in other regions of the nervous system that were positive at E17.5 (i.e. cortex, hippocampus and olfactory bulbs, gray matter of the spinal cord and pons). It got stronger also in the testes, ovaries,
lungs, kidneys, urogenital sinus (bladder), pituitary and adrenal glands (Fig. 2H, I, L and M). Besides skin and tongue mucosa it appeared in the oral cavity mucosa (Fig. 2K). 1.3. b-Galactosidase activity corresponded to Stam2 expression In order to confirm that the observed b-galactosidase activity pattern indeed reflects the endogenous Stam2 expression, in situ RNA hybridization using Stam2 specific probe and X-gal staining were compared on the cryo sections of E16.5 embryos. In situ RNA hybridization on the wild type embryos showed a weak ubiquitous Stam2 expression with distinguished higher expression in the nervous tissue, lungs, heart, digestive and endocrine system (Fig. 3B, Table 2). X-gal staining was more restricted than in situ RNA hybridization (Fig. 3A). The ubiquitous low level of Stam2 mRNA was not visible with X-gal staining, and the areas with high mRNA presence were wider than those outlined by X-gal. For example, a clear laminar distribution of b-galactosidase activity in the brain cortex was visible, while mRNA distribution in the cortex was rather diffused. In situ RNA hybridization revealed high Stam2 expression in the intestine which was undetectable due to the presence of high background by X-gal staining. Also, a weak signal in the area of the choroid plexus indicated Stam2 expression in this structure. The Stam2 expression revealed by X-gal staining matched the regions of high expression of Stam2 mRNA, i.e. it showed more restricted pattern than in situ RNA hybridization. Another verification of observed X-gal staining was obtained by immunohistochemistry using STAM2 and b-galactosidase antibodies on the heterozygous mutant E11.5 and E16.5 embryos. Immunohistochemistry of both antibodies revealed strong fluorescent signal in the Stam2 expressing regions identified by X-gal staining (Table 2). However, both were less restricted than X-gal staining, i.e. they demonstrated weak ubiquitous signal that was not visible by X-gal staining. As well as b-galactosidase activity, the STAM2 and b-galactosidase immunostainings were strong in the superficial intermediate zone of the telencephalic cortex in E16.5 embryos, but also were present throughout the cortex in the ventricular and
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
71
Table 1 Regional distribution of Stam2 expression assessed by X-gal staining. Only tissues and organs showing lacZ expression are outlined. b – Background staining; ‘‘’’ – no signal; ‘‘/ +’’, ‘‘+’’, ‘‘++’’ and ‘‘+++’’ – arbitrary estimated intensities of signal strength. Embryonic day
E9.5
E10.5
Notochord Nervous system Spinal cord (roof plate) Spinal cord (basal plates) Spinal cord (floor plate) Spinal cord (raphe) Spinal cord (gray matter) Oblongata, pons (floor plate) Oblongata, pons (raphe) Oblongata, pons (gray matter) Cortex (ventricular zone) Cortex (intermediate zone) Cortex (cortical plate) Cortex (marginal zone) Hippocampus Olfactory bulbs Trigeminal ganglia Dorsal root ganglia Choroid plexus Heart Atrium Ventriculum Spleen Lungs Nasal cavity mucosa Digestive system Hindgut Intestine and stomach Oral cavity mucosa Tongue Pancreas Urogenital system Kidneys Urogenital sinus Phalus
E11.5
E12.5
E13.5
E14.5
E15.5
E16.5
E17.5
E18.5
+ /+ +
+ + +
+
+ + + /+ + + /+ +
+ + + + + + + +
+ /+ /+ b
+ + + b
+ + + + + + /+ ++ /+ /+ /+ + + + b
+ + + + /+ + /+ + + + + + + + b
/+ + /+ + + + ++ + + + + + b
++ + /+ + +
++ + /+ + +
+
+ +
+ +
+ +
+ +
+ +
+ +
++ +
/+ /+
+ +
++ + /+ + +
+
b
b + /+
b + /+
b ++ +
b ++ +
b + ++ +
/+
+
/+ + +
+ + +
+ + +
/+
+
+
++
+
+
/+
+
+ + +++ ++ /+ +
+ + +++ + ++ /+ +
+ + +++ + ++ /+ +
Endocrine system Pituitary Adrenal glands (medulla) Testes Ovaries Skin Brown adipose tissue Muscles
intermediate zones (Fig. 3C and D). Similarly, the STAM2 and bgalactosidase immunostainings were strong in the ventral part of the neural tube of E11.5 embryos but also were present throughout the whole section of the neural tube. Other organs and tissues did not show significant difference between strong fluorescence signals and X-gal staining. The colocalization immunohistochemistry study of STAM2 protein and b-galactosidase revealed STAM2 and b-galactosidase in the same tissues and cells, but the intracellular distribution of those proteins was different. STAM2 was present in the cell bodies and cell processes, but the signal was very intense in punctuate structures in the cytoplasm and in some cells in the nucleus (Fig. 3E). The immunohistochemical signal of b-galactosidase was homogenous throughout the cytoplasm and it was not present in the nucleus. Tiny dots representing accumulations of b-galactosidase were visible in some cells as documented previously (Eyer and Peterson, 1994; Letournel et al., 2006).
2. Discussion The present study represents the first comprehensive mapping of Stam2 expression during mouse embryo development. X-gal
+
histochemistry of the molecularly tagged Stam2 gene in the Stam2Gt1Gaj mouse line allowed analysis of Stam2 expression pattern in the embryos. The location of gene trap vector within Stam2 gene was confirmed by Southern blot and PCR analyses (Fig. 1B), and the observed lacZ expression pattern was additionally verified by in situ RNA hybridization and immunohistochemistry (Fig. 3). In situ RNA hybridization and immunohistochemistry revealed two levels of Stam2 expression: low and ubiquitous vs. high and specific. Regions with strong signal observed by in situ RNA hybridization and immunohistochemistry overlapped the regions that showed b-galactosidase activity. The lower sensitivity of X-gal histochemistry was expected due to different detection levels of the three methods used (mRNA, protein, and enzyme activity). It has been shown that X-gal histochemistry underestimates the extent of gene expression while immunohistochemistry has the superior sensitivity (Pereira et al., 2006; Couegnas et al., 2007). In addition, the lower intensity of the X-gal staining could be due to possible instability of the mutant protein. Still identifying the regions with high levels of Stam2 expression by X-gal staining could be not considered a disadvantage, as it reveals restricted positive areas most relevant for the STAM2 function research.
72
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
Fig. 2. Visualization of b-galactosidase activity in the representative heterozygous mouse embryos by histochemical staining with X-gal. (A and B) Lateral views of E9.5 and E11.5 embryos, respectively, (C) the developing heart of E11.5 embryo, (D) cross section of the neural tube of E11.5 embryo, (E) sagital section of E14.5 embryo head, (F) sagital section of E17.5 embryo telencephalon, (G) transversal section of E18.5 brain, (H) the testis, and (I) the ovary at E18.5, (J) cryo section of the skin at E16.5, (K) the tongue and oral cavity epithelia at E18.5, (L) the pituitary, and (M) the adrenal gland at E18.5. AH – adenohypophysis, C – cortex, CP – cortical plate, FP – floor plate, H – heart, HC – hippocampus, HG – hindgut, IZ – intermediate zone, MA – medulla of adrenal gland, MO – medulla oblongata, NT – neural tube, N – notochord, NH – neurohypophysis, OCE – oral cavity epithelium, P – pons, SC – spinal cord, TE – tongue epithelium, TS – seminiferous tubules. White bars – 1 mm; black bars – 0.1 mm.
The endocytic pathway can be important for the embryonic development in several ways, but the most intriguing is the establishment of the gradient of morphogens via planar transcytosis, and their subsequent selective uptake and degradation. The candidate regions for these processes correspond to the regions of Stam2 expression and include the notochord, floor plate and roof plate of the neural tube, telencephalic cortex, hippocampus and the heart. STAM2 was as well suggested to participate in exocytic extrusion of synaptic and other secretory granules (Murai and Kitamura, 2000; Komada and Kitamura, 2001). One of the regions of Stam2 expression was the nervous tissue and the endocrine organs like pituitary and adrenal glands near the end of gestation, all of them at this stage already highly secretory active. Other regions of expression are polarized epithelial tissues in the skin, tongue and oral cavity, where sorting and correct delivery of the proteins to different membrane domains depends on accurate vesicle trafficking and sorting (Nelson and Yeaman, 2001; Altschuler et al., 2003).
In addition, Stam2 showed an intriguing strong and specific expression pattern in the cortex of the telencephalon (neopallial cortex). An appearance of strong Stam2 expression in the intermediate zone at the time of the cortex differentiation and zone stratification and further spreading of the expression into the cortical plate during the intensive neural migration and cortical layers formation indicate a possible Stam2 function in the processes of the cortex differentiation comprising complex cell specifications. When compared to other members of the ESCRT-0 complex, Hrs and STAM1, the observed Stam2 expression was more restricted than Hrs expression in mouse and rat embryos (Avantaggiato et al., 1995; Komada and Soriano, 1999; Tsujimoto et al., 1999; Yamada et al., 2001; Tamai et al., 2008). Furthermore, a comparison of our study on Stam2 and published data on Stam1 expression (Yamada et al., 2001) reveals that Stam2 and Stam1 mRNA distributions overlap. On the other hand our b-galactosidase activity study showed that Stam2 is expressed in the organs where Stam1 expression was
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
73
Fig. 3. Visualization of b-galactosidase activity in the representative cryosections of homozygous mouse embryos by histochemical staining with X-gal. Bar (the same for A, B and C) – 1 mm. (A) b-Galactosidase activity on the sagital cryosection of E14.5 embryo. (B) b-Galactosidase activity on the sagital cryosection of E16.5 embryo. (C) bGalactosidase activity on the transversal cryosections of E16.5 embryo. The locations of the sections are indicated by horizontal arrows in the B. IZ – intermediate zone of the neopallial cortex, P – pituitary, TG – grigeminal ganglion, MO – medulla oblongata, SC – spinal cord, DRG – dorsal root ganglion, T – tongue, M – skeletal muscles, BA – brown adipose tissue, Ht A – heart atrium, Ht V – heart ventriculum, N – nasal cavity mucosa, Lu – lungs, L – liver, G – gut, K – kidney, S – spleen, Pa – pancreas, US – urogenital sinus, Ph – phalus.
not reported: skin, oral and nasal cavity mucosa, urogenital sinus, pancreas, muscles, testis, ovary, adrenal glands and pituitary. Expression in the nasal cavity mucosa and olfactory bulbs is in accordance to the described Stam2 expression in the olfactory system in ˇ unko et al., 2008). adult mice (Furic´ C The insertion of the pKC199bgeo vector into the second intron of Stam2 gene was expected to impair its function. However, as mentioned above, no overt phenotype was detectable in the homozygotes. Similar result was also reported in the case of the complete loss of STAM2 function in homozygous mouse mutants generated by gene targeting mutagenesis (Yamada et al., 2002). The embryonic lethality of Stam1 and Stam2 double knockout indeed confirms that STAMs are important for the embryonic development. One of the reasons that the loss of STAM2 during development was not accompanied with phenotypic changes could be the compensation of its loss by STAM1. Although current data show differences in their expression pattern, they do posses several overlapping expression domains. Our data actually suggest for Stam2 two different expression levels, one low which could be detected as a low signal by in situ RNA hybridization and immunohistochemistry. This differs to stronger level of expression which was clearly detected by all three methods. If the same is valid for Stam1, we could speculate that these low levels of expression could help to compensate loss of either STAM1 or STAM2 in case of their individual loss of function, but in case of double loss of function, their importance for development is revealed and results with embryo lethality.
analyzes of the functional roles of the STAM proteins during development.
4. Experimental procedures 4.1. Animals This study was performed on heterozygous E9.5–E18.5 embryos from the gene trap mouse line Stam2Gt1Gaj and wild type inbred strain C57Bl/6NCrl. Gene trap vector pKC199bgeo, containing splice acceptor of Hoxc9 gene in frame with bgeo (lacZ/neomycin phosphotransferase fusion gene) upstream to the SV40 polyadenylation signal (Thomas et al., 2000), was used for transformation of ES cells by electroporation. After selection for 10 days by 250 mg/ml G418 (GIBCO BRL, Gaithersburg, MD), resistant clones were isolated and stained with X-gal for the presence of b-galactosidase. The positive clones were expanded; the chimeras were generated by morula aggregation and germ line transmission achieved by mating them with C57Bl/6 mice. The mouse line Stam2Gt1Gaj was selected for further investigation and kept as heterozygous through subsequent breeding with C57Bl/6NCrl mice. Homozygous animals of Stam2Gt1Gaj line were obtained by intercrossing of heterozygotes. All the experiments were approved by institutional Ethical Committee and were in agreement with the Croatian Society for Laboratory Animal Science and the International Council for Laboratory Animal Science.
3. Conclusions 4.2. Sequence determination of the trapped gene In conclusion, we provide new data revealing that the main regions of Stam2 expression during development are confined to the developing nervous system, heart, lungs, skin, tongue, oral cavity epithelia, intestine, pancreas, kidney, urogenital sinus, phalus, testis, ovary, pituitary and adrenal glands, muscles, and brown adipose tissue. These data provide additional information for further
The sequence of the trapped gene was obtained by 50 and 30 RACE (Frohman et al., 1988; C´urlin et al., 2002). The obtained sequence was compared to the known cDNA sequences by BLAST search at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov).
74
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
Fig. 4. Stam2 expression in E11.5 and E16.5 embryos detected by in situ RNA hybridization and immunohistochemistry confirmed the expression pattern obtained by X-gal staining. (A) b-Galactosidase activity on the cryosection of E16.5 embryo. (B) Stam2 in situ RNA hybridization on E16.5 embryos. Left – antisense (AS) Stam2 specific probe, right – sense (S) Stam2 specific probe, as negative control. Bars in (A) and (B) – 1 mm. (C) b-Galactosidase activity on the sagital section of the telencephalic cortex of E16.5 embryo, (D) STAM2 and b-galactosidase immunohistochemistry of the sagital section of the telecenphalic cortex of E16.5 embryo. Bars in (C) and (D) – 0.1 mm. (E) STAM2 and b-galactosidase immunohistochemistry colocalisation in the ventral part of the neural tube of E11.5 embryo, bar – 10 lm. Ct – neopallial cortex, P – pituitary, SC – spinal cord, DRG – dorsal root ganglion, NA – cartilage primordia of neural arches, T – tongue, M – skeletal muscles, Ht V – heart ventriculum, Ht A – heart atrium, Lu – lungs, L – liver, G – gut, K – kidney, AR – adrenal gland, MZ – marginal zone, CP – cortical plate, IZ – intermediate zone, VZ – ventricular zone.
4.3. Southern blotting and PCR DNA for Southern blot analysis was isolated from the adult liver mouse tissue and cut by restriction enzymes BglI or SacI (Promega). The digoxygenin (DIG-dUTP, Boehringer Mannheim) labeled DNA probes were produced by PCR using bgeo specific primers (50 TTGGCGTAAGTGAAGCGAC30 and 50 AGCGGCTGATGTTGAACTG30 ) and Stam2 gene specific primers (50 TGACAGGGTTGGAAGCACTC30 and 50 ATAAAGCTCTGACTCTCCG30 ). Both, bgeo and Stam2 DNA probes were approximately 500 bp long. The detection of the template – probe hybrids was performed using a chemiluminescence substrate ‘‘CDP Star’’ (Boehringer Mannheim). For PCR genomic DNA was isolated from the tail tips and three primers used for
genotyping were LOB31 (50 GCTTTACAGTGGGGATACAT30 ), LOB5A (50 TTATGGCTTTTAGGCAATCT30 ) and lac2 (50 CTGCAAGGCGATTAA GTTGG30 ). 4.4. Detection of b-galactosidase activity 4.4.1. Whole mount staining The heterozygous and wild type (negative control) embryos were obtained by mating heterozygous mutant males with females of C57Bl/6 strain. The morning of the vaginal plug was taken as stage E0.5. The isolated embryos were fixed in a mixture of 2% formaldehyde and 0.2% glutaraldehyde (Sigma) in phosphate buffered saline (PBS) for 1 h either as whole embryos (E8.5–E12.5) or cut
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C Table 2 Stam2 expressing regions identified by X-gal staining were confirmed by in situ RNA hybridization and immunohistochemistry. b – Background staining; ‘‘’’ – no signal; ‘‘/+’’, ‘‘+’’, ‘‘++’’ and ‘‘+++’’ – arbitrary estimated intensities of signal strength. Embryonic day
E11.5 IHC +
X-gal
ISH
IHC
Notochord
X-gal + + +
+ ++ +++
+ + + + + + /+ ++ /+ + /+ + +
+ + + + + + + + + ++ + + + + +
/+ /+ + + + + + + + +++ /+ + + + +
++ + + +
+ + + +
++ + + +
Digestive system Intestine and stomach Oral cavity mucosa Tongue Kidneys Urogenital sinus
b ++ + +
+ /+ + +
+ /+ + + +
Endocrine system Pituitary Testes Skin Muscles
+ +++ ++ +
+ + ++ +
+ + ++ +
Nervous system Spinal cord (roof plate) Spinal cord (basal plates) Spinal cord (floor plate) Spinal cord (raphe) Spinal cord (gray matter) Oblongata, pons (floor plate) Oblongata, pons (raphe) Oblongata, pons (gray matter) Cortex (ventricular zone) Cortex (intermediate zone) Cortex (cortical plate) Cortex (marginal zone) Hippocampus Olfactory bulbs Trigeminal ganglia Heart Atrium Ventriculum Lungs Nasal cavity mucosa
+ +
E16.5
+ +
sagitally or transversally (E13.5 and later). After fixation they were rinsed three times in PBS, and incubated overnight at 37 °C in the Xgal solution (1 mg/ml X-gal, 10 mM K3Fe(CN)6, 10 mM K4Fe(CN)6, and 2 mM MgCl2 in PBS), washed in PBS for 24 h and cleared in ascending concentrations of glycerol in PBS up to 70%. 4.4.2. Cryosection staining The homozygous and wild type embryos were obtained by mating heterozygous female with heterozygous male mouse. The genotype of the embryos was determined by PCR with DNA isolated from the embryonic tail. The isolated embryos were fixed for 1 h in a mixture of 2% formaldehyde and 0.2% glutaraldehyde (Sigma) in phosphate buffered saline (PBS), washed two times in the PBS and frozen to 80 °C by 1 min immersion in the prefreezed isopentane. The selected embryos were cut on a cryostat (Leica CM3000, Leica Instruments GmbH, Germany) into 40–50 lm thick sections, mounted on the glass slides, air-dried for 1–3 h, washed two times in PBS, incubated in the X-gal solution overnight at 37 °C. The stained sections were washed in PBS, dehydrated in ascending concentration of ethanol, cleared in Histo-Clear (National Diagnostics, USA) and covered with coverslips using mounting agent Histomount (National Diagnostics, USA). The micrographs of the sections were taken by computer scanning (EPSON EFFECTION 4870 PHOTO). 4.5. In situ hybridization In situ RNA hybridization for Stam2 gene was performed by a modified method described previously (Sperk et al., 1992). DNA
75
oligonucleotides complementary to mouse Stam2 gene (50 GGATGACAGTGACGCCAACTGGTGGCAAGGAGAAAATCACAGAGG30 ) were labeled with [35S] thio-dATP (Perkin–Elmer) using terminal deoxynucleotidyltransferase (Roche). Unfixed frozen mouse embryos at E16.5 were cut on a cryostat (Leica CM3000, Leica Instruments GmbH, Germany) into 20 lm thick sections and thaw-mounted on poly-L-lysine coated slides (Menzel–Glaser). After fixation by immersion in 2% paraformaldehyde, sections were rinsed in 0.1 M PBS (pH 7.4) and were acetylated with 0.25% acetic anhydride in triethanolamine (pH 8.2). The sections were further rehydrated in ascending series of alcohol. Hybridization was performed overnight at 53 °C in the hybridization buffer supplemented with dextran sulfate, dithiothreitol (Sigma), and the 35S labeled oligonucleotide probe. Next day the sections were washed with sodium citrate buffer at 60 °C and dipped in 70% ethanol. The sections were further exposed to Kodak BioMax MR Film for 2 weeks at room temperature. 4.6. Immunohistochemistry Two different stages of embryos were used for immunohistochemical analysis (E11.5 and E16.5). Whole embryos were fixed by immersion in 4% paraformaldehyde (Sigma) at 4 °C overnight. Embryos were rinsed in PBS and then transferred to 10% sucrose followed by 30% sucrose in PBS at 4 °C. Sagital sections were cut on a cryostat at 20 °C. Thickness of the sections was 30 lm for 16.5 day-old embryos and 40 lm for 11.5 day-old embryos. Sections were mounted on SuperFrost microscope slides (Menzel– Glaser). Section were further incubated with primary antibodies against STAM2 (Rabbit polyclonal, diluted 1:50, Abcam, ab63372) and bgalactosidase (Chicken polyclonal, diluted 1:50, Abcam, ab9361) at 4 °C overnight. Primary antibodies were diluted in PBS containing 0.2% Triton X-100 and 2% goat serum. Fluorescent secondary antibody incubation was carried out for 2.5 h at room temperature. The secondary antibodies were: Alexa Fluor 488 goat anti-rabbit (Invitrogen, A11008) and Alexa Fluor 546 goat anti-chicken (Invitrogen, A11040). All secondary antibodies were diluted in a PBS at a concentration 1:200. Sections were rinsed in PBS and coverslipped using Fluoromount (Sigma–Aldrich) mounting media. Fluorescent labeling was viewed using a confocal microscope Zeiss LSM 510 Meta. Acknowledgments This work was supported by Grants of Ministry of Science and Technology, Republic of Croatia (108-1081870-1902), and Unity for Knowledge Fund, Republic of Croatia (UKF 35/08). The production of the gene trap mutant mouse line was supported by the Max Planck Society, Germany. References Altschuler, Y., Hodson, C., Milgram, S.L., 2003. The apical compartment: trafficking pathways, regulators and scaffolding proteins. Curr. Opin. Cell Biol. 15, 423– 429. Avantaggiato, V., Torino, A., Wong, W.T., Di Fiore, P.P., Simeone, A., 1995. Expression of the receptor tyrosine kinase substrate genes eps8 and eps15 during mouse development. Oncogene 11, 1191–1198. Bache, K.G., Raiborg, C., Mehlum, A., Stenmark, H., 2003. STAM and Hrs are subunits of a multivalent ubiquitin-binding complex on early endosomes. J. Biol. Chem. 278, 12513–12521. Conibear, E., 2002. An ESCRT into the endosome. Mol. Cell. 10, 215–216. Couegnas, A., Schweitzer, A., Andrieux, A., Ghandour, M.S., Boehm, N., 2007. Expression pattern of STOP lacZ reporter gene in adult and developing mouse brain. J. Neurosci. Res. 85, 1515–1527. C´urlin, M., Kostovic´-Knezˇevic´, L., Gajovic´, S., 2002. Gene trap mutagenesis of three genes expressed during mouse embryo development. Periodicum. Biologorum. 104, 47–54.
76
´ urlin et al. / Gene Expression Patterns 12 (2012) 68–76 M. C
Endo, K., Takeshita, T., Kasai, H., Sasaki, Y., Tanaka, N., Asao, H., Kikuchi, K., Yamada, M., Chenb, M., O’Shea, J.J., Sugamura, K., 2000. STAM2, a new member of the STAM family, binding to the Janus kinases. FEBS Lett. 477, 55–61. Eyer, J., Peterson, A., 1994. Neurofilament-deficient axons and perikaryal aggregates in viable transgenic mice expressing a neurofilament-beta-galactosidase fusion protein. Neuron 12, 389–405. Frohman, M.A., Dush, M.K., Martin, G.R., 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998–9002. Furic´ Cˇunko, V., Mitrecˇic´, D., Mavric´, S., Gajovic´, S., 2008. Expression pattern and functional analysis of mouse Stam2 in the olfactory system. Coll. Antropol. 1 (Suppl. 32), 59–63. Gajovic´, S., Chowdhury, K., Gruss, P., 1998. Genes expressed after retinoic acidmediated differentiation of embryoid bodies are likely to be expressed during embryo development. Exp. Cell. Res. 242, 138–143. Hu, X., Chen, J., Wang, L., Ivashkiv, L.B., 2007. Crosstalk among Jak-STAT, Toll-like receptor, and ITAM-dependent pathways in macrophage activation. J. Leukoc Biol. 82, 237–243. Hurley, J.H., Emr, S.D., 2006. The ESCRT complexes: structure and mechanism of a membrane-trafficking network. Annu. Rev. Biophys. Biomol. Struct. 35, 277–298. Katzmann, D.J., Odorizzi, G., Emr, S.D., 2002. Receptor downregulation and multivesicular-body sorting. Nat. Rev. Mol. Cell. Biol. 3, 893–905. Kirkin, V., Dikic, I., 2007. Role of ubiquitin- and Ubl-binding proteins in cell signaling. Curr. Opin. Cell Biol. 19, 199–205. Komada, M., Kitamura, N., 2001. Hrs and hbp: possible regulators of endocytosis and exocytosis. Biochem. Biophys. Res. Commun. 281, 1065–1069. Komada, M., Soriano, P., 1999. Hrs, a FYVE finger protein localized to early endosomes, is implicated in vesicular traffic and required for ventral folding morphogenesis. Genes Dev. 13, 1475–1485. Letournel, F., Bocquet, A., Perrot, R., Dechaume, A., Guinut, F., Eyer, J., Barthelaix, A., 2006. Neurofilament high molecular weight-green fluorescent protein fusion is normally expressed in neurons and transported in axons: a neuronal marker to investigate the biology of neurofilaments. Neuroscience 137, 103–111. Luzio, J.P., Parkinson, M.D., Gray, S.R., Bright, N.A., 2009. The delivery of endocytosed cargo to lysosomes. Biochem. Soc. Trans. 37, 1019–1021. Mizuno, E., Kawahata, K., Kato, M., Kitamura, N., Komada, M., 2003. STAM proteins bind ubiquitinated proteins on the early endosome via the VHS domain and ubiquitin-interacting motif. Mol. Biol. Cell. 14, 3675–3689. Murai, S., Kitamura, N., 2000. Involvement of hrs binding protein in IgE receptortriggered exocytosis in RBL-2H3 mast cells. Biochem. Biophys. Res. Commun. 277, 752–756. Nelson, W.J., Yeaman, C., 2001. Protein trafficking in the exocytic pathway of polarized epithelial cells. Trends. Cell. Biol. 11, 483–486.
Pandey, A., Fernandez, M.M., Steen, H., Blagoev, B., Nielsen, M.M., Roche, S., Mann, M., Lodish, H.F., 2000. Identification of a novel immunoreceptor tyrosine-based activation motif-containing molecule, STAM2, by mass spectrometry and its involvement in growth factor and cytokine receptor signaling pathways. J. Biol. Chem. 275, 38633–38639. Pereira, C., Maamar-Tayeb, M., Burke, A., Perez-Polo, R., Herndon, D.N., Jeschke, M.G., 2006. Immunohistochemical staining of transgenic beta-galactosidase in burned skin is a better indicator of transfection efficiency than histochemical techniques. J. Immunol. Methods 315, 75–79. Piper, R.C., Luzio, J.P., 2007. Ubiquitin-dependent sorting of integral membrane proteins for degradation in lysosomes. Curr. Opin. Cell Biol. 19, 459–465. Raiborg, C., Rusten, T.E., Stenmark, H., 2003. Protein sorting into multivesicular endosomes. Curr. Opin. Cell Biol. 15, 446–455. Raiborg, C., Stenmark, H., 2009. The ESCRT machinery in endosomal sorting of ubiquitylated membrane proteins. Nature 458, 445–452. Ren, X., Kloer, D.P., Kim, Y.C., Ghirlando, R., Saidi, L.F., Hummer, G., Hurley, J.H., 2009. Hybrid structural model of the complete human ESCRT-0 complex. Structure 17, 406–416. Sperk, G., Marksteiner, J., Gruber, B., Bellmann, R., Mahata, M., Ortler, M., 1992. Functional changes in neuropeptide Y- and somatostatin-containing neurons induced by limbic seizures in the rat. Neuroscience 50, 831–846. Takata, H., Kato, M., Denda, K., Kitamura, N., 2000. A hrs binding protein having a Src homology 3 domain is involved in intracellular degradation of growth factors and their receptors. Genes Cells 5, 57–69. Tamai, K., Toyoshima, M., Tanaka, N., Yamamoto, N., Owada, Y., Kiyonari, H., Murata, K., Ueno, Y., Ono, M., Shimosegawa, T., Yaegashi, N., Watanabe, M., Sugamura, K., 2008. Loss of hrs in the central nervous system causes accumulation of ubiquitinated proteins and neurodegeneration. Am. J. Pathol. 173, 1806–1817. Thomas, T., Voss, A.K., Chowdhury, K., Gruss, P., 2000. A new gene trap construct enriching for insertion events near the 50 end of genes. Transgenic Res. 9, 395– 404. Tsujimoto, S., Pelto-Huikko, M., Aitola, M., Meister, B., Vik-Mo, E.O., Davanger, S., Scheller, R.H., Bean, A.J., 1999. The cellular and developmental expression of hrs-2 in rat. Eur. J. Neurosci. 11, 3047–3063. Williams, R.L., Urbé, S., 2007. The emerging shape of the ESCRT machinery. Nat. Rev. Mol. Cell. Biol. 8, 355–368. Yamada, M., Takeshita, T., Miura, S., Murata, K., Kimura, Y., Ishii, N., Nose, M., Sakagami, H., Kondo, H., Tashiro, F., Miyazaki, J., Sasaki, H., Sugamura, K., 2001. Loss of hippocampal CA3 pyramidal neurons in mice lacking STAM1. Mol. Cell. Biol. 21, 3807–3819. Yamada, M., Ishii, N., Asao, H., Murata, K., Kanazawa, C., Sasaki, H., Sugamura, K., 2002. Signal-transducing adaptor molecules STAM1 and STAM2 are required for T-cell development and survival. Mol. Cell Biol. 22, 8648–8658.