- Email: [email protected]
Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression
BBAPAP-39470; No. of pages: 9; 4C: 5, 6, 7, 8 Biochimica et Biophysica Acta xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbapap
F
O
4
Sang-su Na a,b, Mark Borris Aldonza a, Hye-Jin Sung a, Yong-In Kim a, Yeon Sung Son a, Sukki Cho c, Je-Yoel Cho a,⁎
5Q5 6 7 8
a
9
a r t i c l e
10 11 12 13 14
Article history: Received 12 July 2014 Received in revised form 29 October 2014 Accepted 5 November 2014 Available online xxxx
15 16 17 18 19
Keywords: Lung cancer Stanniocalcin 2 Metastasis Biomarkers
Department of Biochemistry, BK21 PLUS Program for Creative Veterinary Science Research and Research Institute for Veterinary Science, College of Veterinary Medicine, Seoul National University, Republic of Korea b Department of Physical Therapy, College of Rehabilitation, Daegu University, Daegu, Republic of Korea c Department of Thoracic and Cardiovascular Surgery, Seoul National University Bundang Hospital, Seoungnam-si, Gyeonggi-do, Republic of Korea
i n f o
R O
3Q4
a b s t r a c t
P
2
Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression☆
The homodimeric glycoprotein, stanniocalcin 2 (STC2) is previously known to be involved in the regulation of calcium and phosphate transport in the kidney and also reported to play multiple roles in several cancers. However, its function and clinical significance in lung cancer have never been reported and still remain uncertain. Here, we investigated the possibility of STC2 as a lung cancer biomarker and identified its potential role in lung cancer cell growth, metastasis and progression. Proteomic analysis of secretome of primary cultured lung cancer cells revealed higher expression of STC2 in cancers compared to that of adjacent normal cells. RT-PCR and Western blot analyses showed higher mRNA and protein expressions of STC2 in lung cancer tissues compared to the adjacent normal tissues. Knockdown of STC2 in H460 lung cancer cells slowed down cell growth progression and colony formation. Further analysis revealed suppression of migration, invasion and delayed G0/G1 cell cycle progression in the STC2 knockdown cells. STC2 knockdown also attenuated the H202-induced oxidative stress on H460 cell viability with a subsequent increase in intracellular ROS levels, which suggest a protective role of STC2 in redox regulatory system of lung cancer. These findings suggest that STC2 can be a potential lung cancer biomarker and plays a positive role in lung cancer metastasis and progression. This article is part of a Special Issue entitled: Medical Proteomics. © 2014 Published by Elsevier B.V.
38 36 35
R
37
1. Introduction
40
Lung cancer is the most common cause of cancer-related deaths worldwide. Despite advances in diagnostics and therapeutics of lung cancer, a 5-year survival rate is still reaching only about 15% [1]. Lung cancer patients are frequently diagnosed in an advanced stage, which makes them suffer in metastatically advanced diseases, resulting in almost 90% death rate due to undetected metastasis progression. Therefore early diagnosis could be another best way for patient's recovery [2]. Unfortunately, most of the current medical standard tumor markers lack sensitivity and specificity for the detection of lung cancer. Historically, radiography and sputum cytology were used for early detection of lung cancer. For the advances of the diagnostic methods, molecular based diagnostics have been studied and proposed by many groups. Proteomic or genomic approach for novel biomarker discovery based on profiling
45 46 47 48 49 50 51 52
U
43 44
N C O
39
41 42
20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
R
E
C
T
E
D
Q31Q2
☆ This article is part of a Special Issue entitled: Medical Proteomics. ⁎ Corresponding author at: Department of Biochemistry, College of Veterinary Medicine, Seoul National University, Daehak-dong, Gwanak-gu, Seoul 151-742, Republic of Korea. Tel.: +82 2 880 1268; fax: +82 2 886 1268. E-mail address: [email protected] (J.-Y. Cho).
differentially expressed proteins or genes has been used for biomarker studies [3]. Due to the advances in techniques of proteomic profiling, the ability to approach secreted proteins in extracellular space and secretome analysis to find new biomarkers has been made possible [4,5]. Although great advancements have been made in proteomic technologies to discover novel biomarkers, the molecular and biochemical mechanism studies of the markers in lung cancer metastasis and progression still require much attention. Stanniocalcin-2 (STC2) is a glycoprotein hormone first known to be involved in calcium and phosphate homeostasis. STC2, originally discovered in fish endocrine gland and corpuscles of Stannius and is known to regulate Ca2+ homeostasis in adult fish by regulating the inhibition of branchial/intestinal Ca2 + uptake and renal Pi exception [6–8]. In the mammalian systems, STC2 is known to be involved in the anti-apoptotic regulatory signaling pathways in endoplasmic reticulum (ER). It is associated with hypoxic stress and known to be regulated by PERK-ATF4 and HIF-1 [9,10]. In some tissues, STC2 is widely expressed and the correlation between STC2 and metastatic cancers has been reported. Previous studies showed that STC2 is overexpressed in several cancer types with poor prognosis [9,11,12]. However, its clinical significance and molecular mechanism in carcinogenesis still remain
http://dx.doi.org/10.1016/j.bbapap.2014.11.002 1570-9639/© 2014 Published by Elsevier B.V.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73
79
2. Materials and methods
80
2.1. Clinical tissue samples and cell lines
81 82
85
A total of 53 tissue samples of lung cancer patients with adenocarcinoma and squamous cell carcinoma were obtained during surgery. These samples were obtained and used in accordance with the institutional ethical guidelines of Seoul National University Bundang Hospital (IRB No. B-1201/143-003) after securing written informed consent. All
t1:1 t1:2
Table 1 Tissue sample information.
76 77
83 84
clinical samples were selected and categorized randomly from a large sample set collected from the affiliate hospital. All patients underwent resection of the primary tumors at Seoul National University Bundang Hospital, Seoul, Korea. All patients were authoritatively identified as having lung cancer based on the clinic-pathological information of the patients from their clinical records (Table 1). Preoperative chemotherapy was not conducted on all patients from where the clinical samples were obtained. Resected and paired tissues were immediately cut and frozen in liquid nitrogen and kept at −80 °C until RNA extraction and complimentary DNA (cDNA) was synthesized as previously described [13]. The human lung cancer cell line, H460 were obtained from the American Type Culture Collection (ATCC) and were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 100 IU/ml penicillin and 100 IU streptomycin antibiotics. The cells were incubated at 37 °C and 5% CO2 in a humidified atmosphere.
O
78
controversial and need to be fully elucidated. Moreover, its involvement and role in lung cancer have not yet been elucidated. In the present study, we sought to investigate STC2 as a potential novel biomarker for lung cancer and identify its putative role in lung cancer cell growth, progression and metastasis.
R O
74 75
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
F
2
Sample no.
Age
Sex
Smoking
Type
TNM
Stage
WB grade
Recurrence
Recurrence free period (month)
t1:4 Q1 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10 t1:11 t1:12 t1:13 t1:14 t1:15 t1:16 t1:17 t1:18 t1:19 t1:20 t1:21 t1:22 t1:23 t1:24 t1:25 t1:26 t1:27 t1:28 t1:29 t1:30 t1:31 t1:32 t1:33 t1:34 t1:35 t1:36 t1:37 t1:38 t1:39 t1:40 t1:41 t1:42 t1:43 t1:44 t1:45 t1:46 t1:47 t1:48 t1:49 t1:50 t1:51 t1:52 t1:53 t1:54 t1:55 t1:56
800 817 826 982 862 923 927 932 936 940 857 877 912 953 956 959 969 971 941 942 992 993 996 999 1003 1009 815 866 851 889 899 831 915 894 888 983 986 880 870 943 794 881 882 937 887 863 839 836 984 1000 1007 917 828
22 63 52 70 70 51 84 69 56 69 75 76 60 53 35 55 76 69 68 51 84 38 64 66 72 78 48 77 65 67 72 71 57 70 68 60 67 56 72 66 75 67 45 64 76 43 45 82 71 56 65 62 80
M F F F M F M M M M M F M F F M M M M M M M M F M F M M M M M M M F F M M M M M M F F M M F M M F F M M M
C (5) N N F (3/1.5) C (30) N F (14/45) F (12/30) N F (2.5/50) F (25/25) N N N N F (1.5/2) C (50) F (6/25) F (1.5/38) C (30) F (20/15) C (20) N N C (50) N C (28) F (16/30) F (12/30) N F (17/5) C (120) C (60) N N F (8/30) F (20/25) F (30/1.5) F (10/10) N N N N C (23) F (6/30) N C (20) N F (3/3) N F (8/20) C (45) C (60)
A A A A S A S S A A A A A A L A A S A A S A A A S A A A S A S S S A A A A A A S A A A S S A A A A A A A S
UK UK 1/0/0 4/0/0 3/1/0 UK 3/0/0 2/1/0 3/1/0 UK 3/0/0 UK UK 2/0/0 UK 3/0/0 3/0/0 2/0/0 2/1/0 UK 4/0/0 UK UK 2/0/0 UK 5/0/0 5/2/0 1/0/0 3/0/0 3/0/0 2/0/0 3/0/0 1/0/0 2/0/0 3/0/0 1/0/0 3/0/0 2/0/0 1/0/0 3/0/0 5/2/0 3/0/0 3/1/0 2/0/0 4/0/0 3/2/1 3/0/0 2/1/0 1/0/0 3/2/0 1/0/0 4/0/0 2/0/0
2 1 1 1 2 3 1 2 2 2 1 1 1 1 2 1 1 1 2 1 2 3 3 1 3 2 3 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1 2 1 2 3 3 2 1 3 1 2 1
†† †† ND † †† †† †† †† ††† †† † ††† ††† †† ND ND †† †† †† ND † †† ND † †† ††† †† †† ††† †† ND † † † † †††† ††† ND †† † †† †† †† † †† ††† †† ††† †† †† ND ND ND
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – † † † † † † † † † † † † † † † –
26 26 26 22 26 23 23 23 23 23 25 25 25 22 22 22 22 22 23 23 20 20 20 20 20 20 23 23 23 23 23 26 24 22 22 22 22 13 19 7 8 15 13 13 18 13 7 13 18 6 14 19 26
t1:57 t1:58
D
E
T
C E
R
R
O C
N
U
P
t1:3
Abbreviations used: A; adenocarcinoma, S; squamous cell carcinoma, L; large cell carcinoma, N; never smoked, F; Former smoker, C; current smoker, UK; unknown, ND; Not detected, –; no-recurrence at present.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
86 87 88 89 90 91 92 93 94 95 96 97 98 99 100
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
2.3. Reverse transcription-polymerase chain reaction (RT-PCR)
121 122
139
RNA extraction and real-time PCR were carried out as previously described [16]. One microgram of total cellular RNA was isolated according to the manufacturer's instructions and cDNA was synthesized using OmniScript cDNA synthesis kit (Qiagen). For the measurement of the STC2 protein expression level in the normal tissues, purified RNA of 20 different organs was purchased (Ambion, Life Technologies, US) and cDNA was synthesized the same method as extracted RNA. Samples for the qRT-PCR were prepared using GoTaq and SYBR Green (Promega) and run on Real-Time PCR System (Bio Rad) using a thermal profile of an initial 5 min denaturing at 95 °C and 30 s melting step at 95 °C, 30 s annealing step at 58 °C, and 30 s extension step at 72 °C, followed by 35 cycles and 72 °C for 5 min as final extension step. The primers used for the analysis were: STC2: (5′-TGAAATGTAAGGCCCACGCT-3′) (forward) and (5′-CGAGGTGCAGAAGCTCAAGA-3′) (reverse) and GAPDH: (5′-ACCACAGTCCATGCCATCAC-3′) (forward) and (5′- TCCACCACCCTG TTGCTGT -3′) (reverse). To verify the presence of only one amplicon, a melting curve was processed after each run. mRNA levels of H460/ shSTC2 and H460/shControl were measured after normalization with GAPDH. All reactions were carried out at least twice in triplicate.
140
2.4. Protein extraction and Western blot analysis
141
Cells were washed twice with pre-cold phosphate-buffered saline quickly and then suspended in protein extraction buffer. Total cell lysates were obtained using a RIPA lysis buffer containing 20 mm Tris–HCl (pH 7.5), 1% Triton X-100, 150 mm sodium chloride, 10% glycerol, 1 mm sodium orthovanadate, 50 mm sodium fluoride, 100 mm phenylmethylsulfonyl fluoride and 1× protease inhibitor (Roche Applied Science) at 4 °C for 2 h. The determination of the protein content was done using Bradford assay according to the manufacturer's instructions. Proteins (20 μg) were resolved under denaturing condition by 12% SDS-PAGE and transferred onto nitrocellulose membranes (Whatman, Germany). The membranes were blocked for 1 h in 5% nonfat skim milk in TBS-T (25 mm Tris–HCl, pH 7.4, 125 mm sodium chloride, 0.05% Tween 20) and incubated with goat antibody to human STC2 (Santa Cruz, 1:1000) or mouse antibody to human β-Actin (Cell signaling, MA, US) at 4 °C overnight. Membranes were then washed three times with TBS-T followed by incubation with horseradish peroxidase-conjugate anti-goat antibody (Bethyl, TX, US, 1:3000) or anti-mouse antibody (Bethyl, TX, US, 1:3000) for 1 h at room temperature. The immune complexes were then detected using a Pierce ECL plus detection kit (Thermo Scientific). The thickness of the bands was
125 126 127 128 129 130 131 132 133 134 135 136 137 138
142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160
C
123 124
E
116 117
R
114 115
R
112 113
N C O
110 111
U
108 109
165
Immunohistochemistry staining was performed as previously reported [16]. Briefly, slides were immersed in a retrieval solution and boiled at 100 °C for 20 min in an autoclave for antigen retrieval. The anti-STC2 antibody (Abnova, 1:50) was applied to each slide after blocking and then the sections were incubated with HRP-labeled antimouse IgG as secondary antibody. DAB solution was used as chromogen and the counterstaining was done with methyl green.
166 167
2.6. Stable short hairpin RNA knockdown of STC2
173
The stable knockdown of STC2 expression in H460 human lung cancer cell line was achieved by the construction of hairpin vectors carrying a puromycin antibiotic resistance gene. Infection of lentiviral particles of shRNA STC2 or shRNA control was done according to the manufacturer's protocol (Santa Cruz). For stable cell population selection, 24 h after transfection, cells were replated in RPMI-1640 (GibcoBRL, Rockville, MD, USA) with 10% (vol/vol) FBS and 3 μg/ml puromycin (Santa Cruz). Puromycin-resistant clones were selected and expanded. The resistant clones were then maintained in the medium containing 0.3 ug/ml of puromycin. The mRNA and protein levels of STC2 in these cells were checked by RT-PCR and Western blot analysis. H460 cells transfected with control vector (H460/shControl) served as the control. The oligonucleotide sequences for shRNA were: shSTC2, forward, GATCCCCGTGGAGATGATCCATTTCATTCAAGAGATG AAATGG ATCATCTCCACTTTTTGGAA; and shSTC2 reverse, AGCTTTTCCAAAAAGT GGAGA TGATCCATTTCATCTCTTGAATGAAATGGATCATCTCCACGGG.
174 175
2.7. Cell growth assessment and colony formation assay
190
Cell growth was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyl-2H-tetrazolium bromide (MTT) assay and trypan blue exclusion test. Briefly, cells were grown in RPMI medium supplemented with 10% heat-inactivated FBS and antibiotics. After 24 h seeding of H460/shSTC2, wild type H460 or vector control, 500 μg/ml of MTT was added to the wells containing cells followed by 3 h incubation under incubation temperature of 37 °C in a humidified atmosphere with 5% CO2. DMSO was added to dissolve MTT. Evaluation was done using a BioTek microplate reader and the absorbance was set to 570 nm for reading. The results were expressed as percentages relative to wild type H460 control. To assess cell numbers, an equal volume of trypan blue (Sigma) at 0.4% (w/v) was added to each cell suspension and cell viability was determined based on the ability of live cells to exclude the vital dye. Hemocytometer was used to count the viable cells. To measure the colony formation, exponentially growing cells were seeded in triplicate in 6-well plates at 1.5 × 103 per well. After incubation at 37 °C for indicated times, cells were fixed with methanol for 5 min followed by staining with 0.005% (w/v) crystal violet for 15 min. Colonies (cell groups containing a minimum of 50 cells) were counted under a phase contrast microscope.
191 192
2.8. Migration and invasion assays
210
Cell migration and invasion assays were performed in 24-well transwell plates (8 μm pore size, Corning, USA). Matrigel was diluted to 1 mg/ml with serum-free culture medium and applied on the insert in the upper chambers of the multiwall for invasion assay plate. 1.0 × 105 cells in 200 μL of serum-free culture medium were seeded in the upper chambers of the wells. For chemotaxis induction of cells, 800 μL of culture medium supplemented with 10% FBS was added to the lower chambers. After incubation for 24 h at 37 °C in humidified
211
F
120
106 107
2.5. Immunohistochemistry
O
118 119
To discover lung cancer derived secreted proteins, conditioned media of primary cultured lung cancer cells and adjacent normal lung cells were analyzed by MS/MS analysis (Sung & Cho, manuscript in preparation). In short, lung cancer tissues obtained during the surgery with their corresponding normal tissues and primary culture of lung tissues were conducted. Twenty-four hours after plating the same number of lung cancer cells and normal lung epithelial cells, the media was replaced with serum free media. Then, after another 24 h, the conditioned media was harvested and proteins were harvested by TCA (Trichloroacetic acid) precipitation method. LC–MS/MS analysis was performed using Thermo Finnigan ProteomeX work station LTQ linear IT MS (Thermo Electron, San Jose, CA, USA) equipped with NSI source (San Jose, CA). MS/MS data was searched based on the IPI human protein database (version 3.29) using the SEQUEST algorithm (Thermo Electron). Scaffold ver. 01_07_00 was used to validate MS/MS based peptides and protein identification.
R O
104 105
P
2.2. Proteomic analysis of primary human lung cancer secretome
161 162
D
103
photographically measured, and the density of a calibration grid slide was calculated using Scion Image (Scion, Frederick, MD). The calculated value of each STC band was divided by its paired β-Actin results and the normalized value was used for further graphical analysis.
E
H460 cells were maintained in 60 mm culture dish and subcultured at various ratios according to their doubling times (22–30 h).
T
101 102
3
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
163 164
168 169 170 171 172
176 177 178 179 180 181 182 183 184 185 186 187 188 189
193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209
212 213 214 215 216 217 218
228 229 230 231
2.9. H202-induced oxidative stress mediated cytotoxicity and intracellular ROS measurement
234
251 252
To determine the effect of STC2 knockdown on the H202-mediated oxidative stress, cell viability was determined by MTT assay. Twentyfour hours after seeding, specific treatments were done with various concentrations of H202 onto H460, H460/shSTC2 and H460/shControl cells in 24-well plates at indicated times. Prior to the absorbance measurement, incubation with 500 μg/ml of MTT for 3 h at 37 °C was conducted. The intensity of the formazan product was measured at 570 nm using a microplate reader. Levels of cellular ROS were determined by flow cytometry (Becton Dickinson, FACSCalibur) as described previously. Briefly, cells were seeded at a density of 1 × 104 cells/ml, in sterile 60 mm dishes and cultured for 24 h. The cells were washed twice and stained with 1 ml of 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) used as a ROSspecific fluorescent probe at 10 μM concentration. Cells were then incubated at 37 °C for 40 min and were analyzed for fluorescence intensity by flow cytometry using a 485 nm excitation beam and a 538 nm bandpass filter. ROS production was expressed as mean fluorescence intensity (MFI) calculated through Cell Quest software (BD Biosciences) analysis of the recorded histograms.
253
2.10. Cell cycle progression analysis
254
269 270
Analysis on the effects of the STC2 knockdown on cell cycle distribution in H460 cells was performed by the method previously described [17]. Cells were seeded in sterile 100 mm dish plates and cultured under the conditions described previously. The cells were harvested, washed twice, and fixed in 70% cold ethanol overnight at − 20 °C. Ethanol-fixed cells were pelleted, washed with ice-cold PBS, and resuspended in staining solution containing 50 μg/mL PI, 0.1% Triton-X-100, 0.1% sodium citrate, and 100 μg/mL RNase. After 1 h of incubation at room temperature in the dark, the fluorescence-activated cells were sorted and cellular DNA content analyzed by flow cytometry using the FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA) equipped with an argon laser and data were evaluated using CellQuest 3.0.1 software (Becton-Dickinson, Franklin Lakes, NJ). At least 20,000 cells were used for each analysis, and the results are displayed as histograms. The proportion of non-apoptotic cells in different phases of the cell cycle was then recorded with at least triplicate and expressed as ± SD.
271
2.11. Statistical analysis
272 273
All experiments were repeated at least three times. All the results were presented as mean ± standard deviations. Student's t test analysis performed from OriginPro 8 from OriginLab Corp. (Northampton, MA, USA). P value b 0.05 was considered statistically significant.
255 256 257 258 259 260 261 262 263 264 265 266 267 268
274 275
C
249 250
E
247 248
R
245 246
R
243 244
O
241 242
C
239 240
N
237 238
U
235 236
279 280 281 282 283 284 285 286 Q6 287 288 289 290 291
3.2. Expression of STC2 in human organs specimens and lung cancer tissues 292 To confirm tissue specific expression of STC2 in various organ tissues, quantitative real-time PCRs were performed on 20 normal organ tissues of healthy humans. The results showed the highest mRNA expression of STC2 in normal hearts and almost no expression of STC2 has been discovered in a normal lung (Fig. 1A). To test STC2 expression levels in lung cancer, mRNAs of 8 pairs of lung cancer tissue samples and their corresponding adjacent normal tissues were subjected to RT-PCR analysis. Although STC2 expression was not detected in few samples due to a low expression in conventional PCR (Fig. 1B), all of the 8 pairs of clinical samples showed significantly higher levels of STC2 in lung cancer tissues than the paired adjacent normal lung tissues in quantitative real-time RT-PCR result analysis (Fig. 1C). Taken together, STC2 mRNA expression increased in lung cancer compared to the normal tissues. From the results, it is suggested that very low expression of STC2 in the normal lung is aberrantly turned on and highly expressed in lung cancer tissues.
293
3.3. Up-regulation of STC2 protein in lung cancer tissues
309
To verify the protein expression of STC2, 53 pairs of lung cancer tissues and its adjacent normal tissues were subjected to Western blot analysis. The results showed that the expression of STC2 protein was significantly higher in lung cancer tissues than that of corresponding adjacent normal tissues (Fig. 2A). While most of the normal tissues showed no or very little expression of STC2, only 3 of the 53 normal samples showed STC2 expression, and 38 cancer tissues showed high to low levels of STC2 expression. The WB results were analyzed by densitometry and the values of STC2 levels were normalized by the β-Actin densitometry value (Fig. 2B). From the 53 tissue samples, 39 (73.6%) samples had up-regulated STC2 expression and 5 (9.4%) samples showed down-regulated STC2 in lung cancer tissues than the adjacent normal tissues. There were no changes between the lung cancers and the adjacent normal in 9 samples. To check the correlation between cancer stages and STC2 expression, we analyzed the STC2 Western blot analysis results based on the clinical information; cancer stage or TNM stage, however there was no significant correlation. To see the correlation between STC2 protein expression and recurrence of patient exists, WB data was analyzed based on the clinical information of each patient. Sixteen samples out of 53 were the tissue samples of the patients who showed recurrence within 7 to 19 months after surgery. Among the 16 samples, 9 samples, about 56% showed increased STC2 in lung cancers (Fig. 2A, lower panel). There was no significant correlation between recurrence and STC2 expression. However, all
310 311
T
232 233
F
226 227
To discover lung cancer specific protein, the secretomes collected from primary cultured lung cancer cells and adjacent normal lung cells were analyzed by MS/MS analysis (Sung & Cho, manuscript in preparation). Lung cancer tissue and its corresponding normal tissues of two lung cancer patients were used for the analysis. From the semiquantitative data, STC-2 appears with higher peptide hit in the lung cancer secretome compared to the adjacent normal cells. Relative values, peptide spectral count divided by total ion current (TIC), of the normal and lung cancer samples were 12.21 and 24.56, and 1 and 9.47 in each patient's data showing 2.0 or 9.4, respectively fold change in lung cancer primary cell secretome (data not shown). From the spectral count data, STC-2 appears with higher peptide hit in the lung cancer secretome compared to the adjacent normal cells.
O
225
3.1. MS/MS spectrometry quantifies overexpression of STC2 in secretome of 277 lung cancer compared to normal tissues 278
R O
223 224
276
3. Results
P
221 222
5% CO2 atmosphere, the membrane inserts were removed and the noninvading cells were removed from the upper surface of the membrane. Migrated or invaded cells were stained with 0.1% crystal violet for 20 min and washed water. The invading cells were counted in 5 random fields by cell confluence measuring program in JuLI FL microscope (NanoEntek, Korea). To further support the migration studies, a wound or scratch assay was conducted. A monolayer of cell was cultured in a 4-well plate and then a wound space was made with a 1 mm width tip. Cell monolayers were then washed with PBS and replaced with fresh new culture media and allowed to migrate for indicated times. Micrographs were taken under a phase-contrast microscope (×100) and wound spaces were measured from 5 random fields using the same program in JuLI FL microscope.
D
219 220
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
E
4
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
294 295 296 297 298 299 300 301 302 303 304 305 306 307 308
312 313 Q7 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334
5
D
P
R O
O
F
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
C
E
R
341 342
3.4. STC2 knock down slows down the cell growth and colony formation 345 Q9 and arrests cell cycle 346 To further investigate the molecular mechanism of STC2 in the lung 347 cancer progression, a stable STC2 knock-downed H460 lung cancer cell 348
R
339 340 Q8
immunohistochemical analysis also showed overexpression of STC2 in 343 the lung cancer cells. 344
N C O
337 338
the 5 female patients with recurrence had high STC2 expression levels in the lung cancer tissues (Table 1). To verify STC2 expression and further prove whether STC2 is directly secreted from lung cancer cells, immunohistochemical analysis was conducted on tissue paraffin sections of lung cancer patients (n = 5) with corresponding normal tissues. A strong positive expression of STC2 was detected in all of the tissue samples (Fig. 3A) while weak signals were found on the adjacent normal tissues (Fig. 3B). The STC2
U
335 336
T
E
Fig. 1. Expression of STC2 mRNA in human normal organ specimens, lung cancers and their adjacent normal tissues. (A) Tissue specificity of STC-2 is confirmed by real-time RT- quantitative PCR from the cDNAs of various human organs. (B) Conventional RT-PCR data of STC2 mRNA expression in lung cancer tissues and its adjacent normal tissues of 8 individuals. (C) Quantification of STC2 mRNA expression level by real-time RT-qPCR analysis in the same samples used in conventional PCR.
Fig. 2. Verification of STC-2 protein expression increase in the lung cancer tissues compared to adjacent normal tissues. (A) Results of Western blot analysis of STC-2 in human lung cancer tissue samples (LC) with their corresponding adjacent normal tissues (N). Same amounts of protein were loaded and the STC2 was detected. (Number above the blots indicates patient sample number listed in Table 1) (B) Densitometry data of the Western blot was shown in line graphs. Red lines indicate the STC2 expression of patients with recurrence.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
O
F
6
P
D
E
T C E R
358 359
R
356 357
O
354 355
of STC2 on cell cycle progression through FACS analysis (Fig. 4D). Significant accumulation of cells at the G0/G1 phase was observed in shSTC2 cells. It suggests that the attenuation of the cell proliferation in shSTC2 cells might be due to cell cycle arrest to G0/G1. In addition, a slight increase of cell population in sub G1 phase suggests that the initial cell cycle arrest in shSTC2 cells might lead to apoptosis and that shSTC2 partially render the lung cancer cells to G0/G1 cell cycle arrest. These results strongly suggest that STC2 is involved in the maintenance of lung cancer cell proliferation. Previous report in liver cancer also supported our results by showing that STC2 is involved in the metastasis and progression of hepatocellular carcinoma [18].
C
352 353
line was developed via lentiviral infection carrying STC2 short hairpin RNA (shSTC2), and proliferative activity of the cells were examined. Almost complete knock down of STC2 in the established stable cell line was confirmed at a protein level by WB analysis (Fig. 4A). Cell proliferation and colony formation assay were performed in shSTC2 stable H460 cells. STC2 knockdown significantly attenuated cell growth in a time-dependent manner from 24 h to 72 h as analyzed by MTT assay and trypan blue cell counting (Fig. 4B). Colony formation assay also showed a decrease in the STC2 knock-downed H460 cell line compared to shControl group (Fig. 4C). To confirm the mechanism of STC2 affecting the cell growth of H460, we then elucidated the effect
N
350 351
U
349
R O
Fig. 3. Immunohistochemical analysis of STC2 protein expression in normal lung and lung cancer tissues. STC2 expression was confirmed by immunohistochemistry on paraffin embedded tissue sections of a normal lung (A), and lung cancer tissue (B).
Fig. 4. STC2 knockdown slowed down cell growth and delayed cell cycle in H460 cells. (A) The shRNA efficiency was determined by Western blot in the H460 cells infected with lentiviral particles of shRNA control or STC2 shRNA. (B) The STC2 knockdown inhibits the cell proliferation of H460 cells after 24–72 h. Bar graph (left) shows MTT assay results and line graphs (right) shows results of cell counting with trypan blue staining. (C) The shSTC2 significantly suppresses cell colony formation of H460 cells. (D) PI-based FACS analysis was performed in the H460 cells. The shSTC2 resulted in significant cell cycle arrest at G0/G1 phase.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
360 361 362 363 364 365 366 367 368 369 370
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
3.5. STC2 knock down reduced the cell migration and invasion
372 373
We then investigated the effects of the stable STC2 knockdown on the migration or metastatic activity of lung cancer cells. Cell migration, invasion and wound healing assays were employed in H460 cells. To assess the migration activity, wound-healing experiments on a cell monolayer were carried out (Fig. 5A). A time course analysis from 0 to 18 h was conducted after a wound scratch was inflicted. At 9 h and 18 h time points, there was a significant difference between shControl
O R O P D E T C E R R
377 378
N C O
376
U
374 375
cells and STC2 knockdown cells. It took less than 20% migration even after 18 h after scratch. To further confirm the STC2 effect on cancer cell migration and invasion, Boyden chamber assay was conducted without (for migration) or with (for invasion) basement membrane matrigel coated. Similar to wound healing assay results, STC2 knock-downed cells showed less migration ability and less invasiveness than control cells (Fig. 5B and C). Overall, migration velocity and invasiveness was greatly reduced by STC2 knockdown in H460 lung cancer cells.
F
371
7
Fig. 5. STC2 silencing suppressed cell migration and invasion of H460 cells. (A) Margins of linear wounds created by scraping confluent cell in wound-healing assay. The “wounded” areas were examined at the indicated time points, 0 h, 9 h and 18 h after scratch. Under 100× magnification. (B & C) Migration and invasion of the cells were determined by Boyden chamber assay without (B) or with (C) a layer of matrigel-coating solution, respectively. Cells were stained and visualized with crystal violet staining.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
379 380 381 382 383 384 385 386 387
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
408 409 410 411 412 413 414 415 416
F
O
C
406 407
E
404 405
R
402 403
R
400 401
O
398 399
421 422 Q10
C
396 397
In this study, we present STC2 as a biomarker secreted by lung cancer cells and validate that its mRNA and protein levels are significantly increased in the lung cancer tissues than in adjacent normal. These lung cancer data are consistent with the observations reported for gastric cancers and laryngeal squamous cell carcinoma etc. [21,22]. For further elucidation of the molecular function of STC2 in lung cancer progression, a stable STC2 knockdown H460 lung cancer cell line was established and the effects on cancer cell growth, migration, invasion, cell cycle progression, and ROS-regulated oxidative stress were examined. The results turned out that STC2 might be involved in lung cancer progression by promoting cell proliferation, migration and invasion. For the last decade, cancer biomarker discovery has been massively conducted by many researchers for its anticipated clinical role in the diagnosis and prognosis of various cancers [23]. Along with the advancement of proteomic technologies, it is expected that new biomarkers discovered in the future could improve the diagnosis and therapeutic rate. In the case of lung cancer, the majority cancer related death is due to the diagnosis at advanced stages. Development of novel and specific biomarkers for lung cancers for early detection might help the current clinical situations. In this study through the aid of MS/MS analysis, we found STC2 up-regulation in the secretome of primary cultured lung cancer cells. Stanniocalcin (STC) is a calcium-regulating hormone first found in bony fishes and known to be released into the blood to regulate the
N
394 395
420
U
393
4. Discussion
R O
Reactive oxygen species have long been known to be associated with increasing cell growth and metabolism of various cancers [19]. Accordingly, increased levels of ROS production and accumulation are often demonstrated in lung cancers [20]. Since a high level of intracellular ROS can induce cell death and considering our findings on the cell arrest induction in sub G1 cell cycle progression by STC2 knock down, we further investigated the effect of the STC2 knockdown on the intracellular levels of ROS in H460 cells. We first identified if the STC2 knockdown can attenuate the cell viability upon oxidative stress via H2O2 on H460 cells. STC2 knock-downed cells were significantly affected and died more by H2O2 induced oxidative stress suggesting that STC2 might have protection effect on the cell growth against oxidative stress induced by H2O2 (Fig. 6A). In line with the hypothesis that the accumulation on the sub G1 phase might be due to the induction of ROS levels, we found out that STC2 knockdown caused subsequent increase in the intracellular ROS levels in H460 cells when compared to both wild type and control vector cells. The results revealed that STC2 knockdown caused a 75.44 to 77.11% increase in ROS levels when the ROS levels of wild type and shControl H460 cells were set as a 100% standard control (Fig. 6B). We incorporated the ROS inhibitor NAC to evaluate whether its anti-oxidative function works in STC2 deprived cells. NAC treatment caused the ROS levels to decline from 2.7 to 34% in all of the combinations with mock, shControl and shSTC2 cells. These events might contribute to the complexity of the many major sources of excessive ROS generation in specific cancer cells and tissues and the relation of the endogenous ROS levels to various signaling molecules including their biological responses.
391 392
P
390
These results infer that STC2 overexpressed in cancer cells can 417 protect the cells from oxidative stress induced in cancer microenviron- 418 ments and thus promote lung cancer cell survival and progression. 419
D
3.6. Knockdown of STC2 attenuates the H202-induced oxidative stress and increases intracellular ROS
T
388 389
E
8
Fig. 6. Effects of STC2 knockdown on the cancer cell viability after oxidative stress induction stress by H2O2. H460 cells were infected with shControl virus or shSTC2 virus. After treating the cells with various H2O2 doses, MTT assays were performed to test cell viability in 24, 48 and 72 h (A). shControl and shSTC2 expressing H460 cells were treated with or without NAC ROS-inhibitor for 24 h and were subsequently tested for FACS analysis. DCFH-DA fluorescent dye was used for intracellular ROS staining prior to the analysis (B).
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499
500 Q11 5. Uncited references 501 502 503 504
[14,15] Acknowledgment
This work was supported by Proteogenomics Research Program grants (No. 2012M3A9B9036669) through the National Research 505 Q12 Foundation of Korea (NRF) grant funded by the Ministry of Science, 506 Q13 ICT & Future Planning (MSIP), Korean Foundation for Cancer Research
O
F
511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587
R O
464 465
[1] R. Siegel, J. Ma, Z. Zou, A. Jemal, Cancer statistics, 2014, CA Cancer J. Clin. 64 (2014) 9–29. [2] R. Etzioni, N. Urban, S. Ramsey, M. McIntosh, S. Schwartz, B. Reid, J. Radich, G. Anderson, L. Hartwell, The case for early detection, Nat. Rev. Cancer 3 (2003) 243–252. [3] H.-J. Sung, J.-Y. Cho, Biomarkers for the lung cancer diagnosis and their advances in proteomics, BMB Rep. 41 (2008) 615–625. [4] V. Kulasingam, E.P. Diamandis, Strategies for discovering novel cancer biomarkers through utilization of emerging technologies, Nat. Clin. Pract. Oncol. 5 (2008) 588–599. [5] M. Makridakis, A. Vlahou, Secretome proteomics for discovery of cancer biomarkers, J. Proteomics 73 (2010) 2291–2305. [6] G. Flik, T. Labedz, J. Neelissen, R. Hanssen, S. Wendelaar Bonga, P. Pang, Rainbow trout corpuscles of Stannius: stanniocalcin synthesis in vitro, Am. J. Physiol. Regul. Integr. Comp. Physiol. 258 (1990) R1157–R1164. [7] M. Lu, G.F. Wagner, J.L. Renfro, Stanniocalcin stimulates phosphate reabsorption by flounder renal proximal tubule in primary culture, Am. J. Physiol. Regul. Integr. Comp. Physiol. 267 (1994) R1356–R1362. [8] G.F. Wagner, E.M. Jaworski, M. Haddad, Stanniocalcin in the seawater salmon: structure, function, and regulation, Am. J. Physiol. Regul. Integr. Comp. Physiol. 274 (1998) R1177–R1185. [9] D. Ito, J.R. Walker, C.S. Thompson, I. Moroz, W. Lin, M.L. Veselits, A.M. Hakim, A.A. Fienberg, G. Thinakaran, Characterization of stanniocalcin 2, a novel target of the mammalian unfolded protein response with cytoprotective properties, Mol. Cell. Biol. 24 (2004) 9456–9469. [10] A. Law, C.K. Wong, Stanniocalcin-2 is a HIF-1 target gene that promotes cell proliferation in hypoxia, Exp. Cell Res. 316 (2010) 466–476. [11] K. Tamura, M. Furihata, S.Y. Chung, M. Uemura, H. Yoshioka, T. Iiyama, S. Ashida, Y. Nasu, T. Fujioka, T. Shuin, Stanniocalcin 2 overexpression in castration‐resistant prostate cancer and aggressive prostate cancer, Cancer Sci. 100 (2009) 914–919. [12] S. Volland, W. Kugler, L. Schweigerer, J. Wilting, J. Becker, Stanniocalcin 2 promotes invasion and is associated with metastatic stages in neuroblastoma, Int. J. Cancer 125 (2009) 2049–2057. [13] K.-A. Yoon, H.-S. Cho, H.-I. Shin, J.-Y. Cho, Differential regulation of CXCL5 by FGF2 in osteoblastic and endothelial niche cells supports hematopoietic stem cell migration, Stem Cells Dev. 21 (2012) 3391–3402. [14] J.L. Alcorn, M.E. Smith, J.F. Smith, L.R. Margraf, C.R. Mendelson, Primary cell culture of human type II pneumonocytes: maintenance of a differentiated phenotype and transfection with recombinant adenoviruses, Am. J. Respir. Cell Mol. Biol. 17 (1997) 672–682. [15] S.H. Heo, S.J. Lee, H.M. Ryoo, J.Y. Park, J.Y. Cho, Identification of putative serum glycoprotein biomarkers for human lung adenocarcinoma by multilectin affinity chromatography and LC–MS/MS, Proteomics 7 (2007) 4292–4302. [16] H.J. Sung, J.M. Ahn, Y.H. Yoon, T.Y. Rhim, C.S. Park, J.Y. Park, S.Y. Lee, J.W. Kim, J.Y. Cho, Identification and validation of SAA as a potential lung cancer biomarker and its involvement in metastatic pathogenesis of lung cancer, J. Proteome Res. 10 (2011) 1383–1395. [17] C. Schorl, J.M. Sedivy, Analysis of cell cycle phases and progression in cultured mammalian cells, Methods 41 (2007) 143–150. [18] H.X. Wang, Y. Sun, M.Y. Wu, Y.J. Wei, B. Cai, STC2 is upregulated in hepatocellular carcinoma and promotes cell proliferation and migration in vitro, Biochem. Mol. Biol. Rep. 45 (2012) 629–634. [19] J. Huang, G.Y. Lam, J.H. Brumell, Autophagy signaling through reactive oxygen species, Antioxid. Redox Signal. 14 (2011) 2215–2231. [20] N. Azad, Y. Rojanasakul, V. Vallyathan, Inflammation and lung cancer: roles of reactive oxygen/nitrogen species, J. Toxicol. Environ. Health B 11 (2008) 1–15. [21] T. Yokobori, K. Mimori, H. Ishii, M. Iwatsuki, F. Tanaka, Y. Kamohara, K. Ieta, Y. Kita, Y. Doki, H. Kuwano, Clinical significance of stanniocalcin 2 as a prognostic marker in gastric cancer, Ann. Surg. Oncol. 17 (2010) 2601–2607. [22] H. Zhou, Y.-Y. Li, W.-Q. Zhang, D. Lin, W.-M. Zhang, W.-D. Dong, Expression of Stanniocalcin-1 and Stanniocalcin-2 in Laryngeal Squamous Cell Carcinoma and Correlations with Clinical and Pathological Parameters, PLoS One 9 (2014) e95466. [23] J.A. Ludwig, J.N. Weinstein, Biomarkers in cancer staging, prognosis and treatment selection, Nat. Rev. Cancer 5 (2005) 845–856. [24] G.F. Wagner, E. Jaworski, Calcium regulates stanniocalcin mRNA levels in primary cultured rainbow trout corpuscles of stannius, Mol. Cell. Endocrinol. 99 (1994) 315–322. [25] A.C. Chang, D. Jellinek, R. Reddel, Mammalian stanniocalcins and cancer, Endocr. Relat. Cancer 10 (2003) 359–373. [26] K. Ieta, F. Tanaka, T. Yokobori, Y. Kita, N. Haraguchi, K. Mimori, H. Kato, T. Asao, H. Inoue, H. Kuwano, Clinicopathological significance of stanniocalcin 2 gene expression in colorectal cancer, Int. J. Cancer 125 (2009) 926–931. [27] K. Joensuu, P. Heikkilä, L.C. Andersson, Tumor dormancy: elevated expression of stanniocalcins in late relapsing breast cancer, Cancer Lett. 265 (2008) 76–83. [28] H.-A. Meyer, A. Tölle, M. Jung, F.R. Fritzsche, B. Haendler, I. Kristiansen, A. Gaspert, M. Johannsen, K. Jung, G. Kristiansen, Identification of stanniocalcin 2 as prognostic marker in renal cell carcinoma, Eur. Urol. 55 (2009) 669–678.
P
462 463
510
D
460 461
References
E
458 459
(CB-2011-02-01), grant No. HI13C-2098-030013 from the Ministry for 507 Health and Welfare and grant No. B-1201/143-003 from the SNUBH 508 Research Fund. 509
T
456 457
C
454 455
E
452 453
R
451
R
449 450
N C O
447 448
Ca2+ and phosphate uptake in different target organs [24]. The human STC2 gene encoding 302 amino acid long protein is primarily expressed in the kidney, heart, pancreas, and spleen [25]. In several different human cancers, aberrant expression of STC2 has been studied. It is reported that the STC2 expression is up-regulated in gastric cancers, colorectal cancer, breast cancer and renal cell carcinoma [21,26–28]. In some studies, it is revealed that STC2 overexpression has been involved with poor prognosis and cancer recurrence in colorectal and prostate cancers [11,26]. Another previous report has shown the involvement of STC2 in tumor progression and metastasis. In addition, on contrary to STC1, STC2 has been consistently found to have an anti-apoptotic mechanism in some cancers, by inhibiting plasma membrane storeoperated Ca2+entry (SOCE), which protects cells from apoptotic factors [9]. One noted characteristic of STC2 is that its contribution to carcinogenesis is selective, depending on the type of cancer. However, correlation of STC2 and human lung cancers has never been studied and notable functional relationship has not yet been fully studied until this study. The mass spectrometry data STC2 increase in the secretome of lung cancer cells were also validated by RT-qPCR and WB analyses. Considering the elevated expression of STC2 in lung cancer tissues, it can be assumed that STC2 is directly related to cancer prognosis. However; data analysis based on the patients' information revealed that there was no significant correlation between STC2 expression and recurrence of lung cancers after surgery. Although, no significant difference was found, all female patients with recurrence had high levels of STC2 protein expression. The sample numbers tested in this study was not enough to conclude clearly. Further study with large number of clinical cases may be needed to confirm this result. This study further extends the preliminary conclusion that STC2 can serve as a biomarker for lung cancer with clinical relevance, to molecular function in lung cancer in vitro. In the early stages of cancer development, cell proliferation ability is a major contribution to cancer progression. This study revealed that STC2 knockdown in H460 cells decreased cell proliferation, colony formation capacity, induced G0/G1 cell cycle arrest. We further demonstrated that STC2 knockdown attenuated cell viability induced by H202 oxidative stress and increased intracellular ROS levels which propose a redox regulatory function for STC2. From these result, it can be inferred that STC2 expression in the early stage of cancer could promote cancer formation by inducing cell proliferation. In addition to proliferation, migration and invasion are the basic processes involved in carcinogenesis, resulting in distant metastasis. Cell migration is considered a critical feature of some physiological and pathological phenomena, which include development, wound repair, angiogenesis, and metastasis. The high metastatic characteristic of lung cancer is pointed out as one of the main causes of death in patients with lung cancer. In vitro studies revealed that STC2 knockdown decrease cell migration and invasion ability. These results indicate that STC2 expression not only affects tumor growth by promoting cell proliferation but also has an influence on cancer progression by inducing cell migration and invasion. In conclusion, STC2 is overexpressed in lung cancer tissues, which lead to cancer progression by inducing cell proliferation, migration and invasion. These results implicate that STC2 is a potential biomarker for lung cancer and might play a critical function in lung carcinogenesis.
U
445 446
9
588
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
Contents lists available at ScienceDirect
Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbapap
F
O
4
Sang-su Na a,b, Mark Borris Aldonza a, Hye-Jin Sung a, Yong-In Kim a, Yeon Sung Son a, Sukki Cho c, Je-Yoel Cho a,⁎
5Q5 6 7 8
a
9
a r t i c l e
10 11 12 13 14
Article history: Received 12 July 2014 Received in revised form 29 October 2014 Accepted 5 November 2014 Available online xxxx
15 16 17 18 19
Keywords: Lung cancer Stanniocalcin 2 Metastasis Biomarkers
Department of Biochemistry, BK21 PLUS Program for Creative Veterinary Science Research and Research Institute for Veterinary Science, College of Veterinary Medicine, Seoul National University, Republic of Korea b Department of Physical Therapy, College of Rehabilitation, Daegu University, Daegu, Republic of Korea c Department of Thoracic and Cardiovascular Surgery, Seoul National University Bundang Hospital, Seoungnam-si, Gyeonggi-do, Republic of Korea
i n f o
R O
3Q4
a b s t r a c t
P
2
Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression☆
The homodimeric glycoprotein, stanniocalcin 2 (STC2) is previously known to be involved in the regulation of calcium and phosphate transport in the kidney and also reported to play multiple roles in several cancers. However, its function and clinical significance in lung cancer have never been reported and still remain uncertain. Here, we investigated the possibility of STC2 as a lung cancer biomarker and identified its potential role in lung cancer cell growth, metastasis and progression. Proteomic analysis of secretome of primary cultured lung cancer cells revealed higher expression of STC2 in cancers compared to that of adjacent normal cells. RT-PCR and Western blot analyses showed higher mRNA and protein expressions of STC2 in lung cancer tissues compared to the adjacent normal tissues. Knockdown of STC2 in H460 lung cancer cells slowed down cell growth progression and colony formation. Further analysis revealed suppression of migration, invasion and delayed G0/G1 cell cycle progression in the STC2 knockdown cells. STC2 knockdown also attenuated the H202-induced oxidative stress on H460 cell viability with a subsequent increase in intracellular ROS levels, which suggest a protective role of STC2 in redox regulatory system of lung cancer. These findings suggest that STC2 can be a potential lung cancer biomarker and plays a positive role in lung cancer metastasis and progression. This article is part of a Special Issue entitled: Medical Proteomics. © 2014 Published by Elsevier B.V.
38 36 35
R
37
1. Introduction
40
Lung cancer is the most common cause of cancer-related deaths worldwide. Despite advances in diagnostics and therapeutics of lung cancer, a 5-year survival rate is still reaching only about 15% [1]. Lung cancer patients are frequently diagnosed in an advanced stage, which makes them suffer in metastatically advanced diseases, resulting in almost 90% death rate due to undetected metastasis progression. Therefore early diagnosis could be another best way for patient's recovery [2]. Unfortunately, most of the current medical standard tumor markers lack sensitivity and specificity for the detection of lung cancer. Historically, radiography and sputum cytology were used for early detection of lung cancer. For the advances of the diagnostic methods, molecular based diagnostics have been studied and proposed by many groups. Proteomic or genomic approach for novel biomarker discovery based on profiling
45 46 47 48 49 50 51 52
U
43 44
N C O
39
41 42
20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
R
E
C
T
E
D
Q31Q2
☆ This article is part of a Special Issue entitled: Medical Proteomics. ⁎ Corresponding author at: Department of Biochemistry, College of Veterinary Medicine, Seoul National University, Daehak-dong, Gwanak-gu, Seoul 151-742, Republic of Korea. Tel.: +82 2 880 1268; fax: +82 2 886 1268. E-mail address: [email protected] (J.-Y. Cho).
differentially expressed proteins or genes has been used for biomarker studies [3]. Due to the advances in techniques of proteomic profiling, the ability to approach secreted proteins in extracellular space and secretome analysis to find new biomarkers has been made possible [4,5]. Although great advancements have been made in proteomic technologies to discover novel biomarkers, the molecular and biochemical mechanism studies of the markers in lung cancer metastasis and progression still require much attention. Stanniocalcin-2 (STC2) is a glycoprotein hormone first known to be involved in calcium and phosphate homeostasis. STC2, originally discovered in fish endocrine gland and corpuscles of Stannius and is known to regulate Ca2+ homeostasis in adult fish by regulating the inhibition of branchial/intestinal Ca2 + uptake and renal Pi exception [6–8]. In the mammalian systems, STC2 is known to be involved in the anti-apoptotic regulatory signaling pathways in endoplasmic reticulum (ER). It is associated with hypoxic stress and known to be regulated by PERK-ATF4 and HIF-1 [9,10]. In some tissues, STC2 is widely expressed and the correlation between STC2 and metastatic cancers has been reported. Previous studies showed that STC2 is overexpressed in several cancer types with poor prognosis [9,11,12]. However, its clinical significance and molecular mechanism in carcinogenesis still remain
http://dx.doi.org/10.1016/j.bbapap.2014.11.002 1570-9639/© 2014 Published by Elsevier B.V.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73
79
2. Materials and methods
80
2.1. Clinical tissue samples and cell lines
81 82
85
A total of 53 tissue samples of lung cancer patients with adenocarcinoma and squamous cell carcinoma were obtained during surgery. These samples were obtained and used in accordance with the institutional ethical guidelines of Seoul National University Bundang Hospital (IRB No. B-1201/143-003) after securing written informed consent. All
t1:1 t1:2
Table 1 Tissue sample information.
76 77
83 84
clinical samples were selected and categorized randomly from a large sample set collected from the affiliate hospital. All patients underwent resection of the primary tumors at Seoul National University Bundang Hospital, Seoul, Korea. All patients were authoritatively identified as having lung cancer based on the clinic-pathological information of the patients from their clinical records (Table 1). Preoperative chemotherapy was not conducted on all patients from where the clinical samples were obtained. Resected and paired tissues were immediately cut and frozen in liquid nitrogen and kept at −80 °C until RNA extraction and complimentary DNA (cDNA) was synthesized as previously described [13]. The human lung cancer cell line, H460 were obtained from the American Type Culture Collection (ATCC) and were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 100 IU/ml penicillin and 100 IU streptomycin antibiotics. The cells were incubated at 37 °C and 5% CO2 in a humidified atmosphere.
O
78
controversial and need to be fully elucidated. Moreover, its involvement and role in lung cancer have not yet been elucidated. In the present study, we sought to investigate STC2 as a potential novel biomarker for lung cancer and identify its putative role in lung cancer cell growth, progression and metastasis.
R O
74 75
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
F
2
Sample no.
Age
Sex
Smoking
Type
TNM
Stage
WB grade
Recurrence
Recurrence free period (month)
t1:4 Q1 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10 t1:11 t1:12 t1:13 t1:14 t1:15 t1:16 t1:17 t1:18 t1:19 t1:20 t1:21 t1:22 t1:23 t1:24 t1:25 t1:26 t1:27 t1:28 t1:29 t1:30 t1:31 t1:32 t1:33 t1:34 t1:35 t1:36 t1:37 t1:38 t1:39 t1:40 t1:41 t1:42 t1:43 t1:44 t1:45 t1:46 t1:47 t1:48 t1:49 t1:50 t1:51 t1:52 t1:53 t1:54 t1:55 t1:56
800 817 826 982 862 923 927 932 936 940 857 877 912 953 956 959 969 971 941 942 992 993 996 999 1003 1009 815 866 851 889 899 831 915 894 888 983 986 880 870 943 794 881 882 937 887 863 839 836 984 1000 1007 917 828
22 63 52 70 70 51 84 69 56 69 75 76 60 53 35 55 76 69 68 51 84 38 64 66 72 78 48 77 65 67 72 71 57 70 68 60 67 56 72 66 75 67 45 64 76 43 45 82 71 56 65 62 80
M F F F M F M M M M M F M F F M M M M M M M M F M F M M M M M M M F F M M M M M M F F M M F M M F F M M M
C (5) N N F (3/1.5) C (30) N F (14/45) F (12/30) N F (2.5/50) F (25/25) N N N N F (1.5/2) C (50) F (6/25) F (1.5/38) C (30) F (20/15) C (20) N N C (50) N C (28) F (16/30) F (12/30) N F (17/5) C (120) C (60) N N F (8/30) F (20/25) F (30/1.5) F (10/10) N N N N C (23) F (6/30) N C (20) N F (3/3) N F (8/20) C (45) C (60)
A A A A S A S S A A A A A A L A A S A A S A A A S A A A S A S S S A A A A A A S A A A S S A A A A A A A S
UK UK 1/0/0 4/0/0 3/1/0 UK 3/0/0 2/1/0 3/1/0 UK 3/0/0 UK UK 2/0/0 UK 3/0/0 3/0/0 2/0/0 2/1/0 UK 4/0/0 UK UK 2/0/0 UK 5/0/0 5/2/0 1/0/0 3/0/0 3/0/0 2/0/0 3/0/0 1/0/0 2/0/0 3/0/0 1/0/0 3/0/0 2/0/0 1/0/0 3/0/0 5/2/0 3/0/0 3/1/0 2/0/0 4/0/0 3/2/1 3/0/0 2/1/0 1/0/0 3/2/0 1/0/0 4/0/0 2/0/0
2 1 1 1 2 3 1 2 2 2 1 1 1 1 2 1 1 1 2 1 2 3 3 1 3 2 3 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1 2 1 2 3 3 2 1 3 1 2 1
†† †† ND † †† †† †† †† ††† †† † ††† ††† †† ND ND †† †† †† ND † †† ND † †† ††† †† †† ††† †† ND † † † † †††† ††† ND †† † †† †† †† † †† ††† †† ††† †† †† ND ND ND
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – † † † † † † † † † † † † † † † –
26 26 26 22 26 23 23 23 23 23 25 25 25 22 22 22 22 22 23 23 20 20 20 20 20 20 23 23 23 23 23 26 24 22 22 22 22 13 19 7 8 15 13 13 18 13 7 13 18 6 14 19 26
t1:57 t1:58
D
E
T
C E
R
R
O C
N
U
P
t1:3
Abbreviations used: A; adenocarcinoma, S; squamous cell carcinoma, L; large cell carcinoma, N; never smoked, F; Former smoker, C; current smoker, UK; unknown, ND; Not detected, –; no-recurrence at present.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
86 87 88 89 90 91 92 93 94 95 96 97 98 99 100
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
2.3. Reverse transcription-polymerase chain reaction (RT-PCR)
121 122
139
RNA extraction and real-time PCR were carried out as previously described [16]. One microgram of total cellular RNA was isolated according to the manufacturer's instructions and cDNA was synthesized using OmniScript cDNA synthesis kit (Qiagen). For the measurement of the STC2 protein expression level in the normal tissues, purified RNA of 20 different organs was purchased (Ambion, Life Technologies, US) and cDNA was synthesized the same method as extracted RNA. Samples for the qRT-PCR were prepared using GoTaq and SYBR Green (Promega) and run on Real-Time PCR System (Bio Rad) using a thermal profile of an initial 5 min denaturing at 95 °C and 30 s melting step at 95 °C, 30 s annealing step at 58 °C, and 30 s extension step at 72 °C, followed by 35 cycles and 72 °C for 5 min as final extension step. The primers used for the analysis were: STC2: (5′-TGAAATGTAAGGCCCACGCT-3′) (forward) and (5′-CGAGGTGCAGAAGCTCAAGA-3′) (reverse) and GAPDH: (5′-ACCACAGTCCATGCCATCAC-3′) (forward) and (5′- TCCACCACCCTG TTGCTGT -3′) (reverse). To verify the presence of only one amplicon, a melting curve was processed after each run. mRNA levels of H460/ shSTC2 and H460/shControl were measured after normalization with GAPDH. All reactions were carried out at least twice in triplicate.
140
2.4. Protein extraction and Western blot analysis
141
Cells were washed twice with pre-cold phosphate-buffered saline quickly and then suspended in protein extraction buffer. Total cell lysates were obtained using a RIPA lysis buffer containing 20 mm Tris–HCl (pH 7.5), 1% Triton X-100, 150 mm sodium chloride, 10% glycerol, 1 mm sodium orthovanadate, 50 mm sodium fluoride, 100 mm phenylmethylsulfonyl fluoride and 1× protease inhibitor (Roche Applied Science) at 4 °C for 2 h. The determination of the protein content was done using Bradford assay according to the manufacturer's instructions. Proteins (20 μg) were resolved under denaturing condition by 12% SDS-PAGE and transferred onto nitrocellulose membranes (Whatman, Germany). The membranes were blocked for 1 h in 5% nonfat skim milk in TBS-T (25 mm Tris–HCl, pH 7.4, 125 mm sodium chloride, 0.05% Tween 20) and incubated with goat antibody to human STC2 (Santa Cruz, 1:1000) or mouse antibody to human β-Actin (Cell signaling, MA, US) at 4 °C overnight. Membranes were then washed three times with TBS-T followed by incubation with horseradish peroxidase-conjugate anti-goat antibody (Bethyl, TX, US, 1:3000) or anti-mouse antibody (Bethyl, TX, US, 1:3000) for 1 h at room temperature. The immune complexes were then detected using a Pierce ECL plus detection kit (Thermo Scientific). The thickness of the bands was
125 126 127 128 129 130 131 132 133 134 135 136 137 138
142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160
C
123 124
E
116 117
R
114 115
R
112 113
N C O
110 111
U
108 109
165
Immunohistochemistry staining was performed as previously reported [16]. Briefly, slides were immersed in a retrieval solution and boiled at 100 °C for 20 min in an autoclave for antigen retrieval. The anti-STC2 antibody (Abnova, 1:50) was applied to each slide after blocking and then the sections were incubated with HRP-labeled antimouse IgG as secondary antibody. DAB solution was used as chromogen and the counterstaining was done with methyl green.
166 167
2.6. Stable short hairpin RNA knockdown of STC2
173
The stable knockdown of STC2 expression in H460 human lung cancer cell line was achieved by the construction of hairpin vectors carrying a puromycin antibiotic resistance gene. Infection of lentiviral particles of shRNA STC2 or shRNA control was done according to the manufacturer's protocol (Santa Cruz). For stable cell population selection, 24 h after transfection, cells were replated in RPMI-1640 (GibcoBRL, Rockville, MD, USA) with 10% (vol/vol) FBS and 3 μg/ml puromycin (Santa Cruz). Puromycin-resistant clones were selected and expanded. The resistant clones were then maintained in the medium containing 0.3 ug/ml of puromycin. The mRNA and protein levels of STC2 in these cells were checked by RT-PCR and Western blot analysis. H460 cells transfected with control vector (H460/shControl) served as the control. The oligonucleotide sequences for shRNA were: shSTC2, forward, GATCCCCGTGGAGATGATCCATTTCATTCAAGAGATG AAATGG ATCATCTCCACTTTTTGGAA; and shSTC2 reverse, AGCTTTTCCAAAAAGT GGAGA TGATCCATTTCATCTCTTGAATGAAATGGATCATCTCCACGGG.
174 175
2.7. Cell growth assessment and colony formation assay
190
Cell growth was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyl-2H-tetrazolium bromide (MTT) assay and trypan blue exclusion test. Briefly, cells were grown in RPMI medium supplemented with 10% heat-inactivated FBS and antibiotics. After 24 h seeding of H460/shSTC2, wild type H460 or vector control, 500 μg/ml of MTT was added to the wells containing cells followed by 3 h incubation under incubation temperature of 37 °C in a humidified atmosphere with 5% CO2. DMSO was added to dissolve MTT. Evaluation was done using a BioTek microplate reader and the absorbance was set to 570 nm for reading. The results were expressed as percentages relative to wild type H460 control. To assess cell numbers, an equal volume of trypan blue (Sigma) at 0.4% (w/v) was added to each cell suspension and cell viability was determined based on the ability of live cells to exclude the vital dye. Hemocytometer was used to count the viable cells. To measure the colony formation, exponentially growing cells were seeded in triplicate in 6-well plates at 1.5 × 103 per well. After incubation at 37 °C for indicated times, cells were fixed with methanol for 5 min followed by staining with 0.005% (w/v) crystal violet for 15 min. Colonies (cell groups containing a minimum of 50 cells) were counted under a phase contrast microscope.
191 192
2.8. Migration and invasion assays
210
Cell migration and invasion assays were performed in 24-well transwell plates (8 μm pore size, Corning, USA). Matrigel was diluted to 1 mg/ml with serum-free culture medium and applied on the insert in the upper chambers of the multiwall for invasion assay plate. 1.0 × 105 cells in 200 μL of serum-free culture medium were seeded in the upper chambers of the wells. For chemotaxis induction of cells, 800 μL of culture medium supplemented with 10% FBS was added to the lower chambers. After incubation for 24 h at 37 °C in humidified
211
F
120
106 107
2.5. Immunohistochemistry
O
118 119
To discover lung cancer derived secreted proteins, conditioned media of primary cultured lung cancer cells and adjacent normal lung cells were analyzed by MS/MS analysis (Sung & Cho, manuscript in preparation). In short, lung cancer tissues obtained during the surgery with their corresponding normal tissues and primary culture of lung tissues were conducted. Twenty-four hours after plating the same number of lung cancer cells and normal lung epithelial cells, the media was replaced with serum free media. Then, after another 24 h, the conditioned media was harvested and proteins were harvested by TCA (Trichloroacetic acid) precipitation method. LC–MS/MS analysis was performed using Thermo Finnigan ProteomeX work station LTQ linear IT MS (Thermo Electron, San Jose, CA, USA) equipped with NSI source (San Jose, CA). MS/MS data was searched based on the IPI human protein database (version 3.29) using the SEQUEST algorithm (Thermo Electron). Scaffold ver. 01_07_00 was used to validate MS/MS based peptides and protein identification.
R O
104 105
P
2.2. Proteomic analysis of primary human lung cancer secretome
161 162
D
103
photographically measured, and the density of a calibration grid slide was calculated using Scion Image (Scion, Frederick, MD). The calculated value of each STC band was divided by its paired β-Actin results and the normalized value was used for further graphical analysis.
E
H460 cells were maintained in 60 mm culture dish and subcultured at various ratios according to their doubling times (22–30 h).
T
101 102
3
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
163 164
168 169 170 171 172
176 177 178 179 180 181 182 183 184 185 186 187 188 189
193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209
212 213 214 215 216 217 218
228 229 230 231
2.9. H202-induced oxidative stress mediated cytotoxicity and intracellular ROS measurement
234
251 252
To determine the effect of STC2 knockdown on the H202-mediated oxidative stress, cell viability was determined by MTT assay. Twentyfour hours after seeding, specific treatments were done with various concentrations of H202 onto H460, H460/shSTC2 and H460/shControl cells in 24-well plates at indicated times. Prior to the absorbance measurement, incubation with 500 μg/ml of MTT for 3 h at 37 °C was conducted. The intensity of the formazan product was measured at 570 nm using a microplate reader. Levels of cellular ROS were determined by flow cytometry (Becton Dickinson, FACSCalibur) as described previously. Briefly, cells were seeded at a density of 1 × 104 cells/ml, in sterile 60 mm dishes and cultured for 24 h. The cells were washed twice and stained with 1 ml of 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) used as a ROSspecific fluorescent probe at 10 μM concentration. Cells were then incubated at 37 °C for 40 min and were analyzed for fluorescence intensity by flow cytometry using a 485 nm excitation beam and a 538 nm bandpass filter. ROS production was expressed as mean fluorescence intensity (MFI) calculated through Cell Quest software (BD Biosciences) analysis of the recorded histograms.
253
2.10. Cell cycle progression analysis
254
269 270
Analysis on the effects of the STC2 knockdown on cell cycle distribution in H460 cells was performed by the method previously described [17]. Cells were seeded in sterile 100 mm dish plates and cultured under the conditions described previously. The cells were harvested, washed twice, and fixed in 70% cold ethanol overnight at − 20 °C. Ethanol-fixed cells were pelleted, washed with ice-cold PBS, and resuspended in staining solution containing 50 μg/mL PI, 0.1% Triton-X-100, 0.1% sodium citrate, and 100 μg/mL RNase. After 1 h of incubation at room temperature in the dark, the fluorescence-activated cells were sorted and cellular DNA content analyzed by flow cytometry using the FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA) equipped with an argon laser and data were evaluated using CellQuest 3.0.1 software (Becton-Dickinson, Franklin Lakes, NJ). At least 20,000 cells were used for each analysis, and the results are displayed as histograms. The proportion of non-apoptotic cells in different phases of the cell cycle was then recorded with at least triplicate and expressed as ± SD.
271
2.11. Statistical analysis
272 273
All experiments were repeated at least three times. All the results were presented as mean ± standard deviations. Student's t test analysis performed from OriginPro 8 from OriginLab Corp. (Northampton, MA, USA). P value b 0.05 was considered statistically significant.
255 256 257 258 259 260 261 262 263 264 265 266 267 268
274 275
C
249 250
E
247 248
R
245 246
R
243 244
O
241 242
C
239 240
N
237 238
U
235 236
279 280 281 282 283 284 285 286 Q6 287 288 289 290 291
3.2. Expression of STC2 in human organs specimens and lung cancer tissues 292 To confirm tissue specific expression of STC2 in various organ tissues, quantitative real-time PCRs were performed on 20 normal organ tissues of healthy humans. The results showed the highest mRNA expression of STC2 in normal hearts and almost no expression of STC2 has been discovered in a normal lung (Fig. 1A). To test STC2 expression levels in lung cancer, mRNAs of 8 pairs of lung cancer tissue samples and their corresponding adjacent normal tissues were subjected to RT-PCR analysis. Although STC2 expression was not detected in few samples due to a low expression in conventional PCR (Fig. 1B), all of the 8 pairs of clinical samples showed significantly higher levels of STC2 in lung cancer tissues than the paired adjacent normal lung tissues in quantitative real-time RT-PCR result analysis (Fig. 1C). Taken together, STC2 mRNA expression increased in lung cancer compared to the normal tissues. From the results, it is suggested that very low expression of STC2 in the normal lung is aberrantly turned on and highly expressed in lung cancer tissues.
293
3.3. Up-regulation of STC2 protein in lung cancer tissues
309
To verify the protein expression of STC2, 53 pairs of lung cancer tissues and its adjacent normal tissues were subjected to Western blot analysis. The results showed that the expression of STC2 protein was significantly higher in lung cancer tissues than that of corresponding adjacent normal tissues (Fig. 2A). While most of the normal tissues showed no or very little expression of STC2, only 3 of the 53 normal samples showed STC2 expression, and 38 cancer tissues showed high to low levels of STC2 expression. The WB results were analyzed by densitometry and the values of STC2 levels were normalized by the β-Actin densitometry value (Fig. 2B). From the 53 tissue samples, 39 (73.6%) samples had up-regulated STC2 expression and 5 (9.4%) samples showed down-regulated STC2 in lung cancer tissues than the adjacent normal tissues. There were no changes between the lung cancers and the adjacent normal in 9 samples. To check the correlation between cancer stages and STC2 expression, we analyzed the STC2 Western blot analysis results based on the clinical information; cancer stage or TNM stage, however there was no significant correlation. To see the correlation between STC2 protein expression and recurrence of patient exists, WB data was analyzed based on the clinical information of each patient. Sixteen samples out of 53 were the tissue samples of the patients who showed recurrence within 7 to 19 months after surgery. Among the 16 samples, 9 samples, about 56% showed increased STC2 in lung cancers (Fig. 2A, lower panel). There was no significant correlation between recurrence and STC2 expression. However, all
310 311
T
232 233
F
226 227
To discover lung cancer specific protein, the secretomes collected from primary cultured lung cancer cells and adjacent normal lung cells were analyzed by MS/MS analysis (Sung & Cho, manuscript in preparation). Lung cancer tissue and its corresponding normal tissues of two lung cancer patients were used for the analysis. From the semiquantitative data, STC-2 appears with higher peptide hit in the lung cancer secretome compared to the adjacent normal cells. Relative values, peptide spectral count divided by total ion current (TIC), of the normal and lung cancer samples were 12.21 and 24.56, and 1 and 9.47 in each patient's data showing 2.0 or 9.4, respectively fold change in lung cancer primary cell secretome (data not shown). From the spectral count data, STC-2 appears with higher peptide hit in the lung cancer secretome compared to the adjacent normal cells.
O
225
3.1. MS/MS spectrometry quantifies overexpression of STC2 in secretome of 277 lung cancer compared to normal tissues 278
R O
223 224
276
3. Results
P
221 222
5% CO2 atmosphere, the membrane inserts were removed and the noninvading cells were removed from the upper surface of the membrane. Migrated or invaded cells were stained with 0.1% crystal violet for 20 min and washed water. The invading cells were counted in 5 random fields by cell confluence measuring program in JuLI FL microscope (NanoEntek, Korea). To further support the migration studies, a wound or scratch assay was conducted. A monolayer of cell was cultured in a 4-well plate and then a wound space was made with a 1 mm width tip. Cell monolayers were then washed with PBS and replaced with fresh new culture media and allowed to migrate for indicated times. Micrographs were taken under a phase-contrast microscope (×100) and wound spaces were measured from 5 random fields using the same program in JuLI FL microscope.
D
219 220
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
E
4
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
294 295 296 297 298 299 300 301 302 303 304 305 306 307 308
312 313 Q7 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334
5
D
P
R O
O
F
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
C
E
R
341 342
3.4. STC2 knock down slows down the cell growth and colony formation 345 Q9 and arrests cell cycle 346 To further investigate the molecular mechanism of STC2 in the lung 347 cancer progression, a stable STC2 knock-downed H460 lung cancer cell 348
R
339 340 Q8
immunohistochemical analysis also showed overexpression of STC2 in 343 the lung cancer cells. 344
N C O
337 338
the 5 female patients with recurrence had high STC2 expression levels in the lung cancer tissues (Table 1). To verify STC2 expression and further prove whether STC2 is directly secreted from lung cancer cells, immunohistochemical analysis was conducted on tissue paraffin sections of lung cancer patients (n = 5) with corresponding normal tissues. A strong positive expression of STC2 was detected in all of the tissue samples (Fig. 3A) while weak signals were found on the adjacent normal tissues (Fig. 3B). The STC2
U
335 336
T
E
Fig. 1. Expression of STC2 mRNA in human normal organ specimens, lung cancers and their adjacent normal tissues. (A) Tissue specificity of STC-2 is confirmed by real-time RT- quantitative PCR from the cDNAs of various human organs. (B) Conventional RT-PCR data of STC2 mRNA expression in lung cancer tissues and its adjacent normal tissues of 8 individuals. (C) Quantification of STC2 mRNA expression level by real-time RT-qPCR analysis in the same samples used in conventional PCR.
Fig. 2. Verification of STC-2 protein expression increase in the lung cancer tissues compared to adjacent normal tissues. (A) Results of Western blot analysis of STC-2 in human lung cancer tissue samples (LC) with their corresponding adjacent normal tissues (N). Same amounts of protein were loaded and the STC2 was detected. (Number above the blots indicates patient sample number listed in Table 1) (B) Densitometry data of the Western blot was shown in line graphs. Red lines indicate the STC2 expression of patients with recurrence.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
O
F
6
P
D
E
T C E R
358 359
R
356 357
O
354 355
of STC2 on cell cycle progression through FACS analysis (Fig. 4D). Significant accumulation of cells at the G0/G1 phase was observed in shSTC2 cells. It suggests that the attenuation of the cell proliferation in shSTC2 cells might be due to cell cycle arrest to G0/G1. In addition, a slight increase of cell population in sub G1 phase suggests that the initial cell cycle arrest in shSTC2 cells might lead to apoptosis and that shSTC2 partially render the lung cancer cells to G0/G1 cell cycle arrest. These results strongly suggest that STC2 is involved in the maintenance of lung cancer cell proliferation. Previous report in liver cancer also supported our results by showing that STC2 is involved in the metastasis and progression of hepatocellular carcinoma [18].
C
352 353
line was developed via lentiviral infection carrying STC2 short hairpin RNA (shSTC2), and proliferative activity of the cells were examined. Almost complete knock down of STC2 in the established stable cell line was confirmed at a protein level by WB analysis (Fig. 4A). Cell proliferation and colony formation assay were performed in shSTC2 stable H460 cells. STC2 knockdown significantly attenuated cell growth in a time-dependent manner from 24 h to 72 h as analyzed by MTT assay and trypan blue cell counting (Fig. 4B). Colony formation assay also showed a decrease in the STC2 knock-downed H460 cell line compared to shControl group (Fig. 4C). To confirm the mechanism of STC2 affecting the cell growth of H460, we then elucidated the effect
N
350 351
U
349
R O
Fig. 3. Immunohistochemical analysis of STC2 protein expression in normal lung and lung cancer tissues. STC2 expression was confirmed by immunohistochemistry on paraffin embedded tissue sections of a normal lung (A), and lung cancer tissue (B).
Fig. 4. STC2 knockdown slowed down cell growth and delayed cell cycle in H460 cells. (A) The shRNA efficiency was determined by Western blot in the H460 cells infected with lentiviral particles of shRNA control or STC2 shRNA. (B) The STC2 knockdown inhibits the cell proliferation of H460 cells after 24–72 h. Bar graph (left) shows MTT assay results and line graphs (right) shows results of cell counting with trypan blue staining. (C) The shSTC2 significantly suppresses cell colony formation of H460 cells. (D) PI-based FACS analysis was performed in the H460 cells. The shSTC2 resulted in significant cell cycle arrest at G0/G1 phase.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
360 361 362 363 364 365 366 367 368 369 370
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
3.5. STC2 knock down reduced the cell migration and invasion
372 373
We then investigated the effects of the stable STC2 knockdown on the migration or metastatic activity of lung cancer cells. Cell migration, invasion and wound healing assays were employed in H460 cells. To assess the migration activity, wound-healing experiments on a cell monolayer were carried out (Fig. 5A). A time course analysis from 0 to 18 h was conducted after a wound scratch was inflicted. At 9 h and 18 h time points, there was a significant difference between shControl
O R O P D E T C E R R
377 378
N C O
376
U
374 375
cells and STC2 knockdown cells. It took less than 20% migration even after 18 h after scratch. To further confirm the STC2 effect on cancer cell migration and invasion, Boyden chamber assay was conducted without (for migration) or with (for invasion) basement membrane matrigel coated. Similar to wound healing assay results, STC2 knock-downed cells showed less migration ability and less invasiveness than control cells (Fig. 5B and C). Overall, migration velocity and invasiveness was greatly reduced by STC2 knockdown in H460 lung cancer cells.
F
371
7
Fig. 5. STC2 silencing suppressed cell migration and invasion of H460 cells. (A) Margins of linear wounds created by scraping confluent cell in wound-healing assay. The “wounded” areas were examined at the indicated time points, 0 h, 9 h and 18 h after scratch. Under 100× magnification. (B & C) Migration and invasion of the cells were determined by Boyden chamber assay without (B) or with (C) a layer of matrigel-coating solution, respectively. Cells were stained and visualized with crystal violet staining.
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
379 380 381 382 383 384 385 386 387
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
408 409 410 411 412 413 414 415 416
F
O
C
406 407
E
404 405
R
402 403
R
400 401
O
398 399
421 422 Q10
C
396 397
In this study, we present STC2 as a biomarker secreted by lung cancer cells and validate that its mRNA and protein levels are significantly increased in the lung cancer tissues than in adjacent normal. These lung cancer data are consistent with the observations reported for gastric cancers and laryngeal squamous cell carcinoma etc. [21,22]. For further elucidation of the molecular function of STC2 in lung cancer progression, a stable STC2 knockdown H460 lung cancer cell line was established and the effects on cancer cell growth, migration, invasion, cell cycle progression, and ROS-regulated oxidative stress were examined. The results turned out that STC2 might be involved in lung cancer progression by promoting cell proliferation, migration and invasion. For the last decade, cancer biomarker discovery has been massively conducted by many researchers for its anticipated clinical role in the diagnosis and prognosis of various cancers [23]. Along with the advancement of proteomic technologies, it is expected that new biomarkers discovered in the future could improve the diagnosis and therapeutic rate. In the case of lung cancer, the majority cancer related death is due to the diagnosis at advanced stages. Development of novel and specific biomarkers for lung cancers for early detection might help the current clinical situations. In this study through the aid of MS/MS analysis, we found STC2 up-regulation in the secretome of primary cultured lung cancer cells. Stanniocalcin (STC) is a calcium-regulating hormone first found in bony fishes and known to be released into the blood to regulate the
N
394 395
420
U
393
4. Discussion
R O
Reactive oxygen species have long been known to be associated with increasing cell growth and metabolism of various cancers [19]. Accordingly, increased levels of ROS production and accumulation are often demonstrated in lung cancers [20]. Since a high level of intracellular ROS can induce cell death and considering our findings on the cell arrest induction in sub G1 cell cycle progression by STC2 knock down, we further investigated the effect of the STC2 knockdown on the intracellular levels of ROS in H460 cells. We first identified if the STC2 knockdown can attenuate the cell viability upon oxidative stress via H2O2 on H460 cells. STC2 knock-downed cells were significantly affected and died more by H2O2 induced oxidative stress suggesting that STC2 might have protection effect on the cell growth against oxidative stress induced by H2O2 (Fig. 6A). In line with the hypothesis that the accumulation on the sub G1 phase might be due to the induction of ROS levels, we found out that STC2 knockdown caused subsequent increase in the intracellular ROS levels in H460 cells when compared to both wild type and control vector cells. The results revealed that STC2 knockdown caused a 75.44 to 77.11% increase in ROS levels when the ROS levels of wild type and shControl H460 cells were set as a 100% standard control (Fig. 6B). We incorporated the ROS inhibitor NAC to evaluate whether its anti-oxidative function works in STC2 deprived cells. NAC treatment caused the ROS levels to decline from 2.7 to 34% in all of the combinations with mock, shControl and shSTC2 cells. These events might contribute to the complexity of the many major sources of excessive ROS generation in specific cancer cells and tissues and the relation of the endogenous ROS levels to various signaling molecules including their biological responses.
391 392
P
390
These results infer that STC2 overexpressed in cancer cells can 417 protect the cells from oxidative stress induced in cancer microenviron- 418 ments and thus promote lung cancer cell survival and progression. 419
D
3.6. Knockdown of STC2 attenuates the H202-induced oxidative stress and increases intracellular ROS
T
388 389
E
8
Fig. 6. Effects of STC2 knockdown on the cancer cell viability after oxidative stress induction stress by H2O2. H460 cells were infected with shControl virus or shSTC2 virus. After treating the cells with various H2O2 doses, MTT assays were performed to test cell viability in 24, 48 and 72 h (A). shControl and shSTC2 expressing H460 cells were treated with or without NAC ROS-inhibitor for 24 h and were subsequently tested for FACS analysis. DCFH-DA fluorescent dye was used for intracellular ROS staining prior to the analysis (B).
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002
423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444
S. Na et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx
466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499
500 Q11 5. Uncited references 501 502 503 504
[14,15] Acknowledgment
This work was supported by Proteogenomics Research Program grants (No. 2012M3A9B9036669) through the National Research 505 Q12 Foundation of Korea (NRF) grant funded by the Ministry of Science, 506 Q13 ICT & Future Planning (MSIP), Korean Foundation for Cancer Research
O
F
511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587
R O
464 465
[1] R. Siegel, J. Ma, Z. Zou, A. Jemal, Cancer statistics, 2014, CA Cancer J. Clin. 64 (2014) 9–29. [2] R. Etzioni, N. Urban, S. Ramsey, M. McIntosh, S. Schwartz, B. Reid, J. Radich, G. Anderson, L. Hartwell, The case for early detection, Nat. Rev. Cancer 3 (2003) 243–252. [3] H.-J. Sung, J.-Y. Cho, Biomarkers for the lung cancer diagnosis and their advances in proteomics, BMB Rep. 41 (2008) 615–625. [4] V. Kulasingam, E.P. Diamandis, Strategies for discovering novel cancer biomarkers through utilization of emerging technologies, Nat. Clin. Pract. Oncol. 5 (2008) 588–599. [5] M. Makridakis, A. Vlahou, Secretome proteomics for discovery of cancer biomarkers, J. Proteomics 73 (2010) 2291–2305. [6] G. Flik, T. Labedz, J. Neelissen, R. Hanssen, S. Wendelaar Bonga, P. Pang, Rainbow trout corpuscles of Stannius: stanniocalcin synthesis in vitro, Am. J. Physiol. Regul. Integr. Comp. Physiol. 258 (1990) R1157–R1164. [7] M. Lu, G.F. Wagner, J.L. Renfro, Stanniocalcin stimulates phosphate reabsorption by flounder renal proximal tubule in primary culture, Am. J. Physiol. Regul. Integr. Comp. Physiol. 267 (1994) R1356–R1362. [8] G.F. Wagner, E.M. Jaworski, M. Haddad, Stanniocalcin in the seawater salmon: structure, function, and regulation, Am. J. Physiol. Regul. Integr. Comp. Physiol. 274 (1998) R1177–R1185. [9] D. Ito, J.R. Walker, C.S. Thompson, I. Moroz, W. Lin, M.L. Veselits, A.M. Hakim, A.A. Fienberg, G. Thinakaran, Characterization of stanniocalcin 2, a novel target of the mammalian unfolded protein response with cytoprotective properties, Mol. Cell. Biol. 24 (2004) 9456–9469. [10] A. Law, C.K. Wong, Stanniocalcin-2 is a HIF-1 target gene that promotes cell proliferation in hypoxia, Exp. Cell Res. 316 (2010) 466–476. [11] K. Tamura, M. Furihata, S.Y. Chung, M. Uemura, H. Yoshioka, T. Iiyama, S. Ashida, Y. Nasu, T. Fujioka, T. Shuin, Stanniocalcin 2 overexpression in castration‐resistant prostate cancer and aggressive prostate cancer, Cancer Sci. 100 (2009) 914–919. [12] S. Volland, W. Kugler, L. Schweigerer, J. Wilting, J. Becker, Stanniocalcin 2 promotes invasion and is associated with metastatic stages in neuroblastoma, Int. J. Cancer 125 (2009) 2049–2057. [13] K.-A. Yoon, H.-S. Cho, H.-I. Shin, J.-Y. Cho, Differential regulation of CXCL5 by FGF2 in osteoblastic and endothelial niche cells supports hematopoietic stem cell migration, Stem Cells Dev. 21 (2012) 3391–3402. [14] J.L. Alcorn, M.E. Smith, J.F. Smith, L.R. Margraf, C.R. Mendelson, Primary cell culture of human type II pneumonocytes: maintenance of a differentiated phenotype and transfection with recombinant adenoviruses, Am. J. Respir. Cell Mol. Biol. 17 (1997) 672–682. [15] S.H. Heo, S.J. Lee, H.M. Ryoo, J.Y. Park, J.Y. Cho, Identification of putative serum glycoprotein biomarkers for human lung adenocarcinoma by multilectin affinity chromatography and LC–MS/MS, Proteomics 7 (2007) 4292–4302. [16] H.J. Sung, J.M. Ahn, Y.H. Yoon, T.Y. Rhim, C.S. Park, J.Y. Park, S.Y. Lee, J.W. Kim, J.Y. Cho, Identification and validation of SAA as a potential lung cancer biomarker and its involvement in metastatic pathogenesis of lung cancer, J. Proteome Res. 10 (2011) 1383–1395. [17] C. Schorl, J.M. Sedivy, Analysis of cell cycle phases and progression in cultured mammalian cells, Methods 41 (2007) 143–150. [18] H.X. Wang, Y. Sun, M.Y. Wu, Y.J. Wei, B. Cai, STC2 is upregulated in hepatocellular carcinoma and promotes cell proliferation and migration in vitro, Biochem. Mol. Biol. Rep. 45 (2012) 629–634. [19] J. Huang, G.Y. Lam, J.H. Brumell, Autophagy signaling through reactive oxygen species, Antioxid. Redox Signal. 14 (2011) 2215–2231. [20] N. Azad, Y. Rojanasakul, V. Vallyathan, Inflammation and lung cancer: roles of reactive oxygen/nitrogen species, J. Toxicol. Environ. Health B 11 (2008) 1–15. [21] T. Yokobori, K. Mimori, H. Ishii, M. Iwatsuki, F. Tanaka, Y. Kamohara, K. Ieta, Y. Kita, Y. Doki, H. Kuwano, Clinical significance of stanniocalcin 2 as a prognostic marker in gastric cancer, Ann. Surg. Oncol. 17 (2010) 2601–2607. [22] H. Zhou, Y.-Y. Li, W.-Q. Zhang, D. Lin, W.-M. Zhang, W.-D. Dong, Expression of Stanniocalcin-1 and Stanniocalcin-2 in Laryngeal Squamous Cell Carcinoma and Correlations with Clinical and Pathological Parameters, PLoS One 9 (2014) e95466. [23] J.A. Ludwig, J.N. Weinstein, Biomarkers in cancer staging, prognosis and treatment selection, Nat. Rev. Cancer 5 (2005) 845–856. [24] G.F. Wagner, E. Jaworski, Calcium regulates stanniocalcin mRNA levels in primary cultured rainbow trout corpuscles of stannius, Mol. Cell. Endocrinol. 99 (1994) 315–322. [25] A.C. Chang, D. Jellinek, R. Reddel, Mammalian stanniocalcins and cancer, Endocr. Relat. Cancer 10 (2003) 359–373. [26] K. Ieta, F. Tanaka, T. Yokobori, Y. Kita, N. Haraguchi, K. Mimori, H. Kato, T. Asao, H. Inoue, H. Kuwano, Clinicopathological significance of stanniocalcin 2 gene expression in colorectal cancer, Int. J. Cancer 125 (2009) 926–931. [27] K. Joensuu, P. Heikkilä, L.C. Andersson, Tumor dormancy: elevated expression of stanniocalcins in late relapsing breast cancer, Cancer Lett. 265 (2008) 76–83. [28] H.-A. Meyer, A. Tölle, M. Jung, F.R. Fritzsche, B. Haendler, I. Kristiansen, A. Gaspert, M. Johannsen, K. Jung, G. Kristiansen, Identification of stanniocalcin 2 as prognostic marker in renal cell carcinoma, Eur. Urol. 55 (2009) 669–678.
P
462 463
510
D
460 461
References
E
458 459
(CB-2011-02-01), grant No. HI13C-2098-030013 from the Ministry for 507 Health and Welfare and grant No. B-1201/143-003 from the SNUBH 508 Research Fund. 509
T
456 457
C
454 455
E
452 453
R
451
R
449 450
N C O
447 448
Ca2+ and phosphate uptake in different target organs [24]. The human STC2 gene encoding 302 amino acid long protein is primarily expressed in the kidney, heart, pancreas, and spleen [25]. In several different human cancers, aberrant expression of STC2 has been studied. It is reported that the STC2 expression is up-regulated in gastric cancers, colorectal cancer, breast cancer and renal cell carcinoma [21,26–28]. In some studies, it is revealed that STC2 overexpression has been involved with poor prognosis and cancer recurrence in colorectal and prostate cancers [11,26]. Another previous report has shown the involvement of STC2 in tumor progression and metastasis. In addition, on contrary to STC1, STC2 has been consistently found to have an anti-apoptotic mechanism in some cancers, by inhibiting plasma membrane storeoperated Ca2+entry (SOCE), which protects cells from apoptotic factors [9]. One noted characteristic of STC2 is that its contribution to carcinogenesis is selective, depending on the type of cancer. However, correlation of STC2 and human lung cancers has never been studied and notable functional relationship has not yet been fully studied until this study. The mass spectrometry data STC2 increase in the secretome of lung cancer cells were also validated by RT-qPCR and WB analyses. Considering the elevated expression of STC2 in lung cancer tissues, it can be assumed that STC2 is directly related to cancer prognosis. However; data analysis based on the patients' information revealed that there was no significant correlation between STC2 expression and recurrence of lung cancers after surgery. Although, no significant difference was found, all female patients with recurrence had high levels of STC2 protein expression. The sample numbers tested in this study was not enough to conclude clearly. Further study with large number of clinical cases may be needed to confirm this result. This study further extends the preliminary conclusion that STC2 can serve as a biomarker for lung cancer with clinical relevance, to molecular function in lung cancer in vitro. In the early stages of cancer development, cell proliferation ability is a major contribution to cancer progression. This study revealed that STC2 knockdown in H460 cells decreased cell proliferation, colony formation capacity, induced G0/G1 cell cycle arrest. We further demonstrated that STC2 knockdown attenuated cell viability induced by H202 oxidative stress and increased intracellular ROS levels which propose a redox regulatory function for STC2. From these result, it can be inferred that STC2 expression in the early stage of cancer could promote cancer formation by inducing cell proliferation. In addition to proliferation, migration and invasion are the basic processes involved in carcinogenesis, resulting in distant metastasis. Cell migration is considered a critical feature of some physiological and pathological phenomena, which include development, wound repair, angiogenesis, and metastasis. The high metastatic characteristic of lung cancer is pointed out as one of the main causes of death in patients with lung cancer. In vitro studies revealed that STC2 knockdown decrease cell migration and invasion ability. These results indicate that STC2 expression not only affects tumor growth by promoting cell proliferation but also has an influence on cancer progression by inducing cell migration and invasion. In conclusion, STC2 is overexpressed in lung cancer tissues, which lead to cancer progression by inducing cell proliferation, migration and invasion. These results implicate that STC2 is a potential biomarker for lung cancer and might play a critical function in lung carcinogenesis.
U
445 446
9
588
Please cite this article as: S. Na, et al., Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.11.002