- Email: [email protected]
Staphylococcus aureus and Escherichia coli elicit different innate immune responses from bovine mammary epithelial cells
Veterinary Immunology and Immunopathology 155 (2013) 245–252
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Research paper
Staphylococcus aureus and Escherichia coli elicit different innate immune responses from bovine mammary epithelial cells Fu Yunhe a , Zhou Ershun a , Liu Zhicheng a , Li Fenyang a , Liang Dejie a , Liu Bo a , Song Xiaojing a , Zhao Fuyi a , Fen Xiaosheng b , Li Depeng a , Cao Yongguo a , Zhang Xichen a , Zhang Naisheng a , Yang Zhengtao a,∗ a Department of Clinical Veterinary Medicine, College of Veterinary Medicine, Jilin University, Changchun, Jilin Province 130062, People’s Republic of China b Guangdong Institute of Modern Agricultural Group, Guangzhou, Guangdong Province, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 10 October 2012 Received in revised form 7 August 2013 Accepted 13 August 2013 Keywords: Escherichia coli Staphylococcus aureus Bovine mammary epithelial cells TLR4 TLR2 NF-B
a b s t r a c t Escherichia coli and Staphylococcus aureus are the most important pathogenic bacteria causing bovine clinical mastitis and subclinical mastitis, respectively. However, little is known about the molecular mechanisms underlying the different host response patterns caused by these bacteria. The aim of this study was to characterize the different innate immune responses of bovine mammary epithelium cells (MECs) to heat-inactivated E. coli and S. aureus. Gene expression of Toll-like receptor 2 (TLR2) and TLR4 was compared. The activation of nuclear factor kappa B (NF-B) and the kinetics and levels of cytokine production were analyzed. The results show that the mRNA for TLR2 and TLR4 was up-regulated when the bovine MECs were stimulated with heat-inactivated E. coli, while only TLR2 mRNA was up-regulated when the bovine MECs were stimulated with heat-inactivated S. aureus. The expression of tumor necrosis factor-␣ (TNF-␣), interleukin (IL)-1, IL-6 and IL-8 increased more rapidly and higher when the bovine MECs were stimulated with heat-inactivated E. coli than when they were stimulated with heat-inactivated S. aureus. E. coli strongly activated NF-B in the bovine MECs, while S. aureus failed to activate NF-B. Heat-inactivated S. aureus could induce NF-B activation when bovine MECs cultured in medium without fetal calf serum. These results were confirmed using TLR2- and TLR4/MD2-transfected HEK293 cells and suggested that differential TLR recognition and the lack of NF-B activation account for the impaired immune response elicited by heat-inactivated S. aureus. © 2013 Published by Elsevier B.V.
1. Introduction Bovine mastitis, an infection of the bovine mammary gland, is a highly prevalent and important infectious disease of dairy cattle (Blosser, 1979; Seegers et al., 2003).
∗ Corresponding author at: Department of Clinical Veterinary Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Changchun, Jilin Province 130062, People’s Republic of China. Tel.: +86 431 87981688; fax: +86 431 87981688. E-mail address: [email protected] (Z. Yang). 0165-2427/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.vetimm.2013.08.003
It can cause a decline in milk production and quality and result in great losses to the dairy industry worldwide. Mastitis can be caused by more than 150 different types of pathogens. In most cases, an infection with Gram-negative bacteria, such as Escherichia coli (E. coli), can often cause clinical mastitis, which is characterized as an acute and severe infection that can be cleared within a few days (Vangroenweghe et al., 2005). In contrast, an infection with Gram-positive bacteria, such as Staphylococcus aureus (S. aureus), often causes a chronic and persistent subclinical mastitis (Taponen and Pyorala, 2009). The molecular
246
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
mechanisms by which different pathogens induce different responses during mammary gland infections are poorly understood. The innate immune system and the immunological functions it mediates are the host’s first line of defense against the invading pathogens during mastitis (Blosser, 1979; Hoffmann et al., 1999). It plays an important role during the early stages of infection. The innate immune system recognizes highly conserved motifs shared by diverse pathogens, which are called pathogen-associated molecular patterns (PAMPs), via pattern recognition receptors (PRR). Toll-like receptors (TLRs) are one of the PRRs that recognize the conserved components of pathogens, or pathogen-associated molecular patterns, and initiate the innate immune response (Akira et al., 2001; Beutler et al., 2003). Reports have recently identified 13 different Tolllike receptors (TLRs) (Akira et al., 2006; Alexopoulou et al., 2001; Takeda and Akira, 2005), and 10 different bovine TLRs have been described (McGuire et al., 2006). Each of the TLRs has their own ligand and functional characteristics. For example, TLR2 recognizes lipoteichoic acid (LTA) and peptidoglycan (PGN) from Gram-positive bacteria, e.g., S. aureus (Schroder et al., 2003; Takeuchi et al., 2000). TLR4 recognizes lipopolysaccharide (LPS) from Gram-negative bacteria, e.g., E. coli. Cytokines, an important group of inflammatory mediators, play an important role in the host innate immune response to infection. Tumor necrosis factor-␣ (TNF-␣) and interleukin (IL)-1 are major pro-inflammatory cytokines that mediate the inflammatory response at both the local and systemic levels (Mueller et al., 2001; Singh et al., 2004). TNF-␣ is an endogenous pyrogen that causes fever and stimulates endothelial cells and leukocytes to release various inflammatory mediators (e.g., NO and oxygenfree radicals), thereby promoting neutrophil phagocytosis. It plays a crucial role in the pathological damage from inflammation and septic shock and is the key mediator contributing to endotoxin shock (Su et al., 2010). IL-1 acts on target cells to boost the synthesis of acute phase proteins and generate inflammatory responses such as fever (Zheng et al., 1995). In addition, this cytokine induces the expression of cellular adhesion molecules, attracts aggregates of neutrophils, stimulates immune cells and endothelial cells to produce various inflammatory cytokines and chemokines and promotes the generation and release of neurotoxic compounds (Dustin et al., 1986). IL-6 is one of the most common inflammatory cytokines (Hodge et al., 2005; Martin, 1999). Circulating levels of IL-6 have been shown to be excellent predictors of the severity of acute respiratory distress syndrome (ARDS) of different etiologies, such as sepsis and acute pancreatitis (Leser et al., 1991). IL-8 is an important chemokine that recruits neutrophils to the infection site. Apart from the innate immune cells, the mammary epithelial cells (MECs) play an important role in udder immunity (Griesbeck-Zilch et al., 2008). They can recognize the PAMPs of invading pathogens via PRR, such as TLRs, and induce the secretion of cytokines and chemokines. Additionally, they can express bactericidal -defensins, acute phase proteins that help fight off pathogens (Isobe et al., 2009). In this study, we used bovine MECs to investigate
the immune defense mechanisms in the udder. We compared the key factors produced by these cells in response to treatment with heat-inactivated S. aureus and E. coli. In addition, we tested if fetal calf serum (FCS) could affect NFB activation by heat-killed S. aureus and E. coli in bovine MECs. 2. Materials and methods 2.1. Cell culture and challenge with mastitis pathogens Epithelial cells from the bovine mammary gland were separated using procedures that have been described previously (Hu et al., 2009). Animal experiments were done in accordance with the guidelines on animal care and use established by the Jilin University Animal Care and Use Committee. The protocols were reviewed and approved by the committee. Six healthy lactating Chinese Holstein cows were selected on the basis of milk somatic cell counts (SCC) and clinical investigations. Then the cows were killed and the mammary tissues obtained from six Holstein cows were transported on ice to the laboratory within 1–1.5 h of harvesting. The mammary tissue was cut into 1-cm3 pieces and washed with D-Hank’s solution several times, until the solution was pellucid and did not contain any milk. The tissue was then cut into 1-mm3 pieces and washed with D-Hank’s solution until clean. The tissue pieces were transferred into cell culture flasks that were coated with rat-tail collagen. The culture flasks were incubated at 37 ◦ C in 5% CO2 . After 4 h, 3 mL of DMEM/F12 basal media were added to every culture flask. After 12 h, 2 mL of the basal media were added. The media was changed once every 48 h until the cells were spread across the bottom of the culture flask. The fibroblasts were digested with Trypsin (0.25%) supplemented with 0.1% EDTA-2Na. The pure MECs were isolated after 3 passages for subsequent experiments. HEK293-TLR2 and HEK293-TLR4/MD2 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FCS. We challenged bovine MECs or HEK293-TLRs cells with heat-inactivated mastitis pathogens E. coli strain 1303 and S. aureus capsular polysaccharide type 5 strain. Heat inactivation of the pathogens was conducted at 80 ◦ C for 1 h. Inactivation efficiency was tested on blood agar plates. The cells were stimulated with 200 g/mL of heat-inactivated E. coli or 200 g/mL of heat-inactivated S. aureus bacteria debris. Bovine MECs were stimulated by LPS (g/mL) or LTA (g/mL) as positive controls. 2.2. RNA extraction and qRT-PCR The total RNA was isolated from the MECs at 1, 3, 6, 12 and 24 h after treatment with heat-inactivated E. coli, heat-inactivated S. aureus, LPS or LTA. The total RNA was extracted using TRIzol (Invitrogen) by following the manufacturer’s instructions. The RNA was reverse-transcribed into cDNA using a Revert Aid First Strand cDNA Synthesis Kit (Thermo). The relative mRNA concentrations were detected by qRT-PCR using a 7500 Fast Real-Time PCR System (Applied Biosystems) and a SYBR green Plus reagent kit (Roche), as has already been described elsewhere (Arms
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
247
Table 1 Sequence of primers used in current investigation in qRT-PCR. Gene
Primer
Sequence 5 > 3
Product size (bp)
TLR2
Sense Anti-sense
CGATGACTACCGCTGTGACTC CCTTCCTGGGCTTCCTCTT
224
TLR4
Sense Anti-sense
TGCCTTCACTACAGGGACTTT TGGGACACCACGACAATAAC
101
-Defensin 5
Sense Anti-sense
GTCTGCTGGGTCAGGATTTAC CCCGAAACAGGTGCCAAT
121
IL-1
Sense Anti-sense
AGGTGGTGTCGGTCATCGT GCTCTCTGTCCTGGAGTTTGC
195
IL-6
Sense Anti-sense
ATGCTTCCAATCTGGGTTC TGAGGATAATCTTTGCGTTC
269
IL-8
Sense Anti-sense
ACACATTCCACACCTTTCCA GGTTTAGGCAGACCTCGTTT
124
TNF-a
Sense Anti-sense
ACGGGCTTTACCTCATCTACTC GCTCTTGATGGCAGACAGG
140
-Actin
Sense Anti-sense
TCACCAACTGGGACGACA GCATACAGGGACAGCACA
206
et al., 2010). The primers used for qRT-PCR are listed in Table 1. Each sample was run in three times to generate a single product. Melt curves were used to analyses and assess the accuracy of the PCR. 2−Ct values were chosen to evaluate the expression of candidate genes. The -actin was acted as an internal calibrator within each sample to calculate Ct . Ct = Ct (target gene) − Ct (housekeeping gene). The Ct = Ct (treatment) − Ct (control). The fold change in expression was then used as a relative measure of gene expression. 2.3. Western blot analysis When the bovine MECs reached 80% confluence in a 6-well dish, the cells were stimulated with 200 g/mL of heat-killed E. coli or 200 g/mL of heat-killed S. aureus for 30 min. The cellular proteins were then extracted using a Nuclear and Cytoplasmic Protein Extraction Kit (Thermo) according to the manufacturer’s protocol. HEK293-TLRs cells were stimulated with pathogens in medium free of FCS or contain of 10% FCS. The total proteins from HEK293 cells were extracted with M-PER Mammalian Protein Extraction Reagent (Thermo). The protein concentration was determined by the BCA method. The proteins were separated by SDS-PAGE using Tris–HCl Precast Gels (Invitrogen) and then transferred onto a PVDF membrane. After blocking nonspecific sites with a blocking solution (5% (wt/vol) nonfat dry milk), the membrane was incubated overnight with the specific primary antibody at 4 ◦ C. The membrane was then incubated for an additional 60 min with a horseradish peroxidase-conjugated secondary antibody at room temperature. The blots were again washed with PBS-T and then developed with an ECL Plus Western Blotting Detection System. Rabbit mAb p65 and phosphor-p65 were purchased from Cell Signaling Technology Inc (Beverly, MA, USA). -actin was purchased from Tianjin Sungene Biotech Co., Ltd (Tianjin, China). HRP-conjugated goat anti-rabbit antibody was purchased from GE Healthcare (Buckinghamshire, UK).
2.4. Statistical analysis All values are expressed as the means ± SEM. The differences between mean values of the normally distributed data were analyzed using a one-way ANOVA (Dunnett’s ttest) and two-tailed Student’s t-test. Statistical significance was defined as P < 0.05 or P < 0.01. 3. Results 3.1. Effect of heat-inactivated E. coli and heat-inactivated S. aureus on the expression of TLR2 and TLR4 in bovine MECs The mRNA for TLR2 was up-regulated when bovine MECs were stimulated with heat-inactivated E. coli or heatinactivated S. aureus. A significant up-regulation in this gene was observed 3 h after treatment of the cells with heat-inactivated E. coli or heat-inactivated S. aureus. The level of mRNA for TLR2 decreased thereafter. However, the up-regulation of TLR2 was much lower when bovine MECs were stimulated with heat-inactivated S. aureus (Fig. 1). The mRNA level of TLR4 was up-regulated only when bovine MECs were stimulated with heat-inactivated E. coli (Fig. 1). The mRNA for TLR4 was increased 3 h after bovine MECs were stimulated with LPS (Fig. 1). Significant up-regulation in the mRNA for TLR2 was observed at 1 h and 3 h after the cells were stimulated with LTA (Fig. 1). 3.2. Differential changes in TNF-˛, IL-1ˇ, IL-6 and IL-8 in bovine MECs challenged with either heat-inactivated E. coli or heat-inactivated S. aureus The expression of TNF-␣ mRNA was increased in heat-inactivated E. coli, LPS heat-inactivated S. aureus or LTA-treated cells (Fig. 2A). Significant up-regulations in the mRNA for TNF-␣ were observed at 1 h after the cells were treated with heat-inactivated E. coli or LPS. Significant upregulations in the mRNA for TNF-␣ were observed at 3 h
248
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
after the cells were treated with heat-inactivated S. aureus or LTA. The mRNA levels of TNF-␣ decreased thereafter. The up-regulation of TNF-␣ was much higher when cells were stimulated with heat-inactivated E. coli. The expression of IL-1 mRNA was increased in heat-inactivated E. coli, LPS heat-inactivated S. aureus or LTA-treated cells (Fig. 2 B). Significant up-regulations in the mRNA for IL-1 were observed at 3 h and 6 h after the heat-inactivated E. coli and heat-inactivated S. aureus treatments, respectively. The levels of mRNA for IL-1 decreased thereafter. The upregulation of IL-1 mRNA was much higher when cells were stimulated with heat-inactivated E. coli. The same profile was found for IL-6 (Fig. 2C) and IL-8 expression (Fig. 2D). 3.3. Heat-inactivated E. coli and heat-inactivated S. aureus up-regulated the expression of ˇ-defensin 5 in bovine MECs The level of mRNA for -defensin 5 was up-regulated significantly over time when bovine MECs were stimulated with heat-inactivated E. coli or heat-inactivated S. aureus. However, the up-regulation of -defensin 5 was much lower when cells were stimulated with heat-inactivated S. aureus (Fig. 3).
Fig. 1. Alteration in the mRNA concentrations of TLR2 and TLR4 in bovine MECs after challenge with heat-inactivated S. aureus, heat-inactivated E. coli, LPS and LTA for 1, 3, 6, 12 and 24 h. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
3.4. Heat-inactivated E. coli, but not heat-inactivated S. aureus, activates NF-B in bovine MECs cultured in medium containing FCS In this study, we detected the activation of NF-B in bovine MECs challenged with either heat-inactivated E. coli
Fig. 2. Alteration in the mRNA concentrations of TNF-␣, IL-1, IL-6 and IL-8 in bovine MECs after challenge with heat-inactivated S. aureus, heat-inactivated E. coli, LPS and LTA for 1, 3, 6, 12 and 24 h. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
249
4. Discussion
Fig. 3. Alteration in the mRNA concentration of -defensin 5 in bovine MECs after challenge with heat-inactivated S. aureus and heat-inactivated E. coli for 1, 3, 6, 12 and 24 h. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
or heat-inactivated S. aureus. The results show that heatinactivated E. coli, but not heat-inactivated S. aureus, could activate NF-B in bovine MECs (Fig. 4). 3.5. The effect of medium constituents on the activation of NF-B in bovine MECs challenged with either heat-inactivated E. coli or heat-inactivated S. aureus The results showed that heat-inactivated S. aureus could activate NF-B in bovine MECs cultured in a medium free of FCS but not cultured in a medium containing FCS. Meanwhile, heat-inactivated E. coli could activate NF-B in bovine MECs cultured in a medium free of FCS and in a medium containing FCS (Fig. 5). These results were consistent with the results from HEK293-TLRs cells(Fig. 6).
Pathogens that invade the udder activate the innate immune system to resist the infection, which results in clinical signs of inflammation. Infections of the mammary gland by E. coli or S. aureus often result in different types of mastitis. Understanding the molecular mechanisms underlying these different disease patterns is particularly important for the prevention and treatment of mastitis. In this study, we used bovine MECs to investigate the immune defense mechanisms in the udder. TLRs are a large class of ancient innate immunity receptors that recognize the conserved components of pathogens, or PAMPs, and initiate the innate immune response (Akira et al., 2001; Beutler et al., 2003). The activation of TLRs plays an important role in defense against invading pathogens. TLR2 has been identified as PRR for peptidoglycans and lipoteichoic acids from Gram-positive bacteria. The expression of TLR2 was up-regulated when bovine MECs were stimulated with LTA (Herath et al., 2006). Goldammer et al. (2004) showed up-regulated TLR2 expression in both E. coli- and S. aureus-treated bovine MECs, and the up-regulation was lower in the E. coli-treated cells (Goldammer et al., 2004). In this study, we observed that TLR2 mRNA was up-regulated in both E. coli- and S. aureus-treated bovine MECs. However, the up-regulation of TLR2 was much higher when MECs were treated with heatinactivated E. coli. Furthermore, it has been shown that TLR2 can recognize LPS from Gram-negative bacteria, such as Porphyromonas gingivalis, Helicobacter pyroli and nonenterobacteria (Smith et al., 2003; Vogel et al., 2001; Werts et al., 2001). These data, in addition to our results, suggest that TLR2 is responsive to both Gram-positive bacteria and Gram-negative bacteria. TLR4 has been identified as the PRR for LPS from Gram-negative bacteria. This is proven by the fact that TLR4 knock-out mice are unresponsive to LPS
Fig. 4. Heat-inactivated E. coli but not heat-inactivated S. aureus activate NF-B in bovine MECs cultured in medium containing FCS. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
250
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
Fig. 5. The effect of plasma constituents on NF-B activation in bovine MECs challenged with either heat-inactivated E. coli or heat-inactivated S. aureus. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
(Hoshino et al., 1999). Griesbeck-Zilch et al. (2008) showed that the expression of TLR4 was up-regulated when bovine MECs were stimulated with heat-inactivated E. coli, but not when they were stimulated with heat-inactivated S. aureus. These data further confirm our results and demonstrate the activation of TLR4 by Gram-negative bacteria. The activation of TLRs by pathogens is known to result in the activation of NF-B. NF-B has been implicated in the regulation of inflammatory and immune responses, which play an important role in the development of disease (Balkwill and Coussens, 2004). NF-B is normally sequestered in the cytoplasm by a family of inhibitory proteins known as inhibitors of NF-B (IBs). Once activated, the NF-B subunit p65 dissociates from its inhibitory protein IB-␣ and translocates from the cytoplasm to the nucleus, where it triggers the transcription of specific target genes, such as TNF-␣, IL-1 and IL-6. In this study, we observed that E. coli, but not S. aureus, could induce NFB activation in bovine MECs. However, the failure of S. aureus to induce NF-B activation presents a discrepancy with the activation of TLR2 by S. aureus. To investigate this discrepancy, a comparative study of the activation of NFB in bovine MECs cultured in the presence and absence of FCS and stimulated with heat-inactivated E. coli or S. aureus was performed. The results demonstrate that the heat-inactivated S. aureus could induce NF-B activation in a medium free of FCS, while the heat-inactivated E. coli induced NF-B activation in a medium containing FCS and in a medium free of FCS. This is consistent with the results found using TLR2- and TLR4/MD2-transfected HEK293 cells. This indicates that plasma constituents suppress
S. aureus-induced NF-B activation. Several reports have shown that serum constituents, such as a soluble decoy TLR2, may down-regulate TLR2 signaling (LeBouder et al., 2003). Our results suggest that there may be an inhibitor in FCS that inhibits S. aureus-induced NF-B activation. Further experiments are needed to reveal the molecular mechanism of impaired NF-B activation. Some reports suggested that quantitative differences in TLR induction are responsible for the impaired immune response induced by S. aureus (Griesbeck-Zilch et al., 2008). We suggest that the differences in TLR induction and the lack of NF-B activation could be a further explanation for the impaired immune response induced by S. aureus. Cytokines, an important group of inflammatory mediators, play an important role in the host innate immune response. TNF-␣ and IL-1 are major pro-inflammatory cytokines that mediate the inflammatory response at both the local and systemic levels (Christman et al., 2000; McCoy et al., 2011). IL-6 plays an important role in the acutephase response of inflammation (Kishimoto et al., 1989; Romano et al., 1997). These pro-inflammatory cytokines are potent inducers of fever and the acute phase response. IL-8 is an important chemokine that recruits neutrophils to the infection site (Baggiolini and Dahinden, 1994). The production of pro-inflammatory cytokines and chemokine is essential to host defense and survival. The production of these cytokines may result in systemic clinical signs, such as fever, anorexia or apathy. E. coli induced the expression of cytokines (such as TNF-␣, IL-1 and IL-6) from bovine MECs to higher levels than S. aureus (Gunther et al., 2011). This is consistent with our data. In this study, we
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
251
Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (Nos. 30972225 and 30771596) and the Research Fund for the Doctoral Program of Higher Education of China (No. 20110061130010). References
Fig. 6. The effect of plasma constituents on NF-B activation in HEK293-TLRs cells challenged with either heat-inactivated E. coli or heatinactivated S. aureus. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
demonstrate that heat-inactivated E. coli induced the gene expression of cytokines (such as TNF-␣, IL-1, IL-6 and IL-8) in bovine MECs more rapidly and to higher levels than heatinactivated S. aureus. The activation of TLR2 could induce NF-B and MAPKs activation and subsequently induce the production of cytokines. In this study, we found that S. aureus was able to induce TNF-␣, IL-1, IL-6 and IL-8 mRNA expression in the absence of NF-B activation. This may due to the activation of MAPKs pathway. The difference in cytokine production may contribute to the fact that E. coli frequently causes clinical mastitis, which is characterized as an acute and severe infection, and S. aureus often causes a chronic and persistent subclinical mastitis. 5. Conclusions In this study, we show that heat-inactivated E. coli induced more rapid and robust cytokine (including TNF-␣, IL-1, IL-6 and IL-8) gene expression than heat-inactivated S. aureus in bovine MECs. The impaired immune response induced by S. aureus may be due to differences in TLR activation and the lack of NF-B activation by this pathogen. Furthermore, we find that heat-inactivated S. aureus can activate NF-B in bovine MECs cultured in medium free of FCS. Conflict of interest statement None of the authors of this paper has a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper.
Akira, S., Takeda, K., Kaisho, T., 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2, 675–680. Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity. Cell 124, 783–801. Alexopoulou, L., Holt, A.C., Medzhitov, R., Flavell, R.A., 2001. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 413, 732–738. Arms, L., Girard, B.M., Vizzard, M.A., 2010. Expression and function of CXCL12/CXCR4 in rat urinary bladder with cyclophosphamideinduced cystitis. Am. J. Physiol. Renal Physiol. 298, F589–F600. Baggiolini, M., Dahinden, C.A., 1994. CC chemokines in allergic inflammation. Immunol. Today 15, 127–133. Balkwill, F., Coussens, L.M., 2004. Cancer: an inflammatory link. Nature 431, 405–406. Beutler, B., Hoebe, K., Du, X., Ulevitch, R.J., 2003. How we detect microbes and respond to them: the Toll-like receptors and their transducers. J. Leukoc. Biol. 74, 479–485. Blosser, T.H., 1979. Economic losses from and the national research program on mastitis in the United States. J. Dairy Sci. 62, 119–127. Christman, J.W., Sadikot, R.T., Blackwell, T.S., 2000. The role of nuclear factor-kappa B in pulmonary diseases. Chest 117, 1482–1487. Dustin, M.L., Rothlein, R., Bhan, A.K., Dinarello, C.A., Springer, T.A., 1986. Induction by IL 1 and interferon-gamma: tissue distribution, biochemistry, and function of a natural adherence molecule (ICAM-1). J. Immunol. 137, 245–254. Goldammer, T., Zerbe, H., Molenaar, A., Schuberth, H.J., Brunner, R.M., Kata, S.R., Seyfert, H.M., 2004. Mastitis increases mammary mRNA abundance of beta-defensin 5, toll-like-receptor 2 (TLR2), and TLR4 but not TLR9 in cattle. Clin. Diagn. Lab. Immunol. 11, 174–185. Griesbeck-Zilch, B., Meyer, H.H., Kuhn, C.H., Schwerin, M., Wellnitz, O., 2008. Staphylococcus aureus and Escherichia coli cause deviating expression profiles of cytokines and lactoferrin messenger ribonucleic acid in mammary epithelial cells. J. Dairy Sci. 91, 2215–2224. Gunther, J., Esch, K., Poschadel, N., Petzl, W., Zerbe, H., Mitterhuemer, S., Blum, H., Seyfert, H.M., 2011. Comparative kinetics of Escherichia coliand Staphylococcus aureus-specific activation of key immune pathways in mammary epithelial cells demonstrates that S. aureus elicits a delayed response dominated by interleukin-6 (IL-6) but not by IL-1A or tumor necrosis factor alpha. Infect. Immun. 79, 695–707. Herath, S., Fischer, D.P., Werling, D., Williams, E.J., Lilly, S.T., Dobson, H., Bryant, C.E., Sheldon, I.M., 2006. Expression and function of Toll-like receptor 4 in the endometrial cells of the uterus. Endocrinology 147, 562–570. Hodge, D.R., Hurt, E.M., Farrar, W.L., 2005. The role of IL-6 and STAT3 in inflammation and cancer. Eur. J. Cancer 41, 2502–2512. Hoffmann, J.A., Kafatos, F.C., Janeway, C.A., Ezekowitz, R.A., 1999. Phylogenetic perspectives in innate immunity. Science 284, 1313–1318. Hoshino, K., Takeuchi, O., Kawai, T., Sanjo, H., Ogawa, T., Takeda, Y., Takeda, K., Akira, S., 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162, 3749–3752. Hu, H., Wang, J., Bu, D., Wei, H., Zhou, L., Li, F., Loor, J.J., 2009. In vitro culture and characterization of a mammary epithelial cell line from Chinese Holstein dairy cow. PLoS One 4, e7636. Isobe, N., Hosoda, K., Yoshimura, Y., 2009. Immunolocalization of lingual antimicrobial peptide (LAP) in the bovine mammary gland. Anim. Sci. J. 80, 446–450. Kishimoto, T., Taga, T., Yamasaki, K., Matsuda, T., Tang, B., Muraguchi, A., Horii, Y., Suematsu, S., Hirata, Y., Yawata, H., et al., 1989. Normal and abnormal regulation of human B cell differentiation by a new cytokine, BSF2/IL-6. Adv. Exp. Med. Biol. 254, 135–143. LeBouder, E., Rey-Nores, J.E., Rushmere, N.K., Grigorov, M., Lawn, S.D., Affolter, M., Griffin, G.E., Ferrara, P., Schiffrin, E.J., Morgan, B.P., Labeta, M.O., 2003. Soluble forms of Toll-like receptor (TLR)2 capable of modulating TLR2 signaling are present in human plasma and breast milk. J. Immunol. 171, 6680–6689. Leser, H.G., Gross, V., Scheibenbogen, C., Heinisch, A., Salm, R., Lausen, M., Ruckauer, K., Andreesen, R., Farthmann, E.H., Scholmerich, J., 1991.
252
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
Elevation of serum interleukin-6 concentration precedes acute-phase response and reflects severity in acute pancreatitis. Gastroenterology 101, 782–785. Martin, T.R., 1999. Lung cytokines and ARDS: Roger S. Mitchell Lecture. Chest 116, 2S–8S. McCoy, M.K., Ruhn, K.A., Blesch, A., Tansey, M.G., 2011. TNF: a key neuroinflammatory mediator of neurotoxicity and neurodegeneration in models of Parkinson’s disease. Adv. Exp. Med. Biol. 691, 539–540. McGuire, K., Jones, M., Werling, D., Williams, J.L., Glass, E.J., Jann, O., 2006. Radiation hybrid mapping of all 10 characterized bovine Toll-like receptors. Anim. Genet. 37, 47–50. Mueller, L.P., Yoza, B.K., Neuhaus, K., Loeser, C.S., Cousart, S., Chang, M.C., Meredith, J.W., Li, L., McCall, C.E., 2001. Endotoxin-adapted septic shock leukocytes selectively alter production of sIL-1RA and IL-1beta. Shock 16, 430–437. Romano, M., Sironi, M., Toniatti, C., Polentarutti, N., Fruscella, P., Ghezzi, P., Faggioni, R., Luini, W., van Hinsbergh, V., Sozzani, S., Bussolino, F., Poli, V., Ciliberto, G., Mantovani, A., 1997. Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity 6, 315–325. Schroder, N.W., Morath, S., Alexander, C., Hamann, L., Hartung, T., Zahringer, U., Gobel, U.B., Weber, J.R., Schumann, R.R., 2003. Lipoteichoic acid (LTA) of Streptococcus pneumoniae and Staphylococcus aureus activates immune cells via Toll-like receptor (TLR)-2, lipopolysaccharide-binding protein (LBP), and CD14, whereas TLR-4 and MD-2 are not involved. J. Biol. Chem. 278, 15587– 15594. Seegers, H., Fourichon, C., Beaudeau, F., 2003. Production effects related to mastitis and mastitis economics in dairy cattle herds. Vet. Res. 34, 475–491. Singh, I.S., He, J.R., Hester, L., Fenton, M.J., Hasday, J.D., 2004. Bacterial endotoxin modifies heat shock factor-1 activity in RAW 264.7 cells: implications for TNF-alpha regulation during exposure to febrile range temperatures. J. Endotoxin Res. 10, 175–184.
Smith Jr., M.F., Mitchell, A., Li, G., Ding, S., Fitzmaurice, A.M., Ryan, K., Crowe, S., Goldberg, J.B., 2003. Toll-like receptor (TLR) 2 and TLR5, but not TLR4, are required for Helicobacter pylori-induced NF-kappa B activation and chemokine expression by epithelial cells. J. Biol. Chem. 278, 32552–32560. Su, X., Sykes, J.B., Ao, L., Raeburn, C.D., Fullerton, D.A., Meng, X., 2010. Extracellular heat shock cognate protein 70 induces cardiac functional tolerance to endotoxin: differential effect on TNF-alpha and ICAM-1 levels in heart tissue. Cytokine 51, 60–66. Takeda, K., Akira, S., 2005. Toll-like receptors in innate immunity. Int. Immunol. 17, 1–14. Takeuchi, O., Hoshino, K., Akira, S., 2000. Cutting edge: TLR2-deficient and MyD88-deficient mice are highly susceptible to Staphylococcus aureus infection. J. Immunol. 165, 5392–5396. Taponen, S., Pyorala, S., 2009. Coagulase-negative staphylococci as cause of bovine mastitis – not so different from Staphylococcus aureus? Vet. Microbiol. 134, 29–36. Vangroenweghe, F., Lamote, I., Burvenich, C., 2005. Physiology of the periparturient period and its relation to severity of clinical mastitis. Domest. Anim. Endocrinol. 29, 283–293. Vogel, S.N., Hirschfeld, M., Weis, J.J., Toshchakov, V., Salkowski, C.A., Cody, M.J., Ward, D.C., Qureshi, N., Michalek, S.M., 2001. Signaling by Tolllike receptor 2 and 4 agonists results in differential gene expression in murine macrophages. Infect. Immun. 69, 1477–1482. Werts, C., Tapping, R.I., Mathison, J.C., Chuang, T.H., Kravchenko, V., Saint Girons, I., Haake, D.A., Godowski, P.J., Hayashi, F., Ozinsky, A., Underhill, D.M., Kirschning, C.J., Wagner, H., Aderem, A., Tobias, P.S., Ulevitch, R.J., 2001. Leptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism. Nat. Immunol. 2, 346–352. Zheng, H., Fletcher, D., Kozak, W., Jiang, M., Hofmann, K.J., Conn, C.A., Soszynski, D., Grabiec, C., Trumbauer, M.E., Shaw, A., et al., 1995. Resistance to fever induction and impaired acute-phase response in interleukin-1 beta-deficient mice. Immunity 3, 9–19.
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Research paper
Staphylococcus aureus and Escherichia coli elicit different innate immune responses from bovine mammary epithelial cells Fu Yunhe a , Zhou Ershun a , Liu Zhicheng a , Li Fenyang a , Liang Dejie a , Liu Bo a , Song Xiaojing a , Zhao Fuyi a , Fen Xiaosheng b , Li Depeng a , Cao Yongguo a , Zhang Xichen a , Zhang Naisheng a , Yang Zhengtao a,∗ a Department of Clinical Veterinary Medicine, College of Veterinary Medicine, Jilin University, Changchun, Jilin Province 130062, People’s Republic of China b Guangdong Institute of Modern Agricultural Group, Guangzhou, Guangdong Province, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 10 October 2012 Received in revised form 7 August 2013 Accepted 13 August 2013 Keywords: Escherichia coli Staphylococcus aureus Bovine mammary epithelial cells TLR4 TLR2 NF-B
a b s t r a c t Escherichia coli and Staphylococcus aureus are the most important pathogenic bacteria causing bovine clinical mastitis and subclinical mastitis, respectively. However, little is known about the molecular mechanisms underlying the different host response patterns caused by these bacteria. The aim of this study was to characterize the different innate immune responses of bovine mammary epithelium cells (MECs) to heat-inactivated E. coli and S. aureus. Gene expression of Toll-like receptor 2 (TLR2) and TLR4 was compared. The activation of nuclear factor kappa B (NF-B) and the kinetics and levels of cytokine production were analyzed. The results show that the mRNA for TLR2 and TLR4 was up-regulated when the bovine MECs were stimulated with heat-inactivated E. coli, while only TLR2 mRNA was up-regulated when the bovine MECs were stimulated with heat-inactivated S. aureus. The expression of tumor necrosis factor-␣ (TNF-␣), interleukin (IL)-1, IL-6 and IL-8 increased more rapidly and higher when the bovine MECs were stimulated with heat-inactivated E. coli than when they were stimulated with heat-inactivated S. aureus. E. coli strongly activated NF-B in the bovine MECs, while S. aureus failed to activate NF-B. Heat-inactivated S. aureus could induce NF-B activation when bovine MECs cultured in medium without fetal calf serum. These results were confirmed using TLR2- and TLR4/MD2-transfected HEK293 cells and suggested that differential TLR recognition and the lack of NF-B activation account for the impaired immune response elicited by heat-inactivated S. aureus. © 2013 Published by Elsevier B.V.
1. Introduction Bovine mastitis, an infection of the bovine mammary gland, is a highly prevalent and important infectious disease of dairy cattle (Blosser, 1979; Seegers et al., 2003).
∗ Corresponding author at: Department of Clinical Veterinary Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Changchun, Jilin Province 130062, People’s Republic of China. Tel.: +86 431 87981688; fax: +86 431 87981688. E-mail address: [email protected] (Z. Yang). 0165-2427/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.vetimm.2013.08.003
It can cause a decline in milk production and quality and result in great losses to the dairy industry worldwide. Mastitis can be caused by more than 150 different types of pathogens. In most cases, an infection with Gram-negative bacteria, such as Escherichia coli (E. coli), can often cause clinical mastitis, which is characterized as an acute and severe infection that can be cleared within a few days (Vangroenweghe et al., 2005). In contrast, an infection with Gram-positive bacteria, such as Staphylococcus aureus (S. aureus), often causes a chronic and persistent subclinical mastitis (Taponen and Pyorala, 2009). The molecular
246
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
mechanisms by which different pathogens induce different responses during mammary gland infections are poorly understood. The innate immune system and the immunological functions it mediates are the host’s first line of defense against the invading pathogens during mastitis (Blosser, 1979; Hoffmann et al., 1999). It plays an important role during the early stages of infection. The innate immune system recognizes highly conserved motifs shared by diverse pathogens, which are called pathogen-associated molecular patterns (PAMPs), via pattern recognition receptors (PRR). Toll-like receptors (TLRs) are one of the PRRs that recognize the conserved components of pathogens, or pathogen-associated molecular patterns, and initiate the innate immune response (Akira et al., 2001; Beutler et al., 2003). Reports have recently identified 13 different Tolllike receptors (TLRs) (Akira et al., 2006; Alexopoulou et al., 2001; Takeda and Akira, 2005), and 10 different bovine TLRs have been described (McGuire et al., 2006). Each of the TLRs has their own ligand and functional characteristics. For example, TLR2 recognizes lipoteichoic acid (LTA) and peptidoglycan (PGN) from Gram-positive bacteria, e.g., S. aureus (Schroder et al., 2003; Takeuchi et al., 2000). TLR4 recognizes lipopolysaccharide (LPS) from Gram-negative bacteria, e.g., E. coli. Cytokines, an important group of inflammatory mediators, play an important role in the host innate immune response to infection. Tumor necrosis factor-␣ (TNF-␣) and interleukin (IL)-1 are major pro-inflammatory cytokines that mediate the inflammatory response at both the local and systemic levels (Mueller et al., 2001; Singh et al., 2004). TNF-␣ is an endogenous pyrogen that causes fever and stimulates endothelial cells and leukocytes to release various inflammatory mediators (e.g., NO and oxygenfree radicals), thereby promoting neutrophil phagocytosis. It plays a crucial role in the pathological damage from inflammation and septic shock and is the key mediator contributing to endotoxin shock (Su et al., 2010). IL-1 acts on target cells to boost the synthesis of acute phase proteins and generate inflammatory responses such as fever (Zheng et al., 1995). In addition, this cytokine induces the expression of cellular adhesion molecules, attracts aggregates of neutrophils, stimulates immune cells and endothelial cells to produce various inflammatory cytokines and chemokines and promotes the generation and release of neurotoxic compounds (Dustin et al., 1986). IL-6 is one of the most common inflammatory cytokines (Hodge et al., 2005; Martin, 1999). Circulating levels of IL-6 have been shown to be excellent predictors of the severity of acute respiratory distress syndrome (ARDS) of different etiologies, such as sepsis and acute pancreatitis (Leser et al., 1991). IL-8 is an important chemokine that recruits neutrophils to the infection site. Apart from the innate immune cells, the mammary epithelial cells (MECs) play an important role in udder immunity (Griesbeck-Zilch et al., 2008). They can recognize the PAMPs of invading pathogens via PRR, such as TLRs, and induce the secretion of cytokines and chemokines. Additionally, they can express bactericidal -defensins, acute phase proteins that help fight off pathogens (Isobe et al., 2009). In this study, we used bovine MECs to investigate
the immune defense mechanisms in the udder. We compared the key factors produced by these cells in response to treatment with heat-inactivated S. aureus and E. coli. In addition, we tested if fetal calf serum (FCS) could affect NFB activation by heat-killed S. aureus and E. coli in bovine MECs. 2. Materials and methods 2.1. Cell culture and challenge with mastitis pathogens Epithelial cells from the bovine mammary gland were separated using procedures that have been described previously (Hu et al., 2009). Animal experiments were done in accordance with the guidelines on animal care and use established by the Jilin University Animal Care and Use Committee. The protocols were reviewed and approved by the committee. Six healthy lactating Chinese Holstein cows were selected on the basis of milk somatic cell counts (SCC) and clinical investigations. Then the cows were killed and the mammary tissues obtained from six Holstein cows were transported on ice to the laboratory within 1–1.5 h of harvesting. The mammary tissue was cut into 1-cm3 pieces and washed with D-Hank’s solution several times, until the solution was pellucid and did not contain any milk. The tissue was then cut into 1-mm3 pieces and washed with D-Hank’s solution until clean. The tissue pieces were transferred into cell culture flasks that were coated with rat-tail collagen. The culture flasks were incubated at 37 ◦ C in 5% CO2 . After 4 h, 3 mL of DMEM/F12 basal media were added to every culture flask. After 12 h, 2 mL of the basal media were added. The media was changed once every 48 h until the cells were spread across the bottom of the culture flask. The fibroblasts were digested with Trypsin (0.25%) supplemented with 0.1% EDTA-2Na. The pure MECs were isolated after 3 passages for subsequent experiments. HEK293-TLR2 and HEK293-TLR4/MD2 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FCS. We challenged bovine MECs or HEK293-TLRs cells with heat-inactivated mastitis pathogens E. coli strain 1303 and S. aureus capsular polysaccharide type 5 strain. Heat inactivation of the pathogens was conducted at 80 ◦ C for 1 h. Inactivation efficiency was tested on blood agar plates. The cells were stimulated with 200 g/mL of heat-inactivated E. coli or 200 g/mL of heat-inactivated S. aureus bacteria debris. Bovine MECs were stimulated by LPS (g/mL) or LTA (g/mL) as positive controls. 2.2. RNA extraction and qRT-PCR The total RNA was isolated from the MECs at 1, 3, 6, 12 and 24 h after treatment with heat-inactivated E. coli, heat-inactivated S. aureus, LPS or LTA. The total RNA was extracted using TRIzol (Invitrogen) by following the manufacturer’s instructions. The RNA was reverse-transcribed into cDNA using a Revert Aid First Strand cDNA Synthesis Kit (Thermo). The relative mRNA concentrations were detected by qRT-PCR using a 7500 Fast Real-Time PCR System (Applied Biosystems) and a SYBR green Plus reagent kit (Roche), as has already been described elsewhere (Arms
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
247
Table 1 Sequence of primers used in current investigation in qRT-PCR. Gene
Primer
Sequence 5 > 3
Product size (bp)
TLR2
Sense Anti-sense
CGATGACTACCGCTGTGACTC CCTTCCTGGGCTTCCTCTT
224
TLR4
Sense Anti-sense
TGCCTTCACTACAGGGACTTT TGGGACACCACGACAATAAC
101
-Defensin 5
Sense Anti-sense
GTCTGCTGGGTCAGGATTTAC CCCGAAACAGGTGCCAAT
121
IL-1
Sense Anti-sense
AGGTGGTGTCGGTCATCGT GCTCTCTGTCCTGGAGTTTGC
195
IL-6
Sense Anti-sense
ATGCTTCCAATCTGGGTTC TGAGGATAATCTTTGCGTTC
269
IL-8
Sense Anti-sense
ACACATTCCACACCTTTCCA GGTTTAGGCAGACCTCGTTT
124
TNF-a
Sense Anti-sense
ACGGGCTTTACCTCATCTACTC GCTCTTGATGGCAGACAGG
140
-Actin
Sense Anti-sense
TCACCAACTGGGACGACA GCATACAGGGACAGCACA
206
et al., 2010). The primers used for qRT-PCR are listed in Table 1. Each sample was run in three times to generate a single product. Melt curves were used to analyses and assess the accuracy of the PCR. 2−Ct values were chosen to evaluate the expression of candidate genes. The -actin was acted as an internal calibrator within each sample to calculate Ct . Ct = Ct (target gene) − Ct (housekeeping gene). The Ct = Ct (treatment) − Ct (control). The fold change in expression was then used as a relative measure of gene expression. 2.3. Western blot analysis When the bovine MECs reached 80% confluence in a 6-well dish, the cells were stimulated with 200 g/mL of heat-killed E. coli or 200 g/mL of heat-killed S. aureus for 30 min. The cellular proteins were then extracted using a Nuclear and Cytoplasmic Protein Extraction Kit (Thermo) according to the manufacturer’s protocol. HEK293-TLRs cells were stimulated with pathogens in medium free of FCS or contain of 10% FCS. The total proteins from HEK293 cells were extracted with M-PER Mammalian Protein Extraction Reagent (Thermo). The protein concentration was determined by the BCA method. The proteins were separated by SDS-PAGE using Tris–HCl Precast Gels (Invitrogen) and then transferred onto a PVDF membrane. After blocking nonspecific sites with a blocking solution (5% (wt/vol) nonfat dry milk), the membrane was incubated overnight with the specific primary antibody at 4 ◦ C. The membrane was then incubated for an additional 60 min with a horseradish peroxidase-conjugated secondary antibody at room temperature. The blots were again washed with PBS-T and then developed with an ECL Plus Western Blotting Detection System. Rabbit mAb p65 and phosphor-p65 were purchased from Cell Signaling Technology Inc (Beverly, MA, USA). -actin was purchased from Tianjin Sungene Biotech Co., Ltd (Tianjin, China). HRP-conjugated goat anti-rabbit antibody was purchased from GE Healthcare (Buckinghamshire, UK).
2.4. Statistical analysis All values are expressed as the means ± SEM. The differences between mean values of the normally distributed data were analyzed using a one-way ANOVA (Dunnett’s ttest) and two-tailed Student’s t-test. Statistical significance was defined as P < 0.05 or P < 0.01. 3. Results 3.1. Effect of heat-inactivated E. coli and heat-inactivated S. aureus on the expression of TLR2 and TLR4 in bovine MECs The mRNA for TLR2 was up-regulated when bovine MECs were stimulated with heat-inactivated E. coli or heatinactivated S. aureus. A significant up-regulation in this gene was observed 3 h after treatment of the cells with heat-inactivated E. coli or heat-inactivated S. aureus. The level of mRNA for TLR2 decreased thereafter. However, the up-regulation of TLR2 was much lower when bovine MECs were stimulated with heat-inactivated S. aureus (Fig. 1). The mRNA level of TLR4 was up-regulated only when bovine MECs were stimulated with heat-inactivated E. coli (Fig. 1). The mRNA for TLR4 was increased 3 h after bovine MECs were stimulated with LPS (Fig. 1). Significant up-regulation in the mRNA for TLR2 was observed at 1 h and 3 h after the cells were stimulated with LTA (Fig. 1). 3.2. Differential changes in TNF-˛, IL-1ˇ, IL-6 and IL-8 in bovine MECs challenged with either heat-inactivated E. coli or heat-inactivated S. aureus The expression of TNF-␣ mRNA was increased in heat-inactivated E. coli, LPS heat-inactivated S. aureus or LTA-treated cells (Fig. 2A). Significant up-regulations in the mRNA for TNF-␣ were observed at 1 h after the cells were treated with heat-inactivated E. coli or LPS. Significant upregulations in the mRNA for TNF-␣ were observed at 3 h
248
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
after the cells were treated with heat-inactivated S. aureus or LTA. The mRNA levels of TNF-␣ decreased thereafter. The up-regulation of TNF-␣ was much higher when cells were stimulated with heat-inactivated E. coli. The expression of IL-1 mRNA was increased in heat-inactivated E. coli, LPS heat-inactivated S. aureus or LTA-treated cells (Fig. 2 B). Significant up-regulations in the mRNA for IL-1 were observed at 3 h and 6 h after the heat-inactivated E. coli and heat-inactivated S. aureus treatments, respectively. The levels of mRNA for IL-1 decreased thereafter. The upregulation of IL-1 mRNA was much higher when cells were stimulated with heat-inactivated E. coli. The same profile was found for IL-6 (Fig. 2C) and IL-8 expression (Fig. 2D). 3.3. Heat-inactivated E. coli and heat-inactivated S. aureus up-regulated the expression of ˇ-defensin 5 in bovine MECs The level of mRNA for -defensin 5 was up-regulated significantly over time when bovine MECs were stimulated with heat-inactivated E. coli or heat-inactivated S. aureus. However, the up-regulation of -defensin 5 was much lower when cells were stimulated with heat-inactivated S. aureus (Fig. 3).
Fig. 1. Alteration in the mRNA concentrations of TLR2 and TLR4 in bovine MECs after challenge with heat-inactivated S. aureus, heat-inactivated E. coli, LPS and LTA for 1, 3, 6, 12 and 24 h. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
3.4. Heat-inactivated E. coli, but not heat-inactivated S. aureus, activates NF-B in bovine MECs cultured in medium containing FCS In this study, we detected the activation of NF-B in bovine MECs challenged with either heat-inactivated E. coli
Fig. 2. Alteration in the mRNA concentrations of TNF-␣, IL-1, IL-6 and IL-8 in bovine MECs after challenge with heat-inactivated S. aureus, heat-inactivated E. coli, LPS and LTA for 1, 3, 6, 12 and 24 h. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
249
4. Discussion
Fig. 3. Alteration in the mRNA concentration of -defensin 5 in bovine MECs after challenge with heat-inactivated S. aureus and heat-inactivated E. coli for 1, 3, 6, 12 and 24 h. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
or heat-inactivated S. aureus. The results show that heatinactivated E. coli, but not heat-inactivated S. aureus, could activate NF-B in bovine MECs (Fig. 4). 3.5. The effect of medium constituents on the activation of NF-B in bovine MECs challenged with either heat-inactivated E. coli or heat-inactivated S. aureus The results showed that heat-inactivated S. aureus could activate NF-B in bovine MECs cultured in a medium free of FCS but not cultured in a medium containing FCS. Meanwhile, heat-inactivated E. coli could activate NF-B in bovine MECs cultured in a medium free of FCS and in a medium containing FCS (Fig. 5). These results were consistent with the results from HEK293-TLRs cells(Fig. 6).
Pathogens that invade the udder activate the innate immune system to resist the infection, which results in clinical signs of inflammation. Infections of the mammary gland by E. coli or S. aureus often result in different types of mastitis. Understanding the molecular mechanisms underlying these different disease patterns is particularly important for the prevention and treatment of mastitis. In this study, we used bovine MECs to investigate the immune defense mechanisms in the udder. TLRs are a large class of ancient innate immunity receptors that recognize the conserved components of pathogens, or PAMPs, and initiate the innate immune response (Akira et al., 2001; Beutler et al., 2003). The activation of TLRs plays an important role in defense against invading pathogens. TLR2 has been identified as PRR for peptidoglycans and lipoteichoic acids from Gram-positive bacteria. The expression of TLR2 was up-regulated when bovine MECs were stimulated with LTA (Herath et al., 2006). Goldammer et al. (2004) showed up-regulated TLR2 expression in both E. coli- and S. aureus-treated bovine MECs, and the up-regulation was lower in the E. coli-treated cells (Goldammer et al., 2004). In this study, we observed that TLR2 mRNA was up-regulated in both E. coli- and S. aureus-treated bovine MECs. However, the up-regulation of TLR2 was much higher when MECs were treated with heatinactivated E. coli. Furthermore, it has been shown that TLR2 can recognize LPS from Gram-negative bacteria, such as Porphyromonas gingivalis, Helicobacter pyroli and nonenterobacteria (Smith et al., 2003; Vogel et al., 2001; Werts et al., 2001). These data, in addition to our results, suggest that TLR2 is responsive to both Gram-positive bacteria and Gram-negative bacteria. TLR4 has been identified as the PRR for LPS from Gram-negative bacteria. This is proven by the fact that TLR4 knock-out mice are unresponsive to LPS
Fig. 4. Heat-inactivated E. coli but not heat-inactivated S. aureus activate NF-B in bovine MECs cultured in medium containing FCS. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
250
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
Fig. 5. The effect of plasma constituents on NF-B activation in bovine MECs challenged with either heat-inactivated E. coli or heat-inactivated S. aureus. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
(Hoshino et al., 1999). Griesbeck-Zilch et al. (2008) showed that the expression of TLR4 was up-regulated when bovine MECs were stimulated with heat-inactivated E. coli, but not when they were stimulated with heat-inactivated S. aureus. These data further confirm our results and demonstrate the activation of TLR4 by Gram-negative bacteria. The activation of TLRs by pathogens is known to result in the activation of NF-B. NF-B has been implicated in the regulation of inflammatory and immune responses, which play an important role in the development of disease (Balkwill and Coussens, 2004). NF-B is normally sequestered in the cytoplasm by a family of inhibitory proteins known as inhibitors of NF-B (IBs). Once activated, the NF-B subunit p65 dissociates from its inhibitory protein IB-␣ and translocates from the cytoplasm to the nucleus, where it triggers the transcription of specific target genes, such as TNF-␣, IL-1 and IL-6. In this study, we observed that E. coli, but not S. aureus, could induce NFB activation in bovine MECs. However, the failure of S. aureus to induce NF-B activation presents a discrepancy with the activation of TLR2 by S. aureus. To investigate this discrepancy, a comparative study of the activation of NFB in bovine MECs cultured in the presence and absence of FCS and stimulated with heat-inactivated E. coli or S. aureus was performed. The results demonstrate that the heat-inactivated S. aureus could induce NF-B activation in a medium free of FCS, while the heat-inactivated E. coli induced NF-B activation in a medium containing FCS and in a medium free of FCS. This is consistent with the results found using TLR2- and TLR4/MD2-transfected HEK293 cells. This indicates that plasma constituents suppress
S. aureus-induced NF-B activation. Several reports have shown that serum constituents, such as a soluble decoy TLR2, may down-regulate TLR2 signaling (LeBouder et al., 2003). Our results suggest that there may be an inhibitor in FCS that inhibits S. aureus-induced NF-B activation. Further experiments are needed to reveal the molecular mechanism of impaired NF-B activation. Some reports suggested that quantitative differences in TLR induction are responsible for the impaired immune response induced by S. aureus (Griesbeck-Zilch et al., 2008). We suggest that the differences in TLR induction and the lack of NF-B activation could be a further explanation for the impaired immune response induced by S. aureus. Cytokines, an important group of inflammatory mediators, play an important role in the host innate immune response. TNF-␣ and IL-1 are major pro-inflammatory cytokines that mediate the inflammatory response at both the local and systemic levels (Christman et al., 2000; McCoy et al., 2011). IL-6 plays an important role in the acutephase response of inflammation (Kishimoto et al., 1989; Romano et al., 1997). These pro-inflammatory cytokines are potent inducers of fever and the acute phase response. IL-8 is an important chemokine that recruits neutrophils to the infection site (Baggiolini and Dahinden, 1994). The production of pro-inflammatory cytokines and chemokine is essential to host defense and survival. The production of these cytokines may result in systemic clinical signs, such as fever, anorexia or apathy. E. coli induced the expression of cytokines (such as TNF-␣, IL-1 and IL-6) from bovine MECs to higher levels than S. aureus (Gunther et al., 2011). This is consistent with our data. In this study, we
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
251
Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (Nos. 30972225 and 30771596) and the Research Fund for the Doctoral Program of Higher Education of China (No. 20110061130010). References
Fig. 6. The effect of plasma constituents on NF-B activation in HEK293-TLRs cells challenged with either heat-inactivated E. coli or heatinactivated S. aureus. The data are presented as the means ± SEM. The asterisks indicate a value of *P < 0.05 or **P < 0.01 compared to the S. aureus group.
demonstrate that heat-inactivated E. coli induced the gene expression of cytokines (such as TNF-␣, IL-1, IL-6 and IL-8) in bovine MECs more rapidly and to higher levels than heatinactivated S. aureus. The activation of TLR2 could induce NF-B and MAPKs activation and subsequently induce the production of cytokines. In this study, we found that S. aureus was able to induce TNF-␣, IL-1, IL-6 and IL-8 mRNA expression in the absence of NF-B activation. This may due to the activation of MAPKs pathway. The difference in cytokine production may contribute to the fact that E. coli frequently causes clinical mastitis, which is characterized as an acute and severe infection, and S. aureus often causes a chronic and persistent subclinical mastitis. 5. Conclusions In this study, we show that heat-inactivated E. coli induced more rapid and robust cytokine (including TNF-␣, IL-1, IL-6 and IL-8) gene expression than heat-inactivated S. aureus in bovine MECs. The impaired immune response induced by S. aureus may be due to differences in TLR activation and the lack of NF-B activation by this pathogen. Furthermore, we find that heat-inactivated S. aureus can activate NF-B in bovine MECs cultured in medium free of FCS. Conflict of interest statement None of the authors of this paper has a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper.
Akira, S., Takeda, K., Kaisho, T., 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2, 675–680. Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity. Cell 124, 783–801. Alexopoulou, L., Holt, A.C., Medzhitov, R., Flavell, R.A., 2001. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 413, 732–738. Arms, L., Girard, B.M., Vizzard, M.A., 2010. Expression and function of CXCL12/CXCR4 in rat urinary bladder with cyclophosphamideinduced cystitis. Am. J. Physiol. Renal Physiol. 298, F589–F600. Baggiolini, M., Dahinden, C.A., 1994. CC chemokines in allergic inflammation. Immunol. Today 15, 127–133. Balkwill, F., Coussens, L.M., 2004. Cancer: an inflammatory link. Nature 431, 405–406. Beutler, B., Hoebe, K., Du, X., Ulevitch, R.J., 2003. How we detect microbes and respond to them: the Toll-like receptors and their transducers. J. Leukoc. Biol. 74, 479–485. Blosser, T.H., 1979. Economic losses from and the national research program on mastitis in the United States. J. Dairy Sci. 62, 119–127. Christman, J.W., Sadikot, R.T., Blackwell, T.S., 2000. The role of nuclear factor-kappa B in pulmonary diseases. Chest 117, 1482–1487. Dustin, M.L., Rothlein, R., Bhan, A.K., Dinarello, C.A., Springer, T.A., 1986. Induction by IL 1 and interferon-gamma: tissue distribution, biochemistry, and function of a natural adherence molecule (ICAM-1). J. Immunol. 137, 245–254. Goldammer, T., Zerbe, H., Molenaar, A., Schuberth, H.J., Brunner, R.M., Kata, S.R., Seyfert, H.M., 2004. Mastitis increases mammary mRNA abundance of beta-defensin 5, toll-like-receptor 2 (TLR2), and TLR4 but not TLR9 in cattle. Clin. Diagn. Lab. Immunol. 11, 174–185. Griesbeck-Zilch, B., Meyer, H.H., Kuhn, C.H., Schwerin, M., Wellnitz, O., 2008. Staphylococcus aureus and Escherichia coli cause deviating expression profiles of cytokines and lactoferrin messenger ribonucleic acid in mammary epithelial cells. J. Dairy Sci. 91, 2215–2224. Gunther, J., Esch, K., Poschadel, N., Petzl, W., Zerbe, H., Mitterhuemer, S., Blum, H., Seyfert, H.M., 2011. Comparative kinetics of Escherichia coliand Staphylococcus aureus-specific activation of key immune pathways in mammary epithelial cells demonstrates that S. aureus elicits a delayed response dominated by interleukin-6 (IL-6) but not by IL-1A or tumor necrosis factor alpha. Infect. Immun. 79, 695–707. Herath, S., Fischer, D.P., Werling, D., Williams, E.J., Lilly, S.T., Dobson, H., Bryant, C.E., Sheldon, I.M., 2006. Expression and function of Toll-like receptor 4 in the endometrial cells of the uterus. Endocrinology 147, 562–570. Hodge, D.R., Hurt, E.M., Farrar, W.L., 2005. The role of IL-6 and STAT3 in inflammation and cancer. Eur. J. Cancer 41, 2502–2512. Hoffmann, J.A., Kafatos, F.C., Janeway, C.A., Ezekowitz, R.A., 1999. Phylogenetic perspectives in innate immunity. Science 284, 1313–1318. Hoshino, K., Takeuchi, O., Kawai, T., Sanjo, H., Ogawa, T., Takeda, Y., Takeda, K., Akira, S., 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162, 3749–3752. Hu, H., Wang, J., Bu, D., Wei, H., Zhou, L., Li, F., Loor, J.J., 2009. In vitro culture and characterization of a mammary epithelial cell line from Chinese Holstein dairy cow. PLoS One 4, e7636. Isobe, N., Hosoda, K., Yoshimura, Y., 2009. Immunolocalization of lingual antimicrobial peptide (LAP) in the bovine mammary gland. Anim. Sci. J. 80, 446–450. Kishimoto, T., Taga, T., Yamasaki, K., Matsuda, T., Tang, B., Muraguchi, A., Horii, Y., Suematsu, S., Hirata, Y., Yawata, H., et al., 1989. Normal and abnormal regulation of human B cell differentiation by a new cytokine, BSF2/IL-6. Adv. Exp. Med. Biol. 254, 135–143. LeBouder, E., Rey-Nores, J.E., Rushmere, N.K., Grigorov, M., Lawn, S.D., Affolter, M., Griffin, G.E., Ferrara, P., Schiffrin, E.J., Morgan, B.P., Labeta, M.O., 2003. Soluble forms of Toll-like receptor (TLR)2 capable of modulating TLR2 signaling are present in human plasma and breast milk. J. Immunol. 171, 6680–6689. Leser, H.G., Gross, V., Scheibenbogen, C., Heinisch, A., Salm, R., Lausen, M., Ruckauer, K., Andreesen, R., Farthmann, E.H., Scholmerich, J., 1991.
252
Y. Fu et al. / Veterinary Immunology and Immunopathology 155 (2013) 245–252
Elevation of serum interleukin-6 concentration precedes acute-phase response and reflects severity in acute pancreatitis. Gastroenterology 101, 782–785. Martin, T.R., 1999. Lung cytokines and ARDS: Roger S. Mitchell Lecture. Chest 116, 2S–8S. McCoy, M.K., Ruhn, K.A., Blesch, A., Tansey, M.G., 2011. TNF: a key neuroinflammatory mediator of neurotoxicity and neurodegeneration in models of Parkinson’s disease. Adv. Exp. Med. Biol. 691, 539–540. McGuire, K., Jones, M., Werling, D., Williams, J.L., Glass, E.J., Jann, O., 2006. Radiation hybrid mapping of all 10 characterized bovine Toll-like receptors. Anim. Genet. 37, 47–50. Mueller, L.P., Yoza, B.K., Neuhaus, K., Loeser, C.S., Cousart, S., Chang, M.C., Meredith, J.W., Li, L., McCall, C.E., 2001. Endotoxin-adapted septic shock leukocytes selectively alter production of sIL-1RA and IL-1beta. Shock 16, 430–437. Romano, M., Sironi, M., Toniatti, C., Polentarutti, N., Fruscella, P., Ghezzi, P., Faggioni, R., Luini, W., van Hinsbergh, V., Sozzani, S., Bussolino, F., Poli, V., Ciliberto, G., Mantovani, A., 1997. Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity 6, 315–325. Schroder, N.W., Morath, S., Alexander, C., Hamann, L., Hartung, T., Zahringer, U., Gobel, U.B., Weber, J.R., Schumann, R.R., 2003. Lipoteichoic acid (LTA) of Streptococcus pneumoniae and Staphylococcus aureus activates immune cells via Toll-like receptor (TLR)-2, lipopolysaccharide-binding protein (LBP), and CD14, whereas TLR-4 and MD-2 are not involved. J. Biol. Chem. 278, 15587– 15594. Seegers, H., Fourichon, C., Beaudeau, F., 2003. Production effects related to mastitis and mastitis economics in dairy cattle herds. Vet. Res. 34, 475–491. Singh, I.S., He, J.R., Hester, L., Fenton, M.J., Hasday, J.D., 2004. Bacterial endotoxin modifies heat shock factor-1 activity in RAW 264.7 cells: implications for TNF-alpha regulation during exposure to febrile range temperatures. J. Endotoxin Res. 10, 175–184.
Smith Jr., M.F., Mitchell, A., Li, G., Ding, S., Fitzmaurice, A.M., Ryan, K., Crowe, S., Goldberg, J.B., 2003. Toll-like receptor (TLR) 2 and TLR5, but not TLR4, are required for Helicobacter pylori-induced NF-kappa B activation and chemokine expression by epithelial cells. J. Biol. Chem. 278, 32552–32560. Su, X., Sykes, J.B., Ao, L., Raeburn, C.D., Fullerton, D.A., Meng, X., 2010. Extracellular heat shock cognate protein 70 induces cardiac functional tolerance to endotoxin: differential effect on TNF-alpha and ICAM-1 levels in heart tissue. Cytokine 51, 60–66. Takeda, K., Akira, S., 2005. Toll-like receptors in innate immunity. Int. Immunol. 17, 1–14. Takeuchi, O., Hoshino, K., Akira, S., 2000. Cutting edge: TLR2-deficient and MyD88-deficient mice are highly susceptible to Staphylococcus aureus infection. J. Immunol. 165, 5392–5396. Taponen, S., Pyorala, S., 2009. Coagulase-negative staphylococci as cause of bovine mastitis – not so different from Staphylococcus aureus? Vet. Microbiol. 134, 29–36. Vangroenweghe, F., Lamote, I., Burvenich, C., 2005. Physiology of the periparturient period and its relation to severity of clinical mastitis. Domest. Anim. Endocrinol. 29, 283–293. Vogel, S.N., Hirschfeld, M., Weis, J.J., Toshchakov, V., Salkowski, C.A., Cody, M.J., Ward, D.C., Qureshi, N., Michalek, S.M., 2001. Signaling by Tolllike receptor 2 and 4 agonists results in differential gene expression in murine macrophages. Infect. Immun. 69, 1477–1482. Werts, C., Tapping, R.I., Mathison, J.C., Chuang, T.H., Kravchenko, V., Saint Girons, I., Haake, D.A., Godowski, P.J., Hayashi, F., Ozinsky, A., Underhill, D.M., Kirschning, C.J., Wagner, H., Aderem, A., Tobias, P.S., Ulevitch, R.J., 2001. Leptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism. Nat. Immunol. 2, 346–352. Zheng, H., Fletcher, D., Kozak, W., Jiang, M., Hofmann, K.J., Conn, C.A., Soszynski, D., Grabiec, C., Trumbauer, M.E., Shaw, A., et al., 1995. Resistance to fever induction and impaired acute-phase response in interleukin-1 beta-deficient mice. Immunity 3, 9–19.