- Email: [email protected]
Starvation-induced autophagy is regulated by mitochondrial reactive oxygen species leading to AMPK activation
Cellular Signalling 25 (2013) 50–65
Contents lists available at SciVerse ScienceDirect
Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig
Starvation-induced autophagy is regulated by mitochondrial reactive oxygen species leading to AMPK activation Lin Li 1, Yongqiang Chen 1, Spencer B. Gibson ⁎ Manitoba Institute of Cell Biology, Faculty of Medicine, University of Manitoba, Winnipeg, MB, Canada Department of Biochemistry and Medical Genetics, Faculty of Medicine, University of Manitoba, Winnipeg, MB, Canada
a r t i c l e
i n f o
Article history: Received 16 May 2012 Received in revised form 29 August 2012 Accepted 12 September 2012 Available online 19 September 2012 Keywords: Autophagy ROS Mitochondria AMPK
a b s t r a c t Starvation is the most extensively studied condition that induces autophagy. Previous studies have demonstrated that starvation-induced autophagy is regulated by reactive oxygen species (ROS) such as superoxide (O2•−) but the source for ROS under starvation conditions and the downstream signaling pathways regulating autophagy are unclear. In this study, a cervical cancer HeLa cell line was generated that was deficient in mitochondrial electron transport chain (mETC) (HeLa ρ° cells). This resulted in endogenous levels of O2•− being significantly reduced and failed to be induced under starvation of glucose, L-glutamine, pyruvate, and serum (GP) or of amino acids and serum (AA) compared to wild type (wt) HeLa cells. In contrast, H2O2 production failed to increase under GP starvation in both wild type and ρ° cells whereas it increased in wt cells but not in ρ° cells under AA starvation. GP or AA starvation induced autophagy was blocked in ρ° cells as determined by the amount of autophagosomes and autolysosomes. Autophagy is regulated by 5′ adenosine monophosphate-activated protein kinase (AMPK) activation and AMPK is activated under starvation conditions. We demonstrate that ρ° cells and HeLa cells over expressing manganese-superoxide dismutase 2 (SOD2) cells fail to activate AMPK activation following starvation. This indicates that mitochondrial ROS might regulate AMPK activation. In addition, inhibiting AMPK activation either by siRNA or compound C resulted in reduced autophagy during starvation. Using a ROS scavenger NAC, AMPK activation is reduced under starvation condition and mTOR signaling is increased. Taken together, mitochondria-generated ROS induces autophagy mediated by the AMPK pathway under starvation conditions. © 2012 Elsevier Inc. All rights reserved.
1. Introduction Autophagy is an intracellular lysosomal degradation process that can be classified into different types such as macroautophagy, microautophagy and chaperone-mediated autophagy [1,2]. Since macroautophagy has been studied most extensively, this study will focus on this type of autophagy and, hereafter autophagy refers to macroautophagy that is characterized by the formation of doublemembrane structures, autophagosomes [3]. Autophagosome encloses cytoplasmic materials and fuses with lysosome to form autolysosome which is a type of acidic vesicular organelles (AVOs). Autolysosomes then degrade enclosed cytoplasmic materials producing essential amino acids and fatty acids which are used to synthesize protein or are oxidized by mitochondrial electron transport chain (mETC) to generate ATP for cell survival [1,2].
⁎ Corresponding author at: Manitoba Institute of Cell Biology, University of Manitoba, 675 McDermot Ave. Rm. ON5042, Winnipeg, MB, Canada R3E 0V9. Tel./fax: +1 204 787 2051x787 2190. E-mail address: [email protected] (S.B. Gibson). 1 L.L and Y.C contributed equally to this work. 0898-6568/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cellsig.2012.09.020
Although autophagy has been investigated intensively, the mechanisms of its regulation are not clear [4]. Furthermore, autophagy is known to be involved in many human diseases [5]. Recently, ROS has been found to regulate autophagy [6–8]. ROS mainly comprises superoxide (O2•−), hydrogen peroxide (H2O2), and hydroxyl radical (•OH) [6]. The major source for intracellular ROS is mETC [9,10]. When O2•− is produced from mETC complexes I, II and III, it can be catalyzed to H2O2 by superoxide dismutase (SOD) which mainly includes copper– zinc SOD (Cu, Zn-SOD or SOD1) and manganese-SOD (Mn-SOD or SOD2). H2O2 can then either be catalyzed to H2O by glutathione peroxidase (GPx), peroxiredoxin III (PrxIII), or catalase [11] or be converted to •OH in the presence of ferrous iron (Fe2+) or copper ion (Cu +). Detailed studies have reported that autophagy can be regulated by both O2•− [7] and H2O2 [8]. We previously found that autophagy induced by starvation of glucose, L-glutamine, pyruvate, and serum (GP starvation) and amino acids and serum (AA starvation) is mediated by O2• [7] but the regulatory mechanism of O2•− induced autophagy is unknown. The 5′ adenosine monophosphate-activated protein kinase (AMPK) is involved in the regulation of autophagy [12]. Specifically, under starvation conditions, AMPK is activated leading to inhibition of the mTOR pathway. This leads to increased formation of autophagosomes and autophagy flux. AMPK is also activated by ROS [13] but the relationship
L. Li et al. / Cellular Signalling 25 (2013) 50–65
between ROS and AMPK activation under starvation conditions leading to autophagy is unclear. In this study, we generated a mETC-deficient cervical cancer cell line, HeLa ρ° cell line. Endogenous levels of O2•− were reduced in HeLa ρ° cells and failed to increase under starvation. In contrast, endogenous levels of H2O2 were increased in ρ° cells and remained unchanged under starvation. Furthermore, starvation induced autophagy was significantly reduced in ρ° cells. Starvation-induced AMPK activation was also significantly decreased in both ρ° cells and in over-expressing SOD2 cells. Inhibition of AMPK activation by treating HeLa cells with AMPK inhibitors compound C and PRKAA1 siRNA blocked starvation induced autophagy. These findings reveal that mETC is a source for starvation-induced ROS involving the AMPK pathway. 2. Materials and methods 2.1. Reagents Compound C (P-5499) and NAC, N-acetyl-cysteine were purchased from Sigma-Aldrich (Sigma-Aldrich Corporation). Acridine orange (AO, A-6014), 3-methyladenine (3-MA, M-9281), Hydrogen peroxide (H2O2, 216763) 2-methoxyestradiol (2-ME, M-6383), rotenone (R-8875), 2-thenoyltrifluoroacetone (TTFA, T27006), 4′,6-diamidino-2-phenylindole (DAPI, D-9542) and medium for GP (glucose, L-glutamine, sodium pyruvate, phenol red, NaHCO3 and serum, D5030) starvation were purchased from Sigma-Aldrich (Sigma-Aldrich Corporation). Medium for AA (amino acids and serum) starvation (EBSS, SH30029.02) was purchased from HyClone Laboratories (HyClone Laboratories, Inc.). Dihydroethidium (DHE, D-1168) and 5-(and-6)-chloromethyl2′,7′-dichlorodihydrofluofluorescein diacetate, acetyl ester (CMH2DCFDA, C-6827) were from Invitrogen (Invitrogen Corporation). DHE, 2-ME, rotenone, TTFA and DAPI were dissolved in dimethyl sulfoxide (DMSO). 3-MA and H2O2 were dissolved in double distilled water. The final concentration of DMSO in media was less than 0.1% and it did not have any effect on the activities tested in this study (data not shown) [7].
51
Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, 100 mg/ml streptomycin, 0.1 μM ethidium bromide and 50 ng/ml uridine in a humidified 5% CO2, 37 °C incubator. Fresh medium was changed twice per week and cells were split and diluted by trypsinization and centrifugation when the confluency reached 80%. Used old medium containing ethidium bromide was bleached for several hours before it was flushed into sink by lots of water. The mitochondrial DNA encoded mETC complex subunits were measured at the mRNA and protein levels every month until these subunit levels were not detectable when compared to the wt HeLa cells. Supplemental data Fig. S1 demonstrated that the ND3 subunit of complex I at the mRNA level and the COX2 subunit of complex IV at the protein level were not detectable when compared to that of HeLa wt cells after six-month's treatment. Additional two-month's treatment with ethidium bromide was performed before the cells were maintained in normal medium without ethidium bromide but uridine was always added. After HeLa ρ° cells were maintained in medium without ethidium bromide for one year (the time when this manuscript was written), ND3 and COX2 subunits were still not detected (data not shown). This indicates that the developed HeLa ρ° cells are stable along the process for this study. The information of media for growing HeLa wt cells and HeLa SOD2 cells (cells overexpressing SOD2) is the same as in our previous study [7]. 2.4. PCR RNA samples were extracted following the Qiagen RNease mini kit protocol. RNA was stored in RNase-free water at −80 °C until use. RT-PCR of mETC complex I subunit ND3 gene was performed using one-step PCR kit (Bio-Rad Laboratories, Inc., 1708895) following its protocol. Primers for ND3 genes: forward, 5′ATCCACCCCTTACGAGTGC3′; Reverse, 5′GGCCAGACTTAGGGCTAGGA3′. Real time PCR of PRKAA1 gene was performed using SYBR Green MasterMix kit (Qiagen, 204143+ 204146) in a 96-well plate (15 min at 95 °C, 40 cycles of 15 s at 95 °C, 15 s at 60 °C and 20 s at 60 °C). The primers for PRKAA1 gene: forward, 5′GGAGCCTTGATGTGGTAGGA 3′; Reverse, 5′CGCCGAC TTTCTTTTTCATC 3′. The primers for β-actin gene (reference gene): forward, 5′AAAAGCCACCCCACTTCTCT 3′; Reverse, 5′CTCAAGTTGGGGGA CAAAAA 3′.
2.2. Antibodies and siRNAs 2.5. Silencing PRKAA1 genes by siRNA Phospho‐specific 4EBP-1 and total 4EBP-1 antibodies were purchased from Cell Signaling Technology. AMPK alpha 1 primary antibody (2532) and phospho-AMPK alpha (Thr 172) primary antibody (2535) were purchased from Cell Signaling Technology (Cell Signaling Technology, Inc.) and its secondary antibody goat anti-rabbit IgG(H +L) (170–6515) HRP was from Bio-Rad Laboratories (Bio-Rad Laboratories, Inc.). Phsopho-4E-BP1 (Thr 37, 9457) and 4E-BP1 (9452) antibodies were purchased from Cell Signaling Technology Inc. Goat polyclonal cytochrome c oxidase COX2 primary antibody (sc-23984) and its secondary antibody donkey anti-goat IgG-HRP (sc-2020) were purchased from Santa Cruz Biotechnology (Santa Cruz Biotechnology, Inc.). The information of anti-LC3 primary antibodies is the same as described in our previous study [7]. The siRNA against PRKAA1 genes was purchased from Applied Biosystems with sequence ID as s100. Scrambled siRNA (control siRNA) was purchased from Dharmacon Technologies (ONTARGETplus Non-targeting Pool, D-001210-01). 2.3. Cell culture and the development of mETC deficient cells HeLa cells that are deficient in functional mETC (named as HeLa ρ° cells) were developed by treating cells with ethidium bromide following the method described previously [14]. Ethidium bromide inhibits mitochondrial DNA synthesis leading to reduced expression of 13 subunits of mETC complex I (ND1–ND6 and ND4L), III (cytochrome b), IV (COX1–COX3) and V (ATP6 and ATP8). In contrast, it has negligible effects on nuclear DNA. HeLa cells were grown in Dulbecco's modified
On the first day, same amount of cells was seeded in each Petri plate (100×20 mm) and incubated at 37 °C and 5% CO2. On the second day, cells (30–50% confluency) were transfected with siRNA (scrambled, or PRKAA1). On the fourth day, cells from each big plate were split into 6-well plates with same amount of cells in each well. On the fifth day, old media were removed, and fresh media and H2O2 were added. Cells in all plates were incubated at 37 °C and 5% CO2. On the sixth or seventh day, cells were collected and analyzed, and partial cells were lysed to make protein lysates for Western blot. Transfection of siRNA into cells follows the Invitrogen protocols with some modifications. For transfection in each Petri plate, 10 μl of Oligofectamine™ Reagent (Invitrogen Corporation, 12252‐011) was diluted with 40 μl of plain DMEM medium (without serum) in an eppendof tube and the diluted reagent was incubated at room temperature for 5–10 min. In another eppendof tube, 10 μl of 20 μM siRNA was added into 440 μl of plain DMEM medium. Then add diluted Oligofectamine™ Reagent to diluted siRNA solution, mix gently, and incubate at room temperature for 15–20 min. Wash cells once with plain DMEM medium. Add 2 ml plain DMEM medium and 500 μl of the siRNA-Oligofectamine™ Reagent complex into each plate containing cells and mix. For the “Non siRNA plate”, 2.5 ml plain DMEM medium was added without Oligofectamine™ Reagent and siRNA. Incubate the cells for 4 h at 37 °C and 5% CO2. Then, add 2.5 ml plain DMEM and 400 μl serum (FBS or BCS) into each plate. Mix and incubate at 37 °C and 5% CO2. The final concentration of siRNA in media was 40 nM [7].
52
200
200
autofluorescence
Counts
Counts
A)
No GP
Control
autofluorescence Control No GP
100
101
102
103
104
100
101
200
autofluorescence Control No AA
200
Counts
Counts
103
104
100
101
102
103
FL1-H
Superoxide
Hydrogen peroxide
C)
104
Hela ρ cells
Hela wt cells
200
autofluorescence Control
102
Control No AA
FL3-H
Hela ρ cells
Hela wt cells
104
No GP
autofluorescence
autofluorescence
autofluorescence No GP
No GP
Control
Control No GP
Control
0
0 100
101
102
103
104
100
101
FL3-H
102
103
104
100
101
102
103
104
100
101
FL1-H
FL3-H
200
102
103
104
FL1-H
200
Counts
Counts
L. Li et al. / Cellular Signalling 25 (2013) 50–65
B)
101
103
autofluorescence
Counts
Counts
200
100
102
FL1-H
FL3-H
autofluorescence Control
autofluorescence
autofluorescence Control
Control
No AA
autofluorescence
No AA
Control
No AA
No AA
0
0 100
101
102
103
104
100
FL3-H
101
102
FL3-H
Superoxide
103
104
100
101
102
103
104
100
101
FL1-H
102
103
104
FL1-H
Hydrogen peroxide
Fig. 1. ROS production in HeLa wt and ρ° cells following starvation. A) Hela cells were starved of GP or AA for 1 h and intracellular ROS species O2•− and H2O2 were simultaneously measured by flow cytometry as described in Materials and methods section. Wild type (B) or ρ° (C) cells were starved for 8 h and ROS species were measured as described above. ROS, reactive oxygen species; GP, glucose, L-glutamine, pyruvate, and serum; AA, amino acids and serum; O2•−, superoxide; H2O2, hydrogen peroxide. Right shift of a histograph (peak) indicates a higher level of O2•− (FL3-H) or H2O2 (FL1-H). The results represent three independent experiments.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
53
Fig. 2. Amount of autophagy in HeLa wt cells and ρ° cells following starvation. The measurement of autophagy has been described in Materials and methods section. (A) GFP-LC3 puncta (green dots, autophagosomes). (i) Scale bars in fluorescent pictures represent 10 μm. (ii) Percentage of cells with GFP-LC3 puncta was obtained by counting at least 100 cells. (iii) Number of puncta per GFP-LC3 cell was the average of at least 30 GFP-LC3 cells. Error bars represent standard deviation (S.D.) (n=3). Starvation was for 24 h. (B) Formation of AVOs (acidic vesicular organelles). (i) AVOs, which include autolysosomes, were represented by the red puncta dots in the fluorescent pictures. The cells that were treated with 3-MA (3 mM) were indicated (ii) AVOs formation was also measured by flow cytometry (histographs). 1: Wt, Control; 2: Wt, No GP/No AA; 3: ρ°, Control; 4: ρ°, No GP/No AA. The cells were starved for 24 h. (C) i) LC3-II Western blot. The lysosomal inhibitor NH4Cl (30 mM) was used to measure the amount of LC3 II as an indicator of autophagy flux. β-Actin was used as the loading control. The blots displayed represent the amalgamation of several Western blots. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error. D) HeLa and ρ° cells were starved of GP or AA and lysed over a 24 hour time course. The lysates were Western blotted for LC3 expression and stripped and reprobed for β-actin. Western blots were also quantified by densitometry as described above.
54
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 2 (continued).
2.6. AVOs detection AVOs (acidic vesicular organelles), which include autolysosomes, can be observed by fluorescent microscopy or analyzed by flow cytometry. The mechanism and method for flow cytometric analysis
of AVOs have been described in our previous studies [15]. To observe AVOs under a fluorescent microscope, cells were grown on coverslips and stained with acridine orange with a final concentration of 100 μg/ml for 5 min. The cells were observed under fluorescent microscope.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
55
Fig. 2 (continued).
2.7. Staining autophagosomes with GFP-LC3 Cells were transfected with 1 μg of GFP or GFP-LC3 expressing plasmid in each well of 6-well plates using lipofectamine as per
manufacturer's instructions (Invitrogen Corporation, 11668‐019). After 4 h, cells were starved for 24 h and the cells were trypsinized and placed on slides. The fluorescence of GFP or GFP-LC3 was viewed and the rate of GFP-LC3 vacuoles (autophagosomes) was counted
56
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 3. AMPK activation in HeLa wt cells and ρ° cells after starvation. (A) i) HeLa, ii) ρ° and iii) U87 cells were starved of GP or AA and lysed over a 24 hour time course. The lysates were Western blotted for phosphorylated (T172) AMPK (P-AMPK), and stripped and reprobed for total AMPK and β-actin. iv) The amount of phosphorylated AMPK compared to total AMPK was determined by densitometry and the error bars represent standard error from three independent experiments. * represents statistical significance (pb 0.05). B) i) Wt and ρ° cells were starved of GP or AA for 24 h and the amount of phosphorylated AMPK was determined as described above. The blots were stripped and reprobed for β-actin. Over-expression of SOD2 in HeLa cells was also GP or AA starved for 24 h and Western blotted for p-AMPK protein levels. Over-expression of SOD2 cells was also GP or AA starved. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error. C) i) The expression of total AMPK protein was determined by Western blotting. β-Actin was used as the loading control. The blots displayed represent the amalgamation of several Western blots. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 3 (continued).
57
58
L. Li et al. / Cellular Signalling 25 (2013) 50–65
L. Li et al. / Cellular Signalling 25 (2013) 50–65
59
Fig. 4. The role of AMPK activation in starvation-induced autophagy in HeLa cells. (A) i) HeLa cells were treated with AMPK inhibitor compound C (cpd C) (40 μM) and cells were then placed under GP or AA starvation over a 24 hour time course. The levels of AMPK-phosphorylation were determined by Western blot. The blots were then stripped and reprobed for β-actin. This represents three independent experiments. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error. B) i) HeLa cells were treated with AMPK inhibitor compound C (cpd C) in the presence or absence of GP or AA starvation for 48 h. The LC3-II protein levels were determined by Western blotting. Ii) Western blots were quantified by densitometry as described above. C). i). The gene that encodes for AMPK catalytic subunit α1 (PRKAA1) was knocked down with siRNA as described in Materials and methods section. Level of PRKAA1 mRNA was determined by quantitative real time PCR after 48 h of siRNA knock down. Fold change in mRNA values was normalized to mRNA level of the reference gene β-actin. The cells transfected with siRNA were also lysed and Western blotted for AMPK. Actin was Western blotted as a loading control ii). The HeLa cells knocked down of PRKAA1 by siRNA were starved of GP or AA for 48 h and Western blotted for LC3-II protein levels. NH4Cl (30 μM) was used to prevent LC3 degradation thereby measuring autophagy flux. β-Actin was used as a protein loading control. The blots displayed represent the amalgamation of several Western blots. iii) Western blots were quantified by densitometry as described previously.
under a fluorescent microscope. The DNA was stained with antifade DAPI solution after cells were fixed with 3.7% paraformaldehyde. When 3-MA or zVAD was used in the combination with starvation, it was pre-incubated in an incubator (37 °C, 5% CO2) for 1 h [15].
chloromethyl-20, 70-dichlorodihydrofluorescein diacetate acetyl ester (CMH2DCFDA), respectively. The method is the same as described in our previous study [7].
2.8. Flow cytometric analysis of ROS
2.9. Western blot analysis
ROS species O2•− and H2O2 were measured by flow cytometry after cells were stained with dihydroethidium (DHE) and 5-(and-6)-
Tris-glycine SDS-PAGE was used, except for the detection of conversion of LC3-I (18 kDa, cytoplasmic form) to LC3-II (16 kDa,
60
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 5. The level of AKT activation following starvation. A) i) HeLa and B) i) U87cells were GP or AA starved over a 24 hour time course. The cells were lysed and the lysates were Western blotted using antibodies to detect phosphorylated AKT (pAKT). The blots were stripped and reprobed for total AKT and β-actin as a loading control. ii) These Western blots were analyzed by densitometry and normalized to actin. Standard error represents three independent experiments.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
61
Fig. 6. Role of ROS in AMPK and mTOR substrate 4EBP-1 phosphorylation following starvation. Hela cells were starved over a 24 hour time course in the presence or absence of the ROS scavenger NAC. A) i) The cells were lysed and Western blotted for phosphorylated AMPK and total AMPK. Actin was also Western blotted for equal loading. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error. B) i) The lysates of these cells were also Western blotted for the phosphorylated mTOR substrate 4EBP-1. Total 4EBP-1 and actin were also Western blotted for equal loading. ii) Western blots were quantified by densitometry. C) i) HeLa cells were also starved treated with ROS scavenger Tiron or NAC and NH4Cl (lysosome inhibitor) to prevent LC3 degradation. LC3 expression was detected by Western blotting and stripped and reprobed for β-actin. As a positive control, cells were also treated with compound C and LC3 expression determined. ii) Western blots were quantified by densitometry and normalized to actin levels. Standard error represents three independent experiments.
62
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 6 (continued).
L. Li et al. / Cellular Signalling 25 (2013) 50–65
preautophagosomal and autophagosomal membrane-bound form), where Tris-Tricine SDS-PAGE was used as previously reported [7]. 2.10. Statistical analysis All experiments have been repeated at least three times and the data were expressed as means ± S.D. (standard deviation) (n = 3). Student's t-test was used for statistical analysis with p b 0.05 as the criterion for statistical significance. 3. Results 3.1. Deficient mETC blocks superoxide production under starvation It is well known that the major source for intracellular ROS is mETC [6]. Our previous study demonstrated that O2•− specifically regulates autophagy induced by starvation and inhibition of the mETC [15]. However, the intracellular source for starvation-induced O2•− is unknown. We found that GP starvation slightly induced O2•− levels after 1 h but failed to induce H2O2. Following 1 h of AA starvation, both O2•− and H2O2 levels were increased (Fig. 1A). To investigate the source of ROS, we generated a HeLa cell line that is deficient in mETC by treating cells with ethidium bromide [14]. Ethidium bromide has little effects on nuclear DNA but inhibits mitochondrial DNA synthesis that is required for the expression of 13 mETC subunits including complex I subunit ND3 and complex IV subunit COX2 [14]. To confirm that we generated ρ° cells, we found that HeLa cells treated with ethidium bromide were depleted of ND3 (mRNA level) and COX2 (protein level) subunits (supplemental data Fig. S1). We then compared ROS levels under GP or AA starvation in wt and ρ° cells by simultaneously measuring two ROS species O2•− and H2O2 (Fig. 1B–C). When endogenous levels of ROS were compared, O2•− levels were higher in wt cells as compared to ρ° cells (Fig. 1B) whereas lower levels of H2O2 were detected in wt cells than in ρ° cells (Fig. 1C). When cells were GP or AA starved, O2•− levels increased in wt cells but remained unchanged in ρ° cells (Fig. 1B). GP starvation failed to induce H2O2 production in both wt and ρ° cells, while AA starvation induced H2O2 production in wt cells but failed to be induced in ρ° cells (Fig. 1C). In addition, mETC complex I inhibitor rotenone and SOD inhibitor 2-methoxyestradiol (2-ME) which is also an inhibitor of mETC complex I [16] induced ROS (O2•− and/or H2O2) generation in wt cells but failed to increase ROS in ρ° cells (data not shown). These findings provide evidence for O2•− generation through the mETC under starvation conditions. 3.2. Deficient mETC blocks starvation-induced autophagy Since starvation induces autophagy and the depletion of mETC in ρ° cells blocks ROS generation induced by starvation (Fig. 1), the amount of starvation-induced autophagy in ρ° cells was evaluated. Autophagy was detected by three sets of assays: observation and quantification of green fluorescent protein (GFP)-LC3 puncta by fluorescent microscopy that detects autophagosomes, staining with acridine orange to detect AVOs by fluorescent microscopy and flow cytometry and Western blot of LC3-II protein levels that measures autophagy flux. Starvation of GP or AA induced the formation of multiple GFP-LC3 puncta (green dots indicating formation of autophagosomes) in wt cells which was significantly reduced in ρ° cells (Fig. 2Ai). The percentage of cells with GFP-LC3 puncta was approximately 80% in wt cells starved of GP or AA compared to less than 10% in starved ρ° cells (Fig. 2Aii). Furthermore, the numbers of GFP-LC3 puncta per GFP-LC3 cell were 35 and 20 in GP and AA starved wt cells, respectively, compared to 3 in starved ρ° cells (Fig. 2Aiii). Since the GP or AA starvation-induced AVOs formation (indicator of autolysosomes) is inhibited by autophagy inhibitors 3-methyladenine (3-MA), wortmannin, and siRNAs against autophagy genes beclin-1 and atg-7, detection of AVOs formation could be used to identify autophagy [2,7]. Fig. 2Bi shows that many red puncta (AVOs)
63
can be observed in wt cells starved of GP or AA but failed to be detected in ρ° cells. We also determine that there was no significant difference in the cell shape between HeLa and ρ° cells (supplemental data Fig. S2) Inhibition of autophagy with 3-MA also reduced the amount of AVOs in wt cells (Fig. 2Bi). The same results were also found by flow cytometry (Fig. 2Bii). During autophagy, the cytoplasmic microtubule-associated protein 1 light chain 3 (LC3-I) will be converted to the lipidated, autophagosome-membrane-bound form (LC3-II) [5]. Furthermore, a lysosomal inhibitor NH4Cl prevents degradation of LC3-II determining autophagy flux [17]. In Fig. 2C, GP and AA starvation-induced LC3-II protein levels in the presence of NH4Cl were increased compared to control wt cells whereas in ρ° cells, LC3-II levels failed to increase compared to control in GP starved and AA starved wt cells. Starvation induced ROS was detected at 1 h. We determined at what times after starvation LC3-II increased. In Fig. 2D, we found that LC3-II was increased at 2 h following GP starvation and 24 h after AA starvation. GP starvation still showed LC3-II increase after 24 h (Fig. 2D). This correlated with the early increased in ROS levels followed by autophagy. In ρ° cells, there was no increase detected over this same time course (Fig. 2D). Furthermore, mETC complex I inhibitors rotenone and 2-ME (also an inhibitor of SOD) also induced autophagy in wt cells but not in ρ° cells (supplemental data Fig. S3). This suggests that mETC is required for starvation-induced autophagy. 3.3. Deficient mETC cells fail to activate AMPK and autophagy following starvation The above-demonstrated results suggest that starvation-induced autophagy is regulated by mitochondrial ROS. The downstream target for ROS regulation of autophagy is not known. AMPK is activated by ROS and starvation contributes to the induction of autophagy [12]. Fig. 3A shows that GP and AA starvation induced AMPK phosphorylation over a 24 hour time course (Fig. 3A) where AMPK phosphorylation was detected after only 2 h of starvation in HeLa and U87 cell lines (Fig. 3A). The amount of AMPK phosphorylation following GP starvation was greater than AA starvation even at earlier time points (Fig. 3A iv). This correlates with delayed induction of autophagy following AA starvation compared to GP starvation. In ρ° cells, AMPK phosphorylation failed to be induced following both GP and AA starvation whereas both GP and AA starvation induced AMPK phosphorylation in wt cells over the same 24 hour time course (Fig. 3B). This correlates with lower levels of O2•− in ρ° cells compared to wt cells (Fig. 1). Over-expression of SOD2 in HeLa cells that reduces the intracellular O2•− levels [7], decreased AMPK phosphorylation in GP and AA starved cells (Fig. 3B). This starvation induced AMPK phosphorylation was not due to increased AMPK levels. Indeed, total AMPK protein levels were not increased after starvation (Fig. 3C). When AMPK inhibitor compound C was added, AMPK phosphorylation was blocked following GP or AA starvation over a 24 hour time course with positive control (+) being AMPK phosphorylation after 24 h of starvation (Fig. 4A). AMPK protein levels were slightly reduced over this time course (Fig. 4A). In addition, LC3-II protein levels were reduced from 7.8 fold to 1.4 fold increase under GP starvation, and from 5.2 fold increase to 3.7 fold increase under AA starvation following treated with compound C (Fig. 4B). When PRKAA1 (AMPK) gene was knocked down by siRNA (Fig. 4Ci), GP and AA starvation-induced LC3-II protein levels were also reduced from 3.8 fold increase to 1.6 fold increase under GP starvation, and from 3.7 fold increase to 0.5 fold decrease under AA starvation (Fig. 4Cii). 3.4. Reactive oxygen species regulates the AMPK–mTOR pathway Both AKT and AMPK are upstream of the mTOR pathway and inhibition of this pathway increased autophagy. We determine the level of AKT activation in HeLa and U87 cells. We found that both
64
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 7. Schematic diagram describing starvation induced autophagy mediated by reactive oxygen species. Under starvation conditions, the mitochondria mediated oxidative phosphorylation becomes incomplete and increases production of reactive oxygen species (ROS). This leads to activation of AMPK independent of LBK. This causes inhibition of the PI3K/AKt/mTOR signaling pathway and subsequent increase autophagy.
GP and AA starvation failed to induce AKT phosphorylation over a 24 hour time course in HeLa cells (Fig. 5A). Indeed, in U87 cells, the level of AKT phosphorylation decreased (Fig. 5B). To confirm that starvation activates the mTOR pathway, we determine the level of phosphorylation of the AMPK and mTOR substrate 4E-BP1 was reduced in Hela cells. We found that AMPK activation was increased and 4E-BP1 phosphorylation was reduced after GP starvation (Fig. 6A and B). When ROS scavengers NAC was added to Hela cells, the amount of phosphor-AMPK was reduced whereas 4E-BP1 phosphorylation was increased (Fig. 6A and B). Under starvation conditions, ROS scavengers also reduced AMPK phosphorylation and increased 4E-BP1 phosphorylation (Fig. 6A and B). This correlated with reduced LC-3 II expression following starvation and treatment with the ROS scavenger Tiron and NAC (Fig. 6C). In addition, we found similar results in U87 cells (supplemental Fig. 4). This indicates that starvation-induced autophagy is mediated by mitochondria ROS activation of the AMPK/mTOR signaling (Fig. 7).
4. Dicussion Autophagy is involved in a wide variety of functions including cell growth, survival, and death [5]. One of the main stimuli that induce autophagy is starvation. Starvation induced autophagy is physiologically important in regulating cell survival. Our previous study has demonstrated that starvation-induced autophagy is specifically regulated by the ROS species O2•− [7]. It is well known that the major source for intracellular ROS is the mETC [10]. Herein, we demonstrate that mETC deficient cells failed to increase O2•− production and failed to undergo autophagy following starvation. This was mediated by AMPK activation and subsequent mTOR pathway inhibition (Fig. 7). This suggests that mitochondrial regulated ROS and specifically O2•− induced autophagy during starvation.
ROS is regulated by a series of antioxidant enzymes. Since SOD is the antioxidant enzyme to convert O2•− to H2O2 [18,19], the level of O2•− can be controlled by modulating SOD activity. Our findings indicate that starvation induced autophagy can be inhibited by over expression SOD2 which is found at the mitochondria. Scherz-Shouval et al. demonstrated that significant amount of AA starvation-induced H2O2 was located in mitochondria [8]. Activation of downstream antioxidant enzymes that catalyze H2O2 to H2O such as catalase, GPx and PrxIII can also reduce autophagy levels. Furthermore, NADPH oxidases regulate ROS levels leading to antibacterial autophagy response [20]. It is important to note that changes in H2O2 levels also affect levels of O2•− through a chain reaction [18,19]. We found that in mETC deficient cells, blocked starvation induced O2•− correlating with decreased starvation mediated autophagy. This illustrates the importance of the mitochondria in regulating starvation induced autophagy. It was reported that the AMPK pathway is involved in autophagy [12,13,21]. In particular, AMPK activation contributes to starvation, hypoxia and oxidative stress induced autophagy. Under oxidative stress, DNA damage induced ATM and PARP activation leads to AMPK activation [20,22]. Furthermore, AMPK is activated by pro-oxidant species [23]. AMPK also induces autophagy through inhibiting mTOR signaling through ULK1 [24, 25]. During starvation, we demonstrate that the blocking ROS is sufficient to reduce AMPK activation under starvation conditions and increase mTOR pathway activation. This demonstrates that ROS regulates the AMPK/mTOR pathway. HeLa cells lack the upstream activator of AMPK, LKB1 but we were able to show that starvation activates AMPK. In mammalian cells, AMPK can be activated by upstream factors including LKB1, TAK1, and CaMKKβ. A recent study suggests that ROS activates AMPK by activating ataxia-telangiectasia mutated (ATM), which is an upstream activator of AMPK [22]. Finally protein kinase A (PKA) inhibition can also increase the activation of AMPK [26]. Thus, AMPK can be activated through many different pathways besides LKB1 and our data suggest that ROS activation of AMPK is not dependent on LKB1 at least in HeLa cells. Besides AMPK, several other downstream targets for ROS induced autophagy have been proposed. The cysteine protease Atg4 has been identified as a direct target for oxidation by H2O2, specifically a cysteine residue located near the active site as critical for this regulation [8]. This leads to starvation-induced oxidative inactivation of Atg4 promoting lipidation of Atg8, facilitating autophagosome formation [8]. It remains to be determined whether ROS-mediated inhibition of Atg4 is regulated by the mitochondria. ROS could also be involved in autophagic cell death involving ROS accumulation caused by selective autophagic degradation of catalase [27]. Using siRNA and the chemical inhibitor zVAD to block caspase activation, it has been demonstrated that caspase inhibition triggers autophagy which selectively degrades the antioxidant enzyme catalase. Catalase degradation subsequently caused ROS accumulation and ultimately cell death [27]. This occurs after induction of autophagy making it unlikely that this ROS regulation directly contributes to initiation of the autophagy response under starvation conditions. Both starvation and ROS also activate p53 leading to its transcriptional activation and up-regulation of autophagy genes [28]. In contrast, cytoplasmic p53 negatively regulates autophagy [29]. Whether ROS generated in the mitochondria affects p53 dependent autophagy is not known and will be the focus for future investigations. Nevertheless, mitochondrial ROS mediated AMPK activation is sufficient to mediate starvation induced autophagy. Since autophagy is involved in many human pathologies [5] and is activated by many treatments for diseases, understanding the regulatory mechanism for autophagy will provide insight into determining the role autophagy plays in diseases. Our findings for a role of mitochondrial regulated ROS in autophagy could provide targets for the development of novel drugs or provide approaches for controlling autophagy in human diseases.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Acknowledgments The study has been supported by a grant from CancerCare Manitoba Foundation. YC has been supported by a post-doctoral fellowship from Manitoba Health Research Council (MHRC). SBG is a Manitoba Research Chair supported by MHRC. Technical assistance was provided by Ms. E.S. Henson. Appendix A. Supplementary data Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.cellsig.2012.09.020. References [1] S. Jin, E. White, Autophagy 3 (2007) 28–31. [2] D.J. Klionsky, H. Abeliovich, P. Agostinis, D.K. Agrawal, G. Aliev, D.S. Askew, M. Baba, E.H. Baehrecke, B.A. Bahr, A. Ballabio, B.A. Bamber, D.C. Bassham, E. Bergamini, X. Bi, M. Biard-Piechaczyk, J.S. Blum, D.E. Bredesen, J.L. Brodsky, J.H. Brumell, U.T. Brunk, W. Bursch, N. Camougrand, E. Cebollero, F. Cecconi, Y. Chen, L.S. Chin, A. Choi, C.T. Chu, J. Chung, P.G. Clarke, R.S. Clark, S.G. Clarke, C. Clave, J.L. Cleveland, P. Codogno, M.I. Colombo, A. Coto-Montes, J.M. Cregg, A.M. Cuervo, J. Debnath, F. Demarchi, P.B. Dennis, P.A. Dennis, V. Deretic, R.J. Devenish, F. Di Sano, J.F. Dice, M. Difiglia, S. Dinesh-Kumar, C.W. Distelhorst, M. Djavaheri-Mergny, F.C. Dorsey, W. Droge, M. Dron, W.A. Dunn Jr., M. Duszenko, N.T. Eissa, Z. Elazar, A. Esclatine, E.L. Eskelinen, L. Fesus, K.D. Finley, J.M. Fuentes, J. Fueyo, K. Fujisaki, B. Galliot, F.B. Gao, D.A. Gewirtz, S.B. Gibson, A. Gohla, A.L. Goldberg, R. Gonzalez, C. Gonzalez-Estevez, S. Gorski, R.A. Gottlieb, D. Haussinger, Y.W. He, K. Heidenreich, J.A. Hill, M. Hoyer-Hansen, X. Hu, W.P. Huang, A. Iwasaki, M. Jaattela, W.T. Jackson, X. Jiang, S. Jin, T. Johansen, J.U. Jung, M. Kadowaki, C. Kang, A. Kelekar, D.H. Kessel, J.A. Kiel, H.P. Kim, A. Kimchi, T.J. Kinsella, K. Kiselyov, K. Kitamoto, E. Knecht, M. Komatsu, E. Kominami, S. Kondo, A.L. Kovacs, G. Kroemer, C.Y. Kuan, R. Kumar, M. Kundu, J. Landry, M. Laporte, W. Le, H.Y. Lei, M.J. Lenardo, B. Levine, A. Lieberman, K.L. Lim, F.C. Lin, W. Liou, L.F. Liu, G. Lopez-Berestein, C. Lopez-Otin, B. Lu, K.F. Macleod, W. Malorni, W. Martinet, K. Matsuoka, J. Mautner, A.J. Meijer, A. Melendez, P. Michels, G. Miotto, W.P. Mistiaen, N. Mizushima, B. Mograbi, I. Monastyrska, M.N. Moore, P.I. Moreira, Y. Moriyasu, T. Motyl, C. Munz, L.O. Murphy, N.I. Naqvi, T.P. Neufeld, I. Nishino, R.A. Nixon, T. Noda, B. Nurnberg, M. Ogawa, N.L. Oleinick, L.J. Olsen, B. Ozpolat, S. Paglin, G.E. Palmer, I. Papassideri, M. Parkes, D.H. Perlmutter, G. Perry, M. Piacentini, R. Pinkas-Kramarski, M. Prescott, T. Proikas-Cezanne, N. Raben, A. Rami, F. Reggiori, B. Rohrer, D.C. Rubinsztein, K.M. Ryan, J. Sadoshima, H. Sakagami, Y. Sakai, M. Sandri, C. Sasakawa, M. Sass, C. Schneider, P.O. Seglen, O. Seleverstov, J. Settleman, J.J. Shacka, I.M. Shapiro, A. Sibirny, E.C. Silva-Zacarin, H.U. Simon, C. Simone, A. Simonsen, M.A. Smith, K. Spanel-Borowski, V. Srinivas, M. Steeves, H. Stenmark, P.E. Stromhaug, C.S. Subauste, S. Sugimoto, D. Sulzer, T. Suzuki, M.S. Swanson, I. Tabas, F. Takeshita, N.J. Talbot, Z. Talloczy, K. Tanaka, K. Tanaka, I. Tanida, G.S. Taylor, J.P. Taylor, A. Terman, G. Tettamanti, C.B. Thompson, M. Thumm, A.M. Tolkovsky, S.A. Tooze, R. Truant, L.V. Tumanovska, Y. Uchiyama, T. Ueno, N.L. Uzcategui, I. van der Klei, E.C. Vaquero, T. Vellai, M.W. Vogel, H.G. Wang, P. Webster, J.W. Wiley, Z. Xi, G. Xiao, J. Yahalom, J.M. Yang, G. Yap, X.M. Yin, T. Yoshimori, L. Yu, Z. Yue, M. Yuzaki, O. Zabirnyk, X. Zheng, X. Zhu, R.L. Deter, Autophagy 4 (2008) 151–175.
65
[3] Y. Chen, M.B. Azad, S.B. Gibson, Canadian Journal of Physiology and Pharmacology 88 (2010) 285–295. [4] Z. Yang, D.J. Klionsky, Current Topics in Microbiology and Immunology 335 (2009) 1–32. [5] N. Mizushima, B. Levine, A.M. Cuervo, D.J. Klionsky, Nature 451 (2008) 1069–1075. [6] M.B. Azad, Y. Chen, S.B. Gibson, Antioxidants & Redox Signaling 11 (2009) 777–790. [7] Y. Chen, M.B. Azad, S.B. Gibson, Cell Death and Differentiation 16 (2009) 1040–1052. [8] R. Scherz-Shouval, E. Shvets, E. Fass, H. Shorer, L. Gil, Z. Elazar, EMBO Journal 26 (2007) 1749–1760. [9] Y. Chen, S.B. Gibson, Autophagy 4 (2008) 246–248. [10] T. Klimova, N.S. Chandel, Cell Death and Differentiation 15 (2008) 660–666. [11] R. Radi, J.F. Turrens, L.Y. Chang, K.M. Bush, J.D. Crapo, B.A. Freeman, Journal of Biological Chemistry 266 (1991) 22028–22034. [12] J. Poels, M.R. Spasic, P. Callaerts, K.K. Norga, Bioessays 31 (2009) 944–952. [13] B.M. Emerling, F. Weinberg, C. Snyder, Z. Burgess, G.M. Mutlu, B. Viollet, G.R. Budinger, N.S. Chandel, Free Radical Biology & Medicine 46 (2009) 1386–1391. [14] M.P. King, G. Attardi, Methods in Enzymology 264 (1996) 304–313. [15] Y. Chen, E. McMillan-Ward, J. Kong, S.J. Israels, S.B. Gibson, Journal of Cell Science 120 (2007) 4155–4166. [16] T. Hagen, G. D'Amico, M. Quintero, M. Palacios-Callender, V. Hollis, F. Lam, S. Moncada, Biochemical and Biophysical Research Communications 322 (2004) 923–929. [17] N. Mizushima, T. Yoshimori, Autophagy 3 (2007) 542–545. [18] T. Hara, K. Nakamura, M. Matsui, A. Yamamoto, Y. Nakahara, R. Suzuki-Migishima, M. Yokoyama, K. Mishima, I. Saito, H. Okano, N. Mizushima, Nature 441 (2006) 885–889. [19] M. Komatsu, S. Waguri, T. Chiba, S. Murata, J. Iwata, I. Tanida, T. Ueno, M. Koike, Y. Uchiyama, E. Kominami, K. Tanaka, Nature 441 (2006) 880–884. [20] Q. Huang, Y.T. Wu, H.L. Tan, C.N. Ong, H.M. Shen, Cell Death and Differentiation 16 (2009) 264–277. [21] J. Liang, S.H. Shao, Z.X. Xu, B. Hennessy, Z. Ding, M. Larrea, S. Kondo, D.J. Dumont, J.U. Gutterman, C.L. Walker, J.M. Slingerland, G.B. Mills, Nature Cell Biology 9 (2007) 218–224. [22] A. Alexander, S.L. Cai, J. Kim, A. Nanez, M. Sahin, K.H. MacLean, K. Inoki, K.L. Guan, J. Shen, M.D. Person, D. Kusewitt, G.B. Mills, M.B. Kastan, C.L. Walker, Proceedings of the National Academy of Sciences of the United States of America 107 (2010) 4153–4158. [23] S. Cardaci, G. Filomeni, M.R. Ciriolo, Journal of Cell Science 125 (2012) 2115–2125. [24] A. Puissant, G. Robert, P. Auberger, Cell Cycle 9 (2010) 3470–3478. [25] J. Kim, M. Kundu, B. Viollet, K.L. Guan, Nature Cell Biology 13 (2011) 132–141. [26] G. Robert, I. Ben Sahra, A. Puissant, P. Colosetti, N. Belhacene, P. Gounon, P. Hofman, F. Bost, J.P. Cassuto, P. Auberger, PLoS One 4 (2009) e7889. [27] L. Yu, F. Wan, S. Dutta, S. Welsh, Z. Liu, E. Freundt, E.H. Baehrecke, M. Lenardo, Proceedings of the National Academy of Sciences of the United States of America 103 (2006) 4952–4957. [28] Y. Kondo, S. Kondo, Autophagy 2 (2006) 85–90. [29] E. Tasdemir, M.C. Maiuri, L. Galluzzi, I. Vitale, M. Djavaheri-Mergny, M. D'Amelio, A. Criollo, E. Morselli, C. Zhu, F. Harper, U. Nannmark, C. Samara, P. Pinton, J.M. Vicencio, R. Carnuccio, U.M. Moll, F. Madeo, P. Paterlini-Brechot, R. Rizzuto, G. Szabadkai, G. Pierron, K. Blomgren, N. Tavernarakis, P. Codogno, F. Cecconi, G. Kroemer, Nature Cell Biology 10 (2008) 676–687.
Contents lists available at SciVerse ScienceDirect
Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig
Starvation-induced autophagy is regulated by mitochondrial reactive oxygen species leading to AMPK activation Lin Li 1, Yongqiang Chen 1, Spencer B. Gibson ⁎ Manitoba Institute of Cell Biology, Faculty of Medicine, University of Manitoba, Winnipeg, MB, Canada Department of Biochemistry and Medical Genetics, Faculty of Medicine, University of Manitoba, Winnipeg, MB, Canada
a r t i c l e
i n f o
Article history: Received 16 May 2012 Received in revised form 29 August 2012 Accepted 12 September 2012 Available online 19 September 2012 Keywords: Autophagy ROS Mitochondria AMPK
a b s t r a c t Starvation is the most extensively studied condition that induces autophagy. Previous studies have demonstrated that starvation-induced autophagy is regulated by reactive oxygen species (ROS) such as superoxide (O2•−) but the source for ROS under starvation conditions and the downstream signaling pathways regulating autophagy are unclear. In this study, a cervical cancer HeLa cell line was generated that was deficient in mitochondrial electron transport chain (mETC) (HeLa ρ° cells). This resulted in endogenous levels of O2•− being significantly reduced and failed to be induced under starvation of glucose, L-glutamine, pyruvate, and serum (GP) or of amino acids and serum (AA) compared to wild type (wt) HeLa cells. In contrast, H2O2 production failed to increase under GP starvation in both wild type and ρ° cells whereas it increased in wt cells but not in ρ° cells under AA starvation. GP or AA starvation induced autophagy was blocked in ρ° cells as determined by the amount of autophagosomes and autolysosomes. Autophagy is regulated by 5′ adenosine monophosphate-activated protein kinase (AMPK) activation and AMPK is activated under starvation conditions. We demonstrate that ρ° cells and HeLa cells over expressing manganese-superoxide dismutase 2 (SOD2) cells fail to activate AMPK activation following starvation. This indicates that mitochondrial ROS might regulate AMPK activation. In addition, inhibiting AMPK activation either by siRNA or compound C resulted in reduced autophagy during starvation. Using a ROS scavenger NAC, AMPK activation is reduced under starvation condition and mTOR signaling is increased. Taken together, mitochondria-generated ROS induces autophagy mediated by the AMPK pathway under starvation conditions. © 2012 Elsevier Inc. All rights reserved.
1. Introduction Autophagy is an intracellular lysosomal degradation process that can be classified into different types such as macroautophagy, microautophagy and chaperone-mediated autophagy [1,2]. Since macroautophagy has been studied most extensively, this study will focus on this type of autophagy and, hereafter autophagy refers to macroautophagy that is characterized by the formation of doublemembrane structures, autophagosomes [3]. Autophagosome encloses cytoplasmic materials and fuses with lysosome to form autolysosome which is a type of acidic vesicular organelles (AVOs). Autolysosomes then degrade enclosed cytoplasmic materials producing essential amino acids and fatty acids which are used to synthesize protein or are oxidized by mitochondrial electron transport chain (mETC) to generate ATP for cell survival [1,2].
⁎ Corresponding author at: Manitoba Institute of Cell Biology, University of Manitoba, 675 McDermot Ave. Rm. ON5042, Winnipeg, MB, Canada R3E 0V9. Tel./fax: +1 204 787 2051x787 2190. E-mail address: [email protected] (S.B. Gibson). 1 L.L and Y.C contributed equally to this work. 0898-6568/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cellsig.2012.09.020
Although autophagy has been investigated intensively, the mechanisms of its regulation are not clear [4]. Furthermore, autophagy is known to be involved in many human diseases [5]. Recently, ROS has been found to regulate autophagy [6–8]. ROS mainly comprises superoxide (O2•−), hydrogen peroxide (H2O2), and hydroxyl radical (•OH) [6]. The major source for intracellular ROS is mETC [9,10]. When O2•− is produced from mETC complexes I, II and III, it can be catalyzed to H2O2 by superoxide dismutase (SOD) which mainly includes copper– zinc SOD (Cu, Zn-SOD or SOD1) and manganese-SOD (Mn-SOD or SOD2). H2O2 can then either be catalyzed to H2O by glutathione peroxidase (GPx), peroxiredoxin III (PrxIII), or catalase [11] or be converted to •OH in the presence of ferrous iron (Fe2+) or copper ion (Cu +). Detailed studies have reported that autophagy can be regulated by both O2•− [7] and H2O2 [8]. We previously found that autophagy induced by starvation of glucose, L-glutamine, pyruvate, and serum (GP starvation) and amino acids and serum (AA starvation) is mediated by O2• [7] but the regulatory mechanism of O2•− induced autophagy is unknown. The 5′ adenosine monophosphate-activated protein kinase (AMPK) is involved in the regulation of autophagy [12]. Specifically, under starvation conditions, AMPK is activated leading to inhibition of the mTOR pathway. This leads to increased formation of autophagosomes and autophagy flux. AMPK is also activated by ROS [13] but the relationship
L. Li et al. / Cellular Signalling 25 (2013) 50–65
between ROS and AMPK activation under starvation conditions leading to autophagy is unclear. In this study, we generated a mETC-deficient cervical cancer cell line, HeLa ρ° cell line. Endogenous levels of O2•− were reduced in HeLa ρ° cells and failed to increase under starvation. In contrast, endogenous levels of H2O2 were increased in ρ° cells and remained unchanged under starvation. Furthermore, starvation induced autophagy was significantly reduced in ρ° cells. Starvation-induced AMPK activation was also significantly decreased in both ρ° cells and in over-expressing SOD2 cells. Inhibition of AMPK activation by treating HeLa cells with AMPK inhibitors compound C and PRKAA1 siRNA blocked starvation induced autophagy. These findings reveal that mETC is a source for starvation-induced ROS involving the AMPK pathway. 2. Materials and methods 2.1. Reagents Compound C (P-5499) and NAC, N-acetyl-cysteine were purchased from Sigma-Aldrich (Sigma-Aldrich Corporation). Acridine orange (AO, A-6014), 3-methyladenine (3-MA, M-9281), Hydrogen peroxide (H2O2, 216763) 2-methoxyestradiol (2-ME, M-6383), rotenone (R-8875), 2-thenoyltrifluoroacetone (TTFA, T27006), 4′,6-diamidino-2-phenylindole (DAPI, D-9542) and medium for GP (glucose, L-glutamine, sodium pyruvate, phenol red, NaHCO3 and serum, D5030) starvation were purchased from Sigma-Aldrich (Sigma-Aldrich Corporation). Medium for AA (amino acids and serum) starvation (EBSS, SH30029.02) was purchased from HyClone Laboratories (HyClone Laboratories, Inc.). Dihydroethidium (DHE, D-1168) and 5-(and-6)-chloromethyl2′,7′-dichlorodihydrofluofluorescein diacetate, acetyl ester (CMH2DCFDA, C-6827) were from Invitrogen (Invitrogen Corporation). DHE, 2-ME, rotenone, TTFA and DAPI were dissolved in dimethyl sulfoxide (DMSO). 3-MA and H2O2 were dissolved in double distilled water. The final concentration of DMSO in media was less than 0.1% and it did not have any effect on the activities tested in this study (data not shown) [7].
51
Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, 100 mg/ml streptomycin, 0.1 μM ethidium bromide and 50 ng/ml uridine in a humidified 5% CO2, 37 °C incubator. Fresh medium was changed twice per week and cells were split and diluted by trypsinization and centrifugation when the confluency reached 80%. Used old medium containing ethidium bromide was bleached for several hours before it was flushed into sink by lots of water. The mitochondrial DNA encoded mETC complex subunits were measured at the mRNA and protein levels every month until these subunit levels were not detectable when compared to the wt HeLa cells. Supplemental data Fig. S1 demonstrated that the ND3 subunit of complex I at the mRNA level and the COX2 subunit of complex IV at the protein level were not detectable when compared to that of HeLa wt cells after six-month's treatment. Additional two-month's treatment with ethidium bromide was performed before the cells were maintained in normal medium without ethidium bromide but uridine was always added. After HeLa ρ° cells were maintained in medium without ethidium bromide for one year (the time when this manuscript was written), ND3 and COX2 subunits were still not detected (data not shown). This indicates that the developed HeLa ρ° cells are stable along the process for this study. The information of media for growing HeLa wt cells and HeLa SOD2 cells (cells overexpressing SOD2) is the same as in our previous study [7]. 2.4. PCR RNA samples were extracted following the Qiagen RNease mini kit protocol. RNA was stored in RNase-free water at −80 °C until use. RT-PCR of mETC complex I subunit ND3 gene was performed using one-step PCR kit (Bio-Rad Laboratories, Inc., 1708895) following its protocol. Primers for ND3 genes: forward, 5′ATCCACCCCTTACGAGTGC3′; Reverse, 5′GGCCAGACTTAGGGCTAGGA3′. Real time PCR of PRKAA1 gene was performed using SYBR Green MasterMix kit (Qiagen, 204143+ 204146) in a 96-well plate (15 min at 95 °C, 40 cycles of 15 s at 95 °C, 15 s at 60 °C and 20 s at 60 °C). The primers for PRKAA1 gene: forward, 5′GGAGCCTTGATGTGGTAGGA 3′; Reverse, 5′CGCCGAC TTTCTTTTTCATC 3′. The primers for β-actin gene (reference gene): forward, 5′AAAAGCCACCCCACTTCTCT 3′; Reverse, 5′CTCAAGTTGGGGGA CAAAAA 3′.
2.2. Antibodies and siRNAs 2.5. Silencing PRKAA1 genes by siRNA Phospho‐specific 4EBP-1 and total 4EBP-1 antibodies were purchased from Cell Signaling Technology. AMPK alpha 1 primary antibody (2532) and phospho-AMPK alpha (Thr 172) primary antibody (2535) were purchased from Cell Signaling Technology (Cell Signaling Technology, Inc.) and its secondary antibody goat anti-rabbit IgG(H +L) (170–6515) HRP was from Bio-Rad Laboratories (Bio-Rad Laboratories, Inc.). Phsopho-4E-BP1 (Thr 37, 9457) and 4E-BP1 (9452) antibodies were purchased from Cell Signaling Technology Inc. Goat polyclonal cytochrome c oxidase COX2 primary antibody (sc-23984) and its secondary antibody donkey anti-goat IgG-HRP (sc-2020) were purchased from Santa Cruz Biotechnology (Santa Cruz Biotechnology, Inc.). The information of anti-LC3 primary antibodies is the same as described in our previous study [7]. The siRNA against PRKAA1 genes was purchased from Applied Biosystems with sequence ID as s100. Scrambled siRNA (control siRNA) was purchased from Dharmacon Technologies (ONTARGETplus Non-targeting Pool, D-001210-01). 2.3. Cell culture and the development of mETC deficient cells HeLa cells that are deficient in functional mETC (named as HeLa ρ° cells) were developed by treating cells with ethidium bromide following the method described previously [14]. Ethidium bromide inhibits mitochondrial DNA synthesis leading to reduced expression of 13 subunits of mETC complex I (ND1–ND6 and ND4L), III (cytochrome b), IV (COX1–COX3) and V (ATP6 and ATP8). In contrast, it has negligible effects on nuclear DNA. HeLa cells were grown in Dulbecco's modified
On the first day, same amount of cells was seeded in each Petri plate (100×20 mm) and incubated at 37 °C and 5% CO2. On the second day, cells (30–50% confluency) were transfected with siRNA (scrambled, or PRKAA1). On the fourth day, cells from each big plate were split into 6-well plates with same amount of cells in each well. On the fifth day, old media were removed, and fresh media and H2O2 were added. Cells in all plates were incubated at 37 °C and 5% CO2. On the sixth or seventh day, cells were collected and analyzed, and partial cells were lysed to make protein lysates for Western blot. Transfection of siRNA into cells follows the Invitrogen protocols with some modifications. For transfection in each Petri plate, 10 μl of Oligofectamine™ Reagent (Invitrogen Corporation, 12252‐011) was diluted with 40 μl of plain DMEM medium (without serum) in an eppendof tube and the diluted reagent was incubated at room temperature for 5–10 min. In another eppendof tube, 10 μl of 20 μM siRNA was added into 440 μl of plain DMEM medium. Then add diluted Oligofectamine™ Reagent to diluted siRNA solution, mix gently, and incubate at room temperature for 15–20 min. Wash cells once with plain DMEM medium. Add 2 ml plain DMEM medium and 500 μl of the siRNA-Oligofectamine™ Reagent complex into each plate containing cells and mix. For the “Non siRNA plate”, 2.5 ml plain DMEM medium was added without Oligofectamine™ Reagent and siRNA. Incubate the cells for 4 h at 37 °C and 5% CO2. Then, add 2.5 ml plain DMEM and 400 μl serum (FBS or BCS) into each plate. Mix and incubate at 37 °C and 5% CO2. The final concentration of siRNA in media was 40 nM [7].
52
200
200
autofluorescence
Counts
Counts
A)
No GP
Control
autofluorescence Control No GP
100
101
102
103
104
100
101
200
autofluorescence Control No AA
200
Counts
Counts
103
104
100
101
102
103
FL1-H
Superoxide
Hydrogen peroxide
C)
104
Hela ρ cells
Hela wt cells
200
autofluorescence Control
102
Control No AA
FL3-H
Hela ρ cells
Hela wt cells
104
No GP
autofluorescence
autofluorescence
autofluorescence No GP
No GP
Control
Control No GP
Control
0
0 100
101
102
103
104
100
101
FL3-H
102
103
104
100
101
102
103
104
100
101
FL1-H
FL3-H
200
102
103
104
FL1-H
200
Counts
Counts
L. Li et al. / Cellular Signalling 25 (2013) 50–65
B)
101
103
autofluorescence
Counts
Counts
200
100
102
FL1-H
FL3-H
autofluorescence Control
autofluorescence
autofluorescence Control
Control
No AA
autofluorescence
No AA
Control
No AA
No AA
0
0 100
101
102
103
104
100
FL3-H
101
102
FL3-H
Superoxide
103
104
100
101
102
103
104
100
101
FL1-H
102
103
104
FL1-H
Hydrogen peroxide
Fig. 1. ROS production in HeLa wt and ρ° cells following starvation. A) Hela cells were starved of GP or AA for 1 h and intracellular ROS species O2•− and H2O2 were simultaneously measured by flow cytometry as described in Materials and methods section. Wild type (B) or ρ° (C) cells were starved for 8 h and ROS species were measured as described above. ROS, reactive oxygen species; GP, glucose, L-glutamine, pyruvate, and serum; AA, amino acids and serum; O2•−, superoxide; H2O2, hydrogen peroxide. Right shift of a histograph (peak) indicates a higher level of O2•− (FL3-H) or H2O2 (FL1-H). The results represent three independent experiments.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
53
Fig. 2. Amount of autophagy in HeLa wt cells and ρ° cells following starvation. The measurement of autophagy has been described in Materials and methods section. (A) GFP-LC3 puncta (green dots, autophagosomes). (i) Scale bars in fluorescent pictures represent 10 μm. (ii) Percentage of cells with GFP-LC3 puncta was obtained by counting at least 100 cells. (iii) Number of puncta per GFP-LC3 cell was the average of at least 30 GFP-LC3 cells. Error bars represent standard deviation (S.D.) (n=3). Starvation was for 24 h. (B) Formation of AVOs (acidic vesicular organelles). (i) AVOs, which include autolysosomes, were represented by the red puncta dots in the fluorescent pictures. The cells that were treated with 3-MA (3 mM) were indicated (ii) AVOs formation was also measured by flow cytometry (histographs). 1: Wt, Control; 2: Wt, No GP/No AA; 3: ρ°, Control; 4: ρ°, No GP/No AA. The cells were starved for 24 h. (C) i) LC3-II Western blot. The lysosomal inhibitor NH4Cl (30 mM) was used to measure the amount of LC3 II as an indicator of autophagy flux. β-Actin was used as the loading control. The blots displayed represent the amalgamation of several Western blots. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error. D) HeLa and ρ° cells were starved of GP or AA and lysed over a 24 hour time course. The lysates were Western blotted for LC3 expression and stripped and reprobed for β-actin. Western blots were also quantified by densitometry as described above.
54
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 2 (continued).
2.6. AVOs detection AVOs (acidic vesicular organelles), which include autolysosomes, can be observed by fluorescent microscopy or analyzed by flow cytometry. The mechanism and method for flow cytometric analysis
of AVOs have been described in our previous studies [15]. To observe AVOs under a fluorescent microscope, cells were grown on coverslips and stained with acridine orange with a final concentration of 100 μg/ml for 5 min. The cells were observed under fluorescent microscope.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
55
Fig. 2 (continued).
2.7. Staining autophagosomes with GFP-LC3 Cells were transfected with 1 μg of GFP or GFP-LC3 expressing plasmid in each well of 6-well plates using lipofectamine as per
manufacturer's instructions (Invitrogen Corporation, 11668‐019). After 4 h, cells were starved for 24 h and the cells were trypsinized and placed on slides. The fluorescence of GFP or GFP-LC3 was viewed and the rate of GFP-LC3 vacuoles (autophagosomes) was counted
56
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 3. AMPK activation in HeLa wt cells and ρ° cells after starvation. (A) i) HeLa, ii) ρ° and iii) U87 cells were starved of GP or AA and lysed over a 24 hour time course. The lysates were Western blotted for phosphorylated (T172) AMPK (P-AMPK), and stripped and reprobed for total AMPK and β-actin. iv) The amount of phosphorylated AMPK compared to total AMPK was determined by densitometry and the error bars represent standard error from three independent experiments. * represents statistical significance (pb 0.05). B) i) Wt and ρ° cells were starved of GP or AA for 24 h and the amount of phosphorylated AMPK was determined as described above. The blots were stripped and reprobed for β-actin. Over-expression of SOD2 in HeLa cells was also GP or AA starved for 24 h and Western blotted for p-AMPK protein levels. Over-expression of SOD2 cells was also GP or AA starved. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error. C) i) The expression of total AMPK protein was determined by Western blotting. β-Actin was used as the loading control. The blots displayed represent the amalgamation of several Western blots. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 3 (continued).
57
58
L. Li et al. / Cellular Signalling 25 (2013) 50–65
L. Li et al. / Cellular Signalling 25 (2013) 50–65
59
Fig. 4. The role of AMPK activation in starvation-induced autophagy in HeLa cells. (A) i) HeLa cells were treated with AMPK inhibitor compound C (cpd C) (40 μM) and cells were then placed under GP or AA starvation over a 24 hour time course. The levels of AMPK-phosphorylation were determined by Western blot. The blots were then stripped and reprobed for β-actin. This represents three independent experiments. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error. B) i) HeLa cells were treated with AMPK inhibitor compound C (cpd C) in the presence or absence of GP or AA starvation for 48 h. The LC3-II protein levels were determined by Western blotting. Ii) Western blots were quantified by densitometry as described above. C). i). The gene that encodes for AMPK catalytic subunit α1 (PRKAA1) was knocked down with siRNA as described in Materials and methods section. Level of PRKAA1 mRNA was determined by quantitative real time PCR after 48 h of siRNA knock down. Fold change in mRNA values was normalized to mRNA level of the reference gene β-actin. The cells transfected with siRNA were also lysed and Western blotted for AMPK. Actin was Western blotted as a loading control ii). The HeLa cells knocked down of PRKAA1 by siRNA were starved of GP or AA for 48 h and Western blotted for LC3-II protein levels. NH4Cl (30 μM) was used to prevent LC3 degradation thereby measuring autophagy flux. β-Actin was used as a protein loading control. The blots displayed represent the amalgamation of several Western blots. iii) Western blots were quantified by densitometry as described previously.
under a fluorescent microscope. The DNA was stained with antifade DAPI solution after cells were fixed with 3.7% paraformaldehyde. When 3-MA or zVAD was used in the combination with starvation, it was pre-incubated in an incubator (37 °C, 5% CO2) for 1 h [15].
chloromethyl-20, 70-dichlorodihydrofluorescein diacetate acetyl ester (CMH2DCFDA), respectively. The method is the same as described in our previous study [7].
2.8. Flow cytometric analysis of ROS
2.9. Western blot analysis
ROS species O2•− and H2O2 were measured by flow cytometry after cells were stained with dihydroethidium (DHE) and 5-(and-6)-
Tris-glycine SDS-PAGE was used, except for the detection of conversion of LC3-I (18 kDa, cytoplasmic form) to LC3-II (16 kDa,
60
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 5. The level of AKT activation following starvation. A) i) HeLa and B) i) U87cells were GP or AA starved over a 24 hour time course. The cells were lysed and the lysates were Western blotted using antibodies to detect phosphorylated AKT (pAKT). The blots were stripped and reprobed for total AKT and β-actin as a loading control. ii) These Western blots were analyzed by densitometry and normalized to actin. Standard error represents three independent experiments.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
61
Fig. 6. Role of ROS in AMPK and mTOR substrate 4EBP-1 phosphorylation following starvation. Hela cells were starved over a 24 hour time course in the presence or absence of the ROS scavenger NAC. A) i) The cells were lysed and Western blotted for phosphorylated AMPK and total AMPK. Actin was also Western blotted for equal loading. ii) Western blots were quantified by densitometry. All data represent three independent experiments and error bars represent standard error. B) i) The lysates of these cells were also Western blotted for the phosphorylated mTOR substrate 4EBP-1. Total 4EBP-1 and actin were also Western blotted for equal loading. ii) Western blots were quantified by densitometry. C) i) HeLa cells were also starved treated with ROS scavenger Tiron or NAC and NH4Cl (lysosome inhibitor) to prevent LC3 degradation. LC3 expression was detected by Western blotting and stripped and reprobed for β-actin. As a positive control, cells were also treated with compound C and LC3 expression determined. ii) Western blots were quantified by densitometry and normalized to actin levels. Standard error represents three independent experiments.
62
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 6 (continued).
L. Li et al. / Cellular Signalling 25 (2013) 50–65
preautophagosomal and autophagosomal membrane-bound form), where Tris-Tricine SDS-PAGE was used as previously reported [7]. 2.10. Statistical analysis All experiments have been repeated at least three times and the data were expressed as means ± S.D. (standard deviation) (n = 3). Student's t-test was used for statistical analysis with p b 0.05 as the criterion for statistical significance. 3. Results 3.1. Deficient mETC blocks superoxide production under starvation It is well known that the major source for intracellular ROS is mETC [6]. Our previous study demonstrated that O2•− specifically regulates autophagy induced by starvation and inhibition of the mETC [15]. However, the intracellular source for starvation-induced O2•− is unknown. We found that GP starvation slightly induced O2•− levels after 1 h but failed to induce H2O2. Following 1 h of AA starvation, both O2•− and H2O2 levels were increased (Fig. 1A). To investigate the source of ROS, we generated a HeLa cell line that is deficient in mETC by treating cells with ethidium bromide [14]. Ethidium bromide has little effects on nuclear DNA but inhibits mitochondrial DNA synthesis that is required for the expression of 13 mETC subunits including complex I subunit ND3 and complex IV subunit COX2 [14]. To confirm that we generated ρ° cells, we found that HeLa cells treated with ethidium bromide were depleted of ND3 (mRNA level) and COX2 (protein level) subunits (supplemental data Fig. S1). We then compared ROS levels under GP or AA starvation in wt and ρ° cells by simultaneously measuring two ROS species O2•− and H2O2 (Fig. 1B–C). When endogenous levels of ROS were compared, O2•− levels were higher in wt cells as compared to ρ° cells (Fig. 1B) whereas lower levels of H2O2 were detected in wt cells than in ρ° cells (Fig. 1C). When cells were GP or AA starved, O2•− levels increased in wt cells but remained unchanged in ρ° cells (Fig. 1B). GP starvation failed to induce H2O2 production in both wt and ρ° cells, while AA starvation induced H2O2 production in wt cells but failed to be induced in ρ° cells (Fig. 1C). In addition, mETC complex I inhibitor rotenone and SOD inhibitor 2-methoxyestradiol (2-ME) which is also an inhibitor of mETC complex I [16] induced ROS (O2•− and/or H2O2) generation in wt cells but failed to increase ROS in ρ° cells (data not shown). These findings provide evidence for O2•− generation through the mETC under starvation conditions. 3.2. Deficient mETC blocks starvation-induced autophagy Since starvation induces autophagy and the depletion of mETC in ρ° cells blocks ROS generation induced by starvation (Fig. 1), the amount of starvation-induced autophagy in ρ° cells was evaluated. Autophagy was detected by three sets of assays: observation and quantification of green fluorescent protein (GFP)-LC3 puncta by fluorescent microscopy that detects autophagosomes, staining with acridine orange to detect AVOs by fluorescent microscopy and flow cytometry and Western blot of LC3-II protein levels that measures autophagy flux. Starvation of GP or AA induced the formation of multiple GFP-LC3 puncta (green dots indicating formation of autophagosomes) in wt cells which was significantly reduced in ρ° cells (Fig. 2Ai). The percentage of cells with GFP-LC3 puncta was approximately 80% in wt cells starved of GP or AA compared to less than 10% in starved ρ° cells (Fig. 2Aii). Furthermore, the numbers of GFP-LC3 puncta per GFP-LC3 cell were 35 and 20 in GP and AA starved wt cells, respectively, compared to 3 in starved ρ° cells (Fig. 2Aiii). Since the GP or AA starvation-induced AVOs formation (indicator of autolysosomes) is inhibited by autophagy inhibitors 3-methyladenine (3-MA), wortmannin, and siRNAs against autophagy genes beclin-1 and atg-7, detection of AVOs formation could be used to identify autophagy [2,7]. Fig. 2Bi shows that many red puncta (AVOs)
63
can be observed in wt cells starved of GP or AA but failed to be detected in ρ° cells. We also determine that there was no significant difference in the cell shape between HeLa and ρ° cells (supplemental data Fig. S2) Inhibition of autophagy with 3-MA also reduced the amount of AVOs in wt cells (Fig. 2Bi). The same results were also found by flow cytometry (Fig. 2Bii). During autophagy, the cytoplasmic microtubule-associated protein 1 light chain 3 (LC3-I) will be converted to the lipidated, autophagosome-membrane-bound form (LC3-II) [5]. Furthermore, a lysosomal inhibitor NH4Cl prevents degradation of LC3-II determining autophagy flux [17]. In Fig. 2C, GP and AA starvation-induced LC3-II protein levels in the presence of NH4Cl were increased compared to control wt cells whereas in ρ° cells, LC3-II levels failed to increase compared to control in GP starved and AA starved wt cells. Starvation induced ROS was detected at 1 h. We determined at what times after starvation LC3-II increased. In Fig. 2D, we found that LC3-II was increased at 2 h following GP starvation and 24 h after AA starvation. GP starvation still showed LC3-II increase after 24 h (Fig. 2D). This correlated with the early increased in ROS levels followed by autophagy. In ρ° cells, there was no increase detected over this same time course (Fig. 2D). Furthermore, mETC complex I inhibitors rotenone and 2-ME (also an inhibitor of SOD) also induced autophagy in wt cells but not in ρ° cells (supplemental data Fig. S3). This suggests that mETC is required for starvation-induced autophagy. 3.3. Deficient mETC cells fail to activate AMPK and autophagy following starvation The above-demonstrated results suggest that starvation-induced autophagy is regulated by mitochondrial ROS. The downstream target for ROS regulation of autophagy is not known. AMPK is activated by ROS and starvation contributes to the induction of autophagy [12]. Fig. 3A shows that GP and AA starvation induced AMPK phosphorylation over a 24 hour time course (Fig. 3A) where AMPK phosphorylation was detected after only 2 h of starvation in HeLa and U87 cell lines (Fig. 3A). The amount of AMPK phosphorylation following GP starvation was greater than AA starvation even at earlier time points (Fig. 3A iv). This correlates with delayed induction of autophagy following AA starvation compared to GP starvation. In ρ° cells, AMPK phosphorylation failed to be induced following both GP and AA starvation whereas both GP and AA starvation induced AMPK phosphorylation in wt cells over the same 24 hour time course (Fig. 3B). This correlates with lower levels of O2•− in ρ° cells compared to wt cells (Fig. 1). Over-expression of SOD2 in HeLa cells that reduces the intracellular O2•− levels [7], decreased AMPK phosphorylation in GP and AA starved cells (Fig. 3B). This starvation induced AMPK phosphorylation was not due to increased AMPK levels. Indeed, total AMPK protein levels were not increased after starvation (Fig. 3C). When AMPK inhibitor compound C was added, AMPK phosphorylation was blocked following GP or AA starvation over a 24 hour time course with positive control (+) being AMPK phosphorylation after 24 h of starvation (Fig. 4A). AMPK protein levels were slightly reduced over this time course (Fig. 4A). In addition, LC3-II protein levels were reduced from 7.8 fold to 1.4 fold increase under GP starvation, and from 5.2 fold increase to 3.7 fold increase under AA starvation following treated with compound C (Fig. 4B). When PRKAA1 (AMPK) gene was knocked down by siRNA (Fig. 4Ci), GP and AA starvation-induced LC3-II protein levels were also reduced from 3.8 fold increase to 1.6 fold increase under GP starvation, and from 3.7 fold increase to 0.5 fold decrease under AA starvation (Fig. 4Cii). 3.4. Reactive oxygen species regulates the AMPK–mTOR pathway Both AKT and AMPK are upstream of the mTOR pathway and inhibition of this pathway increased autophagy. We determine the level of AKT activation in HeLa and U87 cells. We found that both
64
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Fig. 7. Schematic diagram describing starvation induced autophagy mediated by reactive oxygen species. Under starvation conditions, the mitochondria mediated oxidative phosphorylation becomes incomplete and increases production of reactive oxygen species (ROS). This leads to activation of AMPK independent of LBK. This causes inhibition of the PI3K/AKt/mTOR signaling pathway and subsequent increase autophagy.
GP and AA starvation failed to induce AKT phosphorylation over a 24 hour time course in HeLa cells (Fig. 5A). Indeed, in U87 cells, the level of AKT phosphorylation decreased (Fig. 5B). To confirm that starvation activates the mTOR pathway, we determine the level of phosphorylation of the AMPK and mTOR substrate 4E-BP1 was reduced in Hela cells. We found that AMPK activation was increased and 4E-BP1 phosphorylation was reduced after GP starvation (Fig. 6A and B). When ROS scavengers NAC was added to Hela cells, the amount of phosphor-AMPK was reduced whereas 4E-BP1 phosphorylation was increased (Fig. 6A and B). Under starvation conditions, ROS scavengers also reduced AMPK phosphorylation and increased 4E-BP1 phosphorylation (Fig. 6A and B). This correlated with reduced LC-3 II expression following starvation and treatment with the ROS scavenger Tiron and NAC (Fig. 6C). In addition, we found similar results in U87 cells (supplemental Fig. 4). This indicates that starvation-induced autophagy is mediated by mitochondria ROS activation of the AMPK/mTOR signaling (Fig. 7).
4. Dicussion Autophagy is involved in a wide variety of functions including cell growth, survival, and death [5]. One of the main stimuli that induce autophagy is starvation. Starvation induced autophagy is physiologically important in regulating cell survival. Our previous study has demonstrated that starvation-induced autophagy is specifically regulated by the ROS species O2•− [7]. It is well known that the major source for intracellular ROS is the mETC [10]. Herein, we demonstrate that mETC deficient cells failed to increase O2•− production and failed to undergo autophagy following starvation. This was mediated by AMPK activation and subsequent mTOR pathway inhibition (Fig. 7). This suggests that mitochondrial regulated ROS and specifically O2•− induced autophagy during starvation.
ROS is regulated by a series of antioxidant enzymes. Since SOD is the antioxidant enzyme to convert O2•− to H2O2 [18,19], the level of O2•− can be controlled by modulating SOD activity. Our findings indicate that starvation induced autophagy can be inhibited by over expression SOD2 which is found at the mitochondria. Scherz-Shouval et al. demonstrated that significant amount of AA starvation-induced H2O2 was located in mitochondria [8]. Activation of downstream antioxidant enzymes that catalyze H2O2 to H2O such as catalase, GPx and PrxIII can also reduce autophagy levels. Furthermore, NADPH oxidases regulate ROS levels leading to antibacterial autophagy response [20]. It is important to note that changes in H2O2 levels also affect levels of O2•− through a chain reaction [18,19]. We found that in mETC deficient cells, blocked starvation induced O2•− correlating with decreased starvation mediated autophagy. This illustrates the importance of the mitochondria in regulating starvation induced autophagy. It was reported that the AMPK pathway is involved in autophagy [12,13,21]. In particular, AMPK activation contributes to starvation, hypoxia and oxidative stress induced autophagy. Under oxidative stress, DNA damage induced ATM and PARP activation leads to AMPK activation [20,22]. Furthermore, AMPK is activated by pro-oxidant species [23]. AMPK also induces autophagy through inhibiting mTOR signaling through ULK1 [24, 25]. During starvation, we demonstrate that the blocking ROS is sufficient to reduce AMPK activation under starvation conditions and increase mTOR pathway activation. This demonstrates that ROS regulates the AMPK/mTOR pathway. HeLa cells lack the upstream activator of AMPK, LKB1 but we were able to show that starvation activates AMPK. In mammalian cells, AMPK can be activated by upstream factors including LKB1, TAK1, and CaMKKβ. A recent study suggests that ROS activates AMPK by activating ataxia-telangiectasia mutated (ATM), which is an upstream activator of AMPK [22]. Finally protein kinase A (PKA) inhibition can also increase the activation of AMPK [26]. Thus, AMPK can be activated through many different pathways besides LKB1 and our data suggest that ROS activation of AMPK is not dependent on LKB1 at least in HeLa cells. Besides AMPK, several other downstream targets for ROS induced autophagy have been proposed. The cysteine protease Atg4 has been identified as a direct target for oxidation by H2O2, specifically a cysteine residue located near the active site as critical for this regulation [8]. This leads to starvation-induced oxidative inactivation of Atg4 promoting lipidation of Atg8, facilitating autophagosome formation [8]. It remains to be determined whether ROS-mediated inhibition of Atg4 is regulated by the mitochondria. ROS could also be involved in autophagic cell death involving ROS accumulation caused by selective autophagic degradation of catalase [27]. Using siRNA and the chemical inhibitor zVAD to block caspase activation, it has been demonstrated that caspase inhibition triggers autophagy which selectively degrades the antioxidant enzyme catalase. Catalase degradation subsequently caused ROS accumulation and ultimately cell death [27]. This occurs after induction of autophagy making it unlikely that this ROS regulation directly contributes to initiation of the autophagy response under starvation conditions. Both starvation and ROS also activate p53 leading to its transcriptional activation and up-regulation of autophagy genes [28]. In contrast, cytoplasmic p53 negatively regulates autophagy [29]. Whether ROS generated in the mitochondria affects p53 dependent autophagy is not known and will be the focus for future investigations. Nevertheless, mitochondrial ROS mediated AMPK activation is sufficient to mediate starvation induced autophagy. Since autophagy is involved in many human pathologies [5] and is activated by many treatments for diseases, understanding the regulatory mechanism for autophagy will provide insight into determining the role autophagy plays in diseases. Our findings for a role of mitochondrial regulated ROS in autophagy could provide targets for the development of novel drugs or provide approaches for controlling autophagy in human diseases.
L. Li et al. / Cellular Signalling 25 (2013) 50–65
Acknowledgments The study has been supported by a grant from CancerCare Manitoba Foundation. YC has been supported by a post-doctoral fellowship from Manitoba Health Research Council (MHRC). SBG is a Manitoba Research Chair supported by MHRC. Technical assistance was provided by Ms. E.S. Henson. Appendix A. Supplementary data Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.cellsig.2012.09.020. References [1] S. Jin, E. White, Autophagy 3 (2007) 28–31. [2] D.J. Klionsky, H. Abeliovich, P. Agostinis, D.K. Agrawal, G. Aliev, D.S. Askew, M. Baba, E.H. Baehrecke, B.A. Bahr, A. Ballabio, B.A. Bamber, D.C. Bassham, E. Bergamini, X. Bi, M. Biard-Piechaczyk, J.S. Blum, D.E. Bredesen, J.L. Brodsky, J.H. Brumell, U.T. Brunk, W. Bursch, N. Camougrand, E. Cebollero, F. Cecconi, Y. Chen, L.S. Chin, A. Choi, C.T. Chu, J. Chung, P.G. Clarke, R.S. Clark, S.G. Clarke, C. Clave, J.L. Cleveland, P. Codogno, M.I. Colombo, A. Coto-Montes, J.M. Cregg, A.M. Cuervo, J. Debnath, F. Demarchi, P.B. Dennis, P.A. Dennis, V. Deretic, R.J. Devenish, F. Di Sano, J.F. Dice, M. Difiglia, S. Dinesh-Kumar, C.W. Distelhorst, M. Djavaheri-Mergny, F.C. Dorsey, W. Droge, M. Dron, W.A. Dunn Jr., M. Duszenko, N.T. Eissa, Z. Elazar, A. Esclatine, E.L. Eskelinen, L. Fesus, K.D. Finley, J.M. Fuentes, J. Fueyo, K. Fujisaki, B. Galliot, F.B. Gao, D.A. Gewirtz, S.B. Gibson, A. Gohla, A.L. Goldberg, R. Gonzalez, C. Gonzalez-Estevez, S. Gorski, R.A. Gottlieb, D. Haussinger, Y.W. He, K. Heidenreich, J.A. Hill, M. Hoyer-Hansen, X. Hu, W.P. Huang, A. Iwasaki, M. Jaattela, W.T. Jackson, X. Jiang, S. Jin, T. Johansen, J.U. Jung, M. Kadowaki, C. Kang, A. Kelekar, D.H. Kessel, J.A. Kiel, H.P. Kim, A. Kimchi, T.J. Kinsella, K. Kiselyov, K. Kitamoto, E. Knecht, M. Komatsu, E. Kominami, S. Kondo, A.L. Kovacs, G. Kroemer, C.Y. Kuan, R. Kumar, M. Kundu, J. Landry, M. Laporte, W. Le, H.Y. Lei, M.J. Lenardo, B. Levine, A. Lieberman, K.L. Lim, F.C. Lin, W. Liou, L.F. Liu, G. Lopez-Berestein, C. Lopez-Otin, B. Lu, K.F. Macleod, W. Malorni, W. Martinet, K. Matsuoka, J. Mautner, A.J. Meijer, A. Melendez, P. Michels, G. Miotto, W.P. Mistiaen, N. Mizushima, B. Mograbi, I. Monastyrska, M.N. Moore, P.I. Moreira, Y. Moriyasu, T. Motyl, C. Munz, L.O. Murphy, N.I. Naqvi, T.P. Neufeld, I. Nishino, R.A. Nixon, T. Noda, B. Nurnberg, M. Ogawa, N.L. Oleinick, L.J. Olsen, B. Ozpolat, S. Paglin, G.E. Palmer, I. Papassideri, M. Parkes, D.H. Perlmutter, G. Perry, M. Piacentini, R. Pinkas-Kramarski, M. Prescott, T. Proikas-Cezanne, N. Raben, A. Rami, F. Reggiori, B. Rohrer, D.C. Rubinsztein, K.M. Ryan, J. Sadoshima, H. Sakagami, Y. Sakai, M. Sandri, C. Sasakawa, M. Sass, C. Schneider, P.O. Seglen, O. Seleverstov, J. Settleman, J.J. Shacka, I.M. Shapiro, A. Sibirny, E.C. Silva-Zacarin, H.U. Simon, C. Simone, A. Simonsen, M.A. Smith, K. Spanel-Borowski, V. Srinivas, M. Steeves, H. Stenmark, P.E. Stromhaug, C.S. Subauste, S. Sugimoto, D. Sulzer, T. Suzuki, M.S. Swanson, I. Tabas, F. Takeshita, N.J. Talbot, Z. Talloczy, K. Tanaka, K. Tanaka, I. Tanida, G.S. Taylor, J.P. Taylor, A. Terman, G. Tettamanti, C.B. Thompson, M. Thumm, A.M. Tolkovsky, S.A. Tooze, R. Truant, L.V. Tumanovska, Y. Uchiyama, T. Ueno, N.L. Uzcategui, I. van der Klei, E.C. Vaquero, T. Vellai, M.W. Vogel, H.G. Wang, P. Webster, J.W. Wiley, Z. Xi, G. Xiao, J. Yahalom, J.M. Yang, G. Yap, X.M. Yin, T. Yoshimori, L. Yu, Z. Yue, M. Yuzaki, O. Zabirnyk, X. Zheng, X. Zhu, R.L. Deter, Autophagy 4 (2008) 151–175.
65
[3] Y. Chen, M.B. Azad, S.B. Gibson, Canadian Journal of Physiology and Pharmacology 88 (2010) 285–295. [4] Z. Yang, D.J. Klionsky, Current Topics in Microbiology and Immunology 335 (2009) 1–32. [5] N. Mizushima, B. Levine, A.M. Cuervo, D.J. Klionsky, Nature 451 (2008) 1069–1075. [6] M.B. Azad, Y. Chen, S.B. Gibson, Antioxidants & Redox Signaling 11 (2009) 777–790. [7] Y. Chen, M.B. Azad, S.B. Gibson, Cell Death and Differentiation 16 (2009) 1040–1052. [8] R. Scherz-Shouval, E. Shvets, E. Fass, H. Shorer, L. Gil, Z. Elazar, EMBO Journal 26 (2007) 1749–1760. [9] Y. Chen, S.B. Gibson, Autophagy 4 (2008) 246–248. [10] T. Klimova, N.S. Chandel, Cell Death and Differentiation 15 (2008) 660–666. [11] R. Radi, J.F. Turrens, L.Y. Chang, K.M. Bush, J.D. Crapo, B.A. Freeman, Journal of Biological Chemistry 266 (1991) 22028–22034. [12] J. Poels, M.R. Spasic, P. Callaerts, K.K. Norga, Bioessays 31 (2009) 944–952. [13] B.M. Emerling, F. Weinberg, C. Snyder, Z. Burgess, G.M. Mutlu, B. Viollet, G.R. Budinger, N.S. Chandel, Free Radical Biology & Medicine 46 (2009) 1386–1391. [14] M.P. King, G. Attardi, Methods in Enzymology 264 (1996) 304–313. [15] Y. Chen, E. McMillan-Ward, J. Kong, S.J. Israels, S.B. Gibson, Journal of Cell Science 120 (2007) 4155–4166. [16] T. Hagen, G. D'Amico, M. Quintero, M. Palacios-Callender, V. Hollis, F. Lam, S. Moncada, Biochemical and Biophysical Research Communications 322 (2004) 923–929. [17] N. Mizushima, T. Yoshimori, Autophagy 3 (2007) 542–545. [18] T. Hara, K. Nakamura, M. Matsui, A. Yamamoto, Y. Nakahara, R. Suzuki-Migishima, M. Yokoyama, K. Mishima, I. Saito, H. Okano, N. Mizushima, Nature 441 (2006) 885–889. [19] M. Komatsu, S. Waguri, T. Chiba, S. Murata, J. Iwata, I. Tanida, T. Ueno, M. Koike, Y. Uchiyama, E. Kominami, K. Tanaka, Nature 441 (2006) 880–884. [20] Q. Huang, Y.T. Wu, H.L. Tan, C.N. Ong, H.M. Shen, Cell Death and Differentiation 16 (2009) 264–277. [21] J. Liang, S.H. Shao, Z.X. Xu, B. Hennessy, Z. Ding, M. Larrea, S. Kondo, D.J. Dumont, J.U. Gutterman, C.L. Walker, J.M. Slingerland, G.B. Mills, Nature Cell Biology 9 (2007) 218–224. [22] A. Alexander, S.L. Cai, J. Kim, A. Nanez, M. Sahin, K.H. MacLean, K. Inoki, K.L. Guan, J. Shen, M.D. Person, D. Kusewitt, G.B. Mills, M.B. Kastan, C.L. Walker, Proceedings of the National Academy of Sciences of the United States of America 107 (2010) 4153–4158. [23] S. Cardaci, G. Filomeni, M.R. Ciriolo, Journal of Cell Science 125 (2012) 2115–2125. [24] A. Puissant, G. Robert, P. Auberger, Cell Cycle 9 (2010) 3470–3478. [25] J. Kim, M. Kundu, B. Viollet, K.L. Guan, Nature Cell Biology 13 (2011) 132–141. [26] G. Robert, I. Ben Sahra, A. Puissant, P. Colosetti, N. Belhacene, P. Gounon, P. Hofman, F. Bost, J.P. Cassuto, P. Auberger, PLoS One 4 (2009) e7889. [27] L. Yu, F. Wan, S. Dutta, S. Welsh, Z. Liu, E. Freundt, E.H. Baehrecke, M. Lenardo, Proceedings of the National Academy of Sciences of the United States of America 103 (2006) 4952–4957. [28] Y. Kondo, S. Kondo, Autophagy 2 (2006) 85–90. [29] E. Tasdemir, M.C. Maiuri, L. Galluzzi, I. Vitale, M. Djavaheri-Mergny, M. D'Amelio, A. Criollo, E. Morselli, C. Zhu, F. Harper, U. Nannmark, C. Samara, P. Pinton, J.M. Vicencio, R. Carnuccio, U.M. Moll, F. Madeo, P. Paterlini-Brechot, R. Rizzuto, G. Szabadkai, G. Pierron, K. Blomgren, N. Tavernarakis, P. Codogno, F. Cecconi, G. Kroemer, Nature Cell Biology 10 (2008) 676–687.