STAT3 activation by IL-6 from mesenchymal stem cells promotes the proliferation and metastasis of osteosarcoma

Cancer Letters 325 (2012) 80–88

Contents lists available at SciVerse ScienceDirect

Cancer Letters journal homepage: www.elsevier.com/locate/canlet

STAT3 activation by IL-6 from mesenchymal stem cells promotes the proliferation and metastasis of osteosarcoma Bing Tu, Lin Du, Qi-Ming Fan, Ze Tang, Ting-Ting Tang ⇑ Shanghai Key Laboratory of Orthopedic Implant, Department of Orthopedic Surgery, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, China

a r t i c l e

i n f o

Article history: Received 31 January 2012 Received in revised form 14 May 2012 Accepted 9 June 2012

Keywords: STAT3 Interleukin-6 Osteosarcoma Mesenchymal stem cells

a b s t r a c t We previously demonstrated that human mesenchymal stem cells (MSCs) promote the growth of osteosarcoma in the bone microenvironment. The aim of the present study was to further determine the effect of IL-6/STAT3 signaling on the progression of osteosarcoma. First, conditioned medium from MSCs was used to stimulate the growth of osteosarcoma cells (Saos-2) in vitro. We found that STAT3 was activated and that the activation could be blocked by an IL-6-neutralizing antibody. The inhibition of STAT3 in Saos-2 cells by siRNA or AG490 decreased cell proliferation, migration and invasion, down-regulated the mRNA expression of Cyclin D, Bcl-xL and Survivin and enhanced the apoptotic response. Furthermore, a nude mouse osteosarcoma model was established by injecting luciferase-labeled Saos-2 cells into the tibia, and the effect of STAT3 on tumor growth was determined by treating the mice with AG490. In vivo bioluminescence images showed that tumor growth was dramatically reduced in the AG490 group. In addition, STAT3 inhibition decreased the lung metastasis rate and prolonged the survival of these mice. After treatment with AG490, the protein levels of IL-6, p-STAT3 and PCNA were decreased, and the level of apoptosis in the tumor was increased. Altogether, these data indicate that MSCs in the bone microenvironment might promote the progression of osteosarcoma and protect tumor cells from drug-induced apoptosis through IL-6/STAT3 signaling. Ó 2012 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Osteosarcoma is the most common primary malignant tumor of the skeleton and the third most prevalent childhood and adolescent cancer [1]. Appropriate surgical resection and chemotherapy are the most important treatments for patients with osteosarcoma [2,3]. Lesions often occur in the metaphyses of long bones [4], which represent the major pool of mesenchymal stem cells (MSCs). Previous reports have provided evidence that the bone marrow, especially MSCs, contribute significantly to the growth of various tumors [5–8]. Some studies have shown that MSCs exert proinflammatory effects by constitutively producing soluble factors in the bone marrow microenvironment [9,10]. Of these factors and cytokines, interleukin-6 (IL-6) may be one of the most important inflammatory factors [11]. IL-6 is a proproliferative and anti-apoptotic cytokine that is up-regulated during injury, inflammation and infection [12]. IL-6 protein and mRNA are often overexpressed in serum and tumor samples from breast, bone, liver, and colon cancers in humans and mice. IL-6 has ⇑ Corresponding author. Address: Shanghai Key Laboratory of Orthopedic Implant, Department of Orthopedic Surgery, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Zhizaoju Road 639, Shanghai 200011, China. Tel.: +86 21 23271133; fax: +86 21 63137020. E-mail address: [email protected] (T.-T. Tang). 0304-3835/$ - see front matter Ó 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.canlet.2012.06.006

a direct stimulatory effect on the growth of many tumors by increasing the expression of pro-proliferation and survival proteins [13]. The inhibition of IL-6 signaling was shown to slow the growth of colon and lung cancers [14]. Additionally, IL-6-ablated mice were found to be more resistant to the development of colorectal cancer [15]. IL-6 exerts its effects by binding to the IL-6 receptor complex (IL-6R and gp130) or the soluble form of IL-6R (sIL-6R) [16]. The interaction between IL-6 and its receptors produces conformational changes in the gp130 subunit, which then activates signal transducer and activator of transcription 3 (STAT3) via Janus kinases (JAKs). This activation depends on STAT3 phosphorylation of at Y705 by kinases, including JAK2 [17]. The dysregulation of STAT3 activation has been shown to directly promote tumor growth directly by tumor-autonomous mechanisms. STAT3 mediates a wide spectrum of cellular responses, including cell proliferation and apoptosis [18]. Accumulating evidence indicates that persistently activated STAT3 contributes to the development and progression of tumors in numerous organs. In some tumors, constitutively activated STAT3 is associated with resistance to chemotherapeutics and decreased survival [19,20]. Consequently, STAT3 may serve as a novel target for the therapy of some tumors [21]. Consistent with this hypothesis, a variety of STAT3 inhibitors have been shown to prevent tumor cell growth and induce apoptosis both in vitro and in vivo [22]. Although the hyperactivation of STAT3 in cancer may have important prognostic

B. Tu et al. / Cancer Letters 325 (2012) 80–88

and therapeutic value, and a recent study has shown that the level of STAT3 activation directly correlates with prognosis in osteosarcoma patients [23], the correlation between STAT3 expression and osteosarcoma progression is not well understood. We have previously shown that bone marrow-derived MSCs promote the proliferation of osteosarcoma in mice and that the high level of IL-6 secreted by MSCs plays a critical role in this process [24]. However, the mechanisms of this activity have not been fully explored. Although it is the major transcription factor target of IL-6, the effect of STAT3 on the interaction between MSCs and osteosarcoma is unclear. In the present study, we aimed to determine the role of the IL-6-dependent STAT3 signaling pathway in MSCs-driven osteosarcoma cell growth both in vitro and in vivo. 2. Materials and methods 2.1. Cell culture and preparation of conditioned medium Human bone marrow-derived MSCs were obtained from the proximal femur during orthopedic surgery as previously described [25], according to the ethical guidelines of the Shanghai Ninth People’s Hospital, Shanghai, China. The human osteosarcoma cell line Saos-2 was purchased from the Chinese Academy of Sciences (Shanghai, China). Luciferase-labeled Saos-2 cells were generated in our lab. Briefly, luciferase was sub-cloned from the phFL-cmv plasmid and inserted into a lentiviral vector system (Promega, Madison, WI). Then, the constructed vector was transfected into Saos-2 cells. Twenty-four hours after transfection, the cells were grown in culture supplemented with G418 (500 ng/ml, Invitrogen, Carlsbad, CA), and luciferase-positive cells were isolated after two weeks. The cells were maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% FBS, 100 U/ml penicillin and 100 lg/ml streptomycin at 37 °C in a humidified atmosphere containing 5% CO2. To prepare conditioned medium (CM), MSCs were grown to 80% confluence in 10-cm dishes in DMEM/10% FBS. The medium was discarded, and the cells were further cultured in serum-free DMEM for 24 h. The medium was then collected, centrifuged at 1000g for 10 min, and filtered through 0.22-lm filters (Millipore, Billerica, MA). 2.2. siRNA transfection Saos-2 cells were seeded in 10-cm plates at a density of 5  105 for 24 h to reach a sub-confluent status. The Saos-2 cells were then transfected with STAT3-specific siRNA or a scrambled siRNA control (Santa Cruz Biotechnology) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. STAT3 siRNA is a pool of 3 target-specific 20- to 25-nt siRNAs designed to knock down gene expression. 2.3. RNA isolation and real-time PCR Saos-2 cells were exposed to 50 lM AG490 (Calbiochem, CA, USA) or transfected with STAT3 siRNA for 48 h. Total RNA was isolated with the Qiagen RNeasy Mini Kit, and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). Subsequently, real-time PCR was performed using an ABI 7500 Sequencing Detection System and SYBR Premix Ex Taq (Takara, Japan). All of the procedures were performed according to the manufacturer’s protocols. The following primer sequences were used: GAPDH, 50 -ATGGGGAAGGTGAAGGTCG-30 (forward) and 50 GGGGTCATTGATGGCAACAATA-30 (reverse); Cyclin D, 50 -GTGCTGCGAAGTGGAAACC-30 (forward) and 50 -ATCCAGGTGGCGACGATCT-30 (reverse); Bcl-xL, 50 GGTCGCATTGTGGCCTTTTTC-30 (forward) and 50 - TGCTGCATTGTTCCCATAGAG -30 (reverse); and Survivin, 50 -AGGACCACCGCATCTCTACAT-30 (forward) and 50 AAGTCTGGCTCGTTCTCAGTG-30 (reverse). All of the reactions were performed in triplicate. 2.4. Enzyme-linked immunosorbent assay 5

Cells (1  10 per well) were plated in 6-well plates. On the following day, the sub-confluent cells were starved in serum-free DMEM. The medium was replaced with 2 ml per well of fresh serum-free DMEM, and the culture supernatants were collected after 24 h. IL-6 secretion in the culture supernatants was determined using ELISA according to the manufacturer’s protocols (Quantikine Human IL-6, R&D Systems, Minneapolis, MN). 2.5. Western blot Whole cell extracts were prepared by lysing the cells in RIPA buffer (150 mM NaCl, 1% sodium deoxycholate, 0.1% SDS, 50 mM Tris–HCl, pH 7.4, 1 mM EDTA, 1 mM PMSF and 1% Triton X-100) containing a cocktail of protease inhibitors and

81

phosphatase inhibitors. Equal amounts of protein (30–50 lg) were separated by SDS–PAGE and transferred to nitrocellulose membranes. The membranes were probed with p-STAT3 (Y705), STAT3 or b-actin primary antibodies (Cell Signaling Technology, MA, USA). The target proteins were detected using the Odyssey Infrared Imaging System (Li-Cor Biosciences, Lincoln, NE, USA). 2.6. Apoptosis assay After treatment, apoptosis was detected by measuring Annexin V levels and caspase 3/7 activities. For the Annexin V assay, sub-confluent cells were cultured in 6-well plates and harvested by trypsinization. After two washes with cold PBS, the cell pellets were resuspended in binding buffer. Annexin V and propidium iodide (PI) staining were performed according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). The Annexin V and PI signals were measured by FACS. To detect caspase 3/7 activities, the cells were cultured in 96-well plates at a density of 5  103 per well. After 24 h of treatment, the plates were removed from the incubator and allowed to equilibrate to room temperature for 30 min. CaspaseGlo reagent (100 ll, Promega) was added to each well and mixed gently in a plate shaker for 30 s. After incubation at room temperature for 2 h, the luminescence of each sample was determined in a luminescence reader (BioTek, Winooski, VT). All of the experiments were performed in triplicate. 2.7. Cell proliferation assay Saos-2 cells were seeded in 96-well plates at a density of 5  103 per well and allowed to recover for 12 h. The proliferation of tumor cells was evaluated using a bromodeoxyuridine (BrdU, Cell Signaling Technology) incorporation assay. The cells were incubated in 10 lM BrdU for 24 h. After exposure to various treatments, the BrdU incorporation assay was performed according to the manufacturer’s instructions. 2.8. Cell migration and invasion assay To perform the migration and invasion assays, 24-well transwell chambers (8 lm pore, Corning, NY) were used. For the invasion assay, the inserts were precoated with 30 lg of Matrigel (BD Biosciences). The cells (1  105/chamber) were suspended in serum-free DMEM, added to the upper chamber and incubated for 12 h (migration) or 24 h (invasion) at 37 °C. DMEM containing 10% FBS was added to the lower chamber as a chemoattractant. Non-migrating or non-invading cells were removed from the top chamber using a cotton swab. The cells remaining in the bottom chamber were fixed with 4% paraformaldehyde for 10 min and stained with 1% crystal violet in 2% ethanol. The cells that migrated or invaded through the membrane were visually quantified in 3–5 random fields from each membrane under a microscope. All of the experiments were performed at least three times. 2.9. Animals and xenograft model Four-week-old male BALB/c nude mice were injected with 1  107 luciferase-labeled Saos-2 cells into the right proximal tibia and randomly divided into two groups (17 mice per group). The mice were treated daily with an intraperitoneal injection of DMSO (OS group) or 500 lg AG490 (OS + AG490 group). The luminescence activity in the mice was monitored weekly using an In Vivo Imaging System (IVIS, Xenogen, Alameda, CA). In addition, tumor volume was measured twice each week until the animals were sacrificed. The tumor volume was calculated using the following equation: volume = 0.2618  L  W(L + W), where W and L represent the average width and length of the tumor, respectively [26]. Nine mice were sacrificed on day 28, and in situ tumor samples and lung tissues were collected for histological analysis. An additional eight mice per group were maintained until death to allow survival curve calculation. All of the experimental protocols were approved by the Animal Ethics Committee of the Shanghai Jiaotong University School of Medicine (Shanghai, China). 2.10. Immunohistochemistry After sacrifice, tumor samples from each nude mouse were fixed in 4% paraformaldehyde. The tissues were embedded in paraffin and cut into 5-lm sections. The slides were incubated at 60 °C for 30 min, deparaffinized in xylene and rehydrated through a graded ethanol series. After antigen retrieval (boiling in the microwave for 10 min in 10 mM sodium citrate, pH 6.0), intrinsic peroxidase activity was blocked by incubation with 3% hydrogen peroxide for 10 min. Nonspecific antibody binding sites were blocked using goat serum (5%, Sigma-Aldrich). The slides were covered with appropriately diluted primary antibodies and incubated at 4 °C overnight. After three washes in TBS-T for 5 min each, secondary antibodies were applied for 1 h, and staining was developed using the DakoCytomation Envision staining kit according to the manufacturer’s instructions. Apoptosis was assessed with a terminal deoxynucleotidyltransferase–mediated dUTP nick end labeling kit (TUNEL, Roche Applied Science) according to the manufacturer’s instructions. Nuclei were counterstained with 6-diamidino-2-phenylindole (DAPI).

82

B. Tu et al. / Cancer Letters 325 (2012) 80–88

Fig. 1. MSCs activate STAT3 in Saos-2 cells through IL-6. (A) Western blot analysis of p-STAT3 and STAT3 protein levels in extracts from Saos-2 cells treated with MSCs conditioned medium (MSCs CM) for the indicated times. (B) Sub-confluent MSCs and Saos-2 were grown in serum-free DMEM for 24 h, and the IL-6 level in the supernatant was measured by ELISA. (C–E) Western blot analysis of p-STAT3 and STAT3 protein levels in extracts from (C) Saos-2 cells treated with MSCs CM for 30 min, in which IL-6 neutralizing antibody was added, (D) Saos-2 cells treated with IL-6 for the indicated concentrations for 30 min, and (E) Saos-2 cells treated with 20 ng/ml IL-6 for the indicated times.

Fig. 2. IL-6 produced by MSCs promotes Saos-2 cells proliferation by activating STAT3. (A) Saos-2 cells were pretreated with STAT3 siRNA (50 nM) for 48 h or AG490 (50 lM) for 2 h before exposure to IL-6 (20 ng/ml) for 30 min. p-STAT3 and STAT3 level were detected by western blot analysis. (B) A densitometric analysis of p-STAT3 in the Saos-2 cells treated with siRNA and AG490 (n = 5,  p < 0.05). (C) Saos-2 cells were treated with DMEM (Control), MSCs CM or IL-6 abolished CM for 8 days. Cell proliferation was evaluated by BrdU incorporation. (D) Saos-2 cells were treated with STAT3 siRNA or AG490 and then cultured in DMEM (control), MSCs CM or IL-6 (20 ng/ml) for 72 h, cell proliferation was measured with the BrdU assay. (E) Saos-2 cells were treated with STAT3 siRNA or AG490 (50 lM) for 48 h, and the expression of Cyclin D, Bcl-xL and Survivin mRNAs were detected by realtime-PCR. The results are expressed as the mean ± SD.  p < 0.05.

B. Tu et al. / Cancer Letters 325 (2012) 80–88 2.11. Statistical analyses The data are represented as the means ± standard deviations (SDs). Comparisons between two groups were performed using Student’s t-test, and one-way ANOVA was used for multiple comparisons. Fisher’s exact test was used to compare the lung metastasis in the OS and OS + AG490 groups. For the overall survival analysis, Kaplan–Meier curves were analyzed using a log rank test. A p-value < 0.05 was considered to be significant.

3. Results 3.1. MSCs activate STAT3 in Saos-2 cells via IL-6 Our previous study showed that MSCs could promote the osteosarcoma growth in mice by secreting IL-6. We hypothesized that the activation of STAT3 is a critical event in this process. We first explored the response of Saos-2 cells to MSCs by examining the effects of MSCs CM on STAT3 activation. The results showed that activation occurred 10 min after exposure to MSCs CM, and the maximal activation was observed at 30 min (Fig. 1A). Because IL6 is the main activator of STAT3, the IL-6 levels in MSC and Saos2 cell supernatants were evaluated by ELISA. The MSCs secreted a considerable amount of IL-6, whereas Saos-2 cells secreted comparatively low quantities of IL-6 (Fig. 1B). When a neutralizing anti-IL-6 antibody was added to the MSCs CM, IL-6 was blocked, and the activation of STAT3 was inhibited (Fig. 1C). Subsequently, the response of Saos-2 cells to exogenous IL-6 was tested. We ob-

83

served STAT3 activation at IL-6 concentrations ranging from 10 to 100 ng/ml, and this activation occurred in a concentration-dependent manner (Fig. 1D). Similar to the MSCs CM, STAT3 activation by IL-6 was observed at 10 min and peaked at 30 min (Fig. 1E). 3.2. MSCs promote Saos-2 cell proliferation by activating STAT3 Next the activation of STAT3 in Saos-2 cells was inhibited by specific siRNA or AG490, a JAK2 inhibitor. The western blot results confirmed that both 50 nM siRNA and 50 lM AG490 inhibited the activation of STAT3 in Saos-2 cells, and these inhibitory effects could not be reversed in the presence of IL-6 (Fig. 2A and B). To further investigate whether MSCs promoted Saos-2 cell proliferation through IL-6/STAT3 signaling, Saos-2 cells were exposed to MSCs CM, and their proliferation was determined by BrdU assay. MSCs CM enhanced the proliferation of Saos-2 cells; however, the proproliferative effect was impaired when the IL-6 in the medium was abolished by a neutralizing antibody (Fig. 2C). In addition, the inhibition of STAT3 suppressed Saos-2 cell proliferation, even in the presence of MSCs CM or exogenous IL-6 (Fig. 2D). Subsequently, the mRNA expression of the proliferation- and apoptosis-related genes Cyclin D, Bcl-xL and Survivin were examined by real-time PCR. The expressions levels of these three genes were reduced when STAT3 was inhibited by siRNA or AG490 (Fig. 2E). These data suggested that MSCs promoted the proliferation of Saos-2 cells via the IL-6/STAT3 signaling pathway.

Fig. 3. MSCs protect Saos-2 cells from drug-induced apoptosis via IL-6/STAT3 signaling. (A) Saos-2 cells were exposed to different concentrations of cisplatin for 24 h and examined for apoptosis by assaying caspase 3/7 activity. (B) Saos-2 cells were treated with cisplatin, cisplatin + MSCs CM or cisplatin + MSCs CM + anti IL-6 antibody (cisplatin 10 lg/ml), and the apoptosis rate was measured by FACS. (C) Quantification of the apoptosis rate. (D) Saos-2 cells pre-cultured in the presence of different concentrations of IL-6 were exposed to 10 lg/ml cisplatin for 24 h, and the relative caspase 3/7 activity was measured. (E) Saos-2 cells were treated with STAT3 siRNA (50 nM) or AG490 for 48 h before the exposure to DMEM (Control), MSCs CM or IL-6 (20 ng/ml) for another 48 h. Then, the caspase 3/7 activities in the cells were measured. The results are expressed as the mean ± SD.  p < 0.05.

84

B. Tu et al. / Cancer Letters 325 (2012) 80–88

3.3. MSCs protect Saos-2 cells from drug-induced apoptosis via IL-6/ STAT3 signaling Previous reports have shown that the bone marrow microenvironment is a sanctuary for tumor cells, protecting tumor cells from the cytotoxic effects of chemotherapeutic agents [27]. We therefore determined whether IL-6 could protect Saos-2 cells from drug-induced cytotoxicity and whether STAT3 also plays a role in this event. We selected cisplatin, a conventional drug used for osteosarcoma chemotherapy, as the apoptosis-inducing agent in our experiments [28]. We observed that cisplatin increased the caspase 3/7 activity of Saos-2 cells in a dose-dependent manner (Fig. 3A). A concentration of 10 lg/ml cisplatin was selected for subsequent experiments. The rate of apoptosis was decreased in the presence of MSCs CM. The inhibitory effect of MSCs on cisplatin-induced apoptosis was impaired by the IL-6 neutralizing antibody (Fig. 3B and C). Then, Saos-2 cells were exposed to different concentrations of IL-6 prior to treatment with 10 lg/ml cisplatin. We observed that IL-6 (>20 ng/ml) significantly decreased cisplatin-induced Saos-2 apoptosis (Fig. 3D). These data suggested that MSCs pro-

tected Saos-2 cells from the cytotoxic effects of cisplatin by producing IL-6. Because we had previously demonstrated that MSCs could enhance the activation of STAT3 in Saos-2 cells, we examined the effect of STAT3 on the apoptotic response of Saos-2 cells. We found that the inhibition of STAT3 increased the caspase 3/7 activity in Saos-2 cells that were exposed to DMEM, MSCs CM or 20 ng/ ml IL-6 (Fig. 3E). 3.4. MSCs promote the migration and invasion of Saos-2 cells through the IL-6/STAT3 signaling pathway We then examined the effects of MSCs on the migration and invasion abilities of Saos-2 cells. The migration of Saos-2 cells was significantly enhanced after treatment with MSCs CM for 12 h. Furthermore, this increase in migration was reduced when the neutralizing IL-6 antibody was added to MSCs CM (Fig. 4A). Then, STAT3 in Saos-2 was abolished by siRNA or AG490 and the tumor cells were exposed to MSCs CM for 12 h. The inhibition of STAT3 dramatically suppressed the migration of Saos-2 cells under all three treatment conditions (Fig. 4B and C). The invasion assay

Fig. 4. MSCs promote migration and invasion through the IL-6/STAT3 signaling pathway. Saos-2 cells were cultured in MSCs CM (or IL-6-abolished CM) for 48 h. Then cells were plated onto upper chamber of a transwell plate and allowed to migrate for 12 h or invade for 24 h. Cells that migrated (A) or invaded (D) to the undersurface were fixed, stained and counted. A total of 3–5 random microscopic fields were counted for each treatment. (B) Saos-2 cells were treated with siRNA (50 nM) or AG490 (50 lM) and cultured in the presence of DMEM (Control), MSCs CM or IL-6 (20 ng/ml) for 48 h. Then, the cells were added to the upper chamber and subjected to transwell migration (B) or invasion assay (E). Migrating (C) and invading (F) cell numbers are the average count of 3–5 random microscopic fields from experiment 3B and 3D.  p < 0.05.

B. Tu et al. / Cancer Letters 325 (2012) 80–88

showed similar results (Fig. 4D, E and F). Together, these data indicated that MSCs promoted the migration and invasion of Saos-2 cells through the IL-6/STAT3 signaling pathway. 3.5. STAT3 is required for the progression and metastasis of osteosarcoma To determine the contribution of STAT3 to the growth and metastasis of osteosarcoma in vivo, we inhibited the activation of STAT3 by injecting AG490 in a mouse tibia osteosarcoma model.

85

Luciferase activity was measured using the IVIS imaging system to reflect the tumor cell number. The signal increased more slowly in the AG490-treated group (OS + AG490) than the osteosarcoma (OS) group (Fig. 5A and B), and the tumor growth and volume were significantly decreased in the OS + AG490 group (Fig. 5C and D). Moreover, at day 28, we observed lung metastasis signals in the OS group, whereas the OS + AG490 group exhibited less luciferase signal in the lung (Fig. 5E). Consistent with this result, we observed tumors in the lung tissues of the OS group (7 of 9 mice) but not in the lung tissues of the OS + AG490 group (1 of 9 mice, Fig. 5F and

Fig. 5. STAT3 is required for the progression and metastasis of osteosarcoma. (A) The luminescence activities of the osteosarcoma group (OS) and AG490 groups (OS + AG490) were measured weekly using the Xenogen IVIS system. (B) Quantification of luminescence activities in the two groups (n = 9,  p < 0.05). (C) Macroscopic view of tumor in the OS and OS + AG490 groups at day 28. (D) Quantification of tumor volume of the two groups in a 28 days period (n = 9,  p < 0.05). (E) Metastatic bioluminescence signals were imaged in the OS and OS + AG490 groups at day 28. Red arrow: luminescence signal in the lung of the mice. (F) Detection of metastatic osteosarcoma in the excised lung tissue by HE staining. Red arrow: metastatic tumor. (G) Incidence of lung tumor metastasis was examined at day 28. (n = 9, p = 0.017). P value was determined using Fisher’s exact test. (H) Survival curve showed a median survival of OS mice at 35 days, which is significantly less than that of the OS + AG490 mice (53 days, n = 8, p < 0.01, log-rank test for pairwise combination). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

86

B. Tu et al. / Cancer Letters 325 (2012) 80–88

Fig. 6. Immunohistochemistry and tumor cell apoptosis induced by STAT3 inhibition in vivo. (A) The levels of p-STAT3, PCNA and IL-6 in tumor tissue at day 28 in the OS and OS + AG490 groups were detected by immunohistochemistry. Apoptotic cells were detected by TUNEL. Scale bars equal 100 lm. (B) Quantification of p-STAT3, PCNA, TUNEL and IL-6 positive cells in the tumor tissues from the two groups (n = 3,  p < 0.05).

G). Finally, the survival curve indicated that the inhibition of STAT3 by AG490 prolonged the survival of mice with osteosarcoma (Fig. 5H). 3.6. Immunohistochemistry and tumor cell apoptosis observation in vivo Because previous studies have reported that STAT3 promotes the tumor growth and survival [15], we evaluated the protein levels of IL-6, p-STAT3 and PCNA by immunohistochemistry in the two mouse groups at day 28. We observed decreased IL-6 and PCNA expression in the OS + AG490 group, in which the activation of STAT3 was strongly inhibited. In addition, we observed that the inhibition of STAT3 phosphorylation increased the rate of apoptosis in the osteosarcoma (Fig. 6A and B). 4. Discussion The aberrant activation of STAT3 in the absence of JAK2 mutations is a recurring theme in many human tumors [29]. However, the implications of STAT3 activation for osteosarcoma remain unclear. In this study, we identify important functions of IL-6 and STAT3 and their implications for multiple aspects of osteosarcoma development. We show that IL-6 produced by MSCs has a paracrine effect on Saos-2 cells and activates STAT3 in these tumor cells. The IL-6/STAT3 signaling pathway stimulates cell proliferation and migration/invasion, and protects tumor cells from drug-induced apoptosis. Using a xenograft mouse osteosarcoma model, we provide evidence that this activation of STAT3 is critical for the proliferation and survival of osteosarcoma cells in vivo. We also

demonstrated that STAT3 inhibition by AG490 significantly reduces osteosarcoma lung metastases in vivo. Therefore, the activation of STAT3 by IL-6 may play a central role in the interplay between MSCs and Saos-2 cells. It has been established that the bone marrow microenvironment contributes to tumor initiation and development [30]. Karnoub et al. found that MSCs in breast cancer promoted tumor metastasis [31]. In the bone marrow microenvironment, the IL-6 produced by the bone marrow is regarded as a critical tumor-promoting cytokine, in part because a strong and consistent association of IL-6 with the outcomes of tumor patients has been observed in many studies [32–34]. Importantly, the major tumorigenic IL-6 effector is STAT3. Based on these facts, we hypothesize that MSCs in the bone marrow persistently generate IL-6, inducing the phosphorylation of STAT3 and thus stimulating the proliferation of the neighboring osteosarcoma. In this study, we found that MSCs promote substantial tumor growth by releasing IL-6 into the microenvironment. Our data, which demonstrate an increase in cell proliferation in association with STAT3 activation, are consistent with a growth stimulatory effect of IL-6 on Saos-2 cells. These results suggest that the pro-proliferation effect of IL-6 on osteosarcoma cells is mediated, at least in part, by the STAT3 pathway. The protective effect of IL-6 against drug-induced apoptosis has been reported in some human tumors, and several IL-6 mediated signaling pathways have been implicated in this effect [34,35]. However, few studies have focused on the anti-apoptotic effect of IL-6 in osteosarcoma. In this paper, we provide evidence that IL-6 generated by MSCs protects Saos-2 cells from cisplatin-induced apoptosis. In addition, a recent report indicated that the constitutive activation of STAT3 contributes to the apoptotic resistance of breast cancer cells by inducing the expression of anti-apoptosis

B. Tu et al. / Cancer Letters 325 (2012) 80–88

genes [36–38]. STAT3 is necessary for the survival of the incipient tumor and its subsequent progression; the inhibition of STAT3 leads to apoptosis in many tumors [39,40]. Therefore, we hypothesize that STAT3 activation is involved in the protective mechanism of IL-6. Consistent with these reports, STAT3 inhibition causes the apoptosis of osteosarcoma cells in vitro and in vivo. In addition, STAT3 inhibition is accompanied by the decreased expression of several pro-proliferation and anti-apoptosis genes. It has been well recognized that STAT3 is an oncogenic transcription factor whose ablation leads to decreased tumor cell proliferation and growth [41]. Emerging evidence suggests a central role for STAT3 in providing a transcriptional milieu that is associated with proliferation, survival and angiogenesis. Onimoe et al. found that inhibition by some molecules reduced osteosarcoma growth in vivo [42]. Chen et al. suggested that the activated STAT3 pathway is important for cell growth and survival in human osteosarcoma [43]. Using a bioluminescent imaging system, we have shown that inhibiting STAT3 in tumor-bearing mice dramatically decreased both the growth rates and volumes of the tumor. Several lines of evidence indicate that the constitutive activation of STAT3 influences metastasis. The activation of STAT3 is associated with metastasis in many human tumors, including renal cell carcinoma, thymic epithelial tumor and melanoma [44]. This association may be attributed to the overexpression of several growth factors, MMP-2 and VEGF, which are induced by STAT3 activation and subsequently promote tumor invasion and angiogenesis [45]. In osteosarcoma, lung metastasis is the major cause of death [46]. Consistent with previous findings, the inhibition of STAT3 in our osteosarcoma mouse model resulted in a lower lung metastasis rate. Due to this reduced and delayed pulmonary metastasis, the survival time of tumor-bearing mice treated with AG490 was increased. It has been reported that serum levels of IL-6 correlate with the clinical features of tumors and patient prognosis [47,48]. In tumor-bearing mice treated with AG490, both the frequency of metastasis and IL-6 expression in tumor tissue are decreased. Thus, we propose that IL-6 may promote the metastasis of osteosarcoma through the activation of STAT3. Our in vitro experiments confirmed that MSCs strengthen the migration and invasion ability of Saos-2 cells by secreting IL-6, which may act by activating STAT3. In summary, our data reveal a signaling network between MSCs in bone marrow and Saos-2 cells and identify STAT3 as the critical effector of this interaction. We provide evidence that STAT3 activation is essential for osteosarcoma proliferation and survival. Through IL-6 secretion, MSCs activate STAT3 in neighboring osteosarcoma cells. Consequently, IL-6 may increase proliferation and metastasis and decrease apoptosis in osteosarcomas, at least partly through activating STAT3 signaling. Acknowledgments This work was supported by a Grant from the National Natural Science Foundation of China (81172549) and Grants from the Shanghai Science and Technology Development Fund (10410711100, 11XD1403300), the key disciplines program of the Shanghai Municipal Education Commission (J50206), the program for innovative research team of the Shanghai Municipal Education Commission (phase I) and a Grant from Ph.D. Innovation Fund of Shanghai Jiaotong University School of Medicine (BXJ201126). References [1] A. Longhi, C. Errani, M. De Paolis, M. Mercuri, G. Bacci, Primary bone osteosarcoma in the pediatric age: state of the art, Cancer Treat Rev. 32 (2006) 423–436. [2] M.L. Tan, P.F. Choong, C.R. Dass, Osteosarcoma: conventional treatment vs. gene therapy, Cancer Biol. Ther. 8 (2009) 106–117.

87

[3] R. Gorlick, C. Khanna, Osteosarcoma, J. Bone Miner. Res. 25 (2010) 683–691. [4] P.A. Meyers, R. Gorlick, Osteosarcoma, Pediatr. Clin. North Am. 44 (1997) 973– 989. [5] N.Z. Kuhn, R.S. Tuan, Regulation of stemness and stem cell niche of mesenchymal stem cells: implications in tumorigenesis and metastasis, J. Cell Physiol. 222 (2010) 268–277. [6] Z.Y. Bian, G. Li, Y.K. Gan, Y.Q. Hao, W.T. Xu, T.T. Tang, Increased number of mesenchymal stem cell-like cells in peripheral blood of patients with bone sarcomas, Arch. Med. Res. 40 (2009) 163–168. [7] W.T. Xu, Z.Y. Bian, Q.M. Fan, G. Li, T.T. Tang, Human mesenchymal stem cells (hMSCs) target osteosarcoma and promote its growth and pulmonary metastasis, Cancer Lett. 281 (2009) 32–41. [8] V.A. Siclari, L. Qin, Targeting the osteosarcoma cancer stem cell, J. Orthop. Surg. Res. 5 (2010) 78. [9] A. Uccelli, L. Moretta, V. Pistoia, Mesenchymal stem cells in health and disease, Nat. Rev. Immunol. 8 (2008) 726–736. [10] S.A. Bergfeld, Y.A. DeClerck, Bone marrow-derived mesenchymal stem cells and the tumor microenvironment, Cancer Metastasis Rev. 29 (2010) 249–261. [11] A. Mantovani, P. Allavena, A. Sica, F. Balkwill, Cancer-related inflammation, Nature 454 (2008) 436–444. [12] W.E. Naugler, M. Karin, The wolf in sheep’s clothing: the role of interleukin-6 in immunity, inflammation and cancer, Trends Mol. Med. 14 (2008) 109–119. [13] M. Jourdan, T. Reme, H. Goldschmidt, G. Fiol, V. Pantesco, J. De Vos, J.F. Rossi, D. Hose, B. Klein, Gene expression of anti- and pro-apoptotic proteins in malignant and normal plasma cells, Br. J. Haematol. 145 (2009) 45–58. [14] K. Heikkila, S. Ebrahim, D.A. Lawlor, Systematic review of the association between circulating interleukin-6 (IL-6) and cancer, Eur. J. Cancer 44 (2008) 937–945. [15] S. Grivennikov, E. Karin, J. Terzic, D. Mucida, G.Y. Yu, S. Vallabhapurapu, J. Scheller, S. Rose-John, H. Cheroutre, L. Eckmann, M. Karin, IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitisassociated cancer, Cancer Cell 15 (2009) 103–113. [16] P.C. Heinrich, I. Behrmann, S. Haan, H.M. Hermanns, G. Muller-Newen, F. Schaper, Principles of interleukin (IL)-6-type cytokine signalling and its regulation, Biochem. J. 374 (2003) 1–20. [17] P.C. Heinrich, I. Behrmann, G. Muller-Newen, F. Schaper, L. Graeve, Interleukin6-type cytokine signalling through the gp130/Jak/STAT pathway, Biochem. J. 334 (Pt 2) (1998) 297–314. [18] S.I. Grivennikov, M. Karin, Dangerous liaisons: STAT3 and NF-kappaB collaboration and crosstalk in cancer, Cytokine Growth Factor Rev. 21 (2010) 11–19. [19] B. Barre, A. Vigneron, N. Perkins, I.B. Roninson, E. Gamelin, O. Coqueret, The STAT3 oncogene as a predictive marker of drug resistance, Trends Mol. Med. 13 (2007) 4–11. [20] M. Benekli, Z. Xia, K.A. Donohue, L.A. Ford, L.A. Pixley, M.R. Baer, H. Baumann, M. Wetzler, Constitutive activity of signal transducer and activator of transcription 3 protein in acute myeloid leukemia blasts is associated with short disease-free survival, Blood 99 (2002) 252–257. [21] J. Turkson, R. Jove, STAT proteins: novel molecular targets for cancer drug discovery, Oncogene 19 (2000) 6613–6626. [22] J. Deng, F. Grande, N. Neamati, Small molecule inhibitors of Stat3 signaling pathway, Curr. Cancer Drug Targets. 7 (2007) 91–107. [23] K. Ryu, E. Choy, C. Yang, M. Susa, F.J. Hornicek, H. Mankin, Z. Duan, Activation of signal transducer and activator of transcription 3 (Stat3) pathway in osteosarcoma cells and overexpression of phosphorylated-Stat3 correlates with poor prognosis, J. Orthop. Res. 28 (2010) 971–978. [24] Z.Y. Bian, Q.M. Fan, G. Li, W.T. Xu, T.T. Tang, Human mesenchymal stem cells promote growth of osteosarcoma: involvement of interleukin-6 in the interaction between human mesenchymal stem cells and Saos-2, Cancer Sci. 101 (2010) 2554–2560. [25] T. Tang, H. Lu, K. Dai, Osteogenesis of freeze-dried cancellous bone allograft loaded with autologous marrow-derived mesenchymal cells, Mater. Sci. Eng. C 20 (2002) 57–61. [26] H.H. Luu, Q. Kang, J.K. Park, W. Si, Q. Luo, W. Jiang, H. Yin, A.G. Montag, M.A. Simon, T.D. Peabody, R.C. Haydon, C.W. Rinker-Schaeffer, T.C. He, An orthotopic model of human osteosarcoma growth and spontaneous pulmonary metastasis, Clin. Exp. Metastasis 22 (2005) 319–329. [27] L.A. Hazlehurst, T.H. Landowski, W.S. Dalton, Role of the tumor microenvironment in mediating de novo resistance to drugs and physiological mediators of cell death, Oncogene 22 (2003) 7396–7402. [28] P.A. Meyers, C.L. Schwartz, M. Krailo, E.S. Kleinerman, D. Betcher, M.L. Bernstein, E. Conrad, W. Ferguson, M. Gebhardt, A.M. Goorin, M.B. Harris, J. Healey, A. Huvos, M. Link, J. Montebello, H. Nadel, M. Nieder, J. Sato, G. Siegal, M. Weiner, R. Wells, L. Wold, R. Womer, H. Grier, Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate, J. Clin. Oncol. 23 (2005) 2004–2011. [29] H. Yu, M. Kortylewski, D. Pardoll, Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment, Nat. Rev. Immunol. 7 (2007) 41–51. [30] M.B. Meads, L.A. Hazlehurst, W.S. Dalton, The bone marrow microenvironment as a tumor sanctuary and contributor to drug resistance, Clin. Cancer Res. 14 (2008) 2519–2526. [31] A.E. Karnoub, A.B. Dash, A.P. Vo, A. Sullivan, M.W. Brooks, G.W. Bell, A.L. Richardson, K. Polyak, R. Tubo, R.A. Weinberg, Mesenchymal stem cells within tumour stroma promote breast cancer metastasis, Nature 449 (2007) 557–563.

88

B. Tu et al. / Cancer Letters 325 (2012) 80–88

[32] D.L. Musselman, A.H. Miller, M.R. Porter, A. Manatunga, F. Gao, S. Penna, B.D. Pearce, J. Landry, S. Glover, J.S. McDaniel, C.B. Nemeroff, Higher than normal plasma interleukin-6 concentrations in cancer patients with depression: preliminary findings, Am. J. Psychiatr. 158 (2001) 1252–1257. [33] H. Knupfer, R. Preiss, Significance of interleukin-6 (IL-6) in breast cancer (review), Breast Cancer Res. Treat. 102 (2007) 129–135. [34] H. Xin, C. Zhang, A. Herrmann, Y. Du, R. Figlin, H. Yu, Sunitinib inhibition of Stat3 induces renal cell carcinoma tumor cell apoptosis and reduces immunosuppressive cells, Cancer Res. 69 (2009) 2506–2513. [35] D. Chauhan, S. Kharbanda, A. Ogata, M. Urashima, G. Teoh, M. Robertson, D.W. Kufe, K.C. Anderson, Interleukin-6 inhibits Fas-induced apoptosis and stressactivated protein kinase activation in multiple myeloma cells, Blood 89 (1997) 227–234. [36] T. Gritsko, A. Williams, J. Turkson, S. Kaneko, T. Bowman, M. Huang, S. Nam, I. Eweis, N. Diaz, D. Sullivan, S. Yoder, S. Enkemann, S. Eschrich, J.H. Lee, C.A. Beam, J. Cheng, S. Minton, C.A. Muro-Cacho, R. Jove, Persistent activation of stat3 signaling induces survivin gene expression and confers resistance to apoptosis in human breast cancer cells, Clin. Cancer Res. 12 (2006) 11–19. [37] J. Hardin, S. MacLeod, I. Grigorieva, R. Chang, B. Barlogie, H. Xiao, J. Epstein, Interleukin-6 prevents dexamethasone-induced myeloma cell death, Blood 84 (1994) 3063–3070. [38] T.D. Chung, J.J. Yu, T.A. Kong, M.T. Spiotto, J.M. Lin, Interleukin-6 activates phosphatidylinositol-3 kinase, which inhibits apoptosis in human prostate cancer cell lines, Prostate 42 (2000) 1–7. [39] L. Lin, A. Liu, Z. Peng, H.J. Lin, P.K. Li, C. Li, J. Lin, STAT3 is necessary for proliferation and survival in colon cancer-initiating cells, Cancer Res. (2011). [40] A. Iwamaru, S. Szymanski, E. Iwado, H. Aoki, T. Yokoyama, I. Fokt, K. Hess, C. Conrad, T. Madden, R. Sawaya, S. Kondo, W. Priebe, Y. Kondo, A novel inhibitor of the STAT3 pathway induces apoptosis in malignant glioma cells both in vitro and in vivo, Oncogene 26 (2007) 2435–2444.

[41] G. He, G.Y. Yu, V. Temkin, H. Ogata, C. Kuntzen, T. Sakurai, W. Sieghart, M. Peck-Radosavljevic, H.L. Leffert, M. Karin, Hepatocyte IKKbeta/NF-kappaB inhibits tumor promotion and progression by preventing oxidative stressdriven STAT3 activation, Cancer Cell 17 (2010) 286–297. [42] G.I. Onimoe, A. Liu, L. Lin, C.C. Wei, E.B. Schwartz, D. Bhasin, C. Li, J.R. Fuchs, P.K. Li, P. Houghton, A. Termuhlen, T. Gross, J. Lin, Small molecules, LLL12 and FLLL32, inhibit STAT3 and exhibit potent growth suppressive activity in osteosarcoma cells and tumor growth in mice, Invest. New Drugs 30 (2012) 916–926. [43] C.L. Chen, A. Loy, L. Cen, C. Chan, F.C. Hsieh, G. Cheng, B. Wu, S.J. Qualman, K. Kunisada, K. Yamauchi-Takihara, J. Lin, Signal transducer and activator of transcription 3 is involved in cell growth and survival of human rhabdomyosarcoma and osteosarcoma cells, BMC Cancer 7 (2007) 111. [44] S. Huang, Regulation of metastases by signal transducer and activator of transcription 3 signaling pathway: clinical implications, Clin. Cancer Res. 13 (2007) 1362–1366. [45] T.X. Xie, F.J. Huang, K.D. Aldape, S.H. Kang, M. Liu, J.E. Gershenwald, K. Xie, R. Sawaya, S. Huang, Activation of stat3 in human melanoma promotes brain metastasis, Cancer Res. 66 (2006) 3188–3196. [46] P. Zhang, Y. Yang, P.A. Zweidler-McKay, D.P. Hughes, Critical role of notch signaling in osteosarcoma invasion and metastasis, Clin. Cancer Res. 14 (2008) 2962–2969. [47] V. Michalaki, K. Syrigos, P. Charles, J. Waxman, Serum levels of IL-6 and TNFalpha correlate with clinicopathological features and patient survival in patients with prostate cancer, Br. J. Cancer 90 (2004) 2312–2316. [48] T. Kinoshita, H. Ito, C. Miki, Serum interleukin-6 level reflects the tumor proliferative activity in patients with colorectal carcinoma, Cancer 85 (1999) 2526–2531.