Stem cell characteristics of human trabecular bone-derived cells

Bone Vol. 30, No. 5 May 2002:699 –704

Stem Cell Characteristics of Human Trabecular Bone-derived Cells V. SOTTILE, C. HALLEUX, F. BASSILANA, H. KELLER, and K. SEUWEN Research, Novartis Pharma AG, Basel, Switzerland

these “bone marrow stromal cells” can give rise to a variety of mesenchymal tissues when transplanted into animals.4,15 This led to the designation of bone marrow stromal cells as mesenchymal stem cells, in analogy with hematopoietic stem cells.2,17 During our own studies with human bone marrow stromal cells, we noted that these cells looked identical to human trabecular bone-derived cells (HTBs), and showed an identical timecourse and pattern of osteogenic differentiation in vitro (see Halleux et al.8 and unpublished results). We therefore put forward the hypothesis that bone marrow stromal cells and HTBs are actually equivalent; that is, HTBs should have stem cell characteristics. Interestingly, Nuttall et al.14 showed adipogenic differentiation in HTB cultures, which favors our hypothesis. We recently investigated the stem cell characteristics of human bone marrow stromal cells. It was shown that these cells can be cloned by limiting dilution and that individual clones expanded by 20 cumulative population doublings retain the capacity to undergo differentiation into osteoblasts, adipocytes, and chondrocytes.8 However, it also became apparent during these experiments that our stromal cell cultures did not represent homogeneous mesenchymal cell (MSC) populations: Many clones could not be expanded to the desired predifferentiation stage, and ⬎50% of the expanded clones failed to undergo differentiation into all three mesenchymal lineages. In the present study, we used HTBs for a similar analysis. We first show that cultures isolated from different donors readily differentiate into osteoblasts, adipocytes, and chondrocytes. We then show that a subset of clones obtained by limiting dilution maintains multilineage potential. We conclude that HTB cultures contain pluripotent stem cells and that the fraction of pluripotent cells as detected by our procedures is equivalent or superior to that observed previously for human bone marrow stromal cells. Our results suggest that HTB and MSC cultures are indeed equivalent.

Human trabecular bone-derived cells (HTBs) have been used for many years as osteoblast progenitors. In this study we tested whether HTBs have stem cell characteristics; that is, whether they are pluripotent and able to self-renew. We show that HTBs readily differentiate into osteoblasts, chondrocytes, and adipocytes if subjected to the appropriate differentiating conditions. Importantly, differentiation into these three lineages is maintained in single cell clones derived by limiting dilution, following expansion over more than 20 cumulative population doublings. We conclude that cultures of HTBs are equivalent to cultures of “mesenchymal stem cells” (MSCs) isolated from bone marrow. (Bone 30: 699 –704; 2002) © 2002 by Elsevier Science Inc. All rights reserved. Key Words: Cell differentiation; Osteoblast; Adipocyte; Chondrocyte; Progenitor cell; Limiting dilution. Introduction Secondary cultures of human trabecular bone have been used for many years to study aspects of bone cell physiology in vitro. Early work, including studies of cell differentiation and hormone action, has been carried out by Beresford et al.,1 MacDonald et al.,11 Wergedal and Baylink,21 and Robey and Termine.18 Depending on the laboratory performing the study, such cells have been named “human bone cells,” “bone-derived cells,” or “osteoblast-like cells.” They have a fibroblast-like appearance during growth at low cell density, but they can differentiate into apparently mature osteoblasts upon prolonged high-density culture. This process is enhanced by ascorbic acid and glucocorticoids.18,22 Freshly prepared secondary cultures of human trabecular bone are therefore considered to contain mainly as yet undifferentiated preosteoblasts. In parallel to this and other work on bone-derived cells, a large body of literature has developed on mesenchymal cells of bone marrow origin. Such cells were first observed as a distinct component of bone marrow cultures that had the capacity to adhere to tissue-culture plastic. Friedenstein and collaborators3,5 showed that such cells were able to form mineralized nodules in vitro and speculated that they represent preosteoblasts, which are most likely at the origin of ectopic bone formation following bone marrow transplantation.6 It could further be shown that

Materials and Methods Materials Unless stated otherwise, fine chemicals were obtained from Fluka (Buchs, Switzerland). Transforming growth factor-␤3 (TGF-␤3) and BRL 49653 were produced at Novartis Pharma AG (Basel, Switzerland). Cell Culture Primary and secondary cultures of human trabecular bone. Samples of healthy trabecular bone were obtained at surgery from the femurs of patients aged 55– 80 years (Felix Platter

Address for correspondence and reprints: Dr. Klaus Seuwen, Novartis Pharma AG, CH-4002, Basel, Switzerland. E-mail: klaus.seuwen@ pharma.novartis.com © 2002 by Elsevier Science Inc. All rights reserved.

699

8756-3282/02/$22.00 PII S8756-3282(02)00674-9

700

V. Sottile et al. Stem cells from bone

Spital, Basel, Switzerland), with approval from the local ethics committee. As described by Beresford et al.,1 bone pieces were cut into fragments 3– 8 mm, cleaned of adherent connective tissue, rinsed well, and placed directly in culture in ␣-MEM/ Ham’s F12 medium containing antibiotics (100 U/mL penicillin and 100 ␮g/mL streptomycin), and 10% fetal calf serum (FCS; Life Technologies, Basel, Switzerland) (“standard medium”). The serum lot used was not selected specifically for this investigation. It had been tested, however, to support efficient proliferation of various cells used routinely in the laboratory. Standard medium was further supplemented with 10 ng/mL of basic fibroblast growth factor (FGF-2; Life Technologies) for primary and secondary culture and for expansion of cell clones. FGF-2 stimulates precursor cell proliferation significantly while maintaining multilineage potential.8,12 Confluent monolayers of fibroblast-like cells were obtained within 10 –20 days, passaged once, and frozen in liquid nitrogen for later analysis. Cell cultures from individual donors were maintained separately, and cells were not pooled. Differentiation experiments were performed on cultures established from frozen stocks at passages 2– 4 or on expanded cell clones. Cells were grown to confluence and then subjected to specific differentiating conditions as described in what follows. Cultures were maintained for up to 3 weeks (see Results). Medium was changed twice weekly. Single Cell Cloning For cloning we used a protocol previously described for human bone marrow mesenchymal cells.8 Subconfluent exponentially growing cultures of HTBs were trypsinized, and diluted single cell suspensions were prepared. Suspensions were seeded at a nominal seeding density of 0.3 cells/well into 96 well plates. After 2 weeks, clones appearing were expanded by transfer to 12 well plates and further to T-25 culture flasks. Differentiation experiments were started with these expanded cultures. Osteogenic Differentiation To induce osteogenic differentiation, the standard medium (not containing FGF-2) was supplemented with osteogenic supplement (OS) containing dexamethasone (DEX; 0.1 ␮mol/L), ascorbic acid 2-phosphate (50 ␮mol/L), and ␤-glycerophosphate (10 mmol/L). The calcium concentration was adjusted to a final concentration of 1.8 mmol/L to compensate for the low calcium content of the F12 medium. For detection of mineralized nodules, cells were fixed with 4% paraformaldehyde and stained with a 1% Alizarin-Red S solution in water for 10 min. Quantitative measurements of mineral deposition were done by colorimetry, using the MPR2 calcium assay kit (Roche Molecular Biochemicals, Basel, Switzerland). Adipogenic Differentiation For adipogenic differentiation (AD), confluent cell cultures were treated with standard medium supplemented with DEX (1 ␮mol/ L), isobutylmethylxanthine (IBMX; 500 ␮mol/L), insulin (Ins; 10 ␮g/mL), and BRL 49653 (1 ␮mol/L). The presence of mature adipocytes was assessed under the microscope following Oil Red-O staining of cultures. Paraformaldehyde-fixed cells were covered with 3 mg/mL Oil Red-O dissolved in 60% isopropanol (v/v) for 10 min, before any excess dye was washed out with water. Quantitative determinations of adipocyte numbers were performed by flow cytometry using the lipophilic dye Nile Red. We

Bone Vol. 30, No. 5 May 2002:699 –704 Table 1. Primer pairs used for RT-PCR experiments (5⬘ 3 3⬘) Primers Abbreviations Clath PPAR␥ haP2 C/EBP␣ hOPN1 hPTH-R1 hCOL I hOC hOSN hBSP hCOL X hCOL II hAGCN hPRLN hSDC1

Forward

Reverse

gacagtgccatcatgaatcc aaactctgggagattctcct gctttgccaccaggaaagtg gtcggtggacaagaacagc catctcagaagcagaatctcc cacagcctcatcttcatgg atccgcagtggcctcctaat cgcagccaccgagacaccat gcagcaatgacaacaagacc aatggcctgtgctttctcaa cttcagggagtgccatcatc acggcgagaagggagaagttg tcaggaactgaactcagtgg catagagaccgtcacagcaag ccttcacactccccacac

tttgtgcttctggaggaaagaa tcttgtgaatggaatgtctt atgacgcattccaccaccag atggccttgaccaaggagc ccataaaccacactatcacctc gcatctcatagtgcatctgg tcccctcaccctcccagtat gggcaagggcaaggggaaga cttctcattctcatggatcttc tctgcttcgctttcttcgtt aacatagcaggacttctttg gggggtccagggttgccattg gccactgagttccacaga atgaacaccacactgacaacc ggcatagaattcctcctgtttg

RT-PCR, reverse transcription-polymerase chain reaction. See text for abbreviations.

adapted our protocol19 from Gimble et al.7 For each cell population 20,000 events were collected. The results are expressed as percentage of cells showing strong Nile Red fluorescence. For measurements of GPDH activity, we used an enzymatic assay previously described in detail.20 Chondrogenic Differentiation The protocol described by Johnstone et al.10 was used to achieve chondrogenic differentiation. Briefly, 2.5 ⫻ 105 cells were seeded into conical 15 mL polypropylene tubes and sedimented at 150g for 5 min. Chondrogenic medium was then added, which consisted of high-glucose serum-free Dulbecco’s modified Eagle medium (DMEM) containing glutamine (2 mmol/L), DEX (0.1 ␮mol/L), ascorbic acid phosphate (50 ␮g/mL), Na-pyruvate (1 mmol/L), proline (40 ␮g/mL), TGF-␤3 (10 ng/mL), and “ITS⫹” (Collaborative Biomedical Products, Bedford, MA; ITS⫹ is bovine insulin, transferrin, and selenous acid, each at a final concentration of 6.25 ␮g/mL, linoleic acid [5.3 ␮g/mL], and bovine serum albumin [1.25 mg/mL]). Chondrogenic differentiation was evaluated after pellets were fixed in 4% paraformaldehyde, dehydrated in serial ethanol dilutions, and embedded in Technovit 7100 blocks (Leica, Glattbrugg, Switzerland). Blocks were cut and sections stained with Safranin-O (Grogg Chemie AG, Deisswil, Switzerland). Reverse Transcription-Polymerase Chain Reaction (RT-PCR) RNA was extracted from HTB cultures using the acid phenol method. After DNAse treatment of the samples, reverse transcription was carried out using Superscript II reverse transcriptase (Life Technologies). Preparations of cDNA were qualitycontrolled with respect to the absence of genomic DNA using appropriate PCR primers. PCR reactions (20 ␮L) were set up using Platinum Taq-DNA Polymerase (Life Technologies) and run on a thermocycler (Biometra, Goettingen, Germany). PCR conditions were: 30 sec denaturation at 94°C; 45 sec annealing at 60°C; and 1 min extension at 72°C. Cycle numbers are given in the figures. Clathrin (Clath; Genbank accession no. D21260) was used as control to ensure equal amounts of cDNA in samples. The primer pairs used are listed in Table 1. For osteogenic differentiation, primers were set for osteopontin (hOPN1; Genbank accession no. J04765), parathyroid hormone receptor

Bone Vol. 30, No. 5 May 2002:699 –704

V. Sottile et al. Stem cells from bone

701

Figure 2. Osteogenic potential of HTBs. (A) Quantification of mineral deposition over 24 days. (B) RT-PCR detection of molecular markers of osteogenesis. Numbers at the right indicate PCR cycles.

Figure 1. Multilineage potential of HTBs. (A) Alizarin-Red stain of cultures maintained for 16 days under control (ctrl) or osteogenic (OS) conditions. (B) Oil Red-O stain of cultures maintained for 16 days under control (ctrl) or adipogenic (AD) conditions. (C) Safranin-O stain of a chondrogenic pellet after 21 days of differentiation (bars ⫽ 50 ␮m).

(hPTH-R1; X68596), collagen type I (hCOL I; Z74615), osteocalcin (hOC; X51699), osteonectin (hOSN; J03040), and bone sialoprotein (hbSP; J05213). For adipogenic differentiation, primers were set for peroxisome proliferator-activated receptor-␥ (PPAR␥; D83233), adipocyte fatty acid-binding protein (haP2; J02874), and CAAT/enhancer binding protein-␣ (C/EBP␣; Y11525). For chondrogenic differentiation, primers were set for collagen type X (hCOL X; X98568), collagen type II (hCOL II; X16711), aggrecan (hAGCN; M55172), perlecan (hPRLN; M85289), and syndecan-1 (hSDC1; Z48199). Results To establish the pluripotency of bone marrow-derived MSCs, differentiation into osteoblasts, chondrocytes, and adipocytes was performed.8,16 To verify whether HTBs can undergo differ-

entiation into these lineages, we subjected early secondary cultures of six different donors to the appropriate culture conditions. In all cases, positive results were obtained as described in what follows. Figures 1– 4 show representative data. As observed by many investigators, HTBs maintained under osteogenic conditions (dexamethasone, ascorbic acid, and ␤-glycerophosphate) showed significantly increased alkaline phosphatase (ALP) activity and cyclic AMP formation in response to parathyroid hormone (PTH) as early as 48 h after start of differentiating treatment (data not shown). A strong mineralization of cultures (⬎1 ␮g calcium deposited per 96 wells) could be measured after day 10 (Figure 2A), and mineralizing nodules could be visualized by Alizarin-Red S staining (Figure 1A). Osteogenic differentiation was accompanied by an increased expression of marker genes such as collagen type 1, PTH receptor, osteonectin, osteopontin, bone sialoprotein, and osteocalcin (Figure 2B). To induce adipogenic differentiation, we used a combination of dexamethasone, IBMX, and the PPAR␥ agonist BRL 49653. Adipocytes became visible after 8 days of treatment, and large numbers of fully differentiated cells were usually obtained within 12 days (Figure 1B). Activity of the marker enzyme GPDH increased continuously during the treatment period (Figure 3A). Between 3% and 30% of the cells in culture were found to accumulate lipids to an extent clearly detectable by Nile Red flow cytometry (Figure 3B). In a previous study we obtained similar percentages for bone marrow-derived mesenchymal cells maintained under comparable conditions.8 Adipogenic differentiation was accompanied by the increased expression of the marker genes C/EBP␣, PPAR␥, and aP2 (Figure 3C).

702

V. Sottile et al. Stem cells from bone

Bone Vol. 30, No. 5 May 2002:699 –704

Figure 4. RT-PCR detection of molecular markers of chondrogenesis. Numbers at the right indicate PCR cycles.

Although the observations just described were both qualitatively and quantitatively in the same range as for bone marrowderived mesenchymal cells,8,16 they were not sufficient to establish the existence of individual stem cells in HTB cultures. We therefore set out to demonstrate that single cells isolated from such cultures had the potential to undergo multilineage differentiation. We previously showed that bone marrow-derived mesenchymal cells could be cloned using limiting dilution and that a subset of the expanded cell clones had indeed maintained the capacity to undergo osteogenic, adipogenic, and chondrogenic differentiation.8 We used the same procedure here for HTBs obtained from two different donors. Cells were seeded at clonal density into 96 well plates and cultured in the presence of FGF until clones appeared in isolated wells. These clones where then expanded to ⬎1 million cells before osteogenic, adipogenic, and chondrogenic differentiation was initiated. Of the 23 clones isolated and expanded, 11 were able to show differentiation into all three lineages, according to our scoring criteria (Table 2). These data show that secondary cultures of human trabecular bone contain individual mesenchymal stem cells. The relative proportion of these cells (approximately 50% of all cells in early secondary culture) is comparable to that found before for cultures of bone marrow-derived mesenchymal cells.8 Discussion

Figure 3. Adipogenic potential of HTBs. (A) Time-course of induction of GPDH activity. (B) Results from Nile Red cytofluorimetry. Upper panel shows plots of side scatter (SSC) vs. forward scatter (FSC); lower panel shows plots of FSC vs. Nile Red fluorescence. Events appearing in window R2 are counted as adipocytes. (C) RT-PCR detection of molecular markers of adipogenesis. Numbers at the right indicate PCR cycles.

Chondrogenic differentiation was induced in pellet cultures as described by Johnstone et al.10 Condensation was observed as early as 24 h after seeding, and pellets then slowly increased in size during the following weeks. Apparently mature chondrogenic pellets were harvested after 3 weeks. Sections showed strong positive staining with Safranin-O, which is specific for glycosaminoglycans (Figure 1C). Chondrogenic differentiation was accompanied by increased expression of the marker genes collagen types 2 and 10, aggrecan, perlecan, syndecan-1 (Figure 4).

We have shown that human trabecular bone-derived cell populations have multilineage potential, and that individual pluripotent “stem cells” can be isolated from HTB cultures using limiting dilution. Our data are in line with earlier observations that HTBs can give rise not only to osteoblasts, but also to adipocytes, if subjected to appropriate treatment protocols.14 When we compared HTBs to cultures of bone marrowderived MSCs, which we have studied previously,8 we could not detect significant differences. Cell morphology was very similar, the proliferation rate as well as time courses of differentiation to adipocytes, osteoblasts, and chondrocytes were in the same range, and equivalent patterns of molecular markers were found to be expressed. Most importantly, early passage cultures from both origins contained very similar numbers of “stem cells,” as defined by our pragmatic criteria (single colony-forming cells that can be isolated by limiting dilution, expanded over ⬎20 cumulative population doublings, and able to undergo osteogenic, adipogenic, and chondrogenic differentiation). In this context, it is noteworthy that the bone samples used in the present study were from patients aged ⱖ50 years, whereas the bone marrow-derived cells we used earlier8 were from young adult

Bone Vol. 30, No. 5 May 2002:699 –704

V. Sottile et al. Stem cells from bone

703

Table 2. Multilineage differentiation of human trabecular bone-derived (HTB) clones that could be expanded to the ⬎1 million cell stage Differentiation

Clone Hu35 Hu35 Hu35 Hu35 Hu35 Hu35 Hu35 Hu35 Hu35 Hu35 Hu36 Hu36 Hu36 Hu36 Hu36 Hu36 Hu36 Hu36 Hu36 Hu36 Hu36 Hu36 Hu36

a

aH2 aB10 aH4a bA1a cE12 cH7 dA3 dF12a dF4a dH3a aA4a aC11a aE2 aG9 bA11 bE4a cC6 cF10 cH10 dB12a dC4 dF1 dG7a

Osteogenic

Chondrogenic

Adipogenic

Mineral deposition

Microscopic observation

Days of treatment

R2 (%)

n

Range

⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹

⫹⫹ No pellet ⫹⫹⫹ ⫹⫹⫹ ⫺ ⫺ No pellet ⫹⫹ ⫹ ⫹⫹⫹ ⫹⫹ ⫹⫹⫹ No pellet ⫺ ⫺ ⫹⫹ ⫺ ⫺ No pellet ⫹ ⫺ ⫺ ⫹⫹

20 15 17 17 20 20 15 17 21 17 17 17 18 17 18 17 21 21 20 17 20 21 17

13.93 0.51 1.01 2.40 10.79 7.54 3.93 5.98 14.21 3.35 2.23 4.55 2.39 2.02 13.38 2.51 3.14 11.43 0.06 6.49 8.28 7.50 7.41

2 2 2 2 2 2 1 2 2 2 2 2 1 2 1 2 2 2 2 2 2 2 2

0.09 0.04 0.11 0.08 0.42 0.61 n.a. 0.01 0.24 0.09 0.17 0.01 n.a. 0.10 n.a. 0.19 0.08 0.01 0.00 0.00 0.29 0.36 0.29

Cytofluorimetry

Osteogenic differentiation was assessed measuring calcium deposition in wells (⫹⫹, ⬎1 ␮g per 96 well), chondrogenic differentiation was assessed by microscopic observation (⫺, pellet ⬎1.5 mm formed, but no positive stain for Safranin-O; ⫹ to ⫹⫹⫹, positive to very strong stain), adipogenic differentiation was assessed by quantitative Nile Red cytofluorimetry (⬎1% in gate R2 scored as positive). a Clones showing differentiation into all three lineages.

donors (⬍30 years old). It is possible that the number of “stem cells” would have been higher if we had had access to trabecular bone from younger donors. Our data lead us to suggest that mesenchymal cell cultures established either from trabecular bone or from bone marrow may actually be considered equivalent. We emphasize, however, that the method we use to isolate HTBs12 selects for cells that have the potential to migrate out of the bone explant, and to proliferate rapidly. This is clearly very different from the method proposed by Robey and Termine,18 wherein bone pieces are first digested with collagenase to release cells from deeper layers of the bone matrix. The latter cultures are certainly enriched in mature osteoblasts, which will divide only slowly or not at all. It does not seem too surprising that mesenchymal cells migrating out from the bone surface have similar characteristics to bone marrow-derived MSCs. Trabecular bone surface and marrow are in close contact, and it must be expected that mesenchymal precursor cells can be isolated from both sources. In fact, we would expect a higher density of such cells near the bone surface than in marrow. At first sight, it seems possible that the pluripotent cells in our HTB cultures actually originate due to contamination from bone marrow. Such contamination is indeed obvious, as even good cleaning and rinsing of trabecular bone samples does not totally eliminate all hematopoietic cells, as we observe regularly when we inspect primary cultures 2 or 3 days after establishment. However, only very few marrow cells can be observed, and the efficacy and speed with which mesenchymal cells develop in primary culture is highly incompatible with the estimated frequency of MSCs in human marrow preparations (one in 104–105 mononuclear cells9,13). On the other hand, the

small percentage of MSCs in bone marrow aspirates could also be explained by a contamination from the bone compartment. In any case, we believe that trabecular bone explants are a good source of adult mesenchymal stem cells for in vitro investigations. As bone samples are readily available following orthopedic interventions, they may constitute a convenient starting material for such cell preparations. As recently described, another readily available source of adult MSCs may be fat tissue obtained during liposuction procedures.23 Acknowledgments: The authors thank the Orthopedic Surgery Department, Felix Platter Spital, Basel, Switzerland, for providing the trabecular bone samples for primary culture. We are also grateful to our colleagues, B. Wilmering-Wetter and G. Guiglia, for help with the cell culture; A. Montefusco for pellet stains; and A. Wanner for analyzing the DNA sequences.

References 1. Beresford, J. N., Gallagher, J. A., Poser, J. W., and Russell, R. G. Production of osteocalcin by human bone cells in vitro. Effects of 1,25(OH)2D3, 24,25(OH)2D3, parathyroid hormone, and glucocorticoids. Metab Bone Dis Rel Res 5:229 –234; 1984. 2. Caplan, A. I. Mesenchymal stem cells. J Orthop Res 9:641– 650; 1991. 3. Friedenstein, A. J. Precursor cells of mechanocytes. Int Rev Cytol 47:327–359; 1976. 4. Friedenstein, A. J. Stromal mechanisms of bone marrow: Cloning in vitro and retransplantation in vivo. In: Thienfelder, S., Ed. Immunobiology of Bone Marrow Transplantation. Berlin: Springer; 1980; 19 –29. 5. Friedenstein, A. J., Chailakhjan, R. K., and Lalykina, K. S. The development

704

6. 7.

8.

9.

10.

11.

12.

13.

14.

V. Sottile et al. Stem cells from bone of fibroblast colonies in monolayer cultures of guinea-pig bone marrow and spleen cells. Cell Tissue Kinet 3:393– 403; 1970. Friedenstein, A. J., Petrakova, K. V., Kurolesova, A. I., and Frolova, G. P. Heterotopic transplants of bone marrow. Transplantation 6:230 –247; 1968. Gimble, J. M., Robinson, C. E., Wu, X., Kelly, K. A., Rodriguez, B. R., Kliewer, S. A., Lehmann, J. M., and Morris, D. C. Peroxisome proliferatoractivated receptor-gamma activation by thiazolidinediones induces adipogenesis in bone marrow stromal cells. Mol Pharmacol 50:1087–1094; 1996. Halleux, C., Sottile, V., Gasser, J., and Seuwen, K. Multi-lineage potential of human mesenchymal stem cells following clonal expansion. J Musculoskel Neuron Interact 2:71–76; 2001. Jaiswal, N., Haynesworth, S. E., Caplan, A. I., and Bruder, S. P. Osteogenic differentiation of purified, culture-expanded human mesenchymal stem cells in vitro. J Cell Biochem 64:295–312; 1997. Johnstone, B., Hering, T. M., Caplan, A. I., Goldberg, V. M., and Yoo, J. U. In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells. Exp Cell Res 238:265–272; 1998. MacDonald, B. R., Gallagher, J. A., Ahnfelt-Ronne, I., Beresford, J. N., Gowen, M., and Russell, R. G. Effects of bovine parathyroid hormone and 1,25-dihydroxyvitamin D3 on the production of prostaglandins by cells derived from human bone. Fed Eur Bone Soc Lett 169:49 –52; 1984. Martin, I., Muraglia, A., Campanile, G., Cancedda, R., and Quarto, R. Fibroblast growth factor-2 supports ex vivo expansion and maintenance of osteogenic precursors from human bone marrow. Endocrinology 138:456 – 462; 1997. Muraglia, A., Cancedda, R., and Quarto, R. Clonal mesenchymal progenitors from human bone marrow differentiate in vitro according to a hierarchical model. J Cell Sci 113:1161–1166; 2000. Nuttall, M. E., Patton, A. J., Olivera, D. L., Nadeau, D. P., and Gowen, M. Human trabecular bone cells are able to express both osteoblastic and adipocytic phenotype: Implications for osteopenic disorders. J Bone Miner Res 13:371–382; 1998.

Bone Vol. 30, No. 5 May 2002:699 –704 15. Owen, M. and Friedenstein, A. J. Stromal stem cells: Marrow-derived osteogenic precursors. Ciba Found Symp 136:42– 60; 1988. 16. Pittenger, M. F., Mackay, A. M., Beck, S. C., Jaiswal, R. K., Douglas, R., Mosca, J. D., Moorman, M. A., Simonetti, D. W., Craig, S., and Marshak, D. R. Multilineage potential of adult human mesenchymal stem cells. Science 284: 143–147; 1999. 17. Prockop, D. J. Marrow stromal cells as stem cells for non-hematopoietic tissues. Science 276:71–74; 1997. 18. Robey, P. G. and Termine, J. D. Human bone cells in vitro. Calcif Tissue Int 37:453– 460; 1985. 19. Sottile, V. and Seuwen, K. Bone morphogenetic protein-2 stimulates adipogenic differentiation of mesenchymal precursor cells in synergy with BRL 49653 (rosiglitazone). Fed Eur Bone Soc Lett 475:201–204; 2000. 20. Sottile, V. and Seuwen, K. A high capacity screen for adipogenic differentiation. Anal Biochem 293:124 –128; 2001. 21. Wergedal, J. E. and Baylink, D. J. Characterization of cells isolated and cultured from human bone. Proc Soc Exp Biol Med 176:60 – 69; 1984. 22. Wong, M. M., Rao, L. G., Ly, H., Hamilton, L., Tong, J., Sturtridge, W., McBroom, R., Aubin, J. E., and Murray, T. M. Long-term effects of physiologic concentrations of dexamethasone on human bone-derived cells. J Bone Miner Res 5:803– 813; 1990. 23. Zuk, P. A., Zhu, M., Mizuno, H., Huang, J., Futrell, J. W., Katz, A. J., Benhaim, P., Lorenz, H. P., and Hedrick, M. H. Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng 7:211–228; 2001.

Date Received: August 13, 2001 Date Revised: December 12, 2001 Date Accepted: December 27, 2001