Stem cells isolated from human dental follicles have osteogenic potential

Stem cells isolated from human dental follicles have osteogenic potential Masaki J. Honda, DDS, PhD,a,b Mari Imaizumi,c Hiroyuki Suzuki,c Satoshi Ohshima,c Shuhei Tsuchiya, DDS, PhD,d and Kazuhito Satomura, DDS, PhD,e,fTokyo, Yokohama, and Tokushima, Japan NIHON UNIVERSITY SCHOOL OF DENTISTRY, UNIVERSITY OF TOKYO, TSURUMI UNIVERSITY, AND THE UNIVERSITY OF TOKUSHIMA GRADUATE SCHOOL

Objective. Stem cells isolated from human dental follicles as a potential cell source for bone-tissue engineering were examined for correcting a critical bone defect. Study design. Impacted third molars were collected and single cell– derived cell populations were cultivated in growth medium. Single cell– derived cell lines were examined in terms of cell shape, gene expression patterns, differentiation capacity in vitro, and osteogenic potential in vivo. Results. Three distinct cell populations were identified with different morphologies, patterns of gene expression, and differentiation capacity. All 3 cell populations promoted bone formation when transplanted into surgically created critical-size defects in imunodeficient rat calvaria, compared with control animals without cell transplantation, although one of these populations showed a weak capacity for osteogenetic differentiation in vitro. Conclusions. Human dental follicle can derive at least 3 unique cell populations in culture, all of which promote bone formation in vivo. (Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2011;111:700-708)

Recently, mesenchymal stem cells (MSCs) were shown to be an attractive cell source for tissue engineering.1,2 They can be easily isolated from bone marrow (BM) and expanded through several passages while retaining their multipotent differentiation capacity.3 However, the harvesting of bone marrow is invasive, and many alternative sources of MSCs also have potential in tissue engineering, including adipose tissue4,5 and den-

This work was supported in part by grants from the Japanese Ministry of Education, Culture, Sports, Science and Technology (Kakenhi Kiban B [19390511 and 21390528] and Houga [20659305]) and by a grant from the Dental Research Center, Nihon University School of Dentistry for 2009. a Associate Professor, Department of Anatomy, Nihon University School of Dentistry, Chiyoda-ku, Tokyo, Japan. b Assistant Professor, Division of Stem Cell Engineering, Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo, Japan. c Technical Assistant, Division of Stem Cell Engineering, Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo, Japan. d Research Associate, Division of Stem Cell Engineering, Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo, Japan. e Professor, Department of Oral Surgery, School of Dental Medicine, Tsurumi University, Tsurumi-ku, Yokohama, Japan. f Associate Professor, Department of Oral and Maxillofacial Surgery, Institute of Health Biosciences, The University of Tokushima Graduate School, Tokushima, Japan. Received for publication Apr 8, 2010; returned for revision Jun 28, 2010; accepted for publication Aug 2, 2010. 1079-2104/$ - see front matter © 2011 Mosby, Inc. All rights reserved. doi:10.1016/j.tripleo.2010.08.004

700

tal pulp cells.6,7 Under appropriate stimulation, MSCs undergo osteogenic differentiation via a well-defined pathway, and bone-tissue engineering using sources such as MSCs is a new tool with the potential to replace autologous tissue grafting for bone defects.8,9 Dental follicle is a loose vascular connective tissue composed of a heterogeneous layer of ectomesenchymal cells surrounding the tooth germ in early stages of tooth development.10-14 In recent years, progenitor cells have been identified in the dental follicle,15-17 and dental follicle cells have been demonstrated to differentiate along osteogenic pathways.18-20 We previously identified single cell– derived stem cells in the dental follicle of porcine developing tooth during early crown formation.21 In that study, the single-cell clonal population combined with ␤-TCP (␤-toricalcium phosphate) formed bone tissue subcutaneously in immunodeficient mice,21 consistent with other studies.12,22 More recently, human dental follicle progenitor cells showed hard tissue-forming potential in immunocompromised rats.23 These results indicate that human dental follicle cells may contribute to bone repair in critical-size defects in vivo. However, no studies have used human dental follicle cells to determine the potential for bone healing, nor has the effect of heterogeneous cell populations derived from human dental follicle tissues on bone repair been addressed. In the first part of this study, we isolated human dental follicle cells from third molars extracted at the

OOOOE Volume 111, Number 6

crown formation stage. Three distinct populations of dental follicle stem cells were derived with different morphologies, patterns of gene expression, and differentiation capacities. Second, we examined the potential of cell source in 3 distinct populations for bone-tissue engineering in surgically created critical-size defects in imunodeficient rat calvaria. MATERIALS AND METHODS The procedures used to acquire all cells from the surgically extracted teeth or from iliac crest conformed to the tenets of the Declaration of Helsinki. This project was approved by the local ethical committee of the Institutional Animal Care and Use Committees (IACUC) at the Institute of Medical Science, the University of Tokyo, and the Ethical Review Committee of the Tokushima University Hospital; all donors gave informed consent. Isolation of putative human dental follicle stem cells A total of 3 impacted third molars were collected from 3 healthy patients for orthodontic reasons (18-25 years of age) in the Department of Oral and Maxillofacial Surgery, Tokushima University Hospital. Dental follicle tissue was carefully dissected from the upside of the dental crown and cut into several pieces. These tissue fragments were incubated at 37°C for 30 minutes in a solution containing 0.05% collagenase (Wako, Tokyo, Japan) and 0.125% trypsin (Invitrogen, Life Technologies, Grand Island, NY). After cell populations had adhered to the plastic dish surface, nonadherent cells were removed by change of medium. After cell populations were 80% confluent, cells were suspended at a density of 1 cell per 100 ␮L and seeded into three 96-well culture plates with the growth culture medium (GCM) consisting of Dulbecco’s modified Eagle’s medium (DMEM; Kohjin Bio, Saitama, Japan) containing 20% fetal calf serum (FCS; Invitrogen) and 1% antibiotics (Invitrogen). The cells were incubated for 1 week, and then 12 colonies (each from a single cell) were obtained and subsequently expanded in medium containing conditioned medium obtained from the cultured primary dental follicle cells diluted 1:2 in GCM. The cells were gradually passaged from 96-well culture plates into 10-cm dishes for subsequent experiments. The human dental follicle cells were characterized against control cells isolated from the human periodontal ligament attached to the middle portion of the extracted 3 third molars and from human bone marrow aspirates from the iliac crest (3 patients). These periodontal ligament– derived cells (PDLC) and bone marrow– derived mesenchymal cells (BMSC) were pas-

Honda et al. 701

saged 4 times in GCM and then used in in vitro experiments. Cultured cells were routinely evaluated using phase-contrast inverted microscopy (Olympus Optical Co., Ltd., Tokyo, Japan). RNA preparation and reverse transcription-polymerase chain reaction Semiquantitative polymerase chain reaction (PCR) analysis using PDL or osteoblast markers was used to characterize the dental follicle cell populations, PDLC, and BMSC. Total RNA was isolated from each cell population using TRIZOL reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized from 1 ␮g of total RNA and amplification was performed in a PCR Thermal Cycler SP (Takara, Ohtsu, Japan) for 25 to 35 cycles according to the following reaction profile: 95°C for 30 seconds, 45 to 60°C for 30 seconds, and 72°C for 30 seconds. Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers were used as internal standards. Synthesized cDNA served as a template for subsequent PCR amplification using specific primers as listed in Table I. The designed primers were based on the sequence of the target gene. The experiment was performed in triplicate. Cell growth analysis To evaluate cell growth, clonal populations (derived from single cells by limiting dilution) of human dental follicle cells were plated at a density of 5 ⫻ 103 cells per well and subcultured in GCM for 1, 7, and 14 days in 6-well culture dishes (Becton Dickinson, Franklin Lakes, NJ). Rate of cell growth was calculated by cell counting (Cell-counting Kit-8; Dojindo Laboratories, Kumamoto, Japan) according to the protocol.24 The relative cell number was determined by measuring absorbance of light at a wavelength of 450 nm (Model 650 Microplate Reader; BioRad Laboratories, Hercules, CA). Results shown are the average of triplicates from one experiment. Induction of differentiation of dental follicle cells Three clonal dental follicle cell populations were treated with different media known to induce either osteogenesis, adipogenesis, or chondrogenesis to evaluate their differentiation potential. Osteogenic differentiation The osteogenic differentiation capacity of clonal human dental follicle cells was assessed by measurement of ALP activity and staining with alizarin red. The cells were grown on 6-well plates at a density of 5 ⫻ 105 cells/well in GCM for 28 days for the assay for ALP activity, and for 14 days for alizarin red staining. For staining of cells with alizarin red, GCM was replaced

702

OOOOE June 2011

Honda et al.

Table I. Sequence of primer pairs Genes runx-2 msx-2 fgfr-2 alp Osteonectin Osteopontin Biglycan Decorin Periostin Collagen-12 Collagen-1 Collagen-3 Vimentin Ameloblastin GAPDH

Sequence (5=-3=) F: CAGACCAGCAGCACTCCATA R: CAGCGTCAACACCATCATTC F: TTACCACATCCCAGCTCCTC R: GAGGGAGAGGAAACCCTTTG F: TGGCAGAACTGTCAACCATGC R: AACGGGAAGGAGTTTAAGCAG F: ATCACCTGTGGGACTTGAGG R: GGATGGTCTCCATCTCCTGA F: GGAAGAAACTGTGGCAGAGGTGAC R: TGTTGTCCTCATCCCTCTCATACAG F: CCAAGTAAGTCCAACGAAAG R: GGTGATGTCCTCGTCTGTA F: CAACCAGATCAGGATCGAGAA R: CCCATGGGACAGAAGTCGTTG F: GGGAGCTTCACTTGGACAACAAC R: GGGCAGAAGTCACTTGATCCAAC F: CAAACCACCTTCACGGATCT R: TGCAGCTTCAAGTAGGCTGA F: GTGCAGTATCATGCCCTGTG R: AACAGGTCTGGGTTTTGTGC F: CCAAAGGATCTCCTGGTGAA R: GGAAACCTCTCTCGCCTCTT F: TGGTGTTGGAGCCGCTGCCA R: CTCAGCACTAGAATCTGTCC F: GGGACCTCTACGAGGAGGAG R: CGCATTGTCAACATCCTGTC F: GCTAAAACACTTATTACCCTT R:AATAGTGTCATGTGCTGTGTAAGAG F: CGTCTTCACCACCATGGAGA R: AAACTGTGGCGTGATGGCCG

Annealing temperature (˚C)

Size, bp

59

178

50

419

55

500

50

495

49

453

50

347

55

186

53

127

50

417

55

220

50

489

52

350

55

200

50

261

55

300

F, forward; GAPDH, glyceraldehydes-3-phosphate dehydrogenase; R, reverse.

with osteogenic induction medium (OIM; complete medium supplemented with 50 mg/mL L-ascorbic acid, 10 mM ␤-glycerophosphate, 10⫺8 M dexamethasone [Wako, Osaka, Japan], and BMP-4 [0.05 ␮g/mL, R&D System, Minneapolis, MN]) after 14 days in culture. Medium was then changed every 2 days for 28 days. ALP activity was tested using Fast p-nitrophenyl phosphate tablets (Sigma, St Louis, MO) according to the protocol.24 The relative amount of p-nitrophenyl reacted was estimated from the light absorbance at a wavelength of 405 nm (BioRad Laboratories) at days 7, 14, 21, and 28. Each experiment was performed in triplicate. The presence of mineralized matrix such as calcium deposition was determined by staining with alizarin red. Cells grown to confluence in OIM for 14 days were rinsed with phosphate-buffered saline (PBS) and fixed with 70% (wt/vol) ethanol for 2 hours before staining with 1% (wt/vol) alizarin red S (Wako) in 0.25% ammonia water for 5 minutes at room temperature and destaining with distilled water for imaging.

Adipogenesis To evaluate adipogenic differentiation, 2 ⫻ 105 cells were plated into each well of a 6-well plate (Becton Dickinson, Franklin Lakes, NJ). At 100% confluence, an adipogenic induction medium was used to stimulate optimal adipogenic differentiation according to the manufacturer’s instruction (CAT: 811D-250, Cell Applications, Inc, Toyobo, Osaka, Japan). The medium was change twice weekly for 2 weeks. Control plates of cells in GCM were also maintained. The cells were fixed with 4% paraformaldehyde, stained with 0.3% Oil Red O and counterstained with 1% Fast green dye using standard techniques. Lipid droplets were identified microscopically (BZ-8000, Keyence, Tokyo, Japan). Chondrogenesis The chondrogenic differentiation was induced by the pellet culture of dental follicle cells with a chondrogenic medium (cat: PT4121, LONZA, Walkersville, MD) plus recombinant transforming growth factor (TGF)-␤3 (code 243-B3-002, R&D System) for chon-

OOOOE Volume 111, Number 6

Honda et al. 703

Fig. 1. Cell morphology of dental follicle stem cells. HDF1 cells have a polygonal cell morphology (A), and are smaller than HDF3 cells. HDF2 cells have a spindle shape (B) that is similar to fibroblastic cells. HDF3 cells are also polygonal (C). Human periodontal ligament cells are spindle shaped (D). Human bone marrow– derived mesenchymal cells have a fibroblastic spindle shape (E). Scale bars: 20 ␮m.

drocyte differentiation. Briefly, trypsinized dental follicle cells were placed in a 15-mL polypropylene tube and centrifuged at 1000 rpm for 5 minutes to form a pelleted cell mass at the bottom of the tube. The pellet was cultured in the chondrogenic medium for 3 weeks. After cultivation, the pellets were fixed and were stained with 1% alcian blue (Sigma) in 0.1N HCL for 30 minutes. Surgical procedure We designed a transplantation procedure to generate bone tissue to compare the in vivo osteogenic capacity of human dental follicle cells. A curvilinear sagittal incision was made in the calvarium scalp of anesthetized, immunocompromised rats (total number ⫽ 24, F344/NJcl-rnu, Nihon Crea, Tokyo, Japan), allowing reflection in a subperiosteal plane. An 8-mm-diameter full-thickness critical size parietal defect was made unilaterally in the parietal bone using a trephine drill. A critical size defect is defined as the minimal size bone defect that, if left untreated, would not heal spontaneously during the animal’s lifetime.25 Care was taken to avoid injuring the dura, and the periosteum was eliminated to exclude the possibility of bone formation from periosteum-derived osteogenic cells. The surgical defect was filled with a pellet of dental follicle cells from all 3 clonal populations (n ⫽ 3 each) that had been expanded in culture (approximately 2 ⫻ 106 cells per pellet). The soft tissues were then repositioned and the skin was closed with 4-0 Vicryl suture (Ethicon, Somerville, NJ).

Tissue processing Each group of animals was divided into 2 subgroups at either 1 or 4 weeks after transplantation (n ⫽ 3 each). The area of the original surgical defect and the surrounding tissues were removed en bloc. After fixing in Bouin’s solution for 24 hours, the tissue blocks were decalcified with 10% EDTA solution for 1 month, and then processed for embedding in paraffin. Serial sections of 6-␮m thickness were cut in a longitudinal direction starting at the center of the original surgical defect. The sections were stained with either hematoxylin and eosin or by immunohistochemistry for analysis by light microscopy. To increase the data reliability, 3 histological sections were selected for the histomorphometric analysis. Scion image software was used for image analysis (National Institutes of Health, Bethesda, MD). Briefly, the total area corresponded to the entire area of the original surgical defect. The newly regenerated bone area within the confines of the total area was measured and calculated as a proportion of the total area. The measure of regenerated bone in the defect was represented by the mean percentage. Immunohistochemical analysis was performed using the Vectastain ABC kit (Vector Laboratories, Inc, Burlingame, CA), as previously described26 with modification.27 Mouse monoclonal osteocalcin antibody was used to identify osteoblasts (1:200 dilution; ab13420, Abcam plc, Tokyo, Japan).

704

Honda et al.

OOOOE June 2011

Fig. 2. Patterns of gene expression in HDF1, 2, 3, PDLC, and BMSC cells.

Fig. 3. Growth potential of HDF clonal cell populations. Cell numbers were evaluated by MTT assay. HDF1 cells had the highest growth potential. Error bar represents mean ⫾ SD from 3 separate experiments. *P ⬍ .05.

Statistical analysis Significance of differences was determined using Student t test and Microsoft Excel software (Microsoft, Redmond, WA). A P value less than .05 was considered significant. RESULTS Characterization of putative human dental follicle stem cells in vitro We obtained 12 single cell– derived cell populations that formed colonies that could be expanded in vitro from 3 donors. Each clonal cell population uniformly displayed 1 of 3 distinct morphologies under phase contrast microscope, which we termed HDF1, 2, and 3 (Fig. 1). HDF-1 cells were small and polygonal (Fig. 1, A and B). HDF-2 cells were spindle-shaped with small processes (Fig. 1, C and D), with a similar morphology to PDLC (Fig. 1, G) and BMSC (Fig. 1, H). HDF-3 cells were also polygonal, but were larger than HDF-1 cells (Fig. 1, E and F). We next examined the expression of specific previously described dental follicle cell markers28-30 by re-

Fig. 4. A, Osteogenic differentiation capacity of HDF cells. HDFs were subcultured in GCM for 28 days, and then ALP activity was analyzed to investigate the difference in osteogenic potential. ALP activity of HDF1 was higher than that observed for HDF2 and HDF3. Error bar represents mean ⫾ SD from 3 separate experiments. *P ⬍ .05. B, Osteogenic differentiation activity of clonal cell populations as measured by mineralization potential. HDFs were subcultured in GCM for 28 days (upper) and subsequently subcultured with OIM for 14 days (lower). A calcified extracellular matrix stained positive for alizarin red in HDF1 and HDF2 cells in GCM.

verse transcription (RT)-PCR in each clone and in controls after 14 days of culture in GCM (Table I). ALP mRNA was expressed at high levels in HDF2 and HDF3 cells, but only weakly in HDF1 cells (Fig. 2). Periostin mRNA was detected only in HDF1 and HDF3 cells. FGFR2 and collagen type XII mRNA were expressed at high levels in HDF1 and HDF3 cells, but only at low levels in HDF2 cells. Decorin mRNA was more highly expressed in HDF1 than HDF2 and HDF3 cells. Furthermore, control PDLC and BMSC cells showed very different patterns of gene expression to HDFs. These control cell populations expressed Msx2, which was not expressed in HDFs, but did not express FGFR2, which was expressed in all HDF cell populations. Growth potential of dental follicle cells There were markedly different patterns of cell proliferation among HDF1, HDF2, and HDF3 cells over

OOOOE Volume 111, Number 6

Honda et al. 705

Fig. 5. Adipogenic differentiation capacity of dental follicle stem cells. HDFs were cultured with GCM (upper panel). Intracellular oil droplets were stained by Oil Red O in HDF3 cells cultured in GCM. HDFs treated with adipogenic medium for 14 days were stained using Oil Red O (lower panel).

the period of observation (Fig. 3). In particular, at day 7, the growth potential of HDF1 cells was significantly higher than that of HDF2 and HDF3 cells. Differentiation potential of dental follicle cells All experiments were repeated at least 3 times. The differentiation potentials of the 3 HDF cell types were then tested by culturing cells under different conditions. None of the cell types could be driven toward chondrogenesis when cultured with chondrogenesis differentiation medium. HDF1 cells grown in GCM had strong ALP activity, in contrast to HDF2 and HDF3 cells, which had only very low levels of activity (Fig. 4, A). When grown in OIM for 14 days, HDF 1 and HDF 2 cells, but not HDF3 cells, stained strongly for alizarin red, indicating calcium accumulation (Fig. 4, B). There was no precipitation of alizarin red in any cells grown in GCM for 28 days or in those cultured in OIM without BMP-4. Neutral lipid, a marker of adipogenic differentiation, which stains with Oil Red O, was evident at high levels only in HDF3 cells when cells were cultured with GCM (Fig. 5, upper panel). However, when HDFs were subcultured in adipogenic differentiation medium, multiple intracellular lipid-filled droplets could be seen in all HDFs (Fig. 5, lower panel). Osteogenic potential in vivo The potential of cells to form bone in vivo was investigated by transplantation of a pellet of dental follicle cells into a surgically created full-thickness critical size parietal defect in rats. In all groups, hematoxylin and eosin staining showed bone formation and evidence of vascular invasion at 4 weeks posttransplantation (Fig. 6). The regions where a defect had been

created were reconstituted and tended to be close to the dura surface owing to new bone formation in animals transplanted with HDF1 and HDF2 cells (Fig. 6, A and B). The appearance of new bone formation was similar to that seen in intramembranous ossification. There was some new bone formation in animals transplanted with HDF3 cells, but markedly more than that seen in control animals without cell transplants (Fig. 6, C), which showed fibrous tissues and only very small amounts of bone at the site of the defect (Fig. 6, D). Histomorphometrical analysis confirmed that the bone area generated with cell transplants was more extensive than that with no cell transplants (Fig. 6, E). There was no significant difference among the 3 cell transplants (HDF1, HDF2, HDF3). Osteocalcin immunostaining showed formation of bone matrix surrounded by osteoblasts in all HDF implants (Fig. 7, A-C) DISCUSSION Dental follicle cells are a relatively recently identified source of multipotent precursor cells that are an attractive source of cells for tissue engineering because of the ease of harvest of cells. Here, we show that human dental follicle obtained between the ages of 18 and 25 years contains at least 3 distinct cell populations that exhibit very different cell morphologies, patterns of gene expression, differentiation potential, and mineralization potential under defined culture conditions. Under nondifferentiating culture conditions, only HDF2 cells displayed the fibroblastlike morphology that is also seen in PDLC and BMSC; the other 2 cell types had very different morphologies. There was marked heterogeneity in terms of cell size, with HDF1 cells being comparatively very small. Cell size has been related to cell cycle,31 cell proliferation,32,33 and cell

706

Honda et al.

OOOOE June 2011

Fig. 6. New bone formations in calvarias. In vivo new bone formation (arrows) after transplantation in immunosuppressed rat, stained with hematoxylin and eosin. A, HDF1 implant; B, HDF2 implant; C, HDF3 implant; and D, no cell implant. E, Mean areas of newly generated bone (expressed as a percentage of the total bone defect area).

Fig. 7. Immunohistochemistry of osteocalcin on bone formation in HDF1 implants (A), HDF2 implants (B), and HDF3 implants (C). Osteoblasts (arrows) located in the surface of newly formed bone had strong reactivity for osteocalcin in all HDF implants.

differentiation.34,35 We then assayed the proliferation potential of the 3 HFD clonal populations and found that the HDF1 cells had a higher proliferation potential than HDF2 and HDF3 cells. It has been reported that smaller cells are more likely to have stem cell properties, whereas larger cells are more likely to be differentiated.36 Our data were consistent with these findings in terms of cell size and cell proliferation.

Mature chondrocytes, osteoblasts, and adipocytes are believed to arise from a common stem/progenitor cell, and resident progenitor cells were recently identified in human dental follicle.18-20,23 Two studies suggested that human dental follicle and periodontal stem cells could specifically differentiate along osteogenic and adipogenic pathways.18,19 In contrast, Lindroos et al.37 reported that human dental follicle cells could differ-

OOOOE Volume 111, Number 6

entiate only to the osteogenic lineage, whereas Kemoun et al.20 showed human dental follicle cells differentiating into osteoblasts, chondrocytes, and adipocytes. Based on these results, the differentiation capacity of these dental follicle stem cells remains poorly characterized. All 3 cell populations identified in the present study could differentiate along the osteogenic lineage, but with very different potentials; HDF1 cells showed the highest osteogenic differentiation potential. All 3 cell populations could also be driven to differentiate into adipocytes; HDF3 cells had the highest propensity to differentiate along this pathway; however, none of the 3 clonal populations showed chondrocyte determination under culture conditions known to produce chondrocyte lineage cells from other stem cell populations. The discrepancies of these data including previous and present results on differentiation capacity in human dental follicle cells may reflect the heterogeneous dental follicle cell populations. Osteoblast, chondroblast, and adipocyte lineages have been shown to express distinct transcription factors during cell specification. These transcription factors include CCAAT (cytidine-cytidine-adenosine-adenosine-thymidine)/Enhancer binding protein (C/EBP) alpha and peroxisome proliferator-activated receptor gamma in adipocytes, 38,39 core-binding factor alpha 1 (Cbfa1/Runx2)40 and osterix in osteoblasts,41 and Sox9 in chondrocytes.42 These lineage-specific transcription factors can also inhibit differentiation of other lineages by suppressing gene expression.43,44 We showed that all 3 clonal cell populations expressed the osteoblast marker Runx2, which was not expressed by PDLC or BMSC cells. These 3 HDF cell populations may therefore have a more restricted differentiation potential than PDLCs and BMSCs, which can also be driven to differentiate into chondrocytes,18,19,37 unlike the HDF populations we have identified. HDFs showed other differences to PDLC and BMSC; periodontal ligament marker genes such as periostin45,46 and MSX247 were only weakly expressed in HDFs. One exciting potential application of tissue engineering is bone regeneration. In this study, the clonal HDF populations were remarkably different in terms of mineralization characteristics in vivo (Fig. 6). HDF1 and HDF2 cells were apparently more responsive to in vivo osteogenic differentiation than in HDF3 cells using a pellet culture system. The pellet culture system can facilitate a 3-dimensional growth environment in which, for example, the secretion of ECM to form a natural scaffold may potentiate cell differentiation.48 On the other hand, we cannot be sure whether the matrix within the transplanted pellet would act as a scaffold for bone formation. Although HDF3 cells produced quantitatively less bone than the HDF1 and HDF2 populations, there was still more bone than seen

Honda et al. 707

in controls, suggesting that all 3 HDF populations may be induced to form osteoblasts with osteocalcin expression (Fig. 7). Our results demonstrate that a heterogeneity in dental follicles does not affect the ability of this tissue to form bone. Our previous study examined the osteogenic capacity of the porcine dental follicle cells in comparison with that of porcine periodontal ligament– derived cells or bone marrow– derived mesenchymal stem cells. The results suggest that there were no significant differences in areas of new bone formation in the transplant. Based on this and previous studies suggests that dental follicle stem cells may provide a cell source for tissue engineering of bone. However, further studies are needed to determine whether such transplanted cells could directly differentiate into osteoblasts with osteocalcin expression. REFERENCES 1. Neuss S, Stainforth R, Salber J, Schenck P, Bovi M, Knuchel R, et al. Long-term survival and bipotent terminal differentiation of human mesenchymal stem cells (hMSC) in combination with a commercially available three-dimensional collagen scaffold. Cell Transplant 2008;17(8):977-86. 2. Le Blanc K, Pittenger M. Mesenchymal stem cells: progress toward promise. Cytotherapy 2005;7(1):36-45. 3. Neuss S, Becher E, Woltje M, Tietze L, Jahnen-Dechent W. Functional expression of HGF and HGF receptor/c-met in adult human mesenchymal stem cells suggests a role in cell mobilization, tissue repair, and wound healing. Stem Cells 2004;22(3): 405-14. 4. Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H, et al. Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell 2002;13(12):4279-95. 5. Matsumoto T, Kano K, Kondo D, Fukuda N, Iribe Y, Tanaka N, et al. Mature adipocyte-derived dedifferentiated fat cells exhibit multilineage potential. J Cell Physiol 2008;215(1):210-22. 6. Gronthos S, Mankani M, Brahim J, Robey PG, Shi S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000;97(25):13625-30. 7. Laino G, d’Aquino R, Graziano A, Lanza V, Carinci F, Naro F, et al. A new population of human adult dental pulp stem cells: a useful source of living autologous fibrous bone tissue (LAB). J Bone Miner Res 2005;20(8):1394-402. 8. Mao JJ, Giannobile WV, Helms JA, Hollister SJ, Krebsbach PH, Longaker MT, et al. Craniofacial tissue engineering by stem cells. J Dent Res 2006;85(11):966-79. 9. Caplan AI. Tissue engineering designs for the future: new logics, old molecules. Tissue Eng 2000;6(1):1-8. 10. Diekwisch TG. The developmental biology of cementum. Int J Dev Biol 2001;45(5-6):695-706. 11. Handa K, Saito M, Tsunoda A, Yamauchi M, Hattori S, Sato S, et al. Progenitor cells from dental follicle are able to form cementum matrix in vivo. Connect Tissue Res 2002;43(2-3):406-8. 12. Saito M, Handa K, Kiyono T, Hattori S, Yokoi T, Tsubakimoto T, et al. Immortalization of cementoblast progenitor cells with Bmi-1 and TERT. J Bone Miner Res 2005;20(1):50-7. 13. Morsczeck C, Gotz W, Schierholz J, Zeilhofer F, Kuhn U, Mohl C, et al. Isolation of precursor cells (PCs) from human dental follicle of wisdom teeth. Matrix Biol 2005;24(2):155-65. 14. Paynter KJ, Pudy G. A study of the structure, chemical nature, and development of cementum in the rat. Anat Rec 1958; 131(2):233-51.

708

OOOOE June 2011

Honda et al.

15. Hou LT, Liu CM, Chen YJ, Wong MY, Chen KC, Chen J, et al. Characterization of dental follicle cells in developing mouse molar. Arch Oral Biol 1999;44(9):759-70. 16. Luan X, Ito Y, Dangaria S, Diekwisch TG. Dental follicle progenitor cell heterogeneity in the developing mouse periodontium. Stem Cells Dev 2006;15(4):595-608. 17. Yao S, Pan F, Prpic V, Wise GE. Differentiation of stem cells in the dental follicle. J Dent Res 2008;87(8):767-71. 18. Lin NH, Menicanin D, Mrozik K, Gronthos S, Bartold PM. Putative stem cells in regenerating human periodontium. J Periodontal Res 2008;43(5):514-23. 19. Jo YY, Lee HJ, Kook SY, Choung HW, Park JY, Chung JH, et al. Isolation and characterization of postnatal stem cells from human dental tissues. Tissue Eng 2007;13(4):767-73. 20. Kemoun P, Laurencin-Dalicieux S, Rue J, Farges JC, Gennero I, Conte-Auriol F, et al. Human dental follicle cells acquire cementoblast features under stimulation by BMP-2/-7 and enamel matrix derivatives (EMD) in vitro. Cell Tissue Res 2007;329(2):283-94. 21. Tsuchiya S, Honda MJ, Shinohara Y, Saito M, Ueda M. Collagen type I matrix affects molecular and cellular behavior of purified porcine dental follicle cells. Cell Tissue Res 2008;331(2):447-59. 22. Handa K, Saito M, Yamauchi M, Kiyono T, Sato S, Teranaka T, et al. Cementum matrix formation in vivo by cultured dental follicle cells. Bone 2002;31(5):606-11. 23. Yagyuu T, Ikeda E, Ohgushi H, Tadokoro M, Hirose M, Maeda M, et al. Hard tissue-forming potential of stem/progenitor cells in human dental follicle and dental papilla. Arch Oral Biol 2010;55: 68-76. 24. Honda MJ, Shinohara Y, Sumita Y, Tonomura A, Kagami H, Ueda M. Shear stress facilitates tissue-engineered odontogenesis. Bone 2006;39(1):125-33. 25. Schmitz JP, Hollinger JO. The critical size defect as an experimental model for craniomandibulofacial nonunions. Clin Orthop Relat Res 1986;(205):299-308. 26. Hsu SM, Raine L, Fanger H. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 1981;29(4):577-80. 27. Chen J, Zhang Q, McCulloch CA, Sodek J. Immunohistochemical localization of bone sialoprotein in foetal porcine bone tissues: comparisons with secreted phosphoprotein 1 (SPP-1, osteopontin) and SPARC (osteonectin). Histochem J 1991;23(6):281-9. 28. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284(5411):143-7. 29. Lee OK, Kuo TK, Chen WM, Lee KD, Hsieh SL, Chen TH. Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 2004;103(5):1669-75. 30. Sakaguchi Y, Sekiya I, Yagishita K, Ichinose S, Shinomiya K, Muneta T. Suspended cells from trabecular bone by collagenase digestion become virtually identical to mesenchymal stem cells obtained from marrow aspirates. Blood 2004;104(9):2728-35. 31. Gao FB, Raff M. Cell size control and a cell-intrinsic maturation program in proliferating oligodendrocyte precursor cells. J Cell Biol 1997;138(6):1367-77. 32. Barrandon Y, Green H. Cell size as a determinant of the cloneforming ability of human keratinocytes. Proc Natl Acad Sci U S A 1985;82(16):5390-4. 33. Angello JC, Pendergrass WR, Norwood TH, Prothero J. Proliferative potential of human fibroblasts: an inverse dependence on cell size. J Cell Physiol 1987;132(1):125-30. 34. Watt FM, Green H. Involucrin synthesis is correlated with cell size in human epidermal cultures. J Cell Biol 1981;90(3):738-42.

35. Dazard JE, Piette J, Basset-Seguin N, Blanchard JM, Gandarillas A. Switch from p53 to MDM2 as differentiating human keratinocytes lose their proliferative potential and increase in cellular size. Oncogene 2000;19(33):3693-705. 36. Kim HS, Jun Song X, de Paiva CS, Chen Z, Pflugfelder SC, Li DQ. Phenotypic characterization of human corneal epithelial cells expanded ex vivo from limbal explant and single cell cultures. Exp Eye Res 2004;79(1):41-9. 37. Lindroos B, Maenpaa K, Ylikomi T, Oja H, Suuronen R, Miettinen S. Characterisation of human dental stem cells and buccal mucosa fibroblasts. Biochem Biophys Res Commun 2008;368(2):329-35. 38. Christy RJ, Yang VW, Ntambi JM, Geiman DE, Landschulz WH, Friedman AD, et al. Differentiation-induced gene expression in 3T3-L1 preadipocytes: CCAAT/enhancer binding protein interacts with and activates the promoters of two adipocytespecific genes. Genes Dev 1989;3(9):1323-35. 39. Chawla A, Lazar MA. Peroxisome proliferator and retinoid signaling pathways co-regulate preadipocyte phenotype and survival. Proc Natl Acad Sci U S A 1994;91(5):1786-90. 40. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/ Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89(5):747-54. 41. Lee MH, Kwon TG, Park HS, Wozney JM, Ryoo HM. BMP-2induced Osterix expression is mediated by Dlx5 but is independent of Runx2. Biochem Biophys Res Commun 2003;309(3):689-94. 42. Lefebvre V, Huang W, Harley VR, Goodfellow PN, de Crombrugghe B. SOX9 is a potent activator of the chondrocytespecific enhancer of the pro alpha1(II) collagen gene. Mol Cell Biol 1997;17(4):2336-46. 43. Enomoto H, Furuichi T, Zanma A, Yamana K, Yoshida C, Sumitani S, et al. Runx2 deficiency in chondrocytes causes adipogenic changes in vitro. J Cell Sci 2004;117(Pt 3):417-25. 44. Lecka-Czernik B, Gubrij I, Moerman EJ, Kajkenova O, Lipschitz DA, Manolagas SC, et al. Inhibition of Osf2/Cbfa1 expression and terminal osteoblast differentiation by PPARgamma2. J Cell Biochem 1999;74(3):357-71. 45. Kruzynska-Frejtag A, Wang J, Maeda M, Rogers R, Krug E, Hoffman S, et al. Periostin is expressed within the developing teeth at the sites of epithelial-mesenchymal interaction. Dev Dyn 2004;229(4):857-68. 46. Suzuki H, Amizuka N, Kii I, Kawano Y, Nozawa-Inoue K, Suzuki A, et al. Immunohistochemical localization of periostin in tooth and its surrounding tissues in mouse mandibles during development. Anat Rec A Discov Mol Cell Evol Biol 2004; 281(2):1264-75. 47. Yoshizawa T, Takizawa F, Iizawa F, Ishibashi O, Kawashima H, Matsuda A, et al. Homeobox protein MSX2 acts as a molecular defense mechanism for preventing ossification in ligament fibroblasts. Mol Cell Biol 2004;24(8):3460-72. 48. Bissell MJ, Labarge MA. Context, tissue plasticity, and cancer: are tumor stem cells also regulated by the microenvironment? Cancer Cell 2005;7(1):17-23.

Reprint requests: Masaki J. Honda, DDS, PhD Associate Professor Department of Anatomy Nihon University School of Dentistry 1-8-13 Kanda-Surugadai Chiyoda-ku Tokyo 101-8310, Japan [email protected]