Steroid receptor mRNA expression in the ovarian follicles of cows with cystic ovarian disease

Research in Veterinary Science 92 (2012) 478–485

Contents lists available at ScienceDirect

Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc

Steroid receptor mRNA expression in the ovarian follicles of cows with cystic ovarian disease Natalia S. Alfaro a,b, Natalia R. Salvetti a,b, Melisa M. Velazquez a,b, Matías L. Stangaferro a, Florencia Rey a,b, Hugo H. Ortega a,b,⇑ a b

Morphological Sciences Department, Faculty of Veterinary Sciences, National University of Litoral (FCV-UNL), Esperanza, Santa Fe, Argentina Argentine National Research Council (CONICET), Argentina

a r t i c l e

i n f o

Article history: Received 18 June 2010 Accepted 11 April 2011

Keywords: Ovarian cyst Cow Steroid receptors

a b s t r a c t Steroid receptors have been demonstrated to be important intra-ovarian regulators of follicular development and ovulatory processes. The aim of the present study was to determine the expression of steroid receptor mRNA in ovarian follicular structures from cows with cystic ovarian disease (COD) compared with ovarian structures from regularly cycling cows using reverse transcription polymerase chain reaction (RT-PCR). The cystic follicles showed a higher estrogen receptor a (ESR1) mRNA expression in the theca and granulosa and a lower estrogen receptor b (ESR2) expression. The cystic follicles also showed a strong expression of androgen receptor mRNA in the granulosa. No changes were observed in total progesterone receptor mRNA, but a very significant increase in the B isoform was found in the granulosa of the cystic follicles. The findings of the current study provide evidence that an altered steroid signaling system may be present in bovine follicular cysts, and we suggest that in conditions characterized by altered ovulation, such as COD, changes in the expression of ovarian steroid receptors could play a fundamental role in the pathogeny of this disease. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction The etiopathogenia of cystic ovarian disease (COD) in dairy cattle is a complex process that involves dysfunctions in folliculogenesis and ovulation, and many factors such as stress, nutritional management and infectious disease can co-exist (Silvia et al., 2002). Steroids play a key role in the growth, differentiation and function of female reproductive tissues, including the ovarian follicles (Drummond et al., 2002; Brosens et al., 2004). In this sense, locally produced androgens, estrogens and progesterone are involved in the regulation of several different follicular functions (Rosenfeld et al., 2001; Bramley et al., 2002; Drummond et al., 2002; Schams and Berisha, 2002; Brosens et al., 2004; Drummond, 2006; Kimura et al., 2007; Ortega et al., 2009). Considering that the genomic effects of steroids are mediated via intracellular receptors (Beato and Klug, 2000; Brosens et al., 2004), and that steroids have the potential to upregulate or downregulate their own receptors (Drummond et al., 1999; Beato and Klug, 2000), the altered follicular dynamics and cellular differenti⇑ Corresponding author at: Morphological Sciences Department, Faculty of Veterinary Sciences, National University of Litoral (FCV-UNL), R.P. Kreder 2805, 3080 Esperanza, Santa Fe, Argentina. Tel.: +54 3496 420639; fax: +54 3496 426304. E-mail address: [email protected] (H.H. Ortega). 0034-5288/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.rvsc.2011.04.009

ation observed in COD (Ortega et al., 2007, 2008; Rey et al., 2009; Velazquez et al., 2010) may be mediated via the altered expression of ovarian steroid receptors. Changes in receptor expression would result in altered steroid signaling culminating in alterations to cellular proliferation, apoptosis and differentiation (Rosenfeld et al., 2001; Drummond et al., 2002; Walters et al., 2008). A critical role for steroids in regulating follicular growth has also been shown by the development of abnormal ovarian phenotypes associated with reduced fertility in mice lacking steroid receptors (Lydon et al., 1996; Drummond et al., 2002; Yeh et al., 2002). Some of these effects are related to changes in other hormones regulated by steroids, such as gonadotrophins, or follicular processes occurring late during follicular development. However, there is also growing evidence to support a direct intra-ovarian role for steroids, particularly estrogens and androgens, in regulating early follicular growth (Koering et al., 1994; Drummond et al., 2002; Britt et al., 2004; Jonard and Dewailly, 2004). Steroids hormones act through specific receptors which are members of the nuclear receptor superfamily of transcription factors (Brosens et al., 2004). Estrogen receptors (ESR) are expressed as two structurally related subtypes in mammals, estrogen receptor a (ESR1) and estrogen receptor b (ESR2), which are encoded by two distinct genes (Kuiper et al., 1996). The existence of these two subtypes may partly explain the selective action of estrogen in different target tissues and in the same tissue at different phys-

479

N.S. Alfaro et al. / Research in Veterinary Science 92 (2012) 478–485

iological states (Mowa and Iwanaga, 2000; Wang et al., 2000). The progesterone receptor (PGR) has at least three isoforms (PGR-A, -B and -C), all originating from the same gene (Wei et al., 1990). The actions of androgens are mediated by androgen receptors (AR) (Brinkmann, 2001) encoded by a single copy gene in the X chromosome (Yong et al., 2000), with at least two isoforms originating from the same gene: AR-A and -B (Takeo and Yamashita, 1999). The locations of steroid hormones receptors within ovarian follicles were confirmed by in situ hybridization (D’haeseleer et al., 2005). In bovine ovarian follicles, ESR2 mRNA expression in granulosa cells decreases with an increase in follicular size (Manikkam et al., 2001). In contrast, mRNA expression of ESR1 in the theca interna continuously increases during the final growth stages of the follicles, whereas no such increase occurs in granulosa cells (Schams and Berisha, 2002). A relatively high expression of ESR1 is found in thecal and stromal cells compared with granulosa cells (Van den Broeck et al., 2002). The expression of PGR mRNA in the follicles continuously increases to a maximum level in preovulatory follicles (Schams and Berisha, 2002), and a surge of gonadotrophin induces a rapid and transient increase in their expression in both theca and granulosa cells (Cassar et al., 2002; Jo et al., 2002). Also, AR mRNA expression in bovine follicles increases during early follicle development (Hampton et al., 2004). It has been demonstrated that either estrogen or estrogen receptor imbalances/disturbances may result in the development of ovarian follicular cysts in cattle (Garverick, 1997; Salvetti et al., 2007), sheep (Ortega et al., 2009), humans (Shushan et al., 1996; Jakimiuk et al., 2002) and rodents (Salvetti et al., 2009). The expression of ESR1, ESR2 and PGR proteins has been analyzed in cows with COD by immunohistochemistry (Salvetti et al., 2007). However, there are no data available on the expression of steroid receptor mRNA in bovine cystic follicles. Since steroid receptors have been demonstrated to be important intra-ovarian regulators of follicular development and ovulatory processes, the aim of the present study was to determine the expression of ESR1, ESR2, PGR and AR mRNA in ovarian follicular structures from cows with COD compared with ovarian structures from regularly cycling cows using reverse transcription polymerase chain reaction (RT-PCR).

2. Materials and methods 2.1. Collection and preparation of tissues Ovaries from 65 random cows were collected at a local abattoir, within 20 min of death, from mixed breeds of Bos taurus cows assessed visually as being non-pregnant and without macroscopic abnormalities in the reproductive system. The complete ovaries were washed, refrigerated and immediately transported to the laboratory. Each batch of ovaries was placed on ice and the antral follicles were removed using scissors and scalpel dissection. Before the ovaries were dissected, the follicular diameter was measured using callipers and the follicular fluid from each follicle was aspirated and stored separately at 20 °C for estradiol and progesterone determination. Follicles with an obviously atretic appearance (avascular theca and debris in the antrum) were discarded. Large antral follicles were obtained only the ovary couples without visible active corpora lutea. Healthy follicles from normal cycling cows were classified into three categories according to their calculated follicle diameters, as described previously (Parrott and Skinner, 1998): small (<5 mm, n = 15), medium (5–10 mm, n = 15) or large (>10 mm, n = 15). The cystic follicles (>20 mm, n = 20) from COD animals were also used (Silvia et al., 2002). Follicles were hemisected in PBS and the granulosa cells (GC) were gently scraped into separate tubes

containing approximately 20 ml of sterile PBS. The cell suspension was centrifuged at 400g for 10 min, the supernatant discarded and the GC pellets resuspended in Trizol LS reagent (Invitrogen, CA, USA). The follicular walls were further washed several times with PBS to remove the remaining GC. The surrounding stroma was also removed from the follicular walls, which was used as the thecal tissue samples (Sudo et al., 2007). All samples were snap-frozen in liquid nitrogen and stored at 80 °C until total RNA extraction. 2.2. Total RNA extraction Total RNA was isolated from the samples after treatment with Trizol LS reagent (Invitrogen) according to the manufacturer’s instructions with slight modifications. Briefly, 50–100 mg of tissue was homogenized with 750 ll of Trizol reagent (Invitrogen) and incubated for 5 min at 4 °C. The RNA was purified by vigorously homogenizing with chloroform and incubating for 15 min at 4 °C. After centrifugation at 12,000g, the aqueous phase was incubated with an equal volume of isopropanol for 30 min at 20 °C and centrifuged at 12,000g to obtain the mRNA pellet which was then washed with 75% ethanol for 10 min at 4 °C. The alcohol was replaced by DEPC-water pre-warmed to 55–60 °C. The extracted RNA was DNase treated with deoxyribonuclease I (amplification grade) (Invitrogen) to eliminate contaminating DNA, assessed for quality and quantity using a fluoroscopic method (Qubit, Invitrogen), aliquoted and stored at 80 °C until further use. 2.3. PCR primer design 2.3.1. Steroid receptor specific primers The primers for ESR1, ESR2 and AR have been previously described (Pfaffl et al., 2003). For the PGR primer design, bovine sequences of PGR were obtained from GenBank (http:// www.ncbi.nlm.nih.gov/Entrez/index.htm) and two specific primers were designed spanning at least two mRNA-splicing sites using the PrimerSelect program in the LASERGENE software (DNAStar, WI, USA). The PGRb primer set flanks part of the NH2-terminal region of the B isoform (62 bp).The PGRab primer set flanks part of the common region of the A and B isoforms (131 bp) and the PGRtotal primer set flanks the hormone-binding domain for all A, B and C isoforms (339 bp) (Fig. 1). All primers were purchased from Invitrogen and the sequences are summarized in Table 1. Oligonucleotide primers and amplification products were tested using BLAST (http://www.ncbi.nlm.nih.-

Protein domains PGR-B

A/B

mRNA structure PGR-B

1

291 352

C

767

D

897

E

2160 2519

3` 484

PGR-A

2685

5`

3` 1645 or 1766

PGR-C

2685

5`

2685

5`

3` PGRb-F ►◄ PGRb-R PGRab-F ► ◄ PGRab-R

62bp

131bp

PGRtotal-F ►

◄ PGRtotal-R

360bp

Fig. 1. Diagrammatic scheme and functional domains of the bovine progesterone receptor (PGR) and its hypothetical variants. The progesterone receptor A isoform (PGR-A) is an NH2-terminally truncated naturally occurring variant of the B isoform. The progesterone receptor C isoform (PGR-C) is also an NH2-terminally truncated transcriptional product, but it is much smaller than PGR-A. Locations of PCR primers used to generate fragments of the different isoforms are indicated (Adapted from (Fang et al., 2002)).

480

N.S. Alfaro et al. / Research in Veterinary Science 92 (2012) 478–485

gov/BLAST) software to confirm gene specificity and to determine nucleotide locations, making sure that they were not designed from any homologous regions coding for other genes. 2.3.2. Other primers The primer sequences for cytochrome P450 aromatase (CYP19a1) and cytochrome P450 17ahydroxylase/17,20-lyase (CYP17a1) were designed following the same rules as for the steroid receptor primers and validated to confirm bovine granulosa and theca cells mRNA purity (no cross-contamination) (Lagaly et al., 2008). In addition, as an internal control of reverse transcription and reaction efficiency, amplification of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was carried out in parallel for each sample using the primers previously described (Shibaya et al., 2007). 2.4. RT-PCR The first strand of cDNA was synthesized in a 20 ll reaction mixture using 1 lg of total RNA. The reaction tubes contained 0.25 ll random hexamers (1 lg/ll), 0.4 ll dNTPs (25 mM), 4 ll 5 reaction buffer, 2 ll DTT (0.1 M), 0.5 ll ribonuclease inhibitor (40 U/ll) and 1 ll M-MLV reverse transcriptase (200 U/ll) (all reactives from Invitrogen). The reactions were incubated at 25 °C for 10 min, 37 °C for 50 min and inactivated for 15 min at 70 °C. For the PCR, each assay was optimized with regard to annealing temperature, and cDNA concentration. Firstly, amplification of the control samples was performed with annealing temperatures between 51 and 69 °C using the gradient feature of the gradient thermal cycler Techne TC-3000G (Techne Inc., NJ, USA). The number of PCR cycles was determined in preliminary experiments by performing 20–35 amplification reactions. The PCR was carried out on a final volume of 25 ll containing 20–30 ng cDNA (previously quantified by the Qubit method), 1.5 mM MgCl2, 0.5 lM forward primer, 0.5 lM reverse primer, 0.2 mM dNTP, 2.5 ll Taq buffer

10X and 2U Taq polymerase (5 U/ll) (all reactants from Invitrogen). The cDNA diluted in 3 ll of each sample was added to the master-mix solution. The amplification conditions included 30– 35 cycles of denaturation at 94 °C for 45 s, annealing at 52– 60.8 °C (Table 1) for 30 s and extension at 72 °C for 1 min 30 s. A single initial denaturation step at 94 °C for 3 min and a final extension step at 72 °C for 10 min were performed. The PCR products were resolved by electrophoresis alongside a 1 kb DNA ladder (BioLogicos, Argentina) through a 2% agarose gel containing GelRed Nucleic Acid Gel Stain (Biotium, CA, USA), and visualized and digitized under UV illumination to confirm the presence of a single band of the correct size. The mRNA levels of the housekeeping gene GAPDH were almost the same in all of the different follicle samples. Only those samples positive for GAPDH mRNA expression were used to investigate the mRNA expression of the other genes. In addition, only the granulosa samples positive for CYP19a1 mRNA and negative for CYP17a1 mRNA and the theca cells samples positive for CYP17a1 mRNA and negative for CYP19a1 mRNA expression were used to detect steroid receptors mRNA expression. 2.5. Nucleotide sequencing The specificity of the PCR products was checked by direct sequencing to verify amplification of the correct sequences, using the Macrogen Sequencing Service (Macrogen, Korea). The resulting sequences were verified using the MegAlign Tool in the LASERGENE software (DNAStar, WI, USA). 2.6. Image analysis The agarose gel images were digitized using an Olympus digital camera and the PCR products were analyzed using the Image ProPlus 3.1 program. The GAPDH mRNA was selected as the internal control because the expression of GAPDH mRNA remained constant in all of the samples studied. In the comparative PCR analysis, the

Table 1 Primer sequences, regions of the target genes and conditions used for semi-quantitative RT-PCR. Name

Sequence (50 –30 )

Gene Accession No.

Primer location

Product length (bp)

Annealing temperature (°C)

Cycles

ESR1 Forward Reverse

AGGGAAGCTCCTATTTGCTCC CGGTGGATGTGGTCCTTCTCT

AY538775

1352–1372 1585–1565

234

64

32

ESR2 Forward Reverse

CTTCGTGGAGCTCAGCCTGT GAGATATTCTTTGTGTTGGAGTTT

NM_174051

972–991 1212–1189

241

54.1

31

AR Forward Reverse

CCTGGTTTTCAATGAGTACCGCATG TTGATTTTTCAGCCCATCCACTGGA

AY862875

420–444 591–567

172

60

32

PGRtotal Forward Reverse

GAGATCTTATAAGCATGTCAGTGG TCATGCAAGTTATCAAGAAGTTTT

XM_583951

2160–2183 2519–2496

360

51.2

32

PGRab Forward Reverse

CCCCGGTGCCCAAAGAAGATG CAGGATGGGCACGTGGATGAAGTC

XM_583951

767–787 897–874

131

63.5

33

PGRb Forward Reverse

TGCGAGACCCCCAGAGAAGGA GCGCCAGCAGGGTGTCCAG

XM_583951

291–311 352–334

62

57.5

32

CYP17a1 Forward Reverse

GGAGGCGACCATCAGAGAAGTGC CAGCCGGGACATGAAGAGGAAGAG

NM_174304

1105–1127 1423–1400

319

60.8

35

CYP19a1 Forward Reverse

TAAAACAAAGCGCCAATCTCTACG GGAACCTGCAGTGGGAAATGA

BTCYP19

8–31 348–328

341

55.4

35

GAPDH Forward Reverse

CACCCTCAAGATTGTCAGCA GGTCATAAGTCCCTCCACGA

BC102589

492–511 594–575

103

52

31

N.S. Alfaro et al. / Research in Veterinary Science 92 (2012) 478–485

absolute optical density (OD) values for each PCR product were obtained by densitometry and were normalized with the GAPDH levels. Relative levels of the specific mRNA were expressed in arbitrary units. 2.7. Hormone assays The follicular health status was confirmed by measuring the hormonal levels in the follicular fluid. Estradiol and progesterone in follicular fluid were measured by ELISA kits (Estradiol EIA, DSL-10-4300; Progesterone EIA, DSL-10-3900; Diagnostic Systems Laboratories, Webster, Texas), according to the manufacturer’s instructions. The assay sensitivity was 7 pg/mL for estradiol and 0.13 ng/mL for progesterone. All follicles were categorized as estrogen-active without luteinization. 2.8. Statistical analyses A statistical software package (SPSS 11.0 for Windows, SPSS Inc., Chicago, IL, USA) was used for performing the statistical tests. Data of semiquantitative PCR products were compared by analyses of variance, followed by Duncan’s multiple range tests. A p < 0.05 value was considered significant. Results are expressed as mean ± SEM.

481

small and medium antral follicles, increasing significantly in the granulosa of large follicles (p < 0.05). The cystic follicles showed a higher ESR1 mRNA expression in theca and granulosa cells in relation to the healthy follicles (p < 0.05). In the granulosa cells of large antral follicles, an increase in ESR2 mRNA expression was observed compared to the other follicular structures, while ESR2 mRNA expression was lower in the theca cells of cystic follicles (p < 0.05). A moderate expression of AR mRNA was detected in the thecal cells of all follicles with a decrease in the cystic follicles in relation to medium healthy follicles. Granulosa cells showed a low expression except in cystic follicles, which showed a strong expression of AR mRNA (p < 0.05). The PGRtotal mRNA expression showed a tendency to decrease as advancing folliculogenesis, although without significant differences between different follicles sizes neither cystic follicles. An increase in the expression of PGRtotal mRNA was found in thecal cells of the cystic follicles (p < 0.05). The expression of PGRab mRNA was moderately detected in the granulosa and theca cells of all structures. The PGRb mRNA levels did not change throughout follicular development in the granulosa and theca cells of control animals, but a very significantly increase was found in the granulosa of cystic follicles (p < 0.01). There were no differences of PGRb mRNA between follicular categories in the theca cells.

3. Results

4. Discussion and conclusions

We compared the expression of steroid receptor mRNA in RTPCR products containing the same amount of GAPDH cDNA. The controls were performed in parallel using water (no cDNA) and RNA samples (without RT) and no PCR products were visible. All granulosa cell samples were positive for CYP19a1 mRNA and negative for CYP17a1 mRNA, whereas the theca cell samples were positive for CYP17a1 mRNA and negative for CYP19a1 mRNA expression. Figs. 2 and 3 show the data obtained in the representative RT-PCR assays for all primers in the ovarian and control tissues. The identity of the PCR products was confirmed by sequencing (range 97–99% homology with bovine sequences). A weak expression of ESR1 mRNA was detected in the granulosa and theca cells of

Alterations in intra-ovarian/intra-follicular amounts of steroid receptors are clearly relevant in determining the fate of individual follicles and changes in steroid receptors have been correlated with follicular health and stage of development (Rosenfeld et al., 2001; Drummond et al., 2002; Walters et al., 2008). In the present study we examined the distribution and amount of steroid receptor mRNA expression in different antral follicles of normal dairy cows and in cystic follicles of COD animals. Findings from this study provide evidence that COD in cattle is concurrent with alterations in the expression of ESR1, ESR2, AR and PGR mRNA in different structures of ovarian follicles. The significance of the changes on cellular types-specific expression pattern of steroid receptors observed is discussed below. A high expression of ESR1 was found in granulosa and theca cells of cystic follicles, concomitantly with a decrease in the expression of ESR2. These results agree with protein expression patterns previously obtained in cattle (Salvetti et al., 2007) and rats (Salvetti et al., 2009). Also, other authors found similar changes in the protein and mRNA expression of ESR isoforms in follicular cysts in women with COD compared with normal size-matched follicles in healthy women (Jakimiuk et al., 2002). We recently found similar results in prenatal testosterone-treated ovine females characterized by follicular persistence (Ortega et al., 2009). Numerous studies have shown that gonadotrophins and estrogen downregulate granulosa expression of the ESR2 isoforms (Byers et al., 1997; Sharma et al., 1999) and that both estrogen receptors show a tendency to upregulate together with increasing estrogen levels in the follicular fluid, which is correlated with an upregulation in the LH and FSH receptors (Berisha et al., 2002). The observation that ESR1 over-expressed mice are subfertile and show downregulation of the ESR2 gene (Tomic et al., 2007) raises the possibility that the decrease in ESR2 observed in cystic follicles may be secondary to ESR1 upregulation. In this sense, studies with ESR1-knockout mice that were anovulatory also indicated that ESR1 is not required for follicular recruitment or early differentiation but that it is necessary for subsequent follicular growth (Dupont et al., 2000), an important component of COD pathogenia in cattle.

Fig. 2. Relative mRNA of steroid receptors in expression granulosa (open bars) and thecal (black bars) cells of small antral follicle (S); medium antral follicle (M); large antral follicle (L) and cystic follicles (C). Values represent mean ± SEM, and the different letters show significant differences (p < 0.05).

482

N.S. Alfaro et al. / Research in Veterinary Science 92 (2012) 478–485

ESR1

2.0

PGRtotal

2.5 b

2.0

1.5 c

1.0

a

a

b

0.5

a

b

1.5

a

1.0

a

a a

0.5

0.0

a

0.0

ESR2

1.5

PGRab

1.5

b

1.0

a

1.0

a

a

a

0.5

a

a

0.5 b

0.0

0.0

AR

2.5 2.0

1.0

1.5 a

a

0.5 0.0

a,b

a,b

S

a

M

b

2.0

b

1.5

PGRb

2.5

b

a

1.0

a a

a

0.5

L

C

S

M

L

C

0.0

S

M

L

C

S

M

L

C

Fig. 3. Gel electrophoresis of specific RT-PCR products, showing the expression of specific primers in granulosa and thecal cells of small antral follicle (S) (n = 15); medium antral follicle (M) (n = 15); large antral follicle (L) (n = 15) and cystic follicles (C) (n = 20).

Although ESR1 and ESR2 bind to endogenous ligands such as 17-b-estradiol with similar affinity and form homo- and hetero-dimers, they display differential transcriptional activities in a celland promoter context-dependent manner (McInerney et al., 1998); (Pettersson et al., 2000). Thus, differential production of ESR1 and/or ESR2 will likely provide a cellular microenvironment that regulates estrogen-responsiveness of target genes in a celldependent manner (O’Brien et al., 1999). Earlier studies have found that ESR2, when present within a heterodimer, repressed ESR1 activity and sensitivity to 17-b-estradiol (Hall and McDonnell, 1999). More recent studies suggest that the main determinants of the transcriptional activity of ESR1 and ESR2 are not their binding ability but rather the individual concentration of the two receptors in target cells and the structure of the estrogen ligand (Gougelet et al., 2007; Bhavnani et al., 2008). As such, a given ligand could exert opposite activities depending on the type of ESR expressed. Therefore, little changes in the ESR subtypes ratio may perturb the normal follicular development (Mosselman et al., 1996; Pettersson et al., 1997), including alteration in the balance of proliferation/apoptosis, in the expression of gonadotropins receptors, disturbance of enzyme action and metabolism, all them signs of COD (Calder et al., 2001; Isobe and Yoshimura, 2007). In bovine follicles have been shown that AR mRNA is expressed and suggest that AR mRNA increases during early follicle development (Hampton et al., 2004). In this work, we found a significant increase in AR mRNA expression in the granulosa cells of cystic follicles, consistent with androgens playing a role in fol-

licular differentiation and growth (Hillier and Tetsuka, 1997; Vendola et al., 1998; Walters et al., 2008). Also, the altered equilibrium of ESR1 to ESR2 coupled with the increased AR mRNA expression in cystic follicles might be contributing factors in the development of follicular persistence (Ortega et al., 2008). In addition, androgen activation of AR may enhance FSH-linked cAMP signaling and thereby modulate granulosa cell differentiation (Hillier, 2001). The increased AR mRNA expression is also consistent with reduced ESR2 expression. Earlier studies found that AR expression in the granulosa of late antral follicles is repressed by the activation of ESR2 (Cheng et al., 2002). The repression of AR changes the follicular environment from androgen to estrogen dominance, a critical step for survival of the follicle (Billig et al., 1993; Hillier and Tetsuka, 1997; Britt and Findlay, 2002; Drummond, 2006; Yang and Fortune, 2006). If AR expression remains high, as in cystic follicles, the antral follicles cannot achieve estrogen dominance and their fate is atresia or arrest (persistence). In this context, it is of interest that the granulosa cells of antral follicles derived after gonadotropin stimulation in women with PCOS exhibit increased AR expression compared to controls (Catteau-Jonard et al., 2008). Previous studies demonstrated a cell-specific expression of PGR in the bovine ovary (Van den Broeck et al., 2002; Jo et al., 2002), and that PGR protein expression remained without changes in the cystic ovaries (Salvetti et al., 2007). In this work, the total PGR mRNA expression was predominantly in granulosa cells, and cystic follicles showed a higher expression in the the-

N.S. Alfaro et al. / Research in Veterinary Science 92 (2012) 478–485

cal cells compared with healthy follicles. These differences may be due to the specificity of the antibody used in previous immunohistochemistry studies which did not detect all of the isoforms. Multiple PGR isoforms may partly explain the enormous complexity of the intracellular processes involved in progesterone activation of a target cell. The 116 kDa B-receptor (PGRb) and the 94 kDa A-receptor (PGRa) can have very different transcriptional functions that are cell specific and promoter specific. Specifically, PGRb has been shown to function as a strong activator of transcription of several PR-dependent promoters and in a variety of cell types in which PGRa is inactive (Mulac-Jericevic and Conneely, 2004). Also, PGRc, a smaller N-terminally truncated 60 kDa protein, has unique transcriptional potentiating properties (Wei et al., 1997). In addition, the co-expression of PGRa or PGRc in the same type of cell as PGRb modulates its activity (Vegeto et al., 1993; Wei et al., 1997). Although we cannot distinguish between the mRNAs of PGRa and PGRc separately, it is noticeable that PGRb significantly increases in the granulosa of cystic follicles. The PGRb and PGRa isoforms have similar ligand-binding affinities and similar DNAbinding affinities (Fang et al., 2002). However, it is clear that the different isoforms have different functions. While selective ablation of PGRb does not affect ovarian function, the finding that double PGR (PGRa and PGRb) knockout mice fail to ovulate (Lydon et al., 1995) provides evidence showing that other PGR isoforms might be involved. Animals with COD usually present high levels of circulating estrogen and LH (Vanholder et al., 2006), and this could cause alterations in PGR expression. The fact that the expression patron seen in the normal ovary become disrupted in ovarian pathologies, and the predominance of one PGR isoform is seen in ovarian disease (Graham and Clarke, 2002) suggests that changes in the ratio of PGR isoform expression could regulate the biological activity of progesterone and result in functional hormone withdrawal in the absence of changes in serum concentrations or total progesterone-binding activities of the reproductive tissues (Schams et al., 2003; Amrozi et al., 2004; Goldman et al., 2005). In summary, ovaries from animals with COD exhibited an altered steroid receptor expression compared with ovaries from control animals. While the findings of the current experiment provide evidence that an altered steroid signaling system may be present in the bovine cystic follicles, additional studies are necessary to understand the potential associations with other follicular regulators, such as coregulator proteins. In this sense, steroid hormone receptors are regulated by proteins leading to activation or repression and subsequent expression or silencing of target genes. These coregulators can be broadly subdivided into coactivators and corepressors (Gurevich et al., 2007) and they are interposed between the receptor and the basal transcriptional complex. This tripartite action of steroid hormone receptors, involving the receptor, its ligands and coregulator proteins, allows for the precise regulation of the biological effects of these hormones on gene expression (Delage-Mourroux et al., 2000). Therefore, changes in the expression level and pattern of steroid receptor coactivators or corepressors, or mutations of their functional domains can affect the transcriptional activity of the steroid hormones and hence cause disorders of their target tissues, including the ovary (Gao et al., 2002). In conclusion, taking into account the importance of the expression of hormonal receptors in the function of the reproductive system and in the regulation of many aspects of ovarian function, it could be postulated that small changes in their expression produce important alterations in follicular dynamics. Therefore, it is reasonable to suggest that in conditions characterized by altered ovulation, such as COD, changes in the expression of ovarian steroid receptors could play a fundamental role in the pathogeny of this disease.

483

Conflict of interest The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work. Acknowledgments This study was supported by a grant from the Argentine National Agency for the Promotion of Science and Technology (ANPCyT) (PICT 2005-38101 & 2007-01193). References Amrozi, Kamimura, S., Ando, T., Hamana, K., 2004. Distribution of estrogen receptor alpha in the dominant follicles and corpus luteum at the three stages of estrous cycle in Japanese black cows. Journal of Veterinary Medical Science 66, 1183– 1188. Beato, M., Klug, J., 2000. Steroid hormone receptors: an update. Hum Reproduction Update 6, 225–236. Berisha, B., Pfaffl, M.W., Schams, D., 2002. Expression of estrogen and progesterone receptors in the bovine ovary during estrous cycle and pregnancy. Endocrine 17, 207–214. Bhavnani, B.R., Tam, S.P., Lu, X., 2008. Structure activity relationships and differential interactions and functional activity of various equine estrogens mediated via estrogen receptors (ERs) ERalpha and ERbeta. Endocrinology 149, 4857–4870. Billig, H., Furuta, I., Hsueh, A.J., 1993. Estrogens inhibit and androgens enhance ovarian granulosa cell apoptosis. Endocrinology 133, 2204–2212. Bramley, T.A., Menzies, G.S., Rae, M.T., Scobie, G., 2002. Non-genomic steroid receptors in the bovine ovary. Domestic Animal Endocrinology 23, 3–12. Brinkmann, A.O., 2001. Lessons to be learned from the androgen receptor. European Journal of Dermatology 11, 301–303. Britt, K.L., Findlay, J.K., 2002. Estrogen actions in the ovary revisited. Journal of Endocrinology 175, 269–276. Britt, K.L., Stanton, P.G., Misso, M., Simpson, E.R., Findlay, J.K., 2004. The effects of estrogen on the expression of genes underlying the differentiation of somatic cells in the murine gonad. Endocrinology 145, 3950–3960. Brosens, J.J., Tullet, J., Varshochi, R., Lam, E.W., 2004. Steroid receptor action. Best Practice & Research. Clinical Obstetrics & Gynaecology 18, 265–283. Byers, M., Kuiper, G.G., Gustafsson, J.A., Park-Sarge, O.K., 1997. Estrogen receptorbeta mRNA expression in rat ovary: down-regulation by gonadotropins. Molecular Endocrinology 11, 172–182. Calder, M.D., Manikkam, M., Salfen, B.E., Youngquist, R.S., Lubahn, D.B., Lamberson, W.R., Garverick, H.A., 2001. Dominant bovine ovarian follicular cysts express increased levels of messenger RNAs for luteinizing hormone receptor and 3 beta-hydroxysteroid dehydrogenase delta(4), delta(5) isomerase compared to normal dominant follicles. Biology of Reproduction 65, 471–476. Cassar, C.A., Dow, M.P., Pursley, J.R., Smith, G.W., 2002. Effect of the preovulatory LH surge on bovine follicular progesterone receptor mRNA expression. Domestic Animal Endocrinology 22, 179–187. Catteau-Jonard, S., Jamin, S.P., Leclerc, A., Gonzales, J., Dewailly, D., di, C.N., 2008. Anti-Mullerian hormone, its receptor, FSH receptor, and androgen receptor genes are overexpressed by granulosa cells from stimulated follicles in women with polycystic ovary syndrome. Journal of Clinical Endocrinology and Metabolism 93, 4456–4461. Cheng, G., Weihua, Z., Makinen, S., Makela, S., Saji, S., Warner, M., Gustafsson, J.A., Hovatta, O., 2002. A role for the androgen receptor in follicular atresia of estrogen receptor beta knockout mouse ovary. Biology of Reproduction 66, 77– 84. D’haeseleer, M., Van, P.M., Van den Broeck, W., 2005. Cell-specific localization of oestrogen receptor beta (ESR2) mRNA within various bovine ovarian cell types using in situ hybridization. Anatomia Histologia and Embryologia 34, 265–272. Delage-Mourroux, R., Martini, P.G., Choi, I., Kraichely, D.M., Hoeksema, J., Katzenellenbogen, B.S., 2000. Analysis of estrogen receptor interaction with a repressor of estrogen receptor activity (REA) and the regulation of estrogen receptor transcriptional activity by REA. Journal of Biological Chemistry 275, 35848–35856. Drummond, A.E., 2006. The role of steroids in follicular growth. Reproductive Biology and Endocrinology 4, 16. Drummond, A.E., Baillie, A.J., Findlay, J.K., 1999. Ovarian estrogen receptor alpha and beta mRNA expression: impact of development and estrogen. Molecular and Cellular Endocrinology 149, 153–161. Drummond, A.E., Britt, K.L., Dyson, M., Jones, M.E., Kerr, J.B., O’Donnell, L., Simpson, E.R., Findlay, J.K., 2002. Ovarian steroid receptors and their role in ovarian function. Molecular and Cellular Endocrinology 191, 27–33. Dupont, S., Krust, A., Gansmuller, A., Dierich, A., Chambon, P., Mark, M., 2000. Effect of single and compound knockouts of estrogen receptors alpha (ERalpha) and beta (ERbeta) on mouse reproductive phenotypes. Development 127, 4277– 4291. Fang, X., Wong, S., Mitchell, B.F., 2002. Messenger RNA for progesterone receptor isoforms in the late-gestation rat uterus. American Journal of Physiology. Endocrinology and Metabolism 283, E1167–E1172.

484

N.S. Alfaro et al. / Research in Veterinary Science 92 (2012) 478–485

Gao, X., Loggie, B.W., Nawaz, Z., 2002. The roles of sex steroid receptor coregulators in cancer. Molecular Cancer 1, 7. Garverick, H.A., 1997. Ovarian follicular cysts in dairy cows. Journal of Dairy Science 80, 995–1004. Goldman, S., Weiss, A., Almalah, I., Shalev, E., 2005. Progesterone receptor expression in human decidua and fetal membranes before and after contractions: possible mechanism for functional progesterone withdrawal. Molecular Human Reproduction 11, 269–277. Gougelet, A., Mueller, S.O., Korach, K.S., Renoir, J.M., 2007. Oestrogen receptors pathways to oestrogen responsive elements: the transactivation function-1 acts as the keystone of oestrogen receptor (ER)beta-mediated transcriptional repression of ERalpha. Journal of Steroid Biochemistry and Molecular Biology 104, 110–122. Graham, J.D., Clarke, C.L., 2002. Expression and transcriptional activity of progesterone receptor A and progesterone receptor B in mammalian cells. Breast Cancer Research 4, 187–190. Gurevich, I., Flores, A.M., Aneskievich, B.J., 2007. Corepressors of agonist-bound nuclear receptors. Toxicology and Applied Pharmacology 223, 288–298. Hall, J.M., McDonnell, D.P., 1999. The estrogen receptor beta-isoform (ERbeta) of the human estrogen receptor modulates ERalpha transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140, 5566–5578. Hampton, J.H., Manikkam, M., Lubahn, D.B., Smith, M.F., Garverick, H.A., 2004. Androgen receptor mRNA expression in the bovine ovary. Domestic Animal Endocrinology 27, 81–88. Hillier, S.G., 2001. Gonadotropic control of ovarian follicular growth and development. Molecular and Cellular Endocrinology 179, 39–46. Hillier, S.G., Tetsuka, M., 1997. Role of androgens in follicle maturation and atresia. Baillieres Clinical Obstetrics and Gynaecology 11, 249–260. Isobe, N., Yoshimura, Y., 2007. Deficient proliferation and apoptosis in the granulosa and theca interna cells of the bovine cystic follicle. Journal of Reproduction and Development 53, 1119–1124. Jakimiuk, A.J., Weitsman, S.R., Yen, H.W., Bogusiewicz, M., Magoffin, D.A., 2002. Estrogen receptor alpha and beta expression in theca and granulosa cells from women with polycystic ovary syndrome. Journal of Clinical Endocrinology and Metabolism 87, 5532–5538. Jo, M., Komar, C.M., Fortune, J.E., 2002. Gonadotropin surge induces two separate increases in messenger RNA for progesterone receptor in bovine preovulatory follicles. Biology of Reproduction 67, 1981–1988. Jonard, S., Dewailly, D., 2004. The follicular excess in polycystic ovaries, due to intraovarian hyperandrogenism, may be the main culprit for the follicular arrest. Human Reproduction Update 10, 107–117. Kimura, S., Matsumoto, T., Matsuyama, R., Shiina, H., Sato, T., Takeyama, K., Kato, S., 2007. Androgen receptor function in folliculogenesis and its clinical implication in premature ovarian failure. Trends in Endocrinology and Metabolism 18, 183– 189. Koering, M.J., Danforth, D.R., Hodgen, G.D., 1994. Early follicle growth in the juvenile macaca monkey ovary: the effects of estrogen priming and follicle-stimulating hormone. Biology of Reproduction 50, 686–694. Kuiper, G.G., Enmark, E., Pelto-Huikko, M., Nilsson, S., Gustafsson, J.A., 1996. Cloning of a novel receptor expressed in rat prostate and ovary. Proceedings of the National Academy of Sciences of the United States of America 93, 5925–5930. Lagaly, D.V., Aad, P.Y., Grado-Ahuir, J.A., Hulsey, L.B., Spicer, L.J., 2008. Role of adiponectin in regulating ovarian theca and granulosa cell function. Molecular and Cellular Endocrinology 284, 38–45. Lydon, J.P., DeMayo, F.J., Conneely, O.M., O’Malley, B.W., 1996. Reproductive phenotpes of the progesterone receptor null mutant mouse. Journal of Steroid Biochemistry and Molecular Biology 56, 67–77. Lydon, J.P., DeMayo, F.J., Funk, C.R., Mani, S.K., Hughes, A.R., Montgomery Jr., C.A., Shyamala, G., Conneely, O.M., O’Malley, B.W., 1995. Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes and Development 9, 2266–2278. Manikkam, M., Bao, B., Rosenfeld, C.S., Yuan, X., Salfen, B.E., Calder, M.D., Youngquist, R.S., Keisler, D.H., Lubahn, D.B., Garverick, H.A., 2001. Expression of the bovine oestrogen receptor-beta (bERbeta) messenger ribonucleic acid (mRNA) during the first ovarian follicular wave and lack of change in the expression of bERbeta mRNA of second wave follicles after LH infusion into cows. Animal Reproduction Science 67, 159–169. McInerney, E.M., Weis, K.E., Sun, J., Mosselman, S., Katzenellenbogen, B.S., 1998. Transcription activation by the human estrogen receptor subtype beta (ER beta) studied with ER beta and ER alpha receptor chimeras. Endocrinology 139, 4513– 4522. Mosselman, S., Polman, J., Dijkema, R., 1996. ER beta: identification and characterization of a novel human estrogen receptor. FEBS Letters 392, 49–53. Mowa, C.N., Iwanaga, T., 2000. Differential distribution of oestrogen receptor-alpha and -beta mRNAs in the female reproductive organ of rats as revealed by in situ hybridization. Journal of Endocrinology 165, 59–66. Mulac-Jericevic, B., Conneely, O.M., 2004. Reproductive tissue selective actions of progesterone receptors. Reproduction 128, 139–146. O’Brien, M.L., Park, K., In, Y., Park-Sarge, O.K., 1999. Characterization of estrogen receptor-beta (ERbeta) messenger ribonucleic acid and protein expression in rat granulosa cells. Endocrinology 140, 4530–4541. Ortega, H.H., Palomar, M.M., Acosta, J.C., Salvetti, N.R., Dallard, B.E., Lorente, J.A., Barbeito, C.G., Gimeno, E.J., 2008. Insulin-like growth factor I in sera, ovarian follicles and follicular fluid of cows with spontaneous or induced cystic ovarian disease. Research in Veterinary Science 84, 419–427.

Ortega, H.H., Salvetti, N.R., Amable, P., Dallard, B.E., Baravalle, C., Barbeito, C.G., Gimeno, E.J., 2007. Intraovarian localization of growth factors in induced cystic ovaries in rats. Anatomia Histologia and Embryologia 36, 94–102. Ortega, H.H., Salvetti, N.R., Padmanabhan, V., 2009. Developmental programming: prenatal androgen excess disrupts ovarian steroid receptor balance. Reproduction 137, 865–877. Parrott, J.A., Skinner, M.K., 1998. Thecal cell-granulosa cell interactions involve a positive feedback loop among keratinocyte growth factor, hepatocyte growth factor, and Kit ligand during ovarian follicular development. Endocrinology 139, 2240–2245. Pettersson, K., Delaunay, F., Gustafsson, J.A., 2000. Estrogen receptor beta acts as a dominant regulator of estrogen signaling. Oncogene 19, 4970–4978. Pettersson, K., Grandien, K., Kuiper, G.G., Gustafsson, J.A., 1997. Mouse estrogen receptor beta forms estrogen response element-binding heterodimers with estrogen receptor alpha. Molecular Endocrinology 11, 1486–1496. Pfaffl, M.W., Lange, I.G., Meyer, H.H., 2003. The gastrointestinal tract as target of steroid hormone action: quantification of steroid receptor mRNA expression (AR, ERalpha, ERbeta and PR) in 10 bovine gastrointestinal tract compartments by kinetic RT-PCR. Journal of Steroid Biochemistry and Molecular Biology 84, 159–166. Rey, F., Rodriguez, F.M., Salvetti, N.R., Palomar, M.M., Barbeito, C.G., Alfaro, N.S., Ortega, H.H., 2009. Insulin-like growth factor-II and insulin-like growth factorbinding proteins in bovine cystic ovarian disease. Journal of Comparative Pathology. Rosenfeld, C.S., Wagner, J.S., Roberts, R.M., Lubahn, D.B., 2001. Intraovarian actions of oestrogen. Reproduction 122, 215–226. Salvetti, N.R., Acosta, J.C., Gimeno, E.J., Muller, L.A., Mazzini, R.A., Taboada, A.F., Ortega, H.H., 2007. Estrogen receptors alpha and beta and progesterone receptors in normal bovine ovarian follicles and cystic ovarian disease. Veterinary Pathology 44, 373–378. Salvetti, N.R., Baravalle, C., Mira, G.A., Gimeno, E.J., Dallard, B.E., Rey, F., Ortega, H.H., 2009. Heat shock protein 70 and sex steroid receptors in the follicular structures of induced ovarian cysts. Reproduction in Domestic Animals 44, 805–814. Schams, D., Berisha, B., 2002. Steroids as local regulators of ovarian activity in domestic animals. Domestic Animal Endocrinology 23, 53–65. Schams, D., Kohlenberg, S., Amselgruber, W., Berisha, B., Pfaffl, M.W., Sinowatz, F., 2003. Expression and localisation of oestrogen and progesterone receptors in the bovine mammary gland during development, function and involution. Journal of Endocrinology 177, 305–317. Sharma, S.C., Clemens, J.W., Pisarska, M.D., Richards, J.S., 1999. Expression and function of estrogen receptor subtypes in granulosa cells: regulation by estradiol and forskolin. Endocrinology 140, 4320–4334. Shibaya, M., Matsuda, A., Hojo, T., Acosta, T.J., Okuda, K., 2007. Expressions of estrogen receptors in the bovine corpus luteum: cyclic changes and effects of prostaglandin F2alpha and cytokines. Journal of Reproduction and Development 53, 1059–1068. Shushan, A., Peretz, T., Uziely, B., Lewin, A., Mor-Yosef, S., 1996. Ovarian cysts in premenopausal and postmenopausal tamoxifen-treated women with breast cancer. American Journal of Obstetrics and Gynecology 174, 141–144. Silvia, W.J., Alter, T.B., Nugent, A.M., Naranja da Fonseca, L.F., 2002. Ovarian follicular cysts in dairy cows: an abnormality in folliculogenesis. Domestic Animal Endocrinology 23, 167–177. Sudo, N., Shimizu, T., Kawashima, C., Kaneko, E., Tetsuka, M., Miyamoto, A., 2007. Insulin-like growth factor-I (IGF-I) system during follicle development in the bovine ovary: relationship among IGF-I, type 1 IGF receptor (IGFR-1) and pregnancy-associated plasma protein-A (PAPP-A). Molecular and Cellular Endocrinology 264, 197–203. Takeo, J., Yamashita, S., 1999. Two distinct isoforms of cDNA encoding rainbow trout androgen receptors. Journal of Biological Chemistry 274, 5674–5680. Tomic, D., Frech, M.S., Babus, J.K., Symonds, D., Furth, P.A., Koos, R.D., Flaws, J.A., 2007. Effects of ERalpha overexpression on female reproduction in mice. Reproductive Toxicology 23, 317–325. Van den Broeck, W., Coryn, M., Simoens, P., Lauwers, H., 2002. Cell-specific distribution of oestrogen receptor-alpha in the bovine ovary. Reproduction in Domestic Animals 37, 291–293. Vanholder, T., Opsomer, G., de, K.A., 2006. Aetiology and pathogenesis of cystic ovarian follicles in dairy cattle: a review. Reproduction, Nutrition, Development 46, 105–119. Vegeto, E., Shahbaz, M.M., Wen, D.X., Goldman, M.E., O’Malley, B.W., McDonnell, D.P., 1993. Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Molecular Endocrinology 7, 1244–1255. Velazquez, M.M., Alfaro, N.S., Dupuy, C.R., Salvetti, N.R., Rey, F., Ortega, H.H., 2010. Heat shock protein patterns in the bovine ovary and relation with cystic ovarian disease. Animal Reproduction Science 118, 201–209. Vendola, K.A., Zhou, J., Adesanya, O.O., Weil, S.J., Bondy, C.A., 1998. Androgens stimulate early stages of follicular growth in the primate ovary. Journal of Clinical Investigation 101, 2622–2629. Walters, K.A., Allan, C.M., Handelsman, D.J., 2008. Androgen actions and the ovary. Biology of Reproduction 78, 380–389. Wang, H., Eriksson, H., Sahlin, L., 2000. Estrogen receptors alpha and beta in the female reproductive tract of the rat during the estrous cycle. Biology of Reproduction 63, 1331–1340. Wei, L.L., Gonzalez-Aller, C., Wood, W.M., Miller, L.A., Horwitz, K.B., 1990. 5’Heterogeneity in human progesterone receptor transcripts predicts a new

N.S. Alfaro et al. / Research in Veterinary Science 92 (2012) 478–485 amino-terminal truncated ‘‘C’’-receptor and unique A-receptor messages. Molecular Endocrinology 4, 1833–1840. Wei, L.L., Norris, B.M., Baker, C.J., 1997. An N-terminally truncated third progesterone receptor protein, PR(C), forms heterodimers with PR(B) but interferes in PR(B)-DNA binding. Journal of Steroid Biochemistry and Molecular Biology 62, 287–297. Yang, M.Y., Fortune, J.E., 2006. Testosterone stimulates the primary to secondary follicle transition in bovine follicles in vitro. Biology of Reproduction 75, 924– 932.

485

Yeh, S., Tsai, M.Y., Xu, Q., Mu, X.M., Lardy, H., Huang, K.E., Lin, H., Yeh, S.D., Altuwaijri, S., Zhou, X., Xing, L., Boyce, B.F., Hung, M.C., Zhang, S., Gan, L., Chang, C., 2002. Generation and characterization of androgen receptor knockout (ARKO) mice. an in vivo model for the study of androgen functions in selective tissues. Proceedings of the National Academy of Sciences of the United States of America 99, 13498–13503. Yong, E.L., Lim, J., Qi, W., Ong, V., Mifsud, A., 2000. Molecular basis of androgen receptor diseases. Annals of Medicine 32, 15–22.