Stimulation by interleukin-1 of interleukin-6 production by human periodontal ligament cells

0003-9969 92 SS.OO+O.OO Copyright D 1992 Pergamon Press Ltd

.achsoral Bid. Vol.37,No.9. pp.743-748, 1992 Printed m Great Britain. All rights reserved

OF INTERLEUKIN-6 STIMULATION BY INTERLEUKIN-1 PRODUCTION BY HUMAN PERIODONTAL LIGAMENT CELLS N. SHIMIZU,’ N. OGLJRA,’ M. YAMAGUCHI,’ T. GOSEKI,’ Y. SHIBATA,’Y. ABIKO,’ T. IWASAWA’ and H. TAKIGUCHI’ Departments of ‘Orthodontics, ?Oral Surgery and ‘Biochemistry, Nihon University School of Dentistry at Matsudo, Matsudo, Chiba, Japan (Accepted

26 March

1992)

Summary-Interleukin-l(IL-I), a cytokine present in the gingiva and crevicular fluid of patients with periodontitis and in the periodontal ligament (PDL) of experimentally moved teeth, has multiple biological activities, including the ability to elicit bone resorption. Interleukin-6, also found in the gingiva of patients Gth periodontitis, may induce osteoclastic bone resorption through an effect on osteoclastogenesis. Here IL-6 production and its gene expression in response to recombinant IL-I/l were examined in primary cultures of PDL cells. IL-l/I stimulated IL-6 production by these cells in a dose- and time-dependent manner; this increase in IL-6 production was much higher than that in human gingival fibroblasts. In situ hybridization, using a synthetic oligonucleotide DNA probe of the IL-6 gene, revealed that most PDL cells expressed IL-6 mRNA in response to IL-I/J treatment. The finding that IL-6 is produced by PDL cells and is regulated by IL-I/l has revealed a potentially important mechanism for controlling alveolar bone resorption. Key words: periodontal ligament, cell culture, interleukin-6, interleukin-Ifi, in situ hybridization.

INTRODUCTION IL-6, a multifunctional cytokine that has previously been called B-cell stimulatory factor 2, hepatocyte stimulating factor, or interferon-b,, is produced by lymphoid and non-lymphoid cells (Hirano and Kishimoto, 1990). It can apparently induce osteoclastic bone resorption through an effect on osteoclastogenesis (Liiwik er al., 1989; Ishimi et al., 1990; Kurihara et al., 1990). IL-6 is produced by the human foreskin fibroblast line FS-4, and its synthesis is stimulated by treatment with IL-1 (May et al., 1988; Bartold and Haynes, 1991), which is considered to be a powerful inducer of IL-6 production (Van Damme et al., 1987). Hijnig et al. (1989) have reported that human gingival tissues from patients with periodontitis contain a high level of IL-lb, whereas IL-lb could not be detected in normal gingival tissues. Furthermore, an increase in the level of an IL-l-like molecule in the periodontal ligament occurs in response to mechanical stress (Meikle et al., 1989), and IL-l/I has been demonstrated in the ligament during orthodontic therapy (Davidovitch et al., 1988). IL-I/I is a key mediator of various immunological and inflammatory phenomena (Dinarello, 1984); moreover, it is one of the most important factors known to stimulate bone resorption (Gowen et al., 1983; Heath et al., 1985). Thus, it is likely that both IL-I and IL-6 have a similar role in regulating osteoclastic bone resorption. However, the production of IL-6 in periodontal tissues is not AbbreriaGons:

ANOVA, analysis of variance; FCS, fetal calf serum; IL, interleukin; MEM, minimal Eagle’s (essential) medium; PBS, phosphate-buffered saline; SSC, saline-sodium citrate.

well characterized. The periodontal ligament, which functions as an anchorage for the tooth in the jaw, lies between two mineralized tissues, alveolar bone and cementum. Therefore, cytokines such as IL-6 produced in the ligament may directly affect alveolar bone metabolism in periodontal disease and orthodontic tooth movement. We have now examined whether human gingival and periodontal ligament fibroblasts have the capacity to synthesize and secrete IL-6 in response to IL-Ip. The expression of IL-6 mRNA was also investigated by in situ hybridization with a synthetic oligonucleotide probe to determine the heterogeneity of periodontal ligament cells in IL-6 production. MATERIALS AND METHODS Cell culture

Fibroblasts from periodontal ligament were prepared according to the method of Somerman et al. (1988). A premolar extracted from a healthy young male patient in the course of orthodontic treatment was washed twice with PBS in a Vortex mixer to remove blood, and then tissue attached to the midthird of the root was removed with a surgical scalpel. The coronal and apical portions of the root were not used so that contamination by cells of the gingiva, nerves and blood vessels would be avoided. The tissue was minced, placed in 35 mm tissue-culture dishes, and then covered with a sterilized glass coverslip. The medium used was a-MEM (G&co, Grand Island, NY, U.S.A.) supplemented with 100 pg/ml penicillin G (Sigma Chemical Co., St Louis, MO, U.S.A.), 50 pg/ml gentamicin sulphate (Sigma), 0.3 pg/ml

744

N. SHIMIX er al.

amphotericin B (Flow Laboratories, McLean, VA, U.S.A.), and 15% FCS/(Cell Culture Laboratories, Cleveland, OH, U.S.A.), and the cultures were kept at 37’C in a humidified incubator in 95% air and 5% CO:. When the cells that grew out from the explants had reached confluence, they were detached with 0.05% trypsin (580 BAEE U/mg, Gibco) in PBS for IOmin and subcultured in culture flasks. Some cells still attached to the bottom of the flask were discarded to avoid contamination by epithelial cells, which are less easily detached than fibroblasts (Ragnarsson et al., 1985). Cells observed at confluence by phase-contrast microscopy had formed none of the small mats typical of epithelial cells. Gin-l, a normal human gingival fibroblast cell line, was purchased from the American Type Culture Collection (Rockville, MD, U.S.A.). Both the ligament cells (four passages) and the Gin-l cells (nine passages) were plated in 24-well plates (Corning, NY. U.S.A.) at 1 x 101cells/well and cultured for 3 days until confluent. Then the medium was replaced with the same medium as described above. except that it contained 2% FCS instead of 15%. The cells were cultured for a further 24 h and then used for experiments. Itntmmoassa~ of IL - 6

The recombinant human IL-ID preparation purchased from Cistron (Pine Brook, NJ. U.S.A.) was pure and free of contamination by endotoxin. The specific activity of IL-lb was IO U,ng. IL-lb (0. I-2.0 U/ml equivalent to IO-200 pg/ml) \vas added to each culture well and the IL-6 content in the culture medium was measured at various times thereafter. As a control, medium from non-treated cells corresponding to each treatment time was measured also. The concentration of IL-6 was determined with a two-step sandwich immunoassay kit, using antihuman IL-6 monoclonal antibody that was a gift from Dr N. Ida (Toray Industries, Inc., Japan). The following procedures were done at room temperature (23’C). Samples were incubated in anti-human IL-6 monoclonal antibody-coated 96-microtitre tvells for 2 h. After washing, biotin-conjugated anti-human IL-6 monoclonal antibody was added and incubation continued for 2 h. This step was followed by a 30-min incubation with horseradish peroxidase-conjugated avidin. Peroxidase activity was developed with ophenylenediamine and the optical density of each well was measured at a wavelength of 492 nm. IL-6 cDNA probe and in situ hybridization The human IL-6 gene has been cloned and the nucleotide sequence determined by Hirano et al. (1986). From the sequence data, a 30-base sequence that started approximately two-thirds of the distance from the 5’ end was selected to prepare an antisense oligonucleotide probe. The single-stranded probe (5’CTCACTACTCTCAAATCTGTTCTGGAG GTA-3’) was synthesized by a DNA synthesizer (Applied Biosystems model 38lA, CA, U.S.A.). The oligonucleotide probe sequence was selected by the following guidelines. (1) The base composition was 40-60% GC content to avoid non-specific hybridization. (2) Intra-probe complementary regions that form ‘hairpin’ structures were not present. (3)

Sequences containing long stretches (more than four) of single base were avoided. (4) It was ensured that the sequence had low homology compared with other gene sequences by use of computerized sequence analysis from the data of Gen Bank (IntelliGenetics Inc., CA, U.S.A.) R 66.0, Dec. 1990 and EMBL (European Molecular Biology Laboratory, Heidelberg, Germany) 25.0, Nov. 1990 (Keller and Manak, 1989). The probe was tail-labelled with digoxigenintriphosphate II- deoxyguridine (Boehringer Mannheim Biochemicals, Indianapolis, IN, U.S.A.) using terminal transferase. The method of tail-labelling and procedures for in situ hybridization, using the Genius Nonradioactive DNA Labeling and Detection Kit (Boehringer). have been described previously (Samoszuk and Nansen, 1990). In brief, periodontal ligament cells (average number 8.2 x 10J/chamber) treated with IL-ID for 3 h in Lab-Tek chamber slides (Nunc Inc., Napervill, IL, U.S.A.) were fixed with 4% paraformaldehyde in PBS for IOmin at 4’C and incubated with 2xSSC (20 x SSC: 3M NaCl. 0.3M sodium citrate) followed by a l-h incubation in prehybridization solution. For the hybridization step, 100~1 of labelled probe at a concentration of 5 ng,‘jlI were applied to each slide. \vhich was then covered with a siliconized coverslip and incubated overnight in a humidified chamber at 37’C. After sequential Lvashing with SSC (2 x for 1 h; 1 x for 1 h; 0.5 x for 30 min two times), the slides were blocked with 2% normal sheep serum (Sigma) and then incubated for 2 h with a I:500 dilution of polyclonal sheep anti-digoxigenin as the Fab fragment conjugated to alkaline phosphatase. The washed slides were then developed by incubation for 45 min at room temperature in a solution of nitroblue tetrazolium salt (75 mg/ml)/j-bromo-4-chloro-3indolyl phosphate (50 mg/ml) in dimethylformamide (Boehringer) in the presence of 2.4mg levamisole (Sigma)/10 ml solution to block endogenous alkaline phosphatase activity. The colour reaction was stopped with tris-EDTA, The slides were then ivashed in distilled water, air dried. and a coverslip placed over the cells uith Moviol 4-88 (Canadian Hoechst, Willowdale, Ontario) before microscopic examination. We carried out two kinds of negative controls for in situ hybridization: first, periodontal ligament cells treated with IL-lb were digested with lOO/lg/ml of RNase A (50 U/mg, Boehringer) for 30 min at room temperature (23°C) before hybridization; second, ligament cells were hybridized with labelled DNA probe (5 ng/kiI) in the presence of a 100 times excess concentration (500 ng//cl) of unlabelled DNA probe. Statistical analysis

Values were calculated as the mean + SD. Data lvere subjected to two-way or one-way ANOVA as indicated in the results. All comparisons were also made with reference to control values using one-way ANOVA. REStiLTS

Production of IL-6

Production of IL-6 by human periodontal ligament and Gin-l cells in response to 0.5 U/ml IL-l/l for 5 h

74s

Interleukin-6 production in periodontal cells

*o T

2.0 r

2.0

**

. IL-10 (+) o IL-1p (-)

I

C

***

2 = (D

1.0

*

-1

,_:.

P

0

0

1

3

5

7

Incubation time (hr) Gin-l

PDL

Fig. I. IL-6 production by human periodontal ligament (PDL) and gingival (Gin-l) cells in response to a 5 h treatment with IL-lb (0.5 U/ml). The values are mean + SD for three cultures. Significance is shown as follows when each data set was compared by one-way ANOVA. *, unstimulated PDL versus unstimulated Gin-l cells (p -z 0.05); *, unstimulated PDL versus stimulated PDL cells (p -c 0.01); 0, stimulated PDL versus stimulated Gin-l cells (p i 0.01).

shown in Text Fig. 1. By two-way ANOVA it was found that IL-6 was produced at significantly higher levels (p < 0.001) by ligament than by Gin-l cells, and that IL-l/l also significantly (p < 0.001) stimulated IL-6 production by both cell types. A comparison of each data set showed that IL-l/l significantly (p < 0.01) stimulated IL-6 production by periodontal ligament ceils and that it tended to stimulate IL-6 in Gin-l cells (p < 0.1). IMore IL-6 was detected in the culture supernatant of periodontal ligament cells than in that of Gin-l cells both constitutively (p < 0.05) and in response to IL-l/l (p < 0.01). The effect of different IL-l/l concentrations on IL-6 production in periodontal ligament cells incubated in the presence of cytokine for 5 h is shown in Text Fig. 2. The stimulation of IL-6 production increased uniformly from 0.1 U ml IL-lb to a maximum stimulation at 1 Uml. Above these levels (2 U/ml) the stimulation aas unchanged. These stimulatory effects were shown to be dose dependent (p < 0.001) by one-way ANOVA. The time course of changes in IL-6 production by periodontal ligament cells in response to 0.5 U/ml is

***

** T

Fig. 3. Time course of the effect of IL-IS (0.5 Uml) on IL-6 production. The values are mean + SD for four cultures. Statistical significance of difference from non-treated group corresponding to each treatment time: *p < 0.05, l*p < 0.01, l**p
IL-lb is shown in Text Fig. 3. IL-6 release into the culture medium started at 1 h and continued for at least 7 h. While ligament cells produced a small amount of IL-6 without the addition of IL-l/, a statistically significant increase in IL-6 production was observed from 3 to 7 h after adding IL-I/l compared to untreated controls. The stimulation of IL-6 production was shown to be time dependent by ANOVA (p < 0.001). In situ hybridization IL-l/3 treatment (2 U/ml) for 3 h produced a great increase in the mRNA signals of IL-6, which appeared as a granular, russet-coloured staining in the cytoplasm of periodontal ligament cells. particularly around the unstained nucleus. Most IL-l/I-treated ligament cells expressed IL-6 mRNA signals, although the signal intensity varied from cell to cell and a few cells did not show any signal [Plate Fig. 4(A)]. At lower concentrations of IL-lb (0.5 U/ml), most cells had the same granular, russet staining but the intensity was markedly decreased [Plate Fig. 4(B)]. There was a very mild russet staining in the control ligament cells (without IL-IS treatment) and occasional granular signals were barely visible in the cytoplasm [Plate Fig. 4(C)]. In another control experiment, in which cells were hybridized with the labelled IL-6 DNA probe containing a 1OO-fold higher concentration (500 rig/illI) of unlabelled DNA probe after treatment with IL-ID (1 U/ml), the periodontal ligament cells displayed very mild granular russet staining in the cytoplasm [Plate Fig. 4(D)]. Furthermore, ligament cells digested with RNase A (100 pg/ml) for 30 min after treatment with IL-I#I (1 U/ml) for 3 h showed no visible staining in their cytoplasm [Plate Fig. 4(E)]. DISCUSSION

00.1

05

1.0

2.0

IL-1p concentration (U/ml) Fig. 2. The effect of IL-I/? concentrations on IL-6 production in periodontal ligament (PDL) cells, incubated in the presence of cytokines for 5 h. The values are mean + SD for four cultures. Statistical significance of difference from non-treatment group: **p < 0.01, **+p c 0.001.

We demonstrate that IL- I/? stimulates the synthesis of IL-6 in human periodontal ligament cells and that these cells produce more IL-6 than do human Gin-l cells, both constitutively and in response to IL-lfi. However, the differences in response between the ligament and gingival cells must be viewed with caution because the ligament cells were obtained as

746

N.

SHIMIZU

primary cultures whereas the Gin-l cells were purchased as a cell line. Periodontal ligament and gingival fibroblasts from the same donor and the same subculture would be more appropriate for comparative studies. However, if our observations reflect an inherent difference between ligament and gingival fibroblasts, we speculate that ligament cells may have a larger number of IL-l/3 receptors or receptors of higher affinity than Gin-l cells, or that the expression and stability of IL-6 mRNA are different in these cells. Bartold et al. (1991) found more intense IL-6 staining in a section of inflamed human gingiva than in healthy gingival tissue, and they also reported greater IL-6 production by human gingival fibroblasts than by foreskin fibroblasts. The ability of gingival fibroblasts to respond to low concentrations of IL-lb was also greater than that of foreskin fibroblasts. Similar results were obtained by Kamagata et al. (1989) in that IL-6 activity was detected at significantly higher levels in the culture supernatant of gingival tissues from gingivitis and periodontitis patients compared to healthy controls. These findings show that IL-6 could have an important role in periodontal diseases. A high concentration of IL-6 was detected in synovial fluids (on average 15.6 ng/ml) from the joints of patients with rheumatoid arthritis (Hirano et al., 1988). Myeloma cells freshly isolated from patients produced IL-6 (Kawano ef al., 1988); Klein et al. (1989) also showed substantial production of IL-6 in the bone marrow of patients with fulminating multiple myeloma. As these diseases are accompanied by bone resorption, it is presumed that IL-6 may mediate bone resorption in pathological states. Several studies (Feyen et al., 1989; Miyaura et al., 1989; Lowik er al., 1989) have shown that osteoblast-like cells produce IL-6 and that this cytokine may be active within the bone micro-environment. Littlewood et al. (1991) have clearly demonstrated that IL-6 (5-5OOOpg/ml) exerted no effect on proliferation, alkaline phosphatase activity, osteocalcin expression, or on the production of tumour necrosis factor and prostaglandin Ez by osteoblasts. They concluded that IL-6 produced by these cells may exert a paracrine action by affecting another cell type within the bone micro-environment, such as the osteoclast. Lowik et al. (1989) and Ishimi et al. (1990) showed that IL-6 production by osteogenic cells, and treatment of bone explants with IL-6, induced osteoelastic bone resorption. This bone-resorbing action of IL-6 is exerted via stimulation of osteoclast formation rather than via the activation of mature osteoclasts. Furthermore IO-l000pg/ml of IL-6 markedly increased the formation of oesteoclast-like multinucleated cells (Kurihara er al., 1990). Al-Humidan et al. (1991) reported that IL-6 had no effect on

er

al.

bone resorption at concentrations ranging from 3 to lOOOpg/ml, but they suggested that differences between their and others’ data may be explained by their use of developmentally more mature tissues. As the production of IL-6 from periodontal ligament cells in our study was about I ng/ml 5 h, this cvtokine could have the ability to increase osteoclast-hke cell formation. It should be pointed out that IL-6 interacts with IL-3 on murine multipotential progenitors (Ikebuchi ef al., 1987). and acts synergistically with IL-3 in the stimulation of granulocyte and monocyte precursors (Hoang et al., 1988). These data indicate that IL-6 may affect bone cells that are developmentally more immature, and play an important part with other cytokines in the complex cascade of events that regulates bone resorption. However, IL-I is one of the factors known to stimulate bone resorption (Gowen et al., 1983; Heath et al., 1985), and is also a powerful inducer of IL-6 production (Van Damme etal., 1987). IL-lfl is present in high concentration in the gingival tissues of patients with gingivitis or periodontitis (Honig ef al., 1989). It is likely that IL-lb produced in gingiva may affect surrounding gingival cells to produce IL-6. and that both IL-I and -6 are capable of alveolar bone resorption. Furthermore IL-l/3 was found in both tension and compression sides of the periodontal ligament during orthodontic tooth movement (Davidovitch et al., 1988) and mechanical stress caused an increase in the level of IL-l-like molecules in cultured periodontal ligament cells (Meikle ef al., 1989). These studies lead us to speculate that IL-6 could be also secreted by periodontal ligament cells in response to IL-ID, and that it could be one of the factors affecting bone resorption during orthodontic tooth movement. We also determined by in sirrr hybridization that IL-l/3 causes an increase in the steady-state level of the IL-6 mRNA in most periodontal ligament cells. However, some cells did not show any IL-6 mRNA. As periodontal ligament cell populations are heterogeneous (i.e. many of the cells are at different stages of differentiation and represent different phenotypes-some appear to be osteoblastic or cementoblastic, and others are fibroblastic). it is possible that only certain populations of ligament cells are capable of synthesizing IL-6. It has been shown by immunohistochemical staining of primary human gingival fibroblasts that IL-6 can be localized on all gingival cells (Bartold and Haynes, 1991). Although localization of IL-6 may not agree with expression of mRNA, it is also possible that the periodontal ligament cells may be more heterogeneous than gingival fibroblasts. Finally, as alveolar bone is always in contact with the periodontal ligament, IL-6 produced by the ligament cells could directly affect the alveolar bone and

Plate I Fig. 4. In situ hybridization of IL-6 mRNA in human periodontal ligament (PDL) cells incubated in the presence of different IL-Ip concentrations for 3 h. (A) 2 U/ml of IL-I/3 treatment: most PDL cells expressed IL-6 mRNA signals (arrow), but a few did not (arrow head). (B) 0.5 U/ml of IL-IS treatment: most cells had similar signals to those seen with the higher concentration, but their intensity was markedly decreased (C) No IL-ID treatment. (D) 1 U/ml IL-lb treatment plus blocking (IOO-fold unlabelled probe). (E) 1U/ml of IL-l/? treatment plus RNase A; no visible cytoplasmic staining.

Interleukin-6 production in periodontal cells

Plate I

N. Smnwizu et id.

748 may thus play an important metabolism.

part in alveolar

bone

J. Immun. 145, 3297-3303.

Acknowledgements-We

thank Dr N. Ida (Toray Industries, Japan) for the gift of the IL-6 immunoassay kits. This research was supported in part by grants from the Science Research Promotion Fund from Japan, the Private School Promotion Foundation and the Japan Foundation for Aging and Health from the Ministry of Public Welfare. REFERENCES Al-Hu~dan A., Ralston S. H., Hughes D. E., Chapman K., Aarden L.. Russell R. G. G. and Gowen M. (1991) Intedeukin-6 does not stimulate bone resorption in neonatal mouse calvariae. J. Bone Miner, Res. 6, 3-8. Bartold P. M. and Haynes D. R. (1991) Interleukin-6 production by human gingival fibroblasts. J. periodonr. Res. 26, 339-345. Davidovitch Z., Nicolay 0. F., Ngan P. W. and Shanfeld J. L. (1988) Neurotransmitters, cytokines, and the control of alveolar bone remodeling in orthodontics. Dent. Clin. N. Am. 32,411-435.

Dinarello C. A. (1984) Interleukin-I.

Hirano T., Kishimoto T. and Suda T. (1990) IL-6 is produced by osteoblasts and induces bone resorption.

Rev. Infect. Dis. 6,

51-95.

Feyen J. H. M., Elford P., Padova F. E. and Trechsel U. f 1989) Interleukin-6 is produced by bone and modulated by parathyroid hormone. J. Bone Miner. Res. 4,633-639. Gowen M., Wood D. D., fhrie E. J., McGuire M. K. B. and Russell R. G. G. (1983) An interleukin 1 like factor stimulates bone resorption in aitro. Na!ure 306, 378-380. Heath J. K., Saklatvala J., Meikle M. C., Atkinson S. J. and Reynolds J. J. (1985) Pig interleukin 1 (catabolin) is a potent stimulator of bone resorption in vitro. Cult. Tiss. Int. 37, 95-97. Hirano T. and Kishimoto T. (1990) Interleukin-6. In Handbook of Experimental Pharmacology (Ed. Roberts A. B.), pp. 633-665. Springer, Berlin. Hirano T., Yasukawa K., Harada H., Taga T., Watanabe Y., Matsuda T., Kashiwamura S., Nakajima K., Koyama K., Iwamatsu A.. Tsunasawa S., Sakiyama F., Matsui H., Takahara Y., Taniguchi T. and Kishimoto T. (1986) Complementary DNA for a novel human interleukin (BSF-2) that induces B lymphocytes to produce immunoglobulin. ?&zure 324, 73-76. Hirano T., Matsuda T., Turner M., Miyasaka N., Buchan G., Tang B., Sato K., Shin-&u M., Maini R., Feldmann M. and Kishimoto T. (1988) Excessive production of interleukin 6/B cell stimulatory factor-2 in rheumatoid arthritis. Eur. J. fmmun. 18, 1797-1801. Hoang T., Haman A., Concalves O., Wong G. G. and Clark S. C. (1988) Interleukin-6 enhances growth factor dependent proliferation of blast cells of acute myeloblastic leukemia. Blood 72, 823-826. Hijnig J., Rordorf-Adam C., Siegmund C., Wiedemann W. and Erard F. (1989) Interleukin-I beta(IL-Ifi) concentration in gingival tissue from periodontitis patients and healthy control subjects. J. periodont. Res. 24, 362-367. Ikebuchi K., Wong G. G., Clark S. C., Ihle J. N., Hirai Y. and Ogawa M. (1987) Interleukin 6 enhancement of interleukin 3-dependent proliferation of multipotential hemopoietic progenitors. Cell Biol. sic, 9035-9039. Ishimi Y., Miyaura C., Jin C. H., Akatsu T., Abe E., Nakamura Y., Yamaguchi A., Yoshiki S., Matsuda T.,

Kamagata Y.. Miyasaka N.. Inoue H., Hashimoto J. and Iida M. (1989) Cytokine production in inflamed human gingival tissues, Interleukin-6. J. Jnp. ASS. Periodont. 31, 1081-1087.

Kawano M., Hirano T., Matsuda T., Taga T., Horii Y.. Iwato K.. Asaoku H.. Tang B.. Tanabe 0.. Tanaka H.. Kuramotb A. and Kishimoio T. (1988) Autocrine gener: ation and requirement of BSF-Z/IL-6 for human multiple myelomas. Nature 332, 83-85. Keller G. H. and Manak M. M. (1989) General considerations. In DNA Probes (Eds Keller G. H. and Manak M. M.), pp. 1l-17. Stockton Press, New York. Klein B., Zhang X. G. Jourdan M., Content J., Houssiau F., Aarden L., Piechaczyk M. and Bataille R. (1989) Paracrine rather than autocrine regulation of myelomacell growth and differentiation by interleukin-6. Blood 72, 517-526.

Kurihara N., Bertolini D.. Suda T., Akiyama Y. and Roodman G. D. (1990) IL-6 stimulates osteoclast-like multinucleated cell formation in long term human marrow cultures by inducing IL-I release. J. Immun. 144, 4226-4230.

Littlewood A. J., Aarden L. A., Evans D. B., Russell R. G. G. and Gowen M. (1991) Human osteoblastlike cells do not respond to interleukin-6. f. Bone Miner. Res. 6, 141-148. Liiwik C. W. G. M., Van der Pluijm G., Bloys H.. Hoekman K., Bijvoet 0. L. M., Aarden L. A. and Papapoulos S. E. (1989) Parathyroid hormone (PTH) and PTH-like protein (PLP) stimulate interleukin-6 production by~.osteogenic cells: a possible role of interleukin-6 in osteoclastogenesis. Biochem. biophys. Res. Commun. 162, 1546-1.552. May L. T., Ghrayeb J., Santhanam U., Tatter S. B., Sthoeger Z., Helfgott D. C., Chiorazzi N., Grieninger G. and Sehgal P. B. (1988) Synthesis and secretion of multiple forms of &interferoniB-cell differentiation factorZ/hepatocyte stimulating factor by human fibroblasts and monocytes. J. biol. Chem. 263, 7760-1766. Meikle M. C., Heath J. K., Atkinson S. J., Hembry R. M. and Reynolds J. J. (1989) The Biology of Tooth Mo(,ement (Eds Norton L. A. and Burstone C. J.), pp. 71-86 CRC press, Boca Raton, FL. Miyaura C., Ishimi Y. Jin C. H., Hirano T., Kishimoto T., Suda T. (1989) Interleukin-6: its production by osteoblasts and activity to induce bone resorption. J. Bone. Miner. Res. 4 (Abstr. 133) 151. Ragnarsson B., Carr G. and Daniel J. C. (1985) Isolation and growth of human periodontal ligament cells in oitro J. dent. Res. 64, 1026-1030.

Samoszuk M. and Nansen L. (1990) Detection of interleukin-5 messenger RNA in Reed-Sternberg cells of Hodekin’s disease with eosinoohilia. Blood 75. 13-16. Some&an M. J., Archer S. Y., Imm G. R. and Foster R. A. (1988) A comparative study of human periodontal ligament cells and gingival tibroblasts in vitro. J. dent Res. 67, 66-70.

Van Damme J., Opdenakker G., Simpson R. J., Rubira M. R., Cayphas S., Vink A., Billiau A., Van Snick J. (1987) Identification of the human 26-kD protein, interferon beta,, as a B cell hybridoma/plasmacytoma growth factor induced by interleukin-1 and tumor necrosis factor. J. exp. Med. 165, 914-919.