Stimulation of chondrocyte hypertrophy by chemokine stromal cell-derived factor 1 in the chondro-osseous junction during endochondral bone formation

Developmental Biology 341 (2010) 236–245

Contents lists available at ScienceDirect

Developmental Biology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / d e v e l o p m e n t a l b i o l o g y

Stimulation of chondrocyte hypertrophy by chemokine stromal cell-derived factor 1 in the chondro-osseous junction during endochondral bone formation Lei Wei a,c,⁎, Katsuaki Kanbe b, Mark Lee a, Xiaochun Wei c, Ming Pei d, Xiaojuan Sun a, Richard Terek a, Qian Chen a a

Department of Orthopaedics, The Warren Alpert Medical School of Brown University/Rhode Island Hospital, Suite 402A, 1 Hoppin Street, Providence RI 02903, USA Department of Orthopaedic Surgery, Tokyo Women's Medical University, Daini Hospital, 2-1-10 Nishiogu, Arakawa-ku, Tokyo 116-8567, Japan Department of Orthopaedics, The Second Hospital. Shanxi Medical University, Taiyuan, Shanxi, 030001, PR China d Department of Orthopaedics, West Virginia University, Morgantown, WV 26506, USA b c

a r t i c l e

i n f o

Article history: Received for publication 10 September 2009 Revised 20 February 2010 Accepted 23 February 2010 Available online 4 March 2010 Keywords: SDF-1/CXCR4 Chondrocyte differentiation Growth plate

a b s t r a c t During endochondral bone formation, chondrocytes undergo differentiation toward hypertrophy before they are replaced by bone and bone marrow. In this study, we found that a G-protein coupled receptor CXCR4 is predominantly expressed in hypertrophic chondrocytes, while its ligand, chemokine stromal cell-derived factor 1 (SDF-1) is expressed in the bone marrow adjacent to hypertrophic chondrocytes. Thus, they are expressed in a complementary pattern in the chondro-osseous junction of the growth plate. Transfection of a CXCR4 cDNA into pre-hypertrophic chondrocytes results in a dose-dependent increase of hypertrophic markers including Runx2, Col X, and MMP-13 in response to SDF-1 treatment. In organ culture SDF-1 infiltrates cartilage and accelerates growth plate hypertrophy. Furthermore, a continuous infusion of SDF-1 into the rabbit proximal tibial physis results in early physeal closure, which is accompanied by a transient elevation of type X collagen expression. Blocking SDF-1/CXCR4 interaction suppresses the expression of Runx2. Thus, interaction of SDF-1 and CXCR4 is required for Runx2 expression. Interestingly, knocking down Runx2 gene expression results in a decrease of CXCR4 mRNA levels in hypertrophic chondrocytes. This suggests a positive feedback loop of stimulation of chondrocyte hypertrophy by SDF-1/CXCR4, which is mediated by Runx2. © 2010 Elsevier Inc. All rights reserved.

Introduction All long bones in the vertebrate limb are developed through a process called endochondral bone formation, in which bone is formed from a cartilage anlage. The growth of the cartilage anlage, which is called a growth plate, determines the size and shape of the long bone. This morphogenic process is uniquely regulated by pathways within the growth plate and tissues adjacent to the growth plate cartilage. One of these neighboring tissues is the bone marrow located at the base of the growth plate adjacent to the hypertrophic zone. The hypertrophic chondrocyte is an important regulatory cell during endochondral bone formation because bone lengthening is driven primarily by the rate of differentiation of the hypertrophic chondrocytes from proliferating chondrocytes. Type X collagen and matrix metalloprotease 13 (MMP-13) are well-known molecular markers up-regulated during chondrocyte hypertrophy (Schmid and

⁎ Corresponding author. Department of Orthopaedics, The Warren Alpert Medical School of Brown University/Rhode Island Hospital, Suite 402A, 1 Hoppin Street, Providence RI 02903, USA. E-mail addresses: [email protected] (L. Wei), [email protected] (Q. Chen). 0012-1606/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2010.02.033

Linsenmayer, 1985), while Runt-related transcription factor 2 (Runx2) is a transcription factor that promotes chondrocyte hypertrophy (Wang et al., 2004). Runx2(−/−) mice lack hypertrophic chondrocytes, while targeted expression of Runx2 in non-hypertrophic chondrocytes accelerates chondrocyte differentiation and leads to maturation of chondrocytes that do not normally become hypertrophic (Ducy et al., 1997; Komori et al., 1997). Previous studies have shown that the degradation of hypertrophic cartilage requires the presence of bone marrow (Cole et al., 1992). However, the molecular mechanism of this induction remains elusive. We hypothesize that the induction of hypertrophic matrix degradation may involve chemokine stromal cell-derived factor 1 (SDF-1) secreted by cells in the bone marrow area adjacent to the hypertrophic cartilage in the chondroosseous junction. Chemokines are soluble peptides that regulate cell movement, morphology, proliferation, and differentiation (Pulsatelli et al., 1999). Chemokines achieve their regulation by signaling through a family of seven transmembrane G-protein coupled receptors. SDF-1 is an 8 kDa peptide originally isolated from a bone marrow stromal cell line (Jo et al., 2000), which activates various primary cells by binding solely to its receptor, CXCR4 (Mohle et al., 1998; Pulsatelli et al., 1999). SDF-1 is also found in other cells, including endothelial cells and osteoblasts

L. Wei et al. / Developmental Biology 341 (2010) 236–245

(Jung et al., 2006; Kollet et al., 2003; Sun et al., 2005). It has been shown previously that SDF-1 and its receptor CXCR4 play an important role in cell migration, embryonic development, and human immunodeficiency virus infection. SDF-1 signaling is important during development and morphogenesis, as both SDF-1 and CXCR4 knockout mice exhibit significant developmental abnormalities that lead to embryonic lethality (Ma et al., 1998). The goal of this study is to determine the distribution pattern of SDF-1 and its receptor CXCR4 in the growth plate, and to determine whether SDF-1/CXCR4 signaling regulates chondrocyte differentiation during endochondral bone formation. Materials and methods Generation of retrovirus containing CXCR4 cDNA CXCR4 cDNA was cloned into a myc-tagged retroviral vector (RCAS) by RT-PCR from total RNA isolated from chick sternal cartilage with primers 5′-CAT GCC ATG GCA ATG GAC GGT TTG GAT-3′, and 5′CAT GCC ATG GCA GCT GGA ATG GAA ACT TGA-3′ (sequence from 60 to 1133), designed according to a DNA sequence from GenBank™ (accession number AF294794) (Table 1). PCR products were digested with ClaI and ligated into a RCAS vector. RCAS–CXCR4 was sequenced to ensure no spontaneous mutations during subcloning. CDNAs contained myc as a marker of the exogenously transfected product. CXCR4–RCAS and empty RCAS vector were transfected into chicken embryonic fibroblasts respectively, and the virus was harvested from the medium as previously described (Chen et al., 1995). Medium from fibroblasts not transfected (mock) was also collected as a control. Primary chick chondrocyte isolation and culture Primary cultures of chick embryonic chondrocytes were established as described previously (Chen et al., 1995; Gibson and Flint, 1985). Caudal (proliferative), middle (pre-hypertrophic), and cephalic (hypertrophic) parts of the sterna from 17-day-old embryonic chickens were separated under a dissection microscope. They were subjected to enzymatic treatment with 0.1% trypsin (Sigma-Aldrich, St. Louis, MO), 0.3% collagenase (Worthington, Freehold, NJ), and 0.1% type 1 testicular hyaluronidase (Sigma-Aldrich, St. Louis, MO) (dissociation medium). After incubating for 30 min. at 37 °C, the dissociation medium was removed and replaced with fresh dissociation medium and incubated at 37 °C for an additional 1 h. Chondrocytes were resuspended in plating medium plus 0.01% testicular hyaluron-

Table 1 Gene

Primer

Sequence

RT-PCR oligonucleotide primer sequences used for detection of target genes' mRNA CXCR4 Forward 5′-CAT GCC ATG GCA ATG GAC GGT TTG GAT-3′ (1073 bp) Reverse 5′-CAT GCC ATG GCA GCT GGA ATG GAA ACT TGA-3′ MMP-13 Forward 5′-ATT TAA CGT ACA GAA TTA TGA GTT ACA CAT-3′ (1280 bp) Reverse 5′-TTC CTT CCT GTT TTC CTA TTA ATT TAA TGC-3′ GPDH Forward 5′-ATG GTG AAA GTC GGA GTC AAC GGA TTT-3′ (1001 bp) Reverse 5′-TCA CTC CTT GGA TGC CAT GTG GAC CAT CAA-3′ Real time RT-PCR oligonucleotide primer sequences used for quantification detection of target genes' mRNA MMP-13 Forward 5′-CCCCTTTGATGGACCCTCTGG-3′ (150 bp) Reverse 5′-TGGCCAAATTCATGAGCAGCA-3′ CXCR4 Forward 5′-ACCGGATCTTCTTGCCAACCAT-3′ (167 bp) Reverse 5′-TGGCAAGGTGATGACAAAGAGG-3′ Type X collagen Forward 5′-AGT GCT GTC ATT GAT CTC ATG GA-3′ (82 bp) Reverse 5′-TCA GAG GAA TAG AGA CCA TTG GAT T-3′ Runx2 Forward 5′-CTT CGC CGT CCA TTC ACT CC-3′ (181 bp) Reverse 5′-GTG CAT TCG TGG GTT GGA GA-3′ 18S RNA Forward 5′-CGGCTACCACATCCAAGGAA-3′ (186 bp) Reverse 5′-GCTGGAATTACCGCGGCT-3′

237

idase (plating medium: 10% fetal bovine serum in Ham F-12 medium; Gibco, Grand Island, NY). After culturing overnight, the medium of the chondrocyte culture was replaced with fresh medium without hyaluronidase. Medium was changed every other day.

Chondrocyte cell transfection Primary chicken chondrocytes were cultured as previously described (Chen et al., 1995). When cell cultures became 50% confluent, cells were infected with retrovirus conditional medium containing RCAS/CXCR4, or empty RCAS, or mock (no virus). After a four-day incubation, transfected cells were analyzed by immunocytochemistry with a mAb against myc-tag (9B11 Cell signaling, Danvers, MA) to confirm the infection. Before collecting samples for experiment, the cells were stimulated with SDF-1 (100 ng/mL; Cat# 351-FS, R&D Systems, Inc. Minneapolis, MN) for 24 h or pretreated with AMD3100 for 2 h (5 µg/mL; Cat# 155148-31-5, Sigma-Aldrich, St. Louis, MO), a specific inhibitor for CXCR4, before stimulation with SDF-1. In some cases, the cells were transfected with full length Runx2 cDNA plasmid (a gift from Dr. D. Chen, Rochester University) or Runx2-siRNA (Dharmacon Com. Lafayette, CO).

Immunocytochemistry After a four-day incubation, transfected cells were analyzed by immunocytochemistry with a mAb against myc-tag (1:200, Cat# 9B11, Cell Signaling, Danvers, MA). The transfected cells on 8 chamber polystyrene vessel tissue culture treated glass slides (REF 354108, BD Biosciences, Bedford, MA) were fixed at −20 °C with 70% ethanol, 50 mM glycine, and pH 2.0 for 20 min. Slides were then washed with PBS and incubated with primary antibodies. After washing with PBS, affinitypurified TRITC conjugated donkey anti-mouse antibodies (1:500, Jackson ImmunoResearch, West Grove, PA) were applied with Hoechst nuclear dye (0.5 mg/mL). Slides were washed and mounted in 95% glycerol in PBS. Single or multiple exposure photography was performed with a Nikon E800 microscope (Melville, NY).

Organ culture Whole sterna were isolated from 15-day-old embryonic chickens and cultured in HBSS containing synthetic SDF-1 peptide (100 ng/mL; 351-FS, R&D Systems, Inc. Minneapolis, MN) for 1 h, 3 h, and 24 h. Tibia growth plates were isolated from 12-day-old embryonic chicken and cultured in F12 containing 10% FBS and, synthetic SDF-1 peptide (100 ng/mL) for 2, 4, and 6 days. The samples were collected, embedded in Tissue Tek (Sakura Finetechanical Co., Ltd., Tokyo, Japan), and subjected to frozen sectioning. Ten µm sections were analyzed by immunohistochemistry with a mAb against SDF-1 (25 µg/mL; MAB 310, R&D Systems, Inc. Minneapolis, MN) or with a mAb against type X collagen (1:2 dilution; Cat# X-AC-9, Developmental Studies Hybridoma Bank, Iowa City, IA). To detect the distribution of Runx2 in growth plate, 10 µm sections from one-day-old mice tibia growth plates (C57BL/6) were analyzed by immuno-fluorescent staining with a rabbit Ab against Runx2 (1:200; Cat# AB/RNT20, CeMines, Inc. Golden, Co.). The sections were fixed at −20 °C with 70% ethanol, 50 mM glycine, and pH 2.0 for 20 min. Slides were then washed with PBS and incubated with primary antibody. After washing with PBS, affinity-purified TRITC conjugated donkey anti-mouse antibody or affinity-purified FITC conjugated donkey anti-rabbit antibody (1:500, Jackson ImmunoResearch, West Grove, PA) was applied with Hoechst nuclear dye (0.5 mg/mL). The sections were washed and mounted in 95% glycerol in PBS. Single or multiple exposure photography was performed with a Nikon E800 microscope (Melville, NY).

238

L. Wei et al. / Developmental Biology 341 (2010) 236–245

Fig. 1. Distribution of SDF-1 and CXCR4 in the growth plate. Immunohistochemical staining for CXCR4 and SDF1 was performed on one-day-old mouse proximal tibial growth plates. CXCR4 expression was strongest in the hypertrophic zone (red color) (A), while SDF-1 was most strongly expressed in bone marrow (red color) adjacent to the hypertrophic chondrocytes(B). Scale bar = 20 µm.

Immunohistochemistry To detect the distribution of CXCR4 and SDF-1 in growth plate, the knee joints from one-day-old mice (C57BL/6) were fixed overnight in 4% paraformaldehyde in phosphate-buffered saline (pH 7.4), dehydrated in ethanol, cleared in xylene, and embedded in paraffin. Ten µm sections were prepared and collected on positively charged glass slides (Superfrost Plus, Fisher Scientific). The sections were dried on a hot plate to increase adherence to the slides. Immunohistochemistry was carried out using the Histostain-SP Kits (Zymed, Cat# 95-9943). Sections were de-paraffined and re-hydrated through conventional methods. Endogenous peroxidase was blocked by treating the sections with 3% hydrogen peroxide in methanol for 30 min. The sections were digested by 5 mg/mL hyaluronidase (Cat# H3506, SigmaAldrich, St. Louis, MO) for 20 min. Nonspecific protein binding was blocked by incubation with a serum blocking solution. The sections were incubated with affinity-isolated Ig G fractions of monoclonal mouse Ab against human CXCR4 (25 µg/mL; Cat# MAB171 R&D Systems, Inc., Minneapolis, MN) and a mAb against SDF-1 (25 µg/mL; Cat# MAB310 R&D Systems, Inc., Minneapolis, MN) respectively at 4 °C overnight. The negative control sections were incubated with isotype control (25 µg/mL; Cat# MAB002 R&D Systems, Inc., Minneapolis, MN) in 0.01 M PBS. Thereafter, the sections were treated sequentially with ready to use biotinylated secondary antibody and ready to use streptavidin–peroxidase conjugate (Zymed), and then

Fig. 2. Expressions of CXCR4, type X, and Runx2 in proliferative, pre-hypertrophic, and hypertrophic chondrocytes. Total RNA was isolated from three different zones of 17day-old chicken embryonic sterna and qRT-PCR was carried out to quantitate CXCR4 mRNA. CXCR4 mRNA was much higher in hypertrophic chondrocytes than in proliferative and pre-hypertrophic chondrocytes (A), similar to the up-regulation of hypertrophic markers type X collagen and Runx2 (B). Bar graphs show the averages of quantified data from three independent experiments using Real time PCR. *: p b 0.05 compared to proliferative chondrocytes.

L. Wei et al. / Developmental Biology 341 (2010) 236–245

were followed by standardized development in AEC chromogen (Zymed). The sections were counterstained with ready to use hematoxylin (Zymed). Photography was performed with a Nikon E800 microscope (Melville, NY).

239

used in amplification of target genes mRNA are shown in Table 1. PCR reactions were performed as follows: 40 cycles with the GoldTaq PCR system (Perkin Elmer, Norwalk, CT) at 94 °C for 30 s, 50 °C for 1 min, and 72 °C for 2 min. GAPDH housekeeping gene mRNA was amplified at the same time as the internal control. The amplified cDNA fragments were detected by electrophoresis in 1.2% (weight/volume) agarose gels.

Reverse transcriptase-polymerase chain reaction (RT-PCR) Seventeen-day-old embryonic chicken sterna were separated into three parts under a dissection microscope: lower third/caudal (proliferative zone), middle (pre-hypertrophic zone), and upper third/cephalic (hypertrophic zone). Total RNA was extracted from each zone using RNeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. First-strand complementary DNA (cDNA) was made from 1 µg of total RNA with Superscript II reverse transcriptase (Gibco BRL) following the manufacturer's protocol. Primers

Real time PCR After cells were incubated with SDF-1 for 24 h, total RNA was isolated with the RNeasy mini kit (QIAGEN). One µg total of RNA was reverse transcribed with the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA). Real time quantitative PCR amplification was performed using the QuantiTect SYBR Green PCR kit (QIAGEN, Valencia, CA) with the DNA Engine Opticon 2 Continuous Fluorescence Detection System

Fig. 3. SDF-1/CXCR4 induction of chondrocyte hypertrophy. To determine whether SDF-1/CXCR4 signaling induces chondrocytes hypertrophy, 50% confluency of proliferative chondrocytes was infected with chicken fibroblast conditional medium containing RCAS–CXCR4 or RCAS alone for 4 days and then treated with 100 ng SDF-1/mL for 1 day. CXCR4 expression in proliferative chondrocytes transfected with RACS–CXCR4 was detected by immuno-fluorescent staining with myc-tag antibody but not in RACS transfected group (A, red color for CXCR4). qRT-PCR was performed for MMP-13 (B) and type X collagen (C). MMP-13 and type X collagen mRNA expression increased after treatment of proliferative chondrocytes transfected with RCAS–CXCR4 with SDF-1 in a dose-dependent manner. Similar results were observed in three experiments for mmp-13. Bar graphs show the averages of quantified data of type X collagen using Real time PCR from three independent experiments. *: Significant difference in comparison to the non-SDF-1 treated group, p b 0.05. Scale bar = 20 µm. CECs: chicken embryonic proliferative chondrocytes.

240

L. Wei et al. / Developmental Biology 341 (2010) 236–245

(MJ Research, Waltham, MA). Primers used in amplification of target genes mRNA are shown in Table 1. mRNA levels were normalized to 18S mRNA levels (Zhen et al., 2001). Calculation of mRNA values was performed as previously described (Wei et al., 2006). The cycle threshold (Ct) values for 18S RNA and that of samples were measured and calculated by computer software (MJ Research, Waltham, MA). Relative transcription levels were calculated as x = 2− ΔΔCt, in which ΔΔCt = ΔE − ΔC, and ΔE = Ctexp − Ct18s; ΔC = Ctctl − Ct18s. In vivo infusion of SDF-1 in rabbit tibial physis The study was approved by the Institutional Animal Care and Use Committee of Rhode Island Hospital. The animals were a subset of those used for a previous study (Lee et al., 2007). A continuous infusion system consisting of a fenestrated catheter and an osmotic pump were implanted into the right proximal tibial physis of twenty six-week-old New Zealand White rabbits (Millbrook Breeding Labs, Amherst, MA). Ten animals received an osmotic pump loaded with human recombinant SDF-1α (PeproTech, Rocky Hill, New Jersey) at a concentration of 250 µg/mL in phosphate-buffered saline solution for 4 weeks (SDF-1-treated group). The sham-treated group consisted of ten rabbits implanted with a pump housing phosphate-buffered saline solution for 4 weeks. The catheter was inserted into the growth plate cartilage and after 8 weeks was in the subchondral bone marrow region due to growth. Two rabbits were randomly chosen from both the SDF-1-treated group and the sham-treated group at 2 and 4 weeks after implantation. The animals were killed with a sodium pentobarbital overdose (100 mg/kg). The remaining rabbits from each group were killed at 8 weeks with use of the same method. The proximal part of the tibiae from the rabbits was harvested, placed in 4% paraformaldehyde for 2 days, decalcified in Richman–Gelfand–Hill solution for 16 h, washed with tap water for 8 h, dehydrated with serial ethanol and xylene washes, and then were embedded in paraffin. Multiple 6-µm sections were obtained and stained with hematoxylin and eosin as well as safranin O for histological analysis. To quantify the mRNA level of type X collagen, a Paradise FFPE Reagent System kit (Molecular Devices, Sunnyvale, CA) was used to extract and amplify RNA from laser captured cells (Sabo et al., 2008). In brief, 6-µm sections were air dried and dehydrated through graded alcohols, and subjected to laser captured microdissection (LCM) within 2 h of deparaffinization. Five thousand cells were microdissected from the proliferative and hypertrophic zone tissue sections respectively and captured on LCM Macro CapSure caps (Molecular Devices) using an AutoPix Automated LCM instrument (Molecular Devices). The quantification of mRNA was performed by Real time PCR using the QuantiTect SYBR Green PCR kit (QIAGEN, Valencia, CA) with the DNA Engine Opticon 2 Continuous Fluorescence Detection System (MJ Research, Waltham, MA). Primers (5′–3′) for rabbit Type X collagen were: forward, CCAGTGAGAGGAGAACAAGG; reverse, TGGCACAGAAATGCCAGCTG (Access number: AF247705, 306 bp). Amplification conditions were as follows: 2 min preincubation at 50 °C, 10 min at 95 °C for enzyme activation, and 40 cycles at 95 °C denaturation for 10 s, 55 °C annealing for 30 s and 72 °C extension for 30 s. The comparative threshold cycle (Ct) method, i.e., 2− ΔΔCt method was used for the calculation of fold amplification (Wei et al., 2006).

Results Distribution of CXCR4 and SDF-1 in a growth plate As the first step to evaluate the potential role of the SDF-1/CXCR4 axis in the growth plate, we analyzed distribution of SDF-1 and its receptor CXCR4 in tibial growth plates from one-day-old mice by immunohistochemistry (Fig. 1). SDF-1 receptor, CXCR4, was strongly expressed in the hypertrophic zone of the growth plate, while weak expression was found in the proliferative and pre-hypertrophic zones (Fig. 1A, red color). SDF-1 was present at very low levels in growth plate cartilage in comparison to its strong expression in the bone marrow area adjacent to the hypertrophic zone of the growth plate (Fig. 1B, brown color). Expression levels of CXCR4, type X collagen, and Runx2 in the growth plate To quantify the expression levels of CXCR4 in different zones of growth plates, we used embryonic chicken sterna, which were separated into the three different zones under a dissection microscope. Quantitative real time RT-PCR analysis indicated that CXCR4 mRNA was most highly expressed in hypertrophic chondrocytes, while it was expressed at very low levels in the proliferating or pre-hypertrophic chondrocytes (Figs. 2A, B). This is similar to the up-regulation of type X collagen and Runx2 mRNA in hypertrophic chondrocytes (Fig. 2B). SDF-1/CXCR4 interaction stimulates chondrocyte hypertrophy To test whether the interaction of SDF-1 and CXCR4 stimulates chondrocyte hypertrophy, we cloned a full length CXCR4 cDNA from chicken growth plate chondrocytes and then cloned it into a retroviral vector RCAS. The RCAS–CXCR4 cDNA was then transfected into

Statistical analysis Two-tailed t-tests were used to compare mRNA levels from proliferative chondrocyte to hypertrophic chondrocytes. MRNA levels in chondrocytes under different conditions were analyzed by one-way ANOVA with the Dunnett Multiple Comparison post-hoc test at a rejection level of 5% unless specifically noted.

Fig. 4. SDF-1 can diffuse into cartilage. To determine whether SDF-1 can diffuse into cartilage, 17-day chicken embryonic sternal cartilage was incubated with SDF-1 (100 ng/mL) or without SDF-1 for 1 h, 3 h, and 24 h. Ten µm frozen sections were used to detect SDF-1 by immuno-fluorescent staining with mAb against SDF-1. Fluorescence microscopy showed a progressive increase in SDF-1 staining (red color) surrounding chondrocytes during the 24 h time course (A, B,C) compared to control at 24 h (D). Scale bar = 20 µm.

L. Wei et al. / Developmental Biology 341 (2010) 236–245

proliferative chondrocytes (Fig. 3A). Cells transfected with CXCR4 showed a significant increase of type X collagen and MMP-13 mRNA levels in response to SDF-1 treatment in a dose-dependent manner (Figs. 3B and C). In contrast, proliferative chondrocytes transfected with empty vector RCAS had no increase in the mRNA levels of type X collagen or MMP13 in response to SDF-1 treatment. SDF-1 infiltrates cartilage tissue and accelerates growth plate hypertrophy To determine whether SDF-1 could conceivably diffuse into growth plate cartilage tissue from adjacent tissue, sternal cartilage was incubated with 100 ng/mL SDF-1 for 1, 3, and 24 h in organ culture. Immunohistochemistry was performed to detect SDF-1 in

241

cartilage tissue using a mAb against SDF-1. While SDF-1 was barely detectable after 1 h incubation (Fig. 4A), a faint staining of SDF-1 was detected around chondrocytes after 3 h incubation (Fig. 4B). SDF-1 was detected surrounding many chondrocytes after 24 h incubation (Fig. 4C). This suggests that SDF-1 is capable of diffusing into cartilage tissue and interacting with chondrocytes. To further test whether SDF-1 induces chondrocyte hypertrophy in organ culture, entire tibia cartilaginous growth plates were dissected from 12-day-old chicken embryos and incubated in the presence or absence of SDF-1 (100 ng/mL) for 2, 4, and 6 days. Immunohistochemical analysis with a mAb against type X collagen was performed to determine the length of the hypertrophic zone. Compared to nonSDF-1 treated samples, the length of the hypertrophic zone was

Fig. 5. SDF-1 accelerates growth plate chondrocyte hypertrophy in organ culture. To confirm that SDF-1 induces chondrocyte hypertrophy in growth plates, 12-day-old chicken tibia growth plates were cultured in the presence of SDF-1 (100 ng/mL) or in the absence of SDF-1 for 2, 4, and 6 days. Ten µm frozen sections were used to detect type X collagen expression by immuno-fluorescent staining with mAb against type X collagen. A progressive increase in the size of the hypertrophic growth plate based on type X collagen staining was seen. The ratio of the length of the hypertrophic zone to that of the total growth plate was calculated at the different time points (B). (*p b 0.05). Scale bar = 100 µm.

242

L. Wei et al. / Developmental Biology 341 (2010) 236–245

Fig. 6. SDF-1/CXCR4 signaling regulates Runx2 expression. Fifty percent confluent proliferative chondrocytes were infected with RACS–CXCR4 or RCAS for 4 days and then treated with 100 ng/mL SDF-1 for 1 day. Real time PCR was used to quantify Runx2 gene expression and western blot was used to detect Runx2 protein levels. (A) Runx2 mRNA expression increased after RACS–CXCR4 transfection and SDF-1 exposure, however, the increase of Runx2 expression was inhibited by CXCR4 inhibitor AMD3100. *p b 0.05 compared to RACS; #: compared to RACS–CXCR4 and SDF-1 treatment. (B) Western blot showed similar changes in Runx2 protein.

increased significantly after incubation with SDF-1 for 4 days, and was further increased after incubation for 6 days (Fig. 5). The decrease of the length of the proliferative and pre-hypertrophic zones in the SDF-1 treated growth plate was also accelerated, possibly due to an increase of the conversion rate to hypertrophy.

SDF-1/CXCR4 interaction stimulates Runx2 expression To test whether SDF-1 treatment of chondrocytes induces Runx2, proliferating chondrocytes were incubated with 100 ng/mL SDF-1 after transfection with CXCR4 or empty vector. Real time RT-PCR results indicated that SDF-1 induced Runx2 mRNA expression in chondrocytes transfected with CXCR4 expression construct (Fig. 6A). Furthermore, this induction of Runx2 was partially inhibited by AMD3100, a specific inhibitor of CXCR4 (Fig. 6A). Western blot results show that the changes in Runx2 protein levels were similar to the changes in Runx2 mRNA (Fig. 6B).

Fig. 7. Runx2 regulates CXCR4, MMP-13, and type X collagen expression. 2.5 × 105 hypertrophic chondrocytes from 17-day chicken sterna embryo were seeded in F12 culture medium overnight and transfected with 1 µg human full length Runx2 DNA or co-transfected with 1 µg human full length Runx2 DNA combined with Runx2 Si RNA (5 nM/mL) 2 days in 6-well plates. mRNA levels of CXCR4, MMP-13, and type X collagen were quantified by Real time PCR. Over-expression of Runx2 increased CXCR4 (A), MMP-13 (B), and type X collagen expression while down-regulation of Runx2 using SiRNA inhibited their endogenicity and Runx2 induction of CXCR4, MMP-13, and type X collagen expression. *: Significant difference in comparison to mock control, p b 0.05. #: Statistically significant in comparison to Runx2 treatment alone.

Runx2 regulates CXCR4, MMP-13, and type X collagen expression To determine whether up-regulation of CXCR4 in hypertrophic chondrocytes was dependent on Runx2 expression, hypertrophic chondrocytes from 17-day-old chicken embryo sterna were transfected with Runx2 SiRNA and/or Runx2 cDNA. Over-expression of Runx2 resulted in an increase of CXCR4 (Fig. 7A), MMP-13 (Fig. 7B), and type X collagen mRNA levels (Fig. 7C), while knocking down Runx2 expression led to a decrease of CXCR4, MMP-13, and type X collagen mRNA levels (Figs. 7A, B, and C).

SDF-1 induces physeal closure and stimulates type X collagen expression in rabbit proximal tibial physis To determine the effect of activating the SDF-1/CXCR4 pathway on regulation of chondrocyte differentiation in vivo, human recombinant SDF-1 (250 µg/mL) or PBS controls were administrated into a growth plate in vivo by using a continuous infusion system, consisting of a fenestrated catheter and an osmotic pump implanted into the right

L. Wei et al. / Developmental Biology 341 (2010) 236–245

proximal tibial physis of twenty six-week-old New Zealand White rabbits. As we reported previously, in the SDF-1-treated group, the SDF-1-treated leg demonstrated a significant decrease in length of 3.7 ± 3.1 mm compared with the control leg (p = 0.006; Lee et al., 2007). Histologic analysis indicates a marked difference in physeal morphology between the SDF-1-treated and PBS-treated groups at the eight-week time-point. The PBS-treated physes demonstrated a normal column cellular arrangement (Fig. 8A-a), while the SDF-1treated physes were narrowed with gross disruption of the columnar organization. The border between the residual proliferative and hypertrophic zones of SDF-1-treated physes was indistinct, and the cartilage column was replaced by vessels and new bone formation, similar to normal physeal closure (Fig. 8B-a). To determine whether the SDF-1 induced physeal closure involves stimulation of chondrocyte hypertrophy, 5000 cells were microdissected through laser capture from the proliferative and hypertrophic zones of the proximal tibial physis respectively (Fig. 8A-b and 8A-c). Five thousand cells

243

were also microdissected from the residual growth plate without distinction between the proliferative and hypertrophic zones in the physes treated with SDF-1 for 8 weeks (Fig. 8B-c). Real time RT-PCR results demonstrated that in controls, type X collagen expression was only detectable in the hypertrophic zone and the residual growth plate, but not in the proliferative zone. After SDF-1 treatment for 4 weeks, Col X mRNA levels were increased in the hypertrophic zone compared to control (Fig. 8C). After SDF-1 treatment for 2 weeks, Col X mRNA levels were not increased compared to control. The Col X mRNA level in the residual growth plate of the eight-week SDF-1 treatment group was equivalent to that in the hypertrophic zone of the control rabbits (Fig. 8C). Discussion The cartilaginous growth plate determines the size and shape of a long bone by maintaining sequential differentiation of chondrocytes

Fig. 8. SDF-1 infusion results in the tibial physeal closure and stimulates type X collagen expression. Tissue sections of rabbit proximal tibiae treated with SDF-1 (SDF-1 treatment) or PBS (No-SDF-1 treatment) for 8 weeks were stained with safranin O for gross morphology (A-a and B-a). Unstained sections were used for chondrocyte microdissection by laser capture with captured area indicated by blue shade (A-b, A-c and B-c). The PBS-treated control rabbit physis (A-a) demonstrates normal growth plate morphology with a distal hypertrophic zone. The SDF-1-treated rabbit physis (B-a) exhibits marked thinning without distinction between proliferative and hypertrophic zone remnants. There was disorganization of cell columns; scattered hypertrophic chondrocytes; and vascular, as well as osseous, invasion into the growth plate remnant (B-a and B-b). These features are consistent with physeal closure. Brackets on two photomicrographs (A-c and B-c) indicate the height of the physis, defined from the resting zone to the last intact hypertrophic lacuna. Cells were microdissected from the proliferative and hypertrophic zones respectively in the control physis (A-b and A-c), and from the remnant of the growth plate in the SDF-1-treated physis (B-c). Real time PCR results indicate that the expression of type X mRNA was not detectable in the proliferative chondrocytes. Type X collagen expression was significantly increased in the hypertrophic zone of the SDF-1-treated physis at four-week time point in comparison to those from the PBS-treated physis, and remained at the same level in the remnant cartilage when the growth plate was closed after the physis was treated with SDF-1 for 8 weeks (C).

244

L. Wei et al. / Developmental Biology 341 (2010) 236–245

Fig. 8 (continued).

from proliferation to hypertrophy, and by regulating the production rate of hypertrophic chondrocytes. Misregulation of this process may lead to chondrodysplasia. The signaling pathways regulating growth plate chondrocyte hypertrophy are not completely understood. There are two major transition points regulating chondrocyte hypertrophy. The first is the entry of the hypertrophic stage from proliferation, which occurs mainly in the pre-hypertrophic zone that expresses the Ihh and PTHrP receptors. Previous studies have suggested a negative feedback loop in which Ihh induces PTHrP at the proximal end of the growth plate, whose interaction with its receptor in the pre-hypertrophic zone potently inhibits chondrocyte entry into hypertrophy (Vortkamp et al., 1996). The second transition point is the exit of hypertrophic cartilage to bone, which occurs at the chondro-osseous junction. Previous studies have shown that this transition requires degradation of hypertrophic cartilage, which is not only mediated by metalloproteinases including MMP 9 and 13 in hypertrophic chondrocytes (Vu et al., 1998), but also is induced by the presence of cells from the bone marrow area in the chondro-osseous junction (Cole et al., 1992). However, the molecular nature of this induction remains elusive. Our study suggests that the chemokine stromal cell-derived factor 1 (SDF-1) may be involved in this process. We found that SDF-1 and its receptor CXCR4 are expressed in a complementary pattern at the chondro-osseous junction in the growth plate, with hypertrophic cartilage positive for the receptor CXCR4, and its adjacent bone marrow

expressing the ligand SDF-1. Interestingly, such a complementary expression pattern of SDF-1/CXCR4 exists in a wide variety of opposed tissue pairs during development, including gastrular mesoderm/ ectoderm, vascular endothelium/mesoderm, thyroid endodermal epithelium/mesenchyme, and nasal ectodermal epithelium/mesenchyme (McGrath et al., 1999). Such a complementary gene expression pattern results in a paracrine regulatory mechanism in which an SDF-1 producing tissue induces the development of the opposing tissue that expresses CXCR4. Based on this complementary gene expression pattern in the growth plate, we hypothesized that SDF-1 from bone marrow induces and/or enhances differentiation and degradation of hypertrophic cartilage, which expresses CXCR4. In this study, we tested this hypothesis directly by examining the role of the chemokine SDF-1 and its receptor CXCR4 in this regulatory process in cells, organ cultures, and in vivo. We found that transfection of CXCR4 into proliferative chondrocytes resulted in a dose-dependent increase of MMP-13 and type X collagen in response to SDF-1 treatment. Both MMP-13 and type X collagen are well-known markers for hypertrophic chondrocytes. In organ culture, SDF-1 is capable of diffusing into sternal cartilage rapidly and accumulates around chondrocytes. This suggests that SDF-1 synthesized by cells in bone marrow may be capable of diffusing into the adjacent cartilage in the chondro-osseous junction. Previous data have shown that SDF-1 binds to glycosaminoglycans in the extracellular matrix or on the cell surface (Fermas et al., 2008; Uchimura et al., 2006; Mbemba et al., 1999). Such binding may stabilize SDF-1 and result in its accumulation around chondrocytes. We have shown that, when a tibia growth plate was incubated with SDF-1, SDF-1 stimulated elongation of the hypertrophic zone at the distal end of the growth plate towards the proximal end. However, it did not result in a neo hypertrophic zone at the top of the growth plate. How is this polarity achieved? Our data suggest that this zone specific induction may be due to the specific expression of the SDF-1 receptor CXCR4 in the hypertrophic cartilage. We have shown that induction of hypertrophic chondrocyte markers, including Runx2, Col X, and MMP-13 in chondrocytes, requires the presence and interaction of both SDF-1 and CXCR4. In organ culture, although SDF-1 infiltrates the growth plate tissue in all directions, only the distal region of a growth plate contains CXCR4, and this is the area where hypertrophy is enhanced by SDF-1. Since a major source of SDF-1 in vivo is from cells in the bone marrow area at the chondro-osseous junction adjacent to the hypertrophic cartilage, these cells may be involved in inducing the hypertrophic cartilage phenotype including synthesis of type X collagen and MMP-13 (Inada et al., 2004). The in vivo effects of SDF-1 on gene expression in the growth plate were consistent with our in vitro findings. Elevation of SDF-1 concentration in rabbit growth plates in vivo leads to increased type X collagen gene expression, degradation of the cartilage matrix, potentially from MMP-13, and premature closure of the growth plate (Lee et al., 2007). Thus, the closure of growth plate in the SDF-1-treated physis is associated with stimulation of chondrocyte hypertrophy. Interaction of SDF-1 and CXCR4 in articular chondrocytes results in up-regulation and release of MMP-3, -9, and -13 (Kanbe et al., 2002; Kanbe et al., 2004). Interestingly, high concentration of SDF-1, which occurs in the synovium of rheumatoid arthritis and osteoarthritis patients, results in death of articular chondrocytes (Lei Wei et al., 2006). Since chondrocytes from the hypertrophic zone of a growth plate and those from OA articular cartilage share some common features including up-regulation of Col X and MMP-13, one may hypothesize that a high concentration of SDF-1 may also contribute to cell death occurring in the chondro-osseous junction in the growth plate, similar to that in OA cartilage. This hypothesis remains to be tested. Our study reveals a role for Runx2, a transcription factor critical for bone formation (Dong et al., 2006; Ducy et al., 1997; Kamekura et al., 2006; Komori et al., 1997; Yoshida et al., 2004; Zou et al., 2006) in regulating chondrocyte hypertrophy by SDF-1/CXCR4 signaling. This

L. Wei et al. / Developmental Biology 341 (2010) 236–245

role is twofold. First, Runx2 mediates SDF-1 induction of chondrocyte hypertrophy. We have shown that treating the CXCR4 cDNA transfected proliferating chondrocytes with SDF-1 resulted in a significant increase of Runx2 mRNA and protein levels. Runx2, in turn, was involved in activating Col X expression. Recent data have shown that SDF-1 also regulates osteoblast properties through Runx2 (Zhu et al., 2007). Second, Runx2 up-regulates CXCR4 in hypertrophic chondrocytes. Through Runx2 over-expression and knock-down experiments, we demonstrated that Runx2 plays an important role for CXCR4 expression in hypertrophic chondrocytes. Thus, our findings suggest a positive feedback loop in which Runx2 regulates chondrocyte differentiation through activation of SDF-1/CXCR4 signaling; and activation of SDF-1/ CXCR4 signaling further enhances Runx2 expression, thereby inducing chondrocyte hypertrophy. Acknowledgments This project was supported by grants AR052479, AG14399, AG00811, P20RR024484 from NIH, and a grant from the Aircast Foundation. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Center of Research Resources or the National Institutes of Health. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ydbio.2010.02.033. References Chen, Q., Johnson, D.M., Haudenschild, D.R., Tondravi, M.M., Goetinck, P.F., 1995. Cartilage matrix protein forms a type II collagen-independent filamentous network: analysis in primary cell cultures with a retrovirus expression system. Mol. Biol. Cell 6, 1743–1753. Cole, A.A., Luchene, L.J., Linsenmayer, T.F., Schmid, T.M., 1992. The influence of bone and marrow on cartilage hypertrophy and degradation during 30-day serum-free culture of the embryonic chick tibia. Dev. Dyn. 193, 277–285. Dong, Y.F., Soung, D.Y., Schwarz, E.M., O'Keefe, R.J., Drissi, H., 2006. Wnt induction of chondrocyte hypertrophy through the Runx2 transcription factor. J. Cell. Physiol. 208, 77–86. Ducy, P., Zhang, R., Geoffroy, V., Ridall, A.L., Karsenty, G., 1997. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. [see comment]. Cell 89, 747–754. Fermas, S., Gonnet, F., Sutton, A., Charnaux, N., Mulloy, B., Du, Y., Baleux, F., Daniel, R., 2008. Sulfated oligosaccharides (heparin and fucoidan) binding and dimerization of stromal cell-derived factor-1 (SDF-1/CXCL 12) are coupled as evidenced by affinity CE-MS analysis. Glycobiology 18, 1054–1064. Gibson, G.J., Flint, M.H., 1985. Type X collagen synthesis by chick sternal cartilage and its relationship to endochondral development. J. Cell Biol. 101, 277–284. Inada, M., Wang, Y., Byrne, M.H., Rahman, M.U., Miyaura, C., Lopez-Otin, C., Krane, S.M., 2004. Critical roles for collagenase-3 (Mmp13) in development of growth plate cartilage and in endochondral ossification. Proc. Natl. Acad. Sci. USA 101, 17192–17197. Jo, D.Y., Rafii, S., Hamada, T., Moore, M.A., 2000. Chemotaxis of primitive hematopoietic cells in response to stromal cell-derived factor-1. J. Clin. Invest. 105, 101–111. Jung, Y., Wang, J., Schneider, A., Sun, Y.X., Koh-Paige, A.J., Osman, N.I., McCauley, L.K., Taichman, R.S., 2006. Regulation of SDF-1 (CXCL12) production by osteoblasts; a possible mechanism for stem cell homing. Bone 38, 497–508. Kamekura, S., Kawasaki, Y., Hoshi, K., Shimoaka, T., Chikuda, H., Maruyama, Z., Komori, T., Sato, S., Takeda, S., Karsenty, G., Nakamura, K., Chung, U.-i., Kawaguchi, H., 2006. Contribution of runt-related transcription factor 2 to the pathogenesis of osteoarthritis in mice after induction of knee joint instability. Arthritis Rheum. 54, 2462–2470. Kanbe, K., Takagishi, K., Chen, Q., 2002. Stimulation of matrix metalloprotease 3 release from human chondrocytes by the interaction of stromal cell-derived factor 1 and CXC chemokine receptor 4. [see comment]. Arthritis Rheum. 46, 130–137. Kanbe, K., Takemura, T., Takeuchi, K., Chen, Q., Takagishi, K., Inoue, K., 2004. Synovectomy reduces stromal-cell-derived factor-1 (SDF-1) which is involved in the destruction of cartilage in osteoarthritis and rheumatoid arthritis. J. Bone Joint Surg. Br. 86, 296–300.

245

Kollet, O., Shivtiel, S., Chen, Y.-Q., Suriawinata, J., Thung, S.N., Dabeva, M.D., Kahn, J., Spiegel, A., Dar, A., Samira, S., Goichberg, P., Kalinkovich, A., Arenzana-Seisdedos, F., Nagler, A., Hardan, I., Revel, M., Shafritz, D.A., Lapidot, T., 2003. HGF, SDF-1, and MMP-9 are involved in stress-induced human CD34+ stem cell recruitment to the liver. J. Clin. Invest. 112, 160–169. Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R.T., Gao, Y.H., Inada, M., Sato, M., Okamoto, R., Kitamura, Y., Yoshiki, S., Kishimoto, T., 1997. Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. [see comment]. Cell 89, 755–764. Lee, M.C., Bier, A.D., Nickisch, F., Eberson, C.P., Ehrlich, M.G., Chen, Q., 2007. Epiphysiodesis with infusion of stromal cell-derived factor-1 in rabbit growth plates. J. Bone Joint Surg. Am. 89, 102–113. Lei Wei, X.S., Wang, Z., Sun, C., Kanbe, K., Terek, R., Chen, Q., 2006. Chondrocyte death induced by pathological concentration of chemokine stromal cell-derived factor-1. J. Rheum. 33. Ma, Q., Jones, D., Borghesani, P.R., Segal, R.A., Nagasawa, T., Kishimoto, T., Bronson, R.T., Springer, T.A., 1998. Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and SDF-1-deficient mice. Proc. Natl. Acad. Sci. USA 95, 9448–9453. Mbemba, E., Benjouad, A., Saffar, L., Gattegno, L., 1999. Glycans and proteoglycans are involved in the interactions of human immunodeficiency virus type 1 envelope glycoprotein and of SDF-1alpha with membrane ligands of CD4(+) CXCR4(+) cells. Virology 265, 354–364. McGrath, K.E., Koniski, A.D., Maltby, K.M., McGann, J.K., Palis, J., 1999. Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev. Biol. 213, 442–456. Mohle, R., Bautz, F., Rafii, S., Moore, M.A., Brugger, W., Kanz, L., 1998. The chemokine receptor CXCR-4 is expressed on CD34+ hematopoietic progenitors and leukemic cells and mediates transendothelial migration induced by stromal cell-derived factor-1. Blood 91, 4523–4530. Pulsatelli, L., Dolzani, P., Piacentini, A., Silvestri, T., Ruggeri, R., Gualtieri, G., Meliconi, R., Facchini, A., 1999. Chemokine production by human chondrocytes. J. Rheum. 26, 1992–2001. Sabo, E., Meitner, P.A., Tavares, R., Corless, C.L., Lauwers, G.Y., Moss, S.F., Resnick, M.B., 2008. Expression analysis of Barrett's esophagus-associated high-grade dysplasia in laser capture microdissected archival tissue. Clin. Cancer Res. 14, 6440–6448. Schmid, T.M., Linsenmayer, T.F., 1985. Developmental acquisition of type X collagen in the embryonic chick tibiotarsus. Dev. Biol. 107, 373–381. Sun, Y.X., Schneider, A., Jung, Y., Wang, J., Dai, J., Cook, K., Osman, N.I., Koh-Paige, A.J., Shim, H., Pienta, K.J., Keller, E.T., McCauley, L.K., Taichman, R.S., 2005. Skeletal localization and neutralization of the SDF-1(CXCL12)/CXCR4 axis blocks prostate cancer metastasis and growth in osseous sites in vivo. J. Bone Miner. Res. 20, 318–329. Uchimura, K., Morimoto-Tomita, M., Bistrup, A., Li, J., Lyon, M., Gallagher, J., Werb, Z., Rosen, S.D., 2006. HSulf-2, an extracellular endoglucosamine-6-sulfatase, selectively mobilizes heparin-bound growth factors and chemokines: effects on VEGF, FGF-1, and SDF-1. BMC Biochem. 7, 2. Vortkamp, A., Lee, K., Lanske, B., Segre, G.V., Kronenberg, H.M., Tabin, C.J., 1996. Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein [see comments]. Science 273, 613–622. Vu, T.H., Shipley, J.M., Bergers, G., Berger, J.E., Helms, J.A., Hanahan, D., Shapiro, S.D., Senior, R.M., Werb, Z., 1998. Mmp-9/gelatinase B is a key regulator of growth plate angiogenesis and apoptosis of hypertrophic chondrocytes. Cell 93, 411–422. Wang, X., Manner, P.A., Horner, A., Shum, L., Tuan, R.S., Nuckolls, G.H., 2004. Regulation of MMP-13 expression by RUNX2 and FGF2 in osteoarthritic cartilage. Osteoarthritis Cartilage 12, 963–973. Wei, L., Sun, X., Terek, R., Chen, Q., 2006. CD95 induced osteoarthritic chondrocytes apoptosis and necrosis: dependency on p38 mitogen-activated protein kinase. Arthritis Res. Ther. 8, R37. Yoshida, C.A., Yamamoto, H., Fujita, T., Furuichi, T., Ito, K., Inoue, K.I., Yamana, K., Zanma, A., Takada, K., Ito, Y., Komori, T., 2004. Runx2 and Runx3 are essential for chondrocyte maturation, and Runx2 regulates limb growth through induction of Indian hedgehog. Genes Dev. 18, 952–963. Zhen, X., Wei, L., Wu, Q., Zhang, Y., Chen, Q., 2001. Mitogen-activated protein kinase p38 mediates regulation of chondrocyte differentiation by parathyroid hormone. J. Biol. Chem. 276, 4879–4885. Zhu, W., Boachie-Adjei, O., Rawlins, B.A., Frenkel, B., Boskey, A.L., Ivashkiv, L.B., Blobel, C.P., 2007. A novel regulatory role for stromal-derived factor-1 signaling in bone morphogenic protein-2 osteogenic differentiation of mesenchymal C2C12 cells. J. Biol. Chem. 282 (26), 18676–18685. Zou, L., Zou, X., Li, H., Mygind, T., Zeng, Y., Lu, N., Bunger, C., 2006. Molecular mechanism of osteochondroprogenitor fate determination during bone formation. Adv. Exp. Med. Biol. 585, 431–441.