Stimulation of cyclic guanosine monophosphate production by natriuretic peptide in human biliary cells

GASTROENTEROLOGY 1998;114:782–790

Stimulation of Cyclic Guanosine Monophosphate Production by Natriuretic Peptide in Human Biliary Cells MARIE V. ST–PIERRE,* THORSTEN SCHLENKER,‡ JEAN–FRANC¸OIS J. DUFOUR,* DOUGLAS M. JEFFERSON,*,§ J. GREGORY FITZ,‡ and IRWIN M. ARIAS* *Department of Physiology, Tufts University School of Medicine, Boston, Massachusetts; ‡Department of Medicine, Duke University and Veterans Administration Medical Centers, Durham, North Carolina; and §Departments of Pediatrics and Medicine, New England Medical Center, Boston, Massachusetts

Background & Aims: Guanosine 38,58-cyclic monophosphate (cGMP), whose production is stimulated by the interaction of nitric oxide, natriuretic peptides, and guanylin with their respective guanylate cyclases, activates secretion through ion channels in several epithelia. Cl2 channels have been identified in the apical membrane of biliary epithelial cells. The aim of this study was to investigate the production of cGMP and its effects on Cl2 permeability in biliary epithelial cells. Methods: Halide efflux measurement, whole-cell patch clamp recording, radioimmunoassay, and reversetranscription polymerase chain reaction using two human biliary cell lines (H69 and Mz-ChA-1) were performed. Results: In cells equilibrated with 125I, bromo-cGMP stimulated halide efflux by 22%. In wholecell patch clamp recordings, the addition of cGMP intracellularly, or of atrial natriuretic peptide extracellularly, stimulated inward currents at negative membrane potentials, consistent with Cl2 efflux through open channels. In H69 cells, atrial and C-type natriuretic peptides stimulated production of cGMP. MzChA-1 responded only to atrial natriuretic peptide. Both cell lines expressed messenger RNA for the guanylate cyclase type A receptor and the guanylate cyclase free-clearance receptor. Conclusions: These data suggest that natriuretic peptide stimulates cGMP production in human biliary epithelial cells, which in turn may regulate ductular bile formation through the opening of Cl2 channels.

iliary epithelial cells (BECs) act in concert with hepatocytes to regulate the composition and volume of bile.1 The extent of the contribution by BECs to bile formation is species dependent, ranging from 10% to 13% in rats2 to .25% in humans.3 At least three signaling molecules that regulate the function of BECs have been identified. Secretin, acting through its receptors, stimulates adenosine 38,58-cyclic monophosphate (cAMP) production and activates cAMP-dependent apical chloride channels4 and Cl2/HCO32 exchange,5 which results in a bicarbonate-rich choleresis.6 Somatostatin

B

binds to its type 2 receptor on biliary epithelium, decreases cellular cAMP, and causes a bicarbonate-poor cholestasis.7 Adenosine triphosphate, which is present in bile,8 activates purinergic receptors in the apical membrane of biliary cells and stimulates apical Cl2 secretion.9,10 Little is known about additional mechanisms that regulate the function of bile ductular cells, although the presence of muscarinic receptors11 has been proposed. The second messenger guanosine 38,58-cyclic monophosphate (cGMP) stimulates Cl2 secretion through the cystic fibrosis transmembrane conductance regulator (CFTR)12 in intestinal epithelial cells. cGMP mediates the actions of natriuretic peptides,13 guanylin,14 and nitric oxide.15 Its formation is catalyzed by a family of guanylate cyclases (GCs), of which three (GC-A, GC-B, and GC-C) are transmembrane proteins that transduce the effects of atrial natriuretic peptide (ANP), C-type natriuretic peptide (CNP), and guanylin, respectively,16 and the fourth is a soluble GC that is activated by NO.15 Escherichia coli heat-stable enterotoxin (STa) is also an agonist for GC-C. Because CFTR has been localized to the apical domain of cholangiocytes17 and because a Cl2 secretory defect has been associated with liver disease in cystic fibrosis,18 we investigated whether cGMP elicits a secretory response in two human biliary cell lines and whether CFTR might be involved in this response. We further investigated the expression of natriuretic peptide receptor isoforms that could stimulate production of cGMP in human BECs. Abbreviations used in this paper: ANP, atrial natriuretic peptide; bcGMP, 8-bromo–cyclic guanosine monophosphate; BEC, biliary epithelial cell; CFTR, cystic fibrosis transmembrane conductance regulator; CNP, C-type natriuretic peptide; dbcAMP, dibutyryl cyclic adenosine monophosphate; GC, guanylate cyclase; ECl, Cl2 equilibrium potential; EK, K1 equilibrium potential; IBMX, isobutylmethylxanthine; ICl, inward current carried by Cl; IK, outward current carried by K1; NPPB, 5-nitro-2-(3-phenylpropylamino)-benzoic acid; SNP, sodium nitroprusside; STa, Escherichia coli heat-stable enterotoxin. r 1998 by the American Gastroenterological Association 0016-5085/98/$3.00

April 1998

CYCLIC GMP PRODUCTION IN HUMAN BILIARY CELLS

Materials and Methods Materials 125Iodine was purchased from Dupont New England Nuclear Corp. (Boston, MA). 5-Nitro-2-(3-phenyl-propylamino)-benzoic acid (NPPB) was obtained from Biomol Research Laboratories (Plymouth Meeting, PA) and 125I-a-ANP (human) from Peninsula Laboratories (Belmont, CA). Deoxyribonuclease 1 was purchased from Boehringer Mannheim (Indianapolis, IN) and TRIZOL reagent, reverse-transcriptase enzyme (Superscript II), and Taq DNA polymerase from GIBCO BRL (Gaithersburg, MD). 8-Bromo-cGMP (bcGMP), sodium nitroprusside (SNP), STa, ANP, CNP, and all other reagents were from Sigma Chemical Co. (St. Louis, MO).

BEC Lines The following two BEC lines were used. (1) Mz-ChA-1, a cell line derived from a human cholangiocarcinoma of the gallbladder,19 expresses the biliary epithelial markers cytokeratin 19 and g-glutamyltranspeptidase.20 Cells were maintained in continuous culture for a maximum of 16 days before study. (2) H69 are SV-40 immortalized cells derived from normal human intrahepatic biliary epithelium. They express gglutamyltranspeptidase and cytokeratins 7 and 19 and are negative for hepatocyte markers.21 Cells were used between passages 8 and 15. 125Iodide

Efflux Studies

was used as a marker for membrane Cl2 permeability in an isotope efflux assay designed to measure the timeaveraged efflux of halide.22 Monolayers of H69 (90% confluence) and Mz-ChA-1 cells (confluent) were equilibrated with 125I (15 µCi/mL) for 4 hours in Hank’s buffer (pH 7.3) containing 1 mmol/L CaCl2 and 1 mmol/L MgCl2 and were then rinsed (3 3 1 minute) in isotope-free buffer. bcGMP (1 mmol/L) or buffer (control group) was added, and at 5 minutes, the entire extracellular medium was removed, and the cells were lysed. In additional experiments, Mz-ChA-1 cells were stimulated with 1 mmol/L dibutyryl cyclic adenosine monophosphate (dbcAMP), a membrane-permeable analogue of cAMP. 125I was quantitated in a gamma counter (Beckman Gamma 5500; Beckman Instruments, Fullerton, CA). Results were calculated as the ratio counts per minute 125Iextracellular/(counts per minute 125Iextracellular 1 intracellular) and are presented as a percentage of the value in control cells. The experiment was repeated in the presence of 0.1 mmol/L NPPB, a chloride channel blocker.23 Studies were performed in triplicate on three successive days. 125I

Patch Clamp Recordings K1 and Cl2 currents were measured using the wholecell patch clamp recording technique24 at 22–25°C, 12–48 hours after Mz-ChA-1 cells were plated on coverslips. Cells were viewed through an inverted phase-contrast microscope with Hoffman optics at a magnification of 6003 (Olympus IMT-2). Patch pipettes were pulled from Corning 7052 glass

783

(Garner Glass, Claremont, CA) and had resistances of 3–6 MV. Recordings were made with an Axopatch IC amplifier (Axon Instruments, Foster City, CA), and signals were filtered at 2-kHz bandwidth using a four-pole low-pass Bessel filter. Currents were recorded on a Gould 2400 chart recorder (Gould, Cleveland, OH) and were also digitized (5 kHz) for storage on a computer (Compaq Deskpro 386/20e; Compaq, Houston, TX). Currents were analyzed with pClamp software (version 6; Axon Instruments). Pipette voltages were referenced to the bath, where Vp corresponds to the membrane potential and upward deflections of the current trace represent outward membrane current. Values were normalized for cell size and are presented as current density (picoamperes/picofarad, pA/pF), and n equals the number of cells.

Bath and Pipette Solutions The standard NaCl-rich extracellular solution (pH 7.3) contained the following (in mmol/L): NaCl, 140; KCl, 4; KH2PO4, 1; MgCl2, 2; CaCl2, 1; glucose, 5; and HEPES/ NaOH, 10; with a total Cl2 concentration of 150 mmol/L. The standard KCl-rich pipette (intracellular) solution (pH 7.3) contained the following: 1 mmol/L adenosine triphosphate, 130 mmol/L KCl, 10 mmol/L NaCl, 2 mmol/L MgCl2, 10 mmol/L HEPES/KOH, and free Ca21 adjusted to 100 nmol/L (0.5 mmol/L CaCl2 and 1 mmol/L ethylene glycol-bis[baminoethyl ether]-N,N,N8,N8-tetraacetic acid); with a total Cl2 concentration of 145 mmol/L.25 Where indicated, ANP, cGMP, and/or the phosphodiesterase inhibitor isobutylmethylxanthine (IBMX) were added to the pipette solution, and bcGMP was added to the bath.

cGMP Assays in BECs and Medium H69 and Mz-ChA-1 cells were incubated in serum-free media for 2 hours, and then IBMX (0.5 mmol/L) was added. Thirty minutes later, cells were stimulated with 1 mmol/L SNP, 1 µmol/L ANP, 1 µmol/L CNP, or 250 U/mL STa for 30 minutes in the continued presence of IBMX. Phosphoramidon (1 µmol/L), which inhibits an enkephalinase that degrades natriuretic peptides,25 was added with the agonists ANP and CNP. The medium was collected, and the cells were treated with 0.1N HCl. cGMP was measured in media and cellular extracts by radioimmunoassay (kit NEX-133; Dupont New England Nuclear Corp.). The protein pellet was resuspended in 1N NaOH and was assayed by the method of Lowry et al.,26 using bovine serum albumin standards. 125I-ANP

Binding

In preliminary studies, specific binding of 125I-ANP was maximal after 30-minute incubations and when cells were subconfluent. Therefore, all binding assays were performed for 30 minutes with subconfluent (80% confluence) monolayers of H69 and Mz-ChA in 24-well plates, as described by Cahill and Hassid.27 Cells were washed twice in serum-free minimal essential medium containing 2 mg/mL bovine serum albumin and 20 mmol/L HEPES, pH 7.4 (binding buffer) and were then incubated with 0.2 nmol/L (0.05 µCi) 125I-ANP in the absence

784

ST–PIERRE ET AL.

or presence of 0.1–20 nmol/L of unlabeled peptide at 25°C. Specific binding was determined as the difference between total binding and nonspecific binding (measured in the presence of 1 µmol/L unlabeled ANP). Cells were washed quickly (34) with ice-cold binding buffer and solubilized in 1N NaOH for 15 minutes at 37°C, and an aliquot was taken for quantitation of radioactivity. After neutralization with an equal volume of 1N HCl, the protein concentration was determined. All studies were performed in duplicate three times.

Reverse-Transcription and Amplification by Polymerase Chain Reaction Total RNA was isolated from cells by a TRIZOL reagent extraction method and treated with deoxyribonuclease I. A complementary DNA (cDNA) strand was synthesized from 10 µg RNA with reverse transcriptase and random hexamers and served as template DNA for the polymerase chain reaction (PCR) amplification. The oligonucleotide primers for the human GC-A receptor28 (sense, TTCGGTGTCAAGGACGAGT; and antisense, TTCTCGGGATCCATATCCCAGAGGGAGAGG) were designed by Ohsaki et al.29 to give a PCR product of 814 base pairs (bp). The primers for the natriuretic peptide clearance receptor, which are complementary to the bovine cDNA30 but have been shown to hybridize with clearance receptor messenger RNA (mRNA) from human tissue,31 predicted a PCR fragment of 573 bp: ATCGTGCGCCACATCCAGGCCAGT (sense) and TCCAAAGTAATCACCAATAACCTCCTGGGTACCCGC (antisense). The conditions for PCR amplification were as follows: 94°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute (39 cycles), and 72°C for 10 minutes. Amplification of b-actin cDNA was performed31 to assess whether the RNA extraction, reverse transcription, and cDNA amplification were efficient. PCR products were size-fractionated by electrophoresis in a 1.8% agarose gel. Nested primers were designed to amplify regions between the first set of primers. An aliquot (1/100) of the initial PCR reaction was subjected to reamplification with two nested sequences for GC-A: CCTGAAGCAGTTAAAACACCTG (sense 1), ACGAGTATGCGCTGACCACCC (sense 2), and AGAAGTCTGTTTCCCGATCGCCACTG (antisense). Amplification with sense 1 and antisense primers predicted a product of 777 bp, whereas sense 2 and antisense primers predicted a product of 251 bp. The nested sequences for the natriuretic peptide clearance receptor were AATATCCAGGCCAGTGAGAGA (sense) and CAATCACAGAGAAATCCCCATA (antisense) and predicted a PCR product of 510 bp. To confirm the identity of the amplified products, the nested PCR products were separated by electrophoresis on a low-melting agarose gel, extracted by digestion with b-agarase, and then sequenced (DNA Sequencer 373; Applied Biosystems Inc., Foster City, CA).

Statistical Analysis Data are presented as means 6 SD. Differences were analyzed by analysis of variance followed by the Newman– Keuls test for comparisons between several groups or by paired

GASTROENTEROLOGY Vol. 114, No. 4

t test for comparisons between a set of observations and its own control (Statistica Software; Statsoft, Tulsa, OK). a levels of ,0.05 were considered significant.

Results Iodide Efflux in BECs To assess whether cGMP could increase membrane anion permeability, 125I efflux was measured in BECs exposed to 1 mmol/L bcGMP for 5 minutes. Preliminary studies showed that the effect of bcGMP was sustained for 5 minutes (data not shown). In H69 and Mz-ChA-1, bcGMP increased 125I efflux by 24% and 20%, respectively, compared with control values (P , 0.05) (Figures 1 and 2). This effect was blocked by 0.1 mmol/L NPPB. dbcAMP (1 mmol/L) also induced an NPPB-inhibitable increase in 125I efflux compared with control values in Mz-ChA-1 cells (Figure 2). Patch Clamp Recordings cGMP-activated ion movement was further characterized by patch clamp recordings. Whole cell currents were measured at a holding potential of 240 mV and at different test potentials (0 and 280 mV). With the KCl-rich pipette solution, outward currents carried by K1 (Ik) were measured at the Cl2 equilibrium potential (ECl, 0 mV), and inward currents carried by Cl2 (ICl) (representing Cl2 efflux) were measured at the K1 equilibrium potential (EK, 280 mV). Under basal conditions, both IK and ICl were low (IK 5 20.86 6 0.56 pA/pF, n 5 15; ICl 5 20.08 6 0.45 pA/pF, n 5 19). Three approaches investigated the cGMP-stimulated currents. First, when cGMP (500 µmol/L) alone was included in the pipette solution, there was a small

Figure 1. Time-averaged effect of bcGMP on 125I efflux from human BECs. H69 cells were loaded for 4 hours with 125I in Hank’s balanced salt solution. Saline (CON) or bcGMP (1 mmol/L) was added in the presence and absence of the chloride channel inhibitor NPPB. 125I was measured in the medium and cell lysate after 5 minutes. bcGMP stimulated 125I efflux by 24% (*P , 0.05) compared with controls. This increase was abolished by NPPB. Data represent the means 6 SD of three experiments in triplicate.

April 1998

Figure 2. Time-averaged effect of cyclic nucleotides on 125I efflux in human BECs. Mz-ChA-1 cells were loaded for 4 hours with 125I as described in Figure 1. Saline (CON), bcGMP (1 mmol/L), or dbcAMP (1 mmol/L) was added, and 125I was measured in the medium and cell lysate after 5 minutes. 125I efflux was stimulated by 18%–22% by all agonists (*P , 0.05) compared with controls (j) and was abolished by NPPB (§). Data represent the means 6 SD of three experiments in triplicate.

increase in Cl2 current density (24.87 6 0.88 pA/pF; n 5 4) but no significant change in K1 current density (0.31 6 0.33 pA/pF; n 5 4). This response was transient with inactivation for longer than 2–5 minutes. Addition of 1 mmol/L bcGMP to the bath in the presence of IBMX also activated inward currents (ICl) (23.94 6 2.63 pA/ pF; n 5 5) similar to the effect of cGMP. In addition, in three of five cells, a large outward current (IK ) (22.18 6 16.43 pA/pF) preceded ICl. When 500 µmol/L cGMP was added directly to the pipette solution in the presence of 1 mmol/L IBMX (n 5 7), a greater increase in ICl was observed with a maximal current density of 245.91 6 36.75 pA/pF. In five of seven cells, there was concomitant activation of IK of 42.12 6 22.24 pA/pF. IBMX alone had no effect on ICl or IK. Finally, ANP (10 µmol/L) added extracellularly (n 5 3) elicited an increase in ICl with a maximal current density of 213.02 6 7.90 pA/pF without concomitant activation of IK (20.46 6 0.25 pA/pF). A representative recording of the time course of current activities is shown in Figure 3A. Currents and current-voltage relationships measured near the peak activation of IK (Figure 3B) and ICl (Figure 3C) are shown. The effects of cGMP on IK and ICl under different experimental conditions are summarized in Figure 4A and B. cGMP Measurements in BECs To determine whether BECs respond to physiological signals that mediate an increase in cGMP production, intracellular and extracellular levels of cGMP were measured after exposure to four GC agonists. In H69 cells, ANP and CNP (1 µmol/L) increased the intracellular levels of cGMP from a basal level of 0.34 6 0.06 pmol/mg to 217 6 14 and 254 6 30 pmol/mg,

CYCLIC GMP PRODUCTION IN HUMAN BILIARY CELLS

785

respectively (P , 0.005) (Figure 5), suggesting the presence of GC, types A and/or B. The extracellular concentrations of cGMP were also increased by ANP and CNP (44-fold and 82-fold, respectively). In contrast, 1 mmol/L SNP, which spontaneously releases NO, and 250 U/mL STa, an agonist for particulate GC-C, had no effect (Figure 5). ANP was the more potent agonist of cGMP production in H69 cells, as shown by the dose-response studies (Table 1). Phosphoramidon alone had no effect. The GC agonists induced a less marked response in Mz-ChA-1 cells. ANP, but not CNP, significantly increased intracellular cGMP levels 10-fold (from 0.37 6 0.09 to 3.52 6 0.48 pmol/mg; P , 0.05) as well as extracellular cGMP levels (from 0.28 6 0.16 to 0.89 6 0.11 pmol/mg) (Figure 6). STa had no effect.

Figure 3. (A ) Representative whole-cell recording of bcGMP-activated IK and ICl. Currents were measured at a holding potential of 240 mV and at test potentials of 280 and 0 mV. The pipette solution contained 1 mmol/L adenosine triphosphate and 1 mmol/L IBMX; 1 mmol/L bcGMP was added to the bath subsequently. IBMX alone had no effect. (B ) Starting from a holding potential of 240 mV, the currentvoltage relationship was assessed by stepping the potentials between 2120 and 1100 mV in 20-mV increments for 400 milliseconds (inset ). Shown is a representative recording and the current-voltage relationship for IK. The pipette contained 500 mmol/L cGMP and 1 mmol/L IBMX. (C ) Representative recording and current-voltage relationship for ICl. Methods were as described in Figure 3B.

786

ST–PIERRE ET AL.

SNP increased intracellular but not extracellular levels of cGMP (Figure 6). ANP (100 nmol/L) elicited a maximal increase in intracellular cGMP levels (Table 1). The potency of ANP relative to the other agonists suggests that the GC-A receptor mediates the increases in cGMP production. Both Mz-ChA-1 and H69 cells showed specific, saturable binding of 125I-ANP. Scatchard analysis of the data gave dissociation constant estimates of 0.84 and 0.98 nmol/L for H69 and Mz-ChA-1 cells, respectively (Figure 7). The estimated maximal binding value for H69 cells (24.2 fmol/mg protein) was eightfold greater than that in Mz-ChA-1 cells (3.1 fmol/mg protein). These data reflect the higher production of cGMP observed in H69 cells after stimulation with GC agonists. Because many

GASTROENTEROLOGY Vol. 114, No. 4

tissues contain both GC-linked receptors as well as the nonguanylate cyclase clearance receptor (C receptor) and because the affinity of ANP for both receptors is similar,32 reverse-transcription PCR was performed to distinguish between these receptor subtypes. After the first PCR amplification, products of the predicted size were detected in RNA extracts from H69 and Mz-ChA-1 cells (Figure 8A): bands of approximately 814 bp for GC-A, 816 bp for b-actin, as well as the predicted 573 bp for the clearance receptor and a minor band of approximately 490 bp. Bands were absent in those samples from which reverse transcriptase was omitted, indicating that the amplified products originated from cellular mRNA and not contaminating DNA. The second PCR amplification with two sets of nested primers produced bands of the predicted size for GC-A: 251 and 777 bp (Figure 8B). For the clearance receptor, the major PCR product was 510 bp, but a secondary band, approximately 100 bp smaller, was also present. Sequence analysis of the 251-bp and the 510-bp products showed 100% identity with the expected sequences for the GC-A and clearance receptors, respectively. The secondary band amplified with the primers designed for the clearance receptor was 100% identical to the larger band except for the absence of 117 nucleotides at the 58 end. This raises the possibility of a splicing variant of the clearance receptor, as reported by others.33,34

Discussion The actions of cGMP on hepatic function have been studied in the perfused rat liver preparation, where cell-permeable cGMP analogues increase bile acid– independent bile flow as a result of concentrative biliary excretion35 and stimulation of HCO32 secretion.36,37

Figure 4. Comparison of cGMP-activated (A ) ICl (at Vp, 280 mV) and (B ) IK (at Vp, 0 mV) under different experimental conditions (N) compared with initial values (j). Currents are presented as current density and were activated by inclusion of 500 mmol/L cGMP to the pipette solution (ICl, n 5 4 and P , 0.05; IK, n 5 4 and NS), by addition of 1 mmol/L bcGMP to the bath in the presence of a 1 mmol/L IBMX-containing pipette solution (ICl, n 5 5 and NS; IK, n 5 3 and P , 0.05), by inclusion of 500 mmol/L cGMP to the IBMX-containing pipette solution (ICl, n 5 7 and P , 0.05; IK, n 5 5 and P , 0.05), or by addition of 10 mmol/L ANP to the bath (ICl, n 5 3 and P , 0.05; IK, n 5 3 and NS).

Figure 5. Effect of agonists of guanylate cyclase on cGMP levels in a human intrahepatic BEC line. H69 cells were incubated for 2 hours in serum-free medium and then for 30 minutes with 0.5 mmol/L IBMX. cGMP was measured in cell lysates (j) and medium (h) after 30-minute stimulation with agonists in the presence of IBMX. Intracellular and extracellular cGMP increased in response to 1 mmol/L ANP and 1 mmol/L CNP but not in response to 1 mmol/L SNP or 250 U/mL STa. Data represent the means 6 SD.

April 1998

CYCLIC GMP PRODUCTION IN HUMAN BILIARY CELLS

787

Table 1. Dose-Dependent Effect of Natriuretic Peptides on cGMP Levels in BECs H69 cells

Agonist

Intracellular levels (pmol/mg)

Extracellular levels (pmol/mg)

Control Phosphoramidon (1 mmol/L) CNP (10 nmol/L) CNP (100 nmol/L) CNP (1000 nmol/L) ANP (10 nmol/L) ANP (100 nmol/L) ANP (1000 nmol/L)

0.72 6 0.12 0.58 6 0.10 13.7 6 2.1 305.8 6 87.2 312.4 6 78.4 307.9 6 17.9 343.1 6 76.5 485.2 6 60.7

ND ND ND 4.6 6 1.0 30.9 6 5.2 1.9 6 1.1 3.8 6 0.6 19.6 6 9.6

Mz-ChA-1 cells

Agonist

Intracellular levels (pmol/mg)

Extracellular levels (pmol/mg)

Control Phosphoramidon (1 mmol/L)

0.38 6 0.03 0.44 6 0.07

ND 0.17 6 0.31

3.9 6 0.3 4.3 6 0.4 4.3 6 0.3

1.0 6 0.1 1.2 6 0.1 1.1 6 0.2

ANP (10 nmol/L) ANP (100 nmol/L) ANP (1000 nmol/L)

ND, not detectable.

Unlike cAMP, cGMP does not stimulate bile acid– dependent bile flow or transcytosis.35 In intestinal epithelia, electrogenic Cl2 secretion and inhibition of Na1 and Cl2 absorption are cGMP-mediated events that result from activation of GC-C in the apical membrane of enterocytes by guanylin or STa.38 This Cl2 secretion has been attributed to CFTR.39 Because the apical membrane of BECs also contain CFTR-associated Cl2 channels17,40 and because hepatobiliary disease in cystic fibrosis may be linked to a biliary secretory defect, we studied the actions of cGMP in human biliary cell lines. Unlike hepatocytes in which the measured Cl2 activity approaches its electrochemical equilibrium,41 BECs do accumulate Cl2 above electrochemical equilibrium, producing a favorable electrochemical gradient42 that is necessary for Cl2 secretion. The human BECs chosen for these studies represent well-characterized experimental models that possess phenotypic features of biliary origin. Functional assays in the SV40-immortalized intrahepatic biliary cells (H69) have identified cAMP-dependent and P2U-purinoceptor– stimulatable Ca21-sensitive Cl2 conductances,10 as well

Figure 6. Effect of agonists of guanylate cyclase on cGMP levels in human BECs derived from a cholangiocarcinoma of the gallbladder. Mz-ChA-1 cells were stimulated with agonists as described in Figure 5. cGMP was measured in cell lysates (j) and medium (§). Intracellular cGMP increased (10-fold) in response to 1 mmol/L ANP (*P , 0.01) but not in response to CNP and increased sixfold in response to 1 mmol/L SNP (*P , 0.01). Extracellular cGMP was increased only after stimulation with ANP (**P , 0.05).

as an electroneutral Na1-Cl2-HCO32 cotransporter and Cl2-HCO32 exchange.21 An additional class of nucleotide receptors (A2) has been identified in the extrahepatic cholangiocarcinoma cell line (Mz-ChA-1),43 and electro-

Figure 7. Scatchard analysis of 125I-ANP binding in human biliary cells. (A ) H69 cells and (B ) Mz-ChA-1 cells were incubated with 0.05 mCi 125I-ANP and increasing concentrations of unlabeled peptide (0.1–20 nmol/L) for 30 minutes at 257C. Specific binding was calculated from the difference between total binding and nonspecific binding (measured in the presence of 1 mmol/L unlabeled ANP). Maximal binding values were 24.2 and 3.1 fmol/mg protein for H69 and Mz-ChA-1 cells, respectively. Data represent three experiments in duplicate. B/F, bound/free.

788

ST–PIERRE ET AL.

Figure 8. Expression of natriuretic peptide receptor isoforms in human biliary cell lines. PCR was performed with reverse-transcribed (1) or untranscribed (2) total RNA isolated from H69 and Mz-ChA-1 cells. (A ) PCR amplification with primers specific for the GC-A receptor (lane 1, H69; lane 3, Mz-ChA-1), the clearance receptor (lane 5, H69; lane 7, Mz-ChA-1), and b-actin (lane 9, H69; lane 10, Mz-ChA-1) gave PCR products of the expected size. (B ) PCR amplification of an aliquot (1/100) of PCR products obtained as described in A. Nested primers were designed to give fragments of 251 bp (lane 1, H69; lane 3, Mz-ChA-1) and 777 bp (lane 5, H69; lane 7, Mz-ChA-1) for GC-A and a fragment of 510 bp (lane 9, H69; lane 11, Mz-ChA-1) for the clearance receptor. Sequencing of the 251- and 510-bp bands confirmed the identity of GC-A and clearance receptors, respectively.

physiological studies have shown regulation of the Ca21activated Cl2 channels by Ca21/calmodulin-dependent protein kinase44 and activation of apamin-sensitive K1 currents by metabolic stress.45 Moreover, the expression of CFTR in Mz-ChA-1 cells has been detected by immunofluorescence.20 The 125I efflux studies showed an increase in membrane Cl2 permeability in both cell types after stimulation with a cGMP analogue. In Mz-ChA-1, the response to bcGMP was consistent with that achieved with dbcAMP (20% increase over control). Because NPPB, a blocker of Ca21-dependent and cAMP-stimulated Cl2 efflux,20,22 consistently inhibited all agonist-dependent increases in 125I efflux, this argues against an indirect effect of bcGMP on I2 efflux and suggests that a Cl2 conductance pathway is a target for the actions of cGMP. In support of this, the whole cell patch clamp studies of Mz-ChA-1 cells exposed to cGMP in the presence of IBMX showed activation of an inward (depolarizing) current that exhibited properties characteristic of the CFTR-dependent Cl2 channel: a linear current-voltage relation, no time dependence, and reversal at the equili-

GASTROENTEROLOGY Vol. 114, No. 4

brium potential for Cl2.4 Whereas the inward current was unaffected by replacing extracellular Na1 (140 mmol/L) with equimolar Tris, there was a significant inhibition after exposure to NPPB, consistent with a cGMP-stimulated Cl2 current and not a nonselective cation current. The mechanism by which cGMP positively regulates Cl2 channels in biliary epithelium is not addressed in these studies, but by analogy with the actions of cGMP in other Cl2 secreting epithelia,38,46 cGMP may regulate phosphorylation of the CFTR protein by cross-activation of cAMP-dependent protein kinase by cGMP39 or by cGMP-dependent protein kinase (type II).47 cGMP elicited an increase in K1 conductance in 67% of trials. The nature of the K1 channels that respond to cGMP is not known and may reflect the presence of a cGMP-gated cation channel, which has been identified in other tissues.48 Because the cultured Mz-ChA-1 monolayers are a nonpolarized model, the cGMP-stimulated ion currents were not localized to the apical or basolateral domains. However, it is reasonable to speculate that, in differentiated biliary cells in situ where the Cl2 channels are located mainly on the apical membrane, the cGMPinduced channel opening may provoke an increase in biliary Cl2 secretion and contribute to the regulation of hepatic bile flow. We have identified agonists that stimulate the production of cGMP in human BECs and have shown that ANP stimulates inward currents at negative membrane potentials consistent with opening of Cl2 channels. Two natriuretic peptide receptor isoforms exist, one of which is associated with guanylate cyclase activity. These hormones have not been recognized previously as regulators of biliary cell function. The disparity in the responses of H69 and Mz-ChA-1 cells to the agonists suggests heterogeneity in expression of the GC enzymes, possibly caused by the intrahepatic21 and extrahepatic19 origins of the tissues, respectively, or by phenotypic changes that arose in culture. The lower GC activity detected in Mz-ChA-1 compared with H69 cells was also reflected in the binding studies, where the calculated maximal binding was eightfold lower. Because the ANP ligand binds with equal affinity to the GC-A and the clearance receptors, the maximal binding data would reflect the total concentration of both receptors. The reversetranscription PCR confirmed that the clearance receptor, which is widely distributed,27 is present in human biliary cells lines, but the relative density of the two receptor isoforms cannot be measured with this technique. Moreover, the expression levels of GC-A and clearance receptors in vitro may not reflect the pattern found in biliary epithelium in vivo because, in some cell types, GC-A is

April 1998

expressed more abundantly and the clearance receptor less abundantly in freshly isolated tissue than in subcultured cells.49 From 1% to 10% and approximately 25% of the intracellular cGMP formed after ANP stimulation was released from the H69 and Mz-ChA-1 cells, respectively. This shows that a mechanism for the cellular export of cGMP from biliary cells exists, as has been shown for isolated hepatocytes.50 Because the intracellular levels of cGMP achieved in stimulated H69 cells were 70-fold greater than those measured in Mz-ChA-1 cells, this difference in the fraction of cGMP exported may reflect saturation of the secretion process in H69 cells. Whether the export of cGMP is vectorial in polarized BECs and whether there is a physiological role for extracellular cGMP have not been established, although we have shown that bcGMP is excreted concentratively into bile of perfused rat livers, which implies a canalicular localization of transport activity.35 Because of the coexpression of the GC-coupled and clearance receptors, elucidation of the role of natriuretic peptides in biliary physiology will require an appreciation for the interactions between signal transduction pathways. The clearance receptor, which is coupled negatively to adenylate cyclase via a G protein, thereby decreasing cAMP accumulation,51 has been associated with the stimulation of phosphotidylinositol metabolism52 and an antimitogenic effect.53 It is possible that biliary epithelium may be exposed not solely to circulating ANP released from the heart and kidney but also to locally released hormones. Evidence of ANP gene expression was detected in the liver of normal rats,54 and immunoreactivity consistent with the presence of atrial natriuretic factor prohormone in the gallbladder and of a smaller peptide in the bile was reported in other species.55 GC receptor activation at the luminal surface of biliary epithelium may implicate ANP as an additional autocrine and/or paracrine mechanism that regulates bile secretion. In summary, our findings show that BECs respond to natriuretic peptide by increasing intracellular cGMP levels and that there is an appropriate effector pathway downstream that positively regulates biliary Cl2 secretion.

References 1. Nathanson MH, Boyer JL. Mechanisms and regulation of bile secretion. Hepatology 1991;14:551–566. 2. Alpini G, Lenzi R, Zhai W-R, Slott PA, Liu MH, Sarkozi L, Tavoloni N. Bile secretory function of intrahepatic biliary epithelium in the rat. Am J Physiol 1989;257:G124–G133. 3. Erlinger S. Bile flow. In: Arias IM, Boyer JL, Fausto N, Jakoby WB, Schachter DA, Shafritz DA, eds. The liver: biology and pathobiology. New York: Raven, 1994:769–785.

CYCLIC GMP PRODUCTION IN HUMAN BILIARY CELLS

789

4. McGill JM, Basavappa S, Gettys TW, Fitz JG. Secretin activates Cl2 channels in bile duct epithelial cells through a cAMP-dependent mechanism. Am J Physiol 1994;266:G731–G736. 5. Alvaro D, Cho WK, Mennone A, Boyer JL. Effect of secretin on intracellular pH regulation in isolated rat bile duct epithelial cells. J Clin Invest 1993;92:1314–1325. 6. Lenzen R, Alpini G, Tavoloni N. Secretin stimulates bile ductular secretory activity through the cAMP system. Am J Physiol 1992; 263:G527–G532. 7. Tietz PS, Alpini G, Pham LD, LaRusso NF. Somatostatin inhibits secretin-induced ductal hypercholeresis and exocytosis by cholangiocytes. Am J Physiol 1995;32:G110–G118. 8. Chari RS, Schutz SM, Haebig JE, Shimokura GH, Cotton PB, Fitz JG, Meyers WC. Adenosine nucleotides in bile. Am J Physiol 1996;270:G246–G252. 9. Schlenker T, Roman RM, LaRusso N, Fitz JG. ATP stimulates biliary secretion through activation of P2U receptors in the apical membrane: a novel mechanism for regulation of bile formation (abstr). Hepatology 1996;24:255A. 10. Wolkoff LI, Perrone RD, Grubman SA, Lee DW, Soltoff SP, Rogers LC, Beinborn M, Fang SL, Cheng SH, Jefferson DM. Purinergic purinoceptor P2u identification and function in human intrahepatic biliary epithelial cell lines. Cell Calcium 1995;17:375–383. 11. Elsing C, Kassner A, Hu¨bner C, Bu¨hli H, Stremmel W. Absorptive and secretory mechanisms in biliary epithelial cells. J Hepatol 1996;24(Suppl 1):121–127. 12. Goldstein JL, Sahi J, Bhuva M, Layden TJ, Rao MC. Escherichia coli heat-stable enterotoxin-mediated colonic Cl2 secretion is absent in cystic fibrosis. Gastroenterology 1994;107:950–956. 13. Waldman SA, Rapoport RM, Murad F. Atrial natriuretic factor selectively activates particulate guanylate cyclase and elevates cyclic GMP in rat tissues. J Biol Chem 1984;259:14332–14334. 14. Currie MG, Fok KF, Kato J, Moore RJ, Hamra FK, Duffin KL, Smith CE. Guanylin: an endogenous activator of intestinal guanylate cyclase. Proc Natl Acad Sci USA 1992;89:947–961. 15. Schmidt HH, Lohmann SM, Walter W. The nitric oxide and cGMP signal transduction system regulation and mechanism of action. Biochim Biophys Acta 1993;1178:153–175. 16. Garbers DL. Guanylyl cyclase receptors and their endocrine, paracrine and autocrine ligands. Cell 1992;71:1–4. 17. Cohn JA, Strong TV, Picciotto MR, Nairn AC, Collins FS, Fitz JG. Localization of the cystic fibrosis transmembrane conductance regulator in human bile duct epithelial cells. Gastroenterology 1993;105:1857–1864. 18. O’Brien S, Keogan M, Casey M, Duffy G, McErlean D, Fitzgerald MX, Hegarty JE. Biliary complications of cystic fibrosis. Gut 1992;33:387–391. 19. Knuth A, Gabbert H, Dippold W, Klein O, Sachsse W, BitterSuermann D, Prellwitz W, Meyer zum Bu¨schenfelde KH. Biliary adenocarcinoma: characterization of three new human tumor cell lines. J Hepatol 1985;1:579–596. 20. Basavappa S, Middleton J, Mangel AW, McGill JM, Cohn JA, Fitz JG. Cl2 and K1 transport in human biliary cell lines. Gastroenterology 1993;104:1796–1805. 21. Grubman SA, Perrone RD, Lee DW, Murray SL, Rogers LC, Wolkoff LI, Mulberg AE, Jefferson D. Regulation of intracellular pH by immortalized human intrahepatic biliary epithelial cell lines. Am J Physiol 1994;266:G1060–G1070. 22. Venglarik CJ, Bridges RJ, Frizzel RA. A simple assay for agonistregulated Cl2 and K1 conductances in salt-secreting epithelial cells. Am J Physiol 1990;259:C358–C364. 23. Wangemann P, Wittner M, Di Stefano A, Englert HC, Lang HJ, Schlatter E, Greger R. Cl2-channel blockers in the thick ascending limb of the loop of Henle. Structure activity relationship. Pflu¨gers Arch 1986;407:S128–S141. 24. Hamill OP, Marty A, Neher E, Sakman B, Sigworth FJ. Improved patch clamp techniques for high resolution recording from cells

790

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

ST–PIERRE ET AL.

and cell-free membrane patches. Pflugers Arch 1981;391:85– 100. Johnson AR, Aston J, Schulz NN, Erdos EG. Neutral metalloendopeptidase in human lung tissue and cultured cells. Am Rev Respir Dis 1985;132:564–568. Lowry OH, Rosenbrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265– 275. Cahill PA, Hassid A. ANF-C-receptor-mediated inhibition of aortic smooth muscle cell proliferation and thymidine kinase activity. Am J Physiol 1994;266:R194–R203. Lowe DG, Chang M-S, Hellmiss R, Chen E, Singh S, Garbers DL, Goeddel DV. Human atrial natriuretic peptide receptor defines a new paradigm for second messenger signal transduction. EMBO J 1989;8:1377–1384. Ohsaki Y, Yang H-K, Le PT, Jensen RT, Johnson BE. Human small cell lung cancer cell lines express functional atrial natriuretic peptide receptors. Cancer Res 1993;53:3165–3171. Fuller F, Porter JG, Arfsten AE, Miller J, Schilling JW, Scarborough RM, Lewicki J, Schenk DB. Atrial natriuretic peptide clearance receptor. J Biol Chem 1988;263:9395–9401. Nunez DJR, Dickson MC, Brown MJ. Natriuretic peptide receptor mRNAs in the rat and human heart. J Clin Invest 1992;90:1966– 1971. Nair BG, Steinke L, Yu Y-M, Rashed HM, Seyer JM, Patel TB. Increase in the number of atrial natriuretic hormone receptors in regenerating rat liver. J Biol Chem 1991;266:567–573. Savoie P, de Champlain J, Anand-Srivastava MB. C-type natriuretic peptide and brain natriuretic peptide inhibit adenylyl cyclase activity: interaction with ANF-R2/ANP-C receptors. FEBS Lett 1995;370:6–10. Nunez DJ, Vassilikioti S, Brown MJ. The human atrial natriuretic factor (ANF) ‘‘C’’ receptor is encoded by two messenger RNAs. J Physiol 1992;446:307. St-Pierre MV, Dufour JF, Arias IM. Stimulation of bile acid independent bile flow with bromo-cyclic guanosine monophosphate. Hepatology 1996;24:1487–1491. Myers NC, Grune S, Anwer MS. Cyclic GMP stimulates bile acid independent bile formation. Am J Physiol 1996;270:G418– G424. Trauner M, Nathanson MH, Mennone A, Rydberg SA, Boyer JL. Nitric oxide donors stimulate bile flow and glutathione disulfide excretion independent of guanosine 38,58-cyclic monophosphate in the isolated perfused rat liver. Hepatology 1997;25:263–269. Vaandrager AB, De Jonge HR. Effect of cyclic GMP on intestinal transport. In: Murad F, ed. Cyclic GMP. Synthesis, metabolism, and function. Advances in pharmacology. Volume 26. San Diego, CA: Academic, 1994:253–283. Tien X-Y, Brasitus TA, Kaetzel MA, Dedman JR, Nelson DJ. Activation of the cystic fibrosis transmembrane conductance regulator by cGMP in the human colonic cancer cell line, Caco-2. J Biol Chem 1994;269:51–54. Fitz JG, Basavappa S, McGill J, Melhus O, Cohn JA. Regulation of membrane chloride currents in rat bile duct epithelial cells. J Clin Invest 1993;91:319–328. Fitz JG, Scharschmidt BF. Intracellular chloride activity in intact rat liver: relationship to membrane potential and bile flow. Am J Physiol 1987;252:G699–G706. Graf J. Canalicular bile salt-independent bile formation: concepts and clues from electrolyte transport in rat liver. Am J Physiol 1983;244:G233–G246. McGill JM, Basavappa S, Mangel AW, Shimokura GH, Middleton JP, Fitz JG. Adenosine triphosphate activates ion permeabilities in biliary epithelial cells. Gastroenterology 1994;107:236–243. Schlenker T, Fitz JG. Ca21-activated Cl2 channels in a human biliary cell line: regulation by Ca21/calmodulin-dependent protein kinase. Am J Physiol 1996;271:G304–G310.

GASTROENTEROLOGY Vol. 114, No. 4

45. Wang Y, Roman R, Schlenker T, Hannun YA, Raymond J, Fitz JG. Cytosolic Ca21 and protein kinase C alpha couple cellular metabolism to membrane K1 permeability in a human biliary cell line. J Clin Invest 1997;99:2890–2897. 46. McCoy DE, Guggino SE, Stanton BA. The renal cGMP-gated cation channel: its molecular structure and physiological role. Kidney Int 1995;48:1125–1133. 47. Crawford I, Maloney PC, Zeitlin PL, Guggino WB, Hyde SC, Turley H, Gatter KC, Harris A, Higgins CF. Immunocytochemical localization of the cystic fibrosis gene product CFTR. Proc Natl Acad Sci USA 1991;88:9262–9266. 48. Vaandrager AB, Tilly BC, Smolenski A, Schneider-Rasp S, Bot AGM, Edixhoven M, Scholte BJ, Jarchau T, Walter U, Lohmann SM, Poller WC, deJonge HR. cGMP stimulation of cystic fibrosis transmembrane conductance regulator Cl2 channels co-expressed with cGMP-dependent protein kinase type II but not type 1b. J Biol Chem 1996;272:4195–4200. 49. Cahill PA, Hassid A. Differential antimitogenic effectiveness of atrial natriuretic peptides in primary versus subcultured rat aortic smooth muscle cells: relationship to expression of ANF-C receptors. J Cell Physiol 1993;154:28–38. 50. Billiar TR, Curran RD, Harbrecht BG, Stadler J, Williams DL, Ochoa JB, Di Silvio M, Simmons RL, Murray SA. Association between synthesis and release of cGMP and nitric oxide biosynthesis by hepatocytes. Am J Physiol 1992;262:C1077–C1082. 51. Anand-Srivastava MB, Gutkowska J, Cantin M. The presence of atrial-natriuretic-factor receptors of ANF-R2 subtype in rat platelets. Biochem J 1991;278:211–217. 52. Hirata M, Chang C-H, Murad F. Stimulatory effects of atrial natriuretic factor on phosphoinositide hydrolysis in cultured bovine aortic smooth muscle cells. Biochim Biophys Acta 1989; 1010:346–351. 53. Rashed HM, Sun H, Patel TB. Atrial natriuretic peptide inhibits growth of hepatoblastoma (Hep G2) cells by means of activation of clearance receptors. Hepatology 1993;17:677–684. 54. Poulos JE, Gower WR, Fontanet HL, Kalmus GW, Vesely DL. Cirrhosis with ascites increased atrial natriuretic peptide messenger mRNA expression in rat ventricle. Gastroenterology 1995;108: 1496–1503. 55. Oh SH, Cho KW, Kim SH, Jeong GB, Kang CW, Hwang YH, Seul KH, Cho BH. Identification of immunoreactive atrial natriuretic peptide in the gallbladder and bile juice of rabbit, pig and human. Regul Pept 1994;49:217–223.

Received June 6, 1997. Accepted December 4, 1997. Address requests for reprints to: Jean-Franc ¸ois J. Dufour, M.D., Clinical Pharmacology, University of Berne, 35 Murtenstrasse, 3010 Berne, Switzerland. Fax: (41) 31-632-4997. Dr. St-Pierre was supported by the American Liver Foundation and Dr. Dufour by the American Gastroenterological Association. Supported by grant SCHL 380-1-1 (to T.S.) from Deutsche Forschungsgemeinschaft; grant DK-44861 (to D.M.J.) from the National Institutes of Health, Cystic Fibrosis Foundation, and March of Dimes Birth Defect Foundation; grants DK-46082 (to J.G.F.), DK-43278 (to J.G.F.), and DK-35652 (to I.M.A.) from the National Institutes of Health; and grant DK-34928 (to D.M.J. and I.M.A.) from the National Institutes of Health and Center for Gastroenterology Research on Absorptive and Secretory Processes–Cell Culture and Fluorescent Probe Cores. Dr. Schlenker’s current affiliation is: Medizinische Universitaetsklinik, Heidelberg, Germany. Dr. Dufour’s current affiliation is: Department of Clinical Pharmacology, University of Berne, Switzerland. Dr. Fitz’s current affiliation is: Division of Gastroenterology, University of Colorado Health Sciences Center, Denver, Colorado.