STK4 (MST1) deficiency in two siblings with autoimmune cytopenias: A novel mutation

Clinical Immunology 161 (2015) 316–323

Contents lists available at ScienceDirect

Clinical Immunology journal homepage: www.elsevier.com/locate/yclim

STK4 (MST1) deficiency in two siblings with autoimmune cytopenias: A novel mutation Sevil Oskay Halacli a, Deniz Cagdas Ayvaz a, Cagman Sun-Tan a, Baran Erman a, Elif Uz b, Didem Yucel Yilmaz c, Koksal Ozgul c, İlhan Tezcan a, Ozden Sanal a,⁎ a b c

Hacettepe University, Institute of Child Health, Department of Pediatric Immunology, Sihhiye, 06100 Ankara, Turkey Uludag University, Faculty of Arts and Sciences, Department of Molecular Biology and Genetics, 16059 Bursa, Turkey Hacettepe University Medical Faculty, Institute of Child Health, Laboratory of Metabolic Diseases, Sihhiye, 06100 Ankara, Turkey

a r t i c l e

i n f o

Article history: Received 8 October 2014 Received in revised form 6 June 2015 Accepted with revision 18 June 2015 Available online 25 June 2015 Keywords: STK4 deficiency Autoimmune cytopenia T cell deficiency Hyper IgE syndrome

a b s t r a c t Combined immunodeficiencies (CIDs) are heterogeneous group of disorders characterized by abrogated/impaired T cell development and/or functions that resulted from diverse genetic defects. In addition to the susceptibility to infections with various microorganisms, the patients may have lymphoproliferation, autoimmunity, inflammation, allergy and malignancy. Recently, three groups have independently reported patients having mutations in STK4 gene that cause a novel autosomal recessive (AR) CID. We describe here two siblings with a novel STK4 mutation identified during the evaluation of a group of patients with features highly overlapping with those of DOCK-8 deficiency, a form of AR hyperimmunoglobulin E syndrome. The patients' clinical features include autoimmune cytopenias, viral skin (molluscum contagiosum and perioral herpetic infection) and bacterial infections, mild onychomycosis, mild atopic and seborrheic dermatitis, lymphopenia (particularly CD4 lymphopenia), and intermittent mild neutropenia. Determination of the underlying defect and reporting the patients are required for the description of the phenotypic spectrum of each immunodeficiency. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Primary or congenital immunodeficiency (PID) diseases are caused by the defects in the development and/or function of various components of the immune system [1,2]. Based on the underlying mechanisms of diseases, PIDs are grouped in somewhat overlapping eight categories, each of which consists of a large number of diseases [3]. Combined immunodeficiency (CID) is one of these categories which comprises an important part of PIDs with about 40 genetically defined diseases and the number of new combined immunodeficiencies that appeared in the literature accelerated during the last few years. In these patients, the clinical phenotype is not limited to the susceptibility to infections with various microorganisms, but they may also have immune dysregulation and lymphoproliferation as well as autoimmunity, inflammation, allergy and malignancy [4]. Recently, STK4 also known as a Macrophage Stimulating 1 (MST1) deficiency, a novel autosomal recessive (AR) CID, is reported independently by three groups [5–7]. Clinical manifestations of STK4 deficiency comprise recurrent and severe viral cutaneous infections including molluscum contagiosum and warts, fungal and bacterial infections and autoimmunity which are also

the features of AR-HIES (autosomal recessive hyperimmunoglobulin E syndrome) caused by DOCK-8 deficiency, a form of combined immunodeficiency (OMIM #614868). Although very high IgE level is characteristic for DOCK8 deficiency, patients with either borderline high, or even normal serum IgE levels were described. Two patients with STK4 deficiency described earlier also had very high IgE levels. Human STK4 is primarily discovered as a constitutively expressed kinase, structurally homologous to yeast Ste20 and the Drosophyla Hippo, and has biological activities in morphogenesis, proliferation, apoptosis and stress response [8]. Although STK4 has both proapoptotic and antiapoptotic functions in immune system, it is mainly linked to apoptotic machinery by means of relationships with caspases or mediators of extrinsic pathway of apoptosis [5,9]. STK4 null mice show severe reduction in the number of T cells due to increased apoptosis [10]. We describe here, two siblings with novel STK4 mutation whose main features include autoimmune cytopenias, lymphopenia, bacterial, cutaneous viral, and mild fungal nail infections, mild atopic and seborrheic dermatitis and compare the clinical and immunological features of STK4 versus DOCK8 deficiency. 2. Methods

⁎ Corresponding author. E-mail addresses: [email protected] (S.O. Halacli), [email protected] (D.C. Ayvaz), [email protected] (C. Sun-Tan), [email protected] (B. Erman), [email protected] (E. Uz), [email protected] (D.Y. Yilmaz), [email protected] (K. Ozgul), [email protected] (İ. Tezcan), [email protected] (O. Sanal).

http://dx.doi.org/10.1016/j.clim.2015.06.010 1521-6616/© 2015 Elsevier Inc. All rights reserved.

2.1. Clinical reports Two affected individuals from a single family is included in this study. Pedigree is given in Fig. 1A, clinical features and laboratory

S.O. Halacli et al. / Clinical Immunology 161 (2015) 316–323

317

318

S.O. Halacli et al. / Clinical Immunology 161 (2015) 316–323

findings of the previously reported patients with various STK-4 mutations and the present patients are given in Tables 1, 2 and 3.

period. She was hospitalized 3 times for pneumonia. She is still on IVIG therapy and ITP did not recur.

2.1.1. Patient 1 (P1) A 28 month-old girl was referred to Hacettepe University, Ihsan Doğramacı Children's Hospital due to autoimmune hemolytic anemia (AIHA) unresponsive to steroids. She was the first child of first degree cousin parents, who was hospitalized in another center at 27 months of age with the complaints of darkening of urine and pallor. Erythrocyte transfusions and steroid therapy were given with the diagnosis of severe hemolytic anemia. On physical examination, her weight was 14.5 kg (75–90p); height, 94 cm (75–90p). She had jaundice, mild atopic dermatitis, hepatomegaly (liver was palpable 2 cm below the costal margin). Laboratory work-up revealed deep anemia (Hb 4.3 g/dl), reticulocytosis (5%), and positive direct and indirect Coombs tests. Immunologic studies revealed lymphopenia, T cell and particularly CD4 T cell lymphopenia and low serum C4 level (Table 3). She had borderline low percentage of CD45RA+CCCR7+ (naive) CD8 and naive CD4 cells, high effector memory CD45RA+CCR7 − (TEMRA) CD8 cells and normal CD4 TEMRA cells. The percentage of CD19+IgD+CD27 + (unswitched memory) B cells were low, while CD19+IgD − CD27 + (switched memory) B cells were normal (Table 3). Autoantibodies (antinuclear, anti ds-DNA, antinuclear cytoplasmic antibodies) and antibodies for CMV, EBV, HBV, HAV were found to be negative. She was given steroids (2 mg/kg methylprednisolone) and high dose intravenous immunoglobulin (2 g/kg IVIG) with the diagnosis of AIHA. Corticosteroid dose was tapered after anemia resolved within 2 weeks. During follow-up intermittant neutropenia (total neutrophil count ranged between 1200 and 2700) and progressively worsening lymphopenia were observed and IgE level increased up to 259 IU/L, and serum C4 level remained low (Table 3). At 3.5 years of age, she was diagnosed as having bronchial hyperreactivity for which she was given inhaled steroid therapy. At age 4 years, she developed molluscum contagiosum, and perioral herpetic lesions which lasted about 2 months and skin lesions compatible with seborheic dermatitis. She did well till 9 years of age with monthly IVIG therapy, which was started at 4 years of age. At 9 year of age she developed a very severe episode of Coombs positive hemolytic anemia. She was hospitalized and given steroids and cyclosporin A. This episode could only be controlled with rituximab therapy. Now, at age 9.5 years, she is well with cyclosporin A and IVIG therapy.

2.2. SNP array genoyping and homozygosity mapping

2.1.2. Patient 2 (P2) She was examined at Hacettepe University, Ihsan Doğramacı Children's Hospital, Division of Pediatric Immunology at the age of 4 months because of the sibling history. Her past medical history revealed that she had tachypnea, hypoxia and respiratory distress in the early neonatal period and was given wide-spectrum antibacterial therapy and mechanical ventilatory support for ten days with the diagnosis of neonatal pneumonia and sepsis. Physical examination showed mild atopic dermatitis on face and molluscum contagiosum around eyes and ears (Table 1). Immunologic studies showed lymphopenia and T cell and particularly CD4 T cell lymphopenia (Table 3). She had borderline low percentages of naive CD4 and CD8 cells, while TEMRA CD8 and CD4 cells were normal. The percentage of unswitched memory B cell was low, while switched memory B cell were high (Table 3). At the age of 28 months, immune thrombocytopenia developed and steroid and cyclosporine-A treatment were started. Monthly IVIG therapy was started at the age of 33 months. She experienced skin lesions resembling atopic and seborrheic dermatitis during follow-up

Genomic DNA was extracted by standard protocol from peripheral blood of the patients and their parents after informed consent was obtained. The study protocol was approved by the Hacettepe University Ethics Committee (Referance Number: 010 01 101 010). Both parents and two affected children were included in Affymetrix (Santa Clara, CA) GeneChip 250K SNP (NspI) array analysis (Affymetrix, Santa Clara, CA, USA). Genotype files (CHP files) were generated using Affymetrix GTYPE software and transferred to the VIGENOS (Visual Genome Studio) program (Hemosoft Inc., Ankara), which facilitates visualization of a large quantity of genomic data in comprehensible visual screens [11,12]. Individual P1 was chosen to construct genome-wide haplotypes. Haplotypes indicating homozygosity by descent were compared with homozygous haplotypes of the other affected individual P2. 2.3. DNA sequence analysis and QRT-PCR Primers used in PCR amplification and cycle sequence PCR are listed in Table 4. Exons of STK4 gene were amplified in these conditions: 1 cycle initial denaturation 95 °C for 5 min, 35 cycles of 95 °C for 1 min, 56 °C for 1 min, 72 °C for 1 min and final elongation step of 72 °C for 10 min. Obtained PCR products were purified using Exo-SAP (Thermoscientific, USA). Cycle sequence PCR was performed with purified PCR products and conditions were as follows: 25 cycles of 96 °C for 10 sec, 50 °C for 5 sec and 60 °C for 4 min. Cycle sequence PCR products were purified with Sephadex according to the manufacturer's instructions (Sigma, Germany). Exons and flanking intron–exon boundaries of STK4 were sequenced with ABI PRISM 3130 DNA Sequencer and analyzed with DNA Sequencing Analysis Version 3 Software (Applied Biosystems, USA). Ensemble database was used for sequence reading and mutation analysis (http://www.ensemble. org/human). Total RNA was exctracted from peripheral blood mononuclear cells (PBMC) using QIAamp RNA mini blood kit according to the manufacturer's instructions (Qiagen, Germany). 500 ng of RNA was used to synthesize cDNA using RT2 First Strend cDNA Synthesis Kit from Qiagen. Real time PCR was performed using RT2 Sybr Green Rox Fast Mastermix with the two step protocol according to the manufacturer's instructions (Qiagen, Germany). Obtained ct (cycle threshold) values for STK4 were normalized against the values of housekeeping gene B-actin. For the analysis of expression level of STK, 2−ΔΔct method was used. Primers used for STK4 RNA expression were as follows: left; 5′GGAAGTGGACCAGGACGATG3′ and right; 5′TGGTGCCCAG TTGTGATGG 3′. 2.4. Western blot Peripheral blood mononuclear cells were lysed using 1 × cell lysis buffer (Cell Signaling Technology, Inc.), including 1 mM phenylmethylsulfonyl fluoride. Bradford assay reagent (Fisher Scientific International Inc.) was used for protein quantitation, and 50 μg protein lysates were separated using 5% stacking and 10% resolving gels at 100 V for 2 h. The separated proteins were immunoblotted to a polyvinylidene difluoride membrane using semidry blotting system (Fisher Scientific International Inc.) and blocked for 1 h with 5% skimmed milk in phosphate-buffered saline and 1% Tween 20 (Sigma-Aldrich). Protein bands were visualized

Fig. 1. STK4 gene analysis in two sisters. A. Pedigree of the family. Consanguinity is indicated by double horizontal bars. Black circles present affected sisters and semi-black box and circle show heterozygous father and mother, respectively. B. Gene sequencing of STK4 shows four nucleotide deletion in exon 2 leading to premature stop codon. C. Diagrammatic representation of STK4 gene (the number of each exon is indicated below). D. The diagram of the known functional domains of human STK4 and localization of the identified mutations in domains. Previously identified mutations are shown in black font and newly identified E22X mutation in kinase domain is shown in red. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Table 1 Clinical manifestations of the patients with various STK4 mutations. Nehme et al. — F1P1

Nehme et al. — F2P1

Nehme et al. — F1P2

Nehme et al. — F2P3

Hengameh et al. — P1

Hengameh et al. — P2

Hengameh et al. — P3

Crequer et al. — P1

Patient 1

Patient 2

STK4 mutation

R117X (349 CNT nucleotide change in exon 4)

T1103del

T1103del

T1103del

c.G750A, p.W250X (homozygous stop codon mutation in exon 7)

c.G750A, p.W250X (homozygous stop codon mutation in exon 7)

c.G750A, p.W250X (homozygous stop codon mutation in exon 7)

R115X (exon4)

c.58-61delATAG (homozygous stop codon mutation in exon 2)

c.58-61delATAG (homozygousstop codon mutation in exon 2)

Nature of mutations Ethnic origin Age at onset Sex Symptoms at onset

Nonsense

Nonsense

Nonsense

Nonsense

Nonsense

Nonsense

Nonsense

Nonsense

Nonsense

Nonsense

Turkish 2 Male Recurrent skin and lower RTI caused by H. influenzae and S. pneumonia.

Turkish 2 Female Recurrent bacterial infections and eczema like lesions of the skin.

Turkish 1 Female Mild erythematous skin lesions.

Iranian 2 Female Pneumonia

Iranian 10 Male Recurrent episodes of fever and upper RTI.

Iranian 4 Female Recurrent sinusitis and rhinitis.

Senegalese 1 Male Bronchitis.

Other symptoms Extensive and findings molluscum contagiosum, chronic EBV infection, persistent viremia, dermatitis, bronchiectasis.

Recurrent pneumonia, bronchiectasis, persistant EBV viremia, EBV B cell lymphoproliferative syndrome, stomatitis.

Turkish 1 Female Recurrent bacterial infections and eczema like lesions of the skin. Recurrent pneumonitis and sinusitis associated with bronchiectasis, stomatitis, persistant EBV viremia, autoimmune hemolytic anemia.

Molluscum contagiosum.

Recurrent upper and lower RTI, recurrent skin abscesses, cutaneous warts, recurrent mouth ulcers, history of sibling death.

Recurrent skin abscesses, cutaneous warts, recurrent mouth ulcers, recurrent episodes of fever and upper RTI, history of sibling death.

Flat warts (extensive), mouth lesions, severe pneumonia, major tooth cavities, cervical adenopathy, history of sibling death.

Turkish Newborn Female Neonatal pneumonia, sepsis, idiopathic trombocytopenic purpura. Seborheic dermatitis, molluscum contagiosum.

Viral infections

HSV, VZV, EBV

EBV, HSV

EBV, HSV

HSV

HPV57, HPV84, HSV

Cardiologic symptoms

−

−

−

Atrial septal defect type II

Patent foramen ovale

HSCT Cause of death

− Alive

+ GVHD (post-HSCT)

+ GVHD (post-HSCT)

No infectious agent Tricuspid valve insufficiency, moderate right ventricular hypertrophy + Alive

− Alive

− Alive

Staphylococcal pneumonia, recurrent skin abscesses, molluscum contagiosum, cutaneous papillomatosis, recurrent mouth ulcers, EBV associated lymphadenopathy. HPV71, HPV3, HPV25, HSV Patent foramen ovale, mitral tricuspid and pulmonary insufficiency − Alive

Turkish 2 Female Autoimmune hemolytic anemia, intermittent neutropenia, lymphopenia. Molluscum contagiosum, seborheic dermatitis, mild atopic dermatitis, perioral herpetic lesions.

EV-HPV, HPV5, HSV HPV15, EBV, HHV8 − −

−

− Alive

− Alive

− Alive

S.O. Halacli et al. / Clinical Immunology 161 (2015) 316–323

Patients

HSV

RTI, respiratory tract infection; GVHD, graft versus host disease; HSCT, hematopoietic stem cell transplantation.

319

– 1.74 (0.41–1.41)H 14.3 (5.5–10)H 0.73 (0.54–1.53) ND – 3.24 (0.41–1.41)H 15 (5.5–10.2)H 0.74 (0.54–1.53) ND

a Values in parenthesis show normal levels; L and H indicate Low and High. Reference values for B cell subsets and T cell subsets are obtained from E.J.H. Schatorje et.al. [Age-matched reference values for B-lymphocyte subpopulations and CVID classifications in children, Scand. J. Immunol. 74 (5) (2011) 502-510.] and Moraes Pinto M.I. et al. [Lymphocyte subsets in human immunodeficiency virüs-unexposed Brasilian individuals from birth to adulthood, Mem. Inst. Oswaldo Cruz 109 (8) (2014) 989-998.].

540 (1400–3700)L 240 (700–2200)L 260 (490–1300)L 600 (390–1400)L 420 (130–720)

520 (1000–2200)a 130 (530–1300)L 200 (330–920)L 0 (110–570)L 170 (100–180) 1.3 (52–68)L 18 (16–28) 2.19 (0.49–1.90) 22.6 (4.8–14)H 0.37 (0.55–1.77)L 110 (10–100)H CD3 (mm3) CD4 (mm3) CD8 (mm3) CD19 (mm3) CD16/56 (mm3) CD8 naive T cells CD45RA+CCR7+ (%) TEMRA CD4+ cells CD4+CD45RA+CCR7 − (%) IgA (mg/ml) IgG (mg/ml) IgM (mg/ml) IgE (IU/L)

400 (1200–2600)L 100 (600–1500)L 410 (370–1100) 420 (270–860) 360 (100–480) 1 (52–68)L 80 (16–28)H 10.9 (1.02–1.94) 20.5 (8.3–14.3)H b0.17 (0.68–1.28)L 12 (10–100)

1400 (1200–2600) 160 (600–1500)L 1230 (370–1100)H 30 (270–860)L 300 (100–480)

177 (1400–2100)L 120 (700–1100)L 86 (600–900) 57 (300–500)L 49 (200–300)L – – 3.14 (0.7–4) 27.1 (7–16)H 0.22 (0.4–2.3)L 366 (1–100)H

– 26.2 (0.7–4)H 50.6 (7–16)H 1.17 (0.4–2.3) 135 (1–100)H

3374 (1400–2100)H 357 (700–1100)L 3056 (600–900) 278 (300–500)L 1469 (200–300)H

253 (1400–2100)L 132 (700–1100)L 156 (600–900) 42 (300–500)L 153 (200–300)L – – 6.24 (0.7–4)H 15.2 (7–16) 0.18 (0.4–2.3)L 3640 (1–100)H

2112 (1200–2600) 528 (650–1500)L 2112 (370–1100) 396 (270–860) ND 4 (37–50)L – 6.20 (1.02–1.94)H 19.6 (8.3–14.3)H 0.44 (0.68–1.28)L 3609 (10–100)H

Hengameh et al. — P3

Neutropenia, lymphopenia

Hengameh et al. — P2 Hengameh et al. — P1 Nehme et al. — F2P3

Lymphopenia Neutropenia, lymphopenia

Nehme et al. — F1P2 Nehme et al. — F2P1

Neutropenia, ANA (+), anticardiolipin ab (+),

Nehme et al. — F1P1

Lymphopenia

Patients

Immunologic findings

Table 2 Immunological findings of the previously reported patients with STK4 deficiency.

Neutropenia, lymphopenia

Neutropenia, lymphopenia

Crequer et al. — P1

S.O. Halacli et al. / Clinical Immunology 161 (2015) 316–323

Neutropenia, lymphopenia, cANCA (+)

320

with the SuperSignal West Femto Chemiluminescence kit (Fisher Scientific International Inc.) and analyzed using Kodak Gel Logic 1500 imaging system software (Eastman Kodak Co., Rochester, NY, USA). 3. Results SNP array genotyping and homozygosity mapping revealed identical homozygous haplotypes in specific portions of chromosomes 7, 11, 16 and 20 in patients. We excluded DOCK-8 deficiency with homozygosity mapping. A total of 23 Mb interval residing between DNA markers rs6071655 and rs1776262 on chromosome 20 was highlighted because of the presence of a highly relevant candidate gene, STK4 which is known to be associated with AR-CID. Therefore, we sequenced STK4 gene and found a novel four nucleotide deletion(c.58-61delATAG) in exon 2. This sequence is located in the protein kinase domain of STK4 protein (Fig. 1C, D) and the deletion does not cause significant mRNA expression level difference between patients and parents (Fig. 2). Western blot analysis showed lack of 59 kDa protein which corresponds in size to STK4 in patients (Fig. 3). 4. Discussion We have been evaluating and following up a group of patients with features suggestive for AR-HIES. Homozygous DOCK-8 mutations were identified in several of these patients [13]. However, in two siblings in this group of patients, having viral cutaneous, bacterial and fungal infections, only mildly elevated serum IgE levels, and autoimmune cytopenias, homozygous block was found by homozygosity mapping in chromosome 20p1.2 which was found to include STK4 gene. Sanger sequencing for STK4 deficiency showed a novel c.58-61delATAG mutation. To examine the effect of the mutation on the mRNA and protein level, we performed QRT-PCR and Western blot analysis with PBMC and the results showed no evidence of significant non-sense mediated decay and lack of a 59 kDa band which corresponds in size to STK4 in patients. As shown in our patients, premature stop codon mutation assosiated with lack of related protein and without evidence of significant non-sense mediated decay has been reported previously [14]. STK4 deficiency is a recently described rare form of CID, which shares the clinical features with DOCK-8 deficiency, that are; susceptibility to bacterial infections, viral skin infections, skin abcesses, and autoimmunity [3,6]. Marked atopy, eosinophilia and very high IgE levels that are characteristic for DOCK-8 deficiency are not among the classical features of STK4 deficiency. Although few patients with either borderline high or normal serum IgE levels have been described, serum IgE levels are typically higher than 2000 IU/L in DOCK-8 deficiency [13]. High IgE levels were found only in three out of eight previously described STK4 deficient patients [5–7], and the highest IgE levels in our patients were 259 and 107 IU/L respectively. While most of the patients with DOCK-8 deficiency have severe eczema, only one patient among the reported patients with STK4 deficiency had eczema and another had mild erythematous skin lesions in the first year of life [6]. Our patients had mild atopic dermatitis and seborrheic dermatitis. Eosinophilia which is a common characteristic of DOCK8 deficient patients could not be found in our and previously described patients with STK4 deficiency [5–7]. Autoimmune hemolytic anemia developed in P1, as in another reported patient with STK-4 deficiency and ITP in P2. Autoantibodies, e.g., antinuclear and anticardiolipin antibodies, have been reported in a patient with STK4 deficiency [6]. The autoimmunity in the patients with STK4 deficiency may be explained by the effect of STK4 on the regulation of Treg development/function by modulating Foxo1/Foxo3 stability [15]. Immunological findings of STK-4 deficiency includes neutropenia, high IgA and IgG, low IgM levels, low T and CD4 lymphocyte counts, and impaired in vitro T cell proliferation [5–7]. Although CD3, CD4, CD8 and CD16+56+ cell counts are variable, CD4+ T cells

Table 3 Immunological findings of the present patients with STK4 deficiency. Patient 1 Age 3

WBC (/mm ) ALC (/mm3) ANC (/mm3) AEC (/mm3) CD3 (%/mm3)

CD8 (%/mm3) CD16/56 (%/mm3) CD19 (%/mm3) CD19+IgD+CD27 + (%) Unswitched memory B cells Switched memory B cells CD19+IgD−CD27+ (%) CD8 Naive T cells CD45RA+CCR7+ (%) CD4 Naive T cells CD45RA+CCR7+ (%) TEMRA CD4+ cells (CD4+CD45RA+CCR7 −) (%) TEMRA CD8+ cells (CD4+CD45RA+CCR7 −) (%) IgA (mg/dL) IgG (mg/dL) IgM (mg/dL) IgE (mg/dL) C3 (mg/dL) C4 (mg/dL)

4 years

5 years

9 years

4 months

2 years

6 years

11,400 (4800–10,800) 1800 (2700–11,900) 2000 (2200–4800) 100 (100–500) 47 (39–73) 846 (1400–8000) 17 (25–50) 306 (900–5500) 29 (11–32) 522 (400–2300) 37 (3–16) 108 (100–1400) 37 (17–41) 666 (600–3100) –

3000 (4100–11,200) 1300 (1700–6900) 1200 (1800–6400) 100 (100–500) 51 (43–76) 663 (900–4500) 22 (23–48) 286 (500–2400) 43 (14–33) 559 (300–1600) 26 (4–23) 299 (100–1000) 30 (14–44) 390 (200–2100) –

2500 (4100–11,200) 900 (1100–5900) 1300 (1800–6400) 100 (0–200) 50 (43–76) 450 (900–4500) 24 (23–48) 216 (500–2400) 43 (14–33) 387 (300–1600) 19 (4–23) 171 (100–1000) 23 (14–44) 207 (200–2100) –

3100 (4800–10,800) 400 (1100–5900) 2700 (2200–4800) 0 (0–200) 38 (55–78) 152 (700–4200) 15 (27–53) 60 (300–2000) 25 (27–53) 100 (300–1800) 13 (4–26) 52 (90–900) 33 (10–31) 132 (200–1600) 2 (4–24)

5400 (4100–11,200) 2600 (3700–9600) 1700 (1800–6400) 200 (100–500) 34 (28–76) 884 (2300–7000) 25 (33–58) 650 (1500–5000) 12 (11–25) 312 (500–1600) 7 (2–14) 182 (100–1300) 54 (14–39) 1404 (600–3000) –

5900 (4100–11,200) 2100 (2700–11,900) 2400 (1800–6400) 600 (100–500) 40 (39–73) 840 (1400–8000) 14 (25–50) 294 (900–5500) 25 (11–32) 525 (400–2300) 16 (3–16) 336 (100–1400) 38 (17–41) 798 (600–3100) –

5600 (4800–10,800) 1000 (1100–5900) 4000 (2200–4800) 0 (0–200) 50 (55–78) 500 (700–4200) 12 (27–53) 120 (300–2000) 35 (27–53) 350 (300–1800) 24 (4–26) 240 (90–900) 19 (10–31) 190 (200–1600) 1.5 (4–24)

–

–

–

15.3 (3–18)

–

–

42.7 (3–18)

–

–

–

7.1 (5.5–39.7)

–

–

5.4 (5.5–39.7)

– –

– –

– –

6 (15.5–59.4) 4.9 (4.5–43.6)

– –

– –

15.8 (15.5–59.4) 8.3 (4.5–43.6)

–

–

66 (21.5–61)

–

–

31.9 (21.5–61)

165 (26–296) 718 (604–1941) 52.2 (71–235) 23 92.2 (90–180) 4.5 (10–40)

1282 (52–282) 1840 (745–1804) 299 (78–261) 176 104 (79–152) 3.7 (16–38)

1665 (52–282) 1730 (745–1804) 246 (78–261) 259 115 (79–152) –

340 (70–303) 1420 (764–2134) 115 (69–387) – –

36 (13.5–72) 400 (294–1165) 36 (33–154) 12 103 (79–150) 26.7 (16–38)

238 (26–296) 1570 (604–1941) 121 (71–235) 62 107 (79–152) 32.4 (10–40)

402 (70–303) 1240 (764–2134) 92.9 (69–387) 107 – –

– – – –

227/353 182/283 89/259 9.8/21

– – – –

– – – –

89/353 151/283 83/259 3.1/21

– – – –

Lymphocyte transformation (cpm × 10−3) (patient/control) PHA – ConA – PMA – Unstimulated –

S.O. Halacli et al. / Clinical Immunology 161 (2015) 316–323

CD4 (%/mm3)

Patient 2

2 years

“–” not tested.

321

322

S.O. Halacli et al. / Clinical Immunology 161 (2015) 316–323

Table 4 Primers used for STK4 gene amplification. Exons

Forward 5′–3′

Reverse 3′–5′

Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 Exon 10 Exon 11

GGGAGGATGGAGCAGTGA GTATCGGCCTCCCAAGAAAC CCTTGGGCAAATCATAAACC GCATTCTTATCAGGAGGTTGTCC TCTGGTATGGAAATATAGCCTT CTTGATCATGCTCAGAGTATGGT AGAGGCAGGGAAACTTGAC ATAGGCATTTCAGCCAGGCT GCGCTTTCATTTCTGGAAGGT GAGCTGTTTGCTATGGGAGAC GCTTCAAGGTATGCCATGCT

CCGGTCCCAAGTCTAACCT AAGCGAAGAAGGACATCACA CATCGAATTCTCCCTTCTGC AAGCTGTCACACTTAGGAGACAT TAACCTATTGGCAGATTCTGT CCACAACACCTGGCTTGAA ACTATCTCCACGTAGGTGACC TAGCATGCGTTGATCCAGG GCTAAGCCTGCATGAACCAT GACCAGAGAACTGCCCAAAC GTTCACAAAGGTGCTGTGGA

percentages of CD4 and CD8 TEMRA, and decreased percentages of unswitched memory B cells. Cardiac malformation reported in previously described 4 patients was not present in our patients. STK4 which is a core component of evolutionary conserved pathway named as Hippo contributes cell death and represses cell proliferation to regulate organ size. STK4 activates intrinsic pathway of apoptosis by phosphorylating antiapoptotic protein Bcl-xL in cardiac myocyte cells [17]. Patient 1 had persistantly low serum C4 levels except once during the follow-up period. Since the concurrent serum C3 levels were normal and the C4 levels were low, but not undetectable, it seems that C4 deficiency was neither secondary nor complete in this patient. C4A and C4B genotyping is necessary to clarify the nature of low C4 levels. Although partial C4 deficiency may contribute to autoimmune diseases, it is unlikely here since affected sister with normal C4 level has similar features. In conclusion, we identified a novel defect in STK4 gene in two siblings with autoimune cytopenias and who showed some features of AR-HIES. Our results indicate that patients showing overlapping features with AR-HIES without DOCK-8 mutation and with the presence of neutropenia in particular need to be evaluated for STK4 deficiency. Determination of the underlying defect and reporting the patients are required for the description of the phenotypic spectrum and the frequency of these diseases as well as for genetic counseling. Conflict of interest None of the authors has any potential conflict of interest related to this article.

Fig. 2. STK4 mRNA expressions in patients, parents and control.

Acknowledgment

and IgM levels are usually low also in patients with DOCK-8 deficiency. A remarkable characteristic feature seems to be the reduced number of T lymphocytes, and is recorded in all reported STK4 deficient patients as well as in the present patients. Several studies in stk4 knock-out mice showed T and B cell depletion due to increased apoptosis. Besides, stk4 has a role in proper egress of lymphocyte from thymus [5,6]. Both of the presented patients with STK-4 deficiency had borderlinelow percentages of both naive CD4 and CD8 cells, while CD4 + and CD8+ TEMRA cells were normal to high. The percentage of unswitched memory B cells was low, while switched memory B cells were normal to high. These results were similar to the results obtained in previous studies [6,7]. Interestingly, these results overlaps with the results obtained in patients with DOCK8 deficiency [16]. DOCK8 deficient patients have been shown to have low level of naive T cell subset, decreased level of naive CD4 cells and tended to have elevated

Fig. 3. STK4 protein expression of the patients, mother and a healthy control.

The authors would like to thank Prof. Nurten Akarsu (Department of Medical Genetics, Hacettepe University) for helpful comments and technical support for homozygosity mapping. The study was supported by Hacettepe University, Scientific Research Projects Coordination Units (Project Number: 010 01 101 010). References [1] L.D. Notarangelo, Primary immunodeficiencies (PIDs) presenting with cytopenias, Hematol. Am. Soc. Hematol. Educ. Program 139–43 (2009). [2] L.D. Notarangelo, et al., Primary immunodeficiencies, J. Allergy Clin. Immunol. 125 (2 Suppl 2) (2010) S182–S194. [3] W. Al-Herz, et al., Primary immunodeficiency diseases: an update on the classification from the international union of immunological societies expert committee for primary immunodeficiency, Front. Immunol. 22 (5) (2014) 162. [4] W.T. Shearer, et al., Establishing diagnostic criteria for severe combined immunodeficiency disease (SCID), leaky SCID, and Omenn syndrome: the Primary Immune Deficiency Treatment Consortium experience, J. Allergy Clin. Immunol. 133 (4) (2014) 1092–1098. [5] H. Abdollahpour, et al., The phenotype of human STK4 deficiency, Blood 119 (15) (2012) 3450–3457. [6] N.T. Nehme, et al., MST1 mutations in autosomal recessive primary immunodeficiency characterized by defective naive T-cell survival, Blood 119 (15) (2012) 3458–3468. [7] A. Crequer, et al., Inherited MST1 deficiency underlies susceptibility to EV-HPV infections, PLoS One 7 (8) (2012) e44010. [8] J.D. Graves, et al., Both phosphorylation and caspase-mediated cleavage contribute to regulation of the Ste20-like protein kinase Mst1 during CD95/Fas-induced apoptosis, J. Biol. Chem. 276 (18) (2001) 14909–14915. [9] M.K. Lehtinen, et al., A conserved MST-FOXO signaling pathway mediates oxidativestress responses and extends life span, Cell 125 (5) (2006) 987–1001. [10] D. Zhou, et al., The Nore1B/Mst1 complex restrains antigen receptor-induced proliferation of naive T cells, Proc. Natl. Acad. Sci. U. S. A. 105 (51) (2008) 20321–20326. [11] H. Kayserili, et al., ALX4 dysfunction disrupts craniofacial and epidermal development, Hum. Mol. Genet. 18 (22) (2009) 4357–4366. [12] E. Uz, et al., Disruption of ALX1 causes extreme microphthalmia and severe facial clefting: expanding the spectrum of autosomal-recessive ALX-related frontonasal dysplasia, Am. J. Hum. Genet. 86 (5) (2010) 789–796. [13] O. Sanal, et al., Additional diverse findings expand the clinical presentation of DOCK-8 deficiency, J. Clin. Immunol. 32 (4) (2012) 698–708.

S.O. Halacli et al. / Clinical Immunology 161 (2015) 316–323 [14] A. Alangari, et al., LPS-responsive beige-like anchor (LRBA) gene mutation in a family with inflammatory bowel disease and combined immunodeficiency, J. Allergy Clin. Immunol. 130 (2) (2012) 481–488. [15] X. Du, et al., Mst1/mst2 regulate development and function of regulatory T cells through modulation of Foxo1/Foxo3 stability in autoimmune disease, J. Immunol. 192 (4) (2014) 1525–1535.

323

[16] E. Janssen, et al., Flow cytometry biomarkers distinguish DOCK8 deficiency from severe atopic dermatitis, Clin. Immunol. 150 (2) (2014) 220–224. [17] Re D.P. Del, et al., Mst1 promotes cardiac myocyte apoptosis through and inhibition of Bcl-xL, Mol. Cell 54 (4) (2014) 639–650.