Streptomyces IHF uses multiple interfaces to bind DNA

BBA - General Subjects 1863 (2019) 129405

Contents lists available at ScienceDirect

BBA - General Subjects journal homepage: www.elsevier.com/locate/bbagen

Streptomyces IHF uses multiple interfaces to bind DNA a,1

b,c,2

a,d,2

a

b,c

Tamiza Nanji , Emma J. Gehrke , Yao Shen , Melanie Gloyd , Xiafei Zhang , Christopher D. Firbyb,c, Angela Huynha, Aida Razie, Joaquin Ortegae, Marie A. Elliotb,c, ⁎ Alba Guarnéa,d,

T

a

Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, ON, Canada Department of Biology, McMaster University, Hamilton, ON, Canada c Institute for Infectious Disease Research, McMaster University, Hamilton, ON, Canada d Department of Biochemistry, McGill University, Montreal, QC, Canada e Department of Anatomy and Cell Biology, McGill University, Montreal, QC, Canada b

ARTICLE INFO

ABSTRACT

Keywords: Nucleoid-associated proteins Small-angle X-ray scattering DNA binding protein Protein-nucleic acids interactions DNA structure Streptomyces

Background: Nucleoid associated proteins (NAPs) are essential for chromosome condensation in bacterial cells. Despite being a diverse group, NAPs share two common traits: they are small, oligomeric proteins and their oligomeric state is critical for DNA condensation. Streptomyces coelicolor IHF (sIHF) is an actinobacterial-specific nucleoid-associated protein that despite its name, shares neither sequence nor structural homology with the well-characterized Escherichia coli IHF. Like E. coli IHF, sIHF is needed for efficient nucleoid condensation, morphological development and antibiotic production in S. coelicolor. Methods: Using a combination of crystallography, small-angle X-ray scattering, electron microscopy and structure-guided functional assays, we characterized how sIHF binds and remodels DNA. Results: The structure of sIHF bound to DNA revealed two DNA-binding elements on opposite surfaces of the helix bundle. Using structure-guided functional assays, we identified an additional surface that drives DNA binding in solution. Binding by each element is necessary for both normal development and antibiotic production in vivo, while in vitro, they act collectively to restrain negative supercoils. Conclusions: The cleft defined by the N-terminal and the helix bundle of sIHF drives DNA binding, but the two additional surfaces identified on the crystal structure are necessary to stabilize binding, remodel DNA and maintain wild-type levels of antibiotic production. We propose a model describing how the multiple DNAbinding elements enable oligomerization-independent nucleoid condensation. General significance: This work provides a new dimension to the mechanistic repertoire ascribed to bacterial NAPs and highlights the power of combining structural biology techniques to study sequence unspecific proteinDNA interactions.

1. Introduction In bacterial cells, the chromosome is not sequestered inside the nucleus, and instead is organized into a condensed nucleoid within the cytoplasm. Effective chromosome compaction is achieved through the combined activity of topoisomerases, condensins, and a diverse group of proteins broadly termed ‘nucleoid-associated proteins’ (NAPs) [1]. While NAPs influence the chromosome architecture in all bacteria, different bacteria employ distinct NAP repertoires [2]. Individual NAPs can contribute to chromosome condensation and organization through

a range of activities, including bending, bridging, wrapping, or otherwise crowding the chromosomal DNA [2]. There is also considerable variation in the sequences or structures that are recognized by different NAPs. NAPs are typically small (10–20 kDa) oligomeric proteins, and their oligomeric state is critical for their role in compacting DNA. For instance, the well-studied H-NS protein in Escherichia coli has an Nterminal oligomerization domain and C-terminal DNA binding domain. As a dimer, it can associate with two DNA duplexes simultaneously, effectively bridging DNA [3]. It can also polymerize along DNA to form

Corresponding author at: Department of Biochemistry, McGill University, Montreal, QC H3G 0B1, Canada. E-mail address: [email protected] (A. Guarné). 1 Present address: Life Sciences Institute, University of British Columbia, Vancouver, BC, Canada. 2 These authors contributed equally. ⁎

https://doi.org/10.1016/j.bbagen.2019.07.014 Received 12 March 2019; Received in revised form 27 June 2019; Accepted 29 July 2019 Available online 31 July 2019 0304-4165/ © 2019 Elsevier B.V. All rights reserved.

BBA - General Subjects 1863 (2019) 129405

T. Nanji, et al.

Fig. 1. Crystal structure of sIHF bound to an 8 bp palindromic DNA. (A) Ribbons representation of the crystal structure of sIHF bound to the 8 bp palindrome. The two DNA molecules interacting with sIHF are shown as colored coded sticks with a 2Fo-Fc electron density map contoured at 1.5 σ shown as a grey mesh. The sIHF lid and the H2TH motif are colored purple. The residues involved in the hydrogen-bond network with duplex I are shown as sticks and labeled. Residues in the Nterminal helix that where mutated on the ‘cleft’ variant of sIHF are labeled. (B) Detail of the interaction between sIHF and duplex I that stabilizes the α5 helix dipole. (C) Detail of the sIHF-DNA interface mediated by the H2TH motif. The K+ ion is shown as a green sphere and coordinating water molecules are shown as red spheres. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

rigid filaments [4]. Similarly, the broadly conserved HU protein is an obligatory dimer that bends DNA sequences containing single-nucleotide insertions [5]. Recent work now also suggests that under certain conditions HU does not bend native DNA, but instead multimerizes to form dynamic DNA interaction networks that constrain DNA supercoils and promote nucleoid organization [6]. Although most NAPs bind DNA without sequence specificity, there are exceptions. In E. coli, Lrp, Fis and IHF all associate with specific DNA sequences. Lrp proteins form disc-shaped octamers with multiple DNA binding sites and promote DNA wrapping in a manner reminiscent of eukaryotic histones [7]. Fis and IHF are dimeric proteins containing two DNA-binding extensions that protrude from the dimerization core. These extensions interact with adjacent minor grooves at specific DNA sequences and impose sharp bends onto the DNA [8–10]. The only monomeric NAP identified to date is the mIHF/sIHF protein. These proteins are highly conserved but confined to the actinobacteria. mIHF was first discovered in Mycobacterium tuberculosis, where it shares similar functionality with the E. coli IHF protein, in promoting the integration of phage DNA into the mycobacterial chromosome [11]. Despite this similar function, mIHF/sIHF do not share sequence or structural homology with the E. coli IHF. For reasons that are not yet understood, mIHF is essential for Mycobacterium tuberculosis viability [11]. Its counterpart in Streptomyces coelicolor (sIHF) is not essential for viability, but deleting the sIHF gene has profound phenotypic consequences [12]. Streptomyces are spore-forming bacteria with a complex, multicellular life cycle. These bacteria are renowned for their production of antibiotics and other specialized metabolites. Loss of sIHF in S. coelicolor leads to defects in both antibiotic production and development [12,13]. sIHF mutants exhibit a reduced ability to sporulate, and those spores that form are heterogeneous in size, have diffuse nucleoids, and are more frequently anucleate than wild type [12]. The crystal structure of sIHF bound to DNA showed that, similar to other NAPs, sIHF binds DNA through the minor groove. Furthermore, each

sIHF molecule contacts two neighboring DNAs, suggesting a possible role in DNA bridging [12]. Additional investigations have suggested that mIHF may bend DNA [14,15]; however, this has not been observed for sIHF [12]. sIHF also modulates the activity of topoisomerase [12], a characteristic that it shares with HU [16]. The sequence of sIHF does not include any obvious functional domains resembling other nucleoid-associated proteins and its mode of DNA compaction cannot be inferred from available crystallographic or biochemical studies. To better understand how DNA binding by sIHF impacts Streptomyces development and metabolism, we have combined functional analyses with biochemical and biophysical experiments. Our results indicate that in solution, sIHF binds DNA primarily through a surface that was not identified in the crystal structure. We show that the two DNA-binding elements identified using crystallographic studies make only minor contributions to DNA binding in vitro. Conversely, the cleft defined by the N-terminal helix and the four-helix bundle makes the greatest contribution to DNA binding. We also show that these three DNA-binding elements collectively function to restrain negative supercoils and contribute to the in vivo function of sIHF. We propose a model where sIHF synergistically employs its multiple binding elements to efficiently bind DNA and restrain negative supercoils, promote Streptomyces development and nucleoid condensation, and influence antibiotic production. 2. Results 2.1. Three distinct elements in sIHF contribute to DNA binding The crystal structure of sIHF bound to DNA showed that each protein molecule simultaneously contacted two DNA duplexes [12]. However, the register of the DNA could not be assigned because the structure captured an average distribution of sIHF over the 19 basepairs (bp) of the DNA duplex that was used for crystallization [12]. The 2

BBA - General Subjects 1863 (2019) 129405

T. Nanji, et al.

Table 1 Data collection and refinements statistics. Data collection Wavelength (Å) Space group Cell dimensions: a, b, c Resolution (Å)a Rmeas/Rpima Completeness (%) I/σ(I) Redundancy

0.979 P 21 21 21 42.26, 72.11, 103.26 40–1.7 (1.73–1.7) 0.07 (0.4)/0.03 (0.16) 99.7 (99.8) 22.6 (3.9) 6.2 (6.0)

Refinement Resolution (Å) Completeness (%) No. reflections Rwork/Rfree (%) Atoms refined protein/DNA/solvent rmsd in bonds (Å) rmsd in angles (°) a

34.4–1.7 98.6 34,996 20.1/23.4 1369/644/340 0.001 1.163

Data in the highest resolution shell is shown in parentheses.

minimal repeating unit in that crystal structure contained one sIHF molecule and 8 bp of DNA. Therefore, we re-crystallized the sIHF-DNA complex using an 8 bp palindromic DNA to analyze the specific interactions that drive the interaction between sIHF and DNA. The resulting crystals diffracted X-rays to 1.7 Å and yielded a structure in which the DNA was perfectly ordered (Fig. 1A and Table 1). As seen in the original structure, the lid of the helix bundle interacted with one DNA molecule, while the helix–2-turns–helix (H2TH) motif interacted with a symmetry-related DNA molecule (Fig. 1A). The 11-residue lid of the bundle connects helices α4 and α5 and defines a flat surface that cradles the phosphate backbone of one of the strands of the DNA duplex. The side chains of Asn93 and Gln94 interact with the phosphate groups of nucleotides adenine 6 and guanine 8, while the phosphate group of thymine 7 stabilizes the dipole moment of helix α5 (Fig. 1B). The interaction with the phosphate backbone of this strand of the duplex is further stabilized by an extensive hydrogen-bond network involving Ser82, Ser84 and Arg85, as well as the side chains of Lys54 and Arg88 which interact with the phosphate groups of guanine 8 and adenine 6, respectively, on the complementary DNA strand (Fig. 1A–B). The side chain of Arg85 further encroaches into the minor groove of the DNA duplex – a common binding mechanism to counteract the negative electrostatic potential of DNA [17]. Similarly, the interaction with the H2TH motif is mediated by electrostatic interactions with two adjacent nucleotides on a symmetry related DNA molecule. The phosphate group of cytosine 5 stabilizes the dipole of helix α4, while the phosphate group of adenine 6 stabilizes a K+-binding site at the end of helix α3 (Fig. 1C). This interaction is further stabilized by the side chain of Arg71 protruding into the minor groove of the DNA. The DNA-binding interface defined by the H2TH motif is smaller than that mediated by the lid (230 and 425 Å2, respectively), but H2TH motifs usually have only peripheral DNA binding roles [18–20]. To compare the relative contribution of each surface to DNA binding, we generated sIHF variants with defects in each surface and tested their ability to bind DNA using electrophoretic mobility shift assays. Several of the specific contacts between the lid and DNA were mediated by the main chain of sIHF and hence difficult to disrupt. Consequently, we created two distinct sIHF variants where we mutated: i) Asn93 and Gln94 (N93A/Q94S), and ii) Arg85 and Arg86 (R85A/ R86S). The side chain of Arg86 pointed away from the DNA palindrome (Fig. 1A), but given its positive charge, we reasoned that it could enhance electrostatic interactions with DNA. In contrast, the protein-DNA interface defined by the H2TH motif was mediated exclusively through main-chain interactions (Fig. 1C), and thus we disrupted the motif by inserting an additional glycine residue after Gly66 (referred to as

Fig. 2. DNA binding defects associated with sIHF variants. Electromobility shift assays of a 23 bp DNA duplex (20 nM) incubated with increasing amounts (0–100 μM) of sIHF (A), sIHF-N93A/Q94S (B), sIHF-R85A/R86S (C), sIHFG66+ (D), sIHF-cleft (E) and sIHF-Δ13 (F). Gels shown are representative of three independent experiments.

G66+). All sIHF variants bound DNA, albeit with lower affinity than the wild-type sIHF (Fig. 2A–D). The limited effect of the sIHF-Gly66+ variant was not entirely unexpected given the peripheral role of H2TH motifs in other DNA-binding proteins [18–20]. However, point mutations in the lid of the helix bundle also showed limited DNA-binding defects. Since the side chain of Arg86 pointed towards the cleft defined by the N-terminal helix (α1) and the helix bundle of sIHF, we wondered whether Arg86 might contribute to DNA binding via a mechanism that was not reflected in the crystal structure. This led us to consider the possibility that the DNA-binding defect observed for the sIHF-R85A/ R86S variant may be the result of altering the cleft defined by the Nterminal helix and the bundle, in addition to modifying the lid of the helix bundle. To test this possibility, we generated a variant of sIHF in which four positive-charged residues within the N-terminal helix were mutated to polar residues (Fig. 1A). We confirmed that this variant (sIHF-R22S/ R25S/K29S/K33S, herein referred to as ‘cleft’ variant) was homogeneous and properly folded, as judged by dynamic light scattering and circular dichroism (Supplementary Fig. 1). The cleft variant showed a strong DNA-binding defect, indicating that the positively charged residues lining the cleft were critical for DNA binding (Fig. 2E). To further distinguish whether DNA binding was mediated by the cleft defined by the N-terminal helix and the main helix bundle, or by the N-terminal helix itself, we created a variant in which the first 13 amino acids of sIHF were removed (sIHF-Δ13). This region was disordered in both crystal structures of sIHF bound to DNA, but we reasoned that it may become ordered if DNA bound to the cleft. The sIHF-Δ13 variant showed reduced DNA binding (Fig. 2F), but the defect was not as severe as for the sIHF-cleft variant (Fig. 2E), suggesting that the cleft may represent the major site of DNA binding for sIHF.

3

BBA - General Subjects 1863 (2019) 129405

T. Nanji, et al.

Fig. 3. Small-angle X-ray scattering analysis of sIHF and sIHF-DNA complexes. (A) Scattering curve of sIHF and fitting (red line) of a representative ab initio model generated with GASBOR (top). Ab initio model depicted as a semi-transparent surface with the crystal structure of sIHF (ribbon diagram) superimposed (bottom). (B) Representative ab initio bead model generated with MONSA and corresponding fitting (red line) to the scattering curve of the sIHF-DNA complex assembled with the 8 bp palindrome. (C) Representative ab initio bead model generated with MONSA and corresponding fitting (red line) to the scattering curve of the sIHF-DNA complex assembled with the 23 bp DNA duplex. For panels (B) and (C) protein and DNA phases of the model are shown as purple and brown spheres, respectively. (D-E) Comparison of the theoretical scattering plots of the structure of sIHF bound to the 8 bp through the helix bundle lid (D) or the H2TH motif (E) with the experimental scattering plot for sIHF bound to the same 8 bp palindrome. The large χ2 values illustrate the poor fit of the theoretical curves to the experimental scattering curve. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

2.2. The cleft defined by helix α1 and the helix bundle drives DNA binding in solution

the sIHF model (Fig. 3B). Accordingly, comparison of the theoretical scattering curves calculated from the sIHF structure bound to DNA through the lid or the H2TH motif with the experimental scattering curve resulted in poor quality fits (Fig. 3C–D). To assess whether sIHF engaged multiple surfaces in binding longer DNA molecules, we collected scattering data of sIHF bound to the 23 bp duplex used for the mobility shift assays. The resulting ab initio models indicated that the duplex extended across the longest axis of sIHF (Fig. 3C), suggesting that the DNA-binding elements identified in the crystal structure together with the cleft may form a continuous DNAbinding surface. The limited resolution of the technique, however, prevented us from determining whether the interface of the complex was defined by the cleft and the lid (‘cleft+lid’), the cleft and the H2TH motif (‘cleft+H2TH’), or a mixture of both. Intrigued by the multiple DNA binding elements identified here, and the simultaneous interaction of sIHF with two DNA molecules in the crystal structure, we next used SAXS to test whether sIHF could bridge two DNA molecules. The dimensions and molecular weight of a protein or a protein-DNA complex can be directly determined from scattering curves [23]. Therefore, we measured the scattering curves of sIHF-DNA complexes assembled at different protein:DNA ratios. We first determined the experimental molecular weights of sIHF and the 23 bp DNA duplex individually. As expected, they were consistent with their calculated molecular weights (Table 2). The sIHF-DNA complex

The electromobility shift assay results seemed to indicate that the constraints imposed by crystal packing may have favored the formation of a complex that could not capture the full range of configurations in which sIHF can bind to DNA. In the crystal structure, the 8 bp DNA palindromes pack head-to-tail forming pseudo-continuous DNA duplexes along one axis of the unit cell (Supplementary Fig. 2). This configuration could potentially prevent sIHF from engaging the cleft in DNA-binding. To analyze the structure of the sIHF-DNA complex in an environment devoid of crystallographic constraints, we used smallangle X-ray scattering (SAXS) – a technique that provides structural information in solution [21]. sIHF behaved ideally in solution and ab initio modeling of the scattering curve yielded bead models with protruding extensions that stretched beyond the crystallographic model (Fig. 3A). This was expected because the histidine-tag and the first 13 amino acids of sIHF were disordered in the crystal structure and, therefore, not included in the final crystallographic model. We subsequently collected scattering data of sIHF bound to the 8 bp palindrome used for crystallization and modeled the scattering curves using multiphase bead-modeling [22]. The ab initio model of the sIHF-DNA complex suggested that DNA was bound at the interface between the extended (N-terminal helix) and the globular (helix bundle) regions of 4

BBA - General Subjects 1863 (2019) 129405

T. Nanji, et al.

Table 2 Small angle X-ray scattering data collection and analysis. sIHF

DNA (23 bp)

(sIHF:DNA) 1:1

(sIHF:DNA) 2:1

(sIHF:DNA) 1:2

Data collection Exposure time (min) Concentration (μM)

20 434

180 109

20 109

20 109

20 217

Structural parameters Io Io/conc Rg (Å) Dmax (Å) MWExperimental (kDa) MWCalculated (kDa)

0.24 0.5 21.3 66 16.4 13.7

0.2 1.8 21.9 71.5 10.6 14

0.6 1.4 25.7 94.5 26.9 27.8

0.6 5.6 29.6 103 46 41.4

0.6 1.4 24.7 84 20 41.7

assembled at a 1:1 ratio was larger (Dmax = 95 Å) than either sIHF (66 Å) or DNA (72 Å) on their own, indicating that they interacted to form a larger species (Table 2). Furthermore, the molecular weight determined from the scattering curve (27 kDa) was in good agreement with the predicted molecular weight for a 1:1 complex (27.8 kDa). Given that sIHF can bind DNA duplexes as short as 8 bp, we predicted that more than one sIHF molecule could bind to the 23 bp DNA duplex. Indeed, the scattering curve for the sIHF:DNA complex assembled at a 2:1 (protein:DNA) ratio had a larger Dmax and a molecular weight of 46 kDa, indicating that two sIHF monomers were bound to the 23 bp DNA duplex (Table 2). In both cases, analysis of the scattering curves revealed that the samples contained a single scattering species [24]. Conversely, when the sIHF:DNA complex was assembled at a 1:2 (protein:DNA) ratio, the molecular weight determined from the scattering curve was smaller than expected (20 kDa instead of 41.7 kDa), indicating that the sample was a mixture of free DNA and sIHF:DNA (1:1) complexes (Table 2). These results suggested that while multiple copies of sIHF could bind a single DNA molecule, sIHF did not bridge short DNA molecules.

However, in the presence of wild-type sIHF, the plasmid no longer adopted a plectonemic conformation, indicating that binding of sIHF had indeed changed the writhe of the plasmid (Fig. 4B and Supplementary Fig. 3). This change required the DNA-binding function of sIHF, because the plectonemic configuration of the plasmid was unaffected by the sIHF-cleft variant (Fig. 4C). We reasoned that since the plasmid DNA had a defined linking number and sIHF does not cleave DNA, the conformational changes observed on the micrographs were most likely the result of sIHF constraining negative supercoils. Interestingly, incubating pUC18 with the sIHF-R85A/R86S, sIHFN93A/Q94S, sIHF-Gly66+ and the sIHF-Δ13 variants resulted in a mixture of DNA plasmids with and without plectonemic supercoils (Fig. 4D–G). We did not observe intermediate conformations, but we had previously shown that sIHF binds DNA cooperatively [12] and, therefore, we suspect that binding of sIHF to topologically constrained DNA molecules may also be cooperative. From these experiments, we cannot distinguish whether sIHF constrains negative supercoils by replacing plectonemic with toroidal supercoils, or by reducing the twist of the DNA duplex. We currently favor the latter possibility based on the analysis of the DNA parameters showing that sIHF stabilizes an underwound conformation of the 8 bp palindrome (Supplementary Table 1) and because NAPs that wrap DNA rely on oligomerization to do so [27,28].

2.3. sIHF constrains negative supercoils The higher resolution and ordered DNA duplex in the crystal structure revealed previously undetected conformational restraints imposed by sIHF. Analysis of the DNA using the 3DNA software package revealed that the four DNA strands in the asymmetric unit formed two straight DNA duplexes with an average rise of 3.2 Å and a twist of 34.1° [25] (Supplementary Table 1). These values, as well as the sugar puckers, are consistent with a B-form conformation. However, the base pairs showed a significant inclination and reduced helical twist, indicating that sIHF binding stabilized an underwound conformation of the DNA duplex. To discern whether this reduced twist was imposed by sIHF binding or was a characteristic of this particular DNA sequence, we analyzed the crystal structure of a related DNA decamer [26]. The 5′ GCATGCATGC3′ decamer can adopt A- and B-form conformations depending on the crystallization conditions (Supplementary Table 1), indicating that, while this DNA sequence can sample multiple conformations, sIHF stabilizes the underwound B-form of the duplex. Since nucleoid associated proteins often promote nucleoid condensation by constraining negative supercoils [2], we wondered whether sIHF might cooperatively remodel topologically constrained DNA molecules. If sIHF-binding restrained negative supercoils, binding to a supercoiled plasmid would change its writhe and it could be readily visualized by the change in the number of plectonemic supercoils. To visualize these changes, we incubated wild type and each sIHF variant with a supercoiled pUC18 plasmid and imaged the complexes using negativestaining electron microscopy. In the absence of sIHF, all plasmid molecules showed the plectonemic conformation characteristic of supercoiled DNA (Fig. 4A and Supplementary Fig. 3). All DNA molecules imaged (n > 100) had the same topology, indicating that the sample was devoid of nicked DNA.

2.4. All DNA-binding interfaces contribute to Streptomyces development and metabolism Deleting sIHF from the S. coelicolor chromosome results in abnormal antibiotic production, decreased sporulation, and aberrant chromosome segregation and condensation within the spores that do form [12]. To probe the relative functionality of the different interfaces, we introduced each of the mutant variants into an sIHF deletion strain and tested their ability to complement the mutant defects (Fig. 5). We found that the sIHF-NQ93 and sIHF-Gly66+ variants effectively complemented the sporulation defect of the sIHF mutant (Fig. 5A). These variants also restored some level of actinorhodin (blue antibiotic) production to the mutant (Fig. 5A). In contrast, the sIHF-cleft and the sIHF-Δ13 variants were phenotypically indistinguishable from the sIHF mutant (Fig. 5A). We also assessed the nucleoid condensation characteristics of the different strains and determined that they could be subdivided into one of two groups (Fig. 5B and Supplementary Fig. 4). The sIHF-Gly66+ expressing variant had more uniformly compacted nucleoids and was most similar to the strain complemented with wild-type sIHF. The other variant-encoding strains exhibited nucleoids with significant size variation relative to wild type (as determined using Levene's test for relative variation [29]) and were more reminiscent of the sIHF mutant strain containing an empty plasmid (Fig. 5B). These observations were largely consistent with the sporulation and antibiotic production differences observed above, with the exception of the NQ93 mutant, which exhibited heterogeneous levels of DNA condensation, but could 5

BBA - General Subjects 1863 (2019) 129405

T. Nanji, et al.

Fig. 4. Effect of sIHF variants on topologically constraint DNA. Negative-stained micrographs of supercoiled pUC18 plasmid on its own (A) or pre-incubated with: wild-type sIHF (WT) (B), sIHF-cleft (cleft) (C), sIHF-R85A/R86S (RR85) (D), sIHF-N93A/Q94S (NQ93) (E), sIHF-Gly66+ (G66+) (F) and sIHF-Δ13 (Δ13) (G). All complexes were incubated at 1:300 (DNA:protein) ratios. (H) The percentage of DNA plasmids with plectonemic supercoils present in each sample is shown as a scatter plot. Between 60 and 150 DNA molecules were scored for each sample by four different individuals.

restore both antibiotic production and sporulation to the sIHF mutant (Table 3). Finally, we assessed the levels of each sIHF variant in the sIHF mutant background, compared with a wild-type strain and a strain complemented with wild-type sIHF (Fig. 5C). The NQ93 protein was present at approximately wild-type levels, whereas the G66+ protein levels were reproducibly lower. Interestingly, neither the Δ13 nor the cleft mutant proteins could be detected by immunoblotting, suggesting that their inability to effectively bind DNA may lead to their rapid turnover in the cell, explaining their inability to complement the sIHF mutant defects.

mechanistic niche within bacterial nucleoid associated proteins. Reinforcing this idea, mutations in any of the DNA-binding elements of sIHF adversely affected its ability to constrain negative supercoils in DNA. Interestingly, the individual contributions of each surface do not appear to be equivalent for different actinobacterial IHFs. Of the three conserved arginine residues in M. tuberculosis IHF, mutation of Arg170 and Arg171 (corresponding to Arg85 and Arg86 in sIHF) abolished DNA binding, whereas mutation of Arg173 led to a minor DNA-binding defect [32]. The opposite was observed for the lid and cleft variants of sIHF with respect to DNA binding, thereby highlighting the functional plasticity of actinobacterial IHFs. The crystal packing observed in the structure of sIHF bound to DNA, where palindromes packing head-to-tail formed pseudo-continuous DNA duplexes (Supplementary Fig. 2), may have precluded sIHF from using the cleft and lid simultaneously. However, the supramolecular organization of these pseudo-duplexes forming parallel DNA bundles held together by protein-protein interactions, revealed a possible mechanism by which sIHF could compact DNA in its monomeric form. Indeed, this organization is reminiscent of the supramolecular organization seen in the crystal structures of the histone-like proteins HUαα and HUαβ bound to DNA, where parallel DNA fibers are held together through protein-mediated interactions [6]. The main drivers of chromosome condensation are DNA supercoiling and macromolecular crowding. The latter is caused by high concentrations of macromolecules in the nucleoid that result in strong depletion/attraction forces. These crowding conditions can shift the equilibrium constant for many protein-DNA interactions, and in doing so, may alter the contributions of ancillary DNA-binding interfaces present in NAPs. In this environment, sIHF almost certainly acts in conjunction with other proteins in promoting DNA condensation. We envision a model whereby sIHF could simultaneously employs two or three of its binding elements to facilitate chromosome organization and compaction (Fig. 6). For example, all three DNA-binding elements may be important in stabilizing DNA bridges formed by other NAPs, while functional associations with NAPs that bend DNA could favor combinations of two DNA-binding elements, in which the lid of the helix bundle (or the

3. Discussion sIHF is required for normal Streptomyces development, antibiotic production and nucleoid compaction, and its counterpart in M. tuberculosis is essential for viability. Given its unusual monomeric nature, how sIHF exerts its regulatory and architectural functions has been an important question. Here, we have identified a critical role for the Nterminus of the protein, and in particular, have defined the region bounded by the N-terminal helix and the helix bundle of the protein, as being a key activity determinant. Disrupting this interface abrogates DNA binding, DNA remodeling, Streptomyces development and antibiotic production. The two DNA-binding surfaces (lid and H2TH motifs) identified in the crystal structure of sIHF bound to DNA (this work and [12]), contribute but probably cannot drive DNA-binding on their own. This finding is consistent with work on other H2TH-containing proteins, where the DNA-binding role for this motif has been shown to be largely peripheral [18–20,30]. However, the lid motif, and to a lesser extent the H2TH motif, are necessary for DNA remodeling and wild-type levels of antibiotic production; and all the DNA-binding elements of sIHF are required to effectively constrain negative supercoils in DNA. Many NAPs constrain negative supercoils but, unlike sIHF, most do so by assembling complex protein scaffolds [6,31]. Our findings suggest that the monomeric sIHF employs multiple DNA-binding elements to bypass the need for oligomerization and, hence, it occupies a unique 6

BBA - General Subjects 1863 (2019) 129405

T. Nanji, et al.

Fig. 5. Complementation of sporulation, antibiotic production and chromosome condensation defects of sIHF variants. (A)sIHF mutant S. coelicolor strains containing an empty plasmid, or a range of sIHF variants, grown on MS agar plates for 4 days. Images from left to right: sporulating cultures, strain legend and underside of plate depicting antibiotic production (blue actinorhodin and red undecylprodigiosin). (B) Box and whisker plots of nucleoid areas for the sIHFcontaining strains, relative to a plasmid-alone control. The boxes delineate the upper and lower quartile nucleoid areas for each strain and the horizontal line within the box indicates the median nucleoid area. The vertical ‘whiskers’ mark the largest and smallest areas observed. n > 270 spores for each strain. (C) Immunoblots of sIHF expression in the different complementation backgrounds. Blot of sIHF (top panel) and an unknown cross-reactive protein (middle panel) using an α-sIHF polyclonal antibody. PVDF membrane stained with Coomassie Brilliant Blue to ensure equivalent protein loading (bottom panel). Table 3 Summary of sIHF variant effects.

WT ΔsIHF Δ1–13 Cleft N93A/Q94S Gly66+

Motif

DNA binding

Plasmid remodel

Sporulation

Nucleoid compaction

Actinorhodin production

Stable in vivo

N-term N-term Lid H2TH

++ – + – ++ ++

++ – + – + +

++ −/+ −/+ −/+ ++ ++

Homogeneous Heterogenous Heterogenous Heterogenous Heterogenous Homogeneous

+++ – – – ++ ++

Yes n/a Yes Yes Yes Yes

H2TH motif) would extend the DNA-binding surface from the cleft (Fig. 6). In this model, sIHF-mediated interactions would synergize with other NAPs to restrain supercoils and promote macromolecular crowding. We speculate that the relative contributions of the multiple DNAbinding elements of sIHF may also change throughout the course of the Streptomyces life cycle; while some level of chromosome organization would be critical at all stages, chromosome condensation only takes place during sporulation in the aerial cells. Notably, heterogeneous chromosome condensation has also been observed for Streptomyces strains expressing mutant variants of other proteins that impact chromosome condensation and segregation, including the sporulation-specific HU-like protein HupS [33], and the topoisomerase TopA [34]. A single protein with multiple DNA binding interfaces adds a new dimension to the mechanistic repertoire ascribed to bacterial NAPs and lays the foundation for understanding the flexible interplay between

chromosome organization and those proteins responsible. While sIHF – and mIHF – are profound modulators of actinobacterial chromosome dynamics, they must function together with other NAPs to promote chromosome organization and nucleoid compaction. Understanding the functional relationships between these different proteins will be an important next step in establishing a complete picture of actinobacterial chromosome dynamics. 4. Experimental procedures 4.1. sIHF protein expression and purification S. coelicolor sIHF was cloned into the NdeI and BamHI restriction enzyme sites of the pET-15b vector (Novagen), which contains a removable N-terminal poly-histidine tag. The resulting plasmid (pAG8380) was transformed in E. coli BL21(DE3) Rosetta cells, after 7

BBA - General Subjects 1863 (2019) 129405

T. Nanji, et al.

essentially recapitulated the sIHF wild type complementation construct. The promoter and terminator sequences, separated by NdeI and BamHI restriction enzyme sites, were fused together by overlap extension PCR, before being introduced into pIJ82. The integrity of the final constructs was confirmed by sequencing. Each variant was then introduced into E. coli strain ET12567 carrying pUZ8002 and conjugated into the S. coelicolor sIHF mutant strain. Exconjugants were selected for with hygromycin B (50 μg/mL). Integration of the plasmid (and its associated sIHF variant) was confirmed by PCR amplification and sequencing (MOBIX, McMaster) for representative colonies. 4.3. Protein crystallization data collection and structure determination Fig. 6. Model for the role of sIHF in nucleoid condensation. The bacterial nucleoid (green coil) achieves its condensed state by the coordinated action of multiple nucleoid associated proteins (NAPs). Many of these NAPs remodel the nucleoid by bending (blue) or bridging (orange) DNA. The multiple binding elements of sIHF will synergize with additional NAPs in Streptomyces coelicolor to enable chromosome organization/condensation. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

TN08-BP1 (5′CATGCATG) was purchased from IDT and resuspended. To form the sIHF:DNA complex, equal volumes of sIHF (1.5 mM, diluted in 2× storage buffer) and the 8 bp palindrome (1.5 mM, in deionized water) were mixed and incubated on ice at 4 °C overnight. Crystals of sIHF bound to TN08-BP1 grew in 0.1 M HEPES pH 7.6, 0.2 M KSCN, 19% (w/v) PEG 3350, and 5% (v/v) ethylene glycol. Data were collected using beam line X25 at the National Synchrotron Light Source (NSLS), Brookhaven National Laboratory (BNL) (Upton, NY). Data were indexed, processed, and merged using HKL2000 [35]. The structure was phased by molecular replacement using PDB entry 4ITQ as search model and refined using iterative cycles of manual model building in COOT and refinement in PHENIX [36,37] (Table 1). The structure has been deposited in the Protein Data Bank (PDB ID: 6BEK).

which cells were grown in Luria-Bertani (LB) medium containing 100 μg/mL ampicillin and 25 μg/mL chloramphenicol. Cells were grown in LB medium at 37 °C until the culture reached an OD600 of ~0.7. sIHF production was induced by addition of 1.0 mM isopropylbeta-D-thiogalactopyranoside (IPTG), and was allowed to proceed for 3 h at 37 °C. Cells were harvested by centrifugation for 15 min at 3000 ×g. Cell pellets were resuspended in 20 mL of buffer A (20 mM Tris pH 8.0, 300 mM NaCl, 1.4 mM β-mercaptoethanol, 5% (v/v) glycerol) and lysed by sonication. Cellular debris was removed by centrifugation at 39,000 ×g for 40 min at 4 °C. Clarified cell lysates were loaded onto a 5 mL HiTrap Chelating HP column (GE Healthcare). The column was washed with increasing concentrations of imidazole (7.5 and 20 mM) and sIHF was eluted from the column with 150 mM imidazole. Fractions containing His-tagged sIHF were loaded onto a Mono S 10/ 100 GL column (GE Healthcare) equilibrated with 20 mM Tris pH 8.0, 100 mM NaCl, 1.4 mM β-mercaptoethanol, 5% (v/v) glycerol and resolved using a linear gradient to 1 M NaCl. The His-tag was removed with thrombin and tagless sIHF was purified on a Mono S 5/50 GL column (GE Healthcare) with a gradient to 1 M NaCl. Purified sIHF protein was concentrated and stored in storage buffer (20 mM Tris pH 8.0, 150 mM NaCl, 10 mM MgCl2, 1.4 mM β-mercaptoethanol, 5% (v/v) glycerol).

4.4. Electrophoretic mobility shift assays To test the DNA binding of sIHF variants, electrophoretic mobility shift assays were performed as described previously [12], with minor modifications. Here, 0.02 μM of a 5′-end-labeled 23 bp DNA duplex (top strand 5′TCGAAAAATCGGAATCTGGTGCA; bottom strand 5′TGCACCA GATTCCGATTTTTCGA), was incubated with increasing concentrations of each sIHF variant (0–100 μM). Gels were first exposed to a phosphorimaging plate for ~30 min and visualized using a phosphorimager (Amersham Biosciences Ltd.), then subsequently exposed to Kodak Biomax XAR film for ~1 h and developed. Assays were conducted in triplicate. 4.5. Small-angle X-ray scattering analysis Purified (His)6-sIHF was resolved using a Superdex-75 (GE Healthcare) size exclusion chromatography column in 40 mM Tris pH 8.0, 200 mM NaCl, 20 mM MgCl2, 2.8 mM β-mercaptoethanol, and 10% (v/v) glycerol. Prior to data collection, 20 μL of each sample were centrifuged for 10 min at 15,700 ×g at 4 °C. Samples were then loaded into a 12 μL quartz cuvette and dynamic light scattering profiles were collected on a Zetasizer Nano (Malvern Instruments). Scattering data for His-tagged sIHF were collected over a range of protein concentration (0.5–1 mM) on a BioSAXS-1000 mounted on a MicroMax-007HF Xray generator. Data were collected at 4 °C for 3 h at each concentration with images refreshing every 20 min. Scattering curves were generated using Rigaku SAXSLab 3.0.0r1 by subtracting buffer scatter from sample scatter. Analysis of the scattering curves at increasing protein concentrations indicated that all samples behaved ideally in solution. Data quality was assessed for aggregation using Guinier plots, and Kratky plots were used to compare protein concentrations and exposure times [24]. The scattering curves for the highest (1 mM) and lowest (0.5 mM) protein concentrations were then merged and the resulting curved was used to calculate Rg and Dmax using Primus version 2.7.1. Ab initio bead models of sIHF were calculated using GASBOR [38] and multiphase bead modeling of the sIHF-DNA complex was performed using with MONSA [22]. Scattering data for His-tagged sIHF bound to the 23 bp DNA duplex

4.2. Production of sIHF variants All sIHF variants were generated by either site-directed mutagenesis or overlap extension. sIHF-R85A/R86S (pAG8775) and sIHF-N93A/ Q94S (pAG8780) were generated by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies) from template pAG8380. The sIHF variant containing an additional glycine after residue 66 (sIHFG66+, pAG8866), as well as the cleft (R22S/R25S/K29S/K33S, pAG8894) variants were generated by overlap extension PCR and subcloned in pET-15b. The N-terminal deletion was generated by PCR, inserting an NdeI restriction site immediately preceding residue Ala14, and then introducing the resulting DNA fragment into pET-15b to yield plasmid pAG8779 (sIHF-Δ13). All mutations were confirmed by DNA sequencing (MOBIX, McMaster). sIHF variants were overexpressed in the same way as wild-type sIHF, and were stored in 20 mM Tris pH 8.0, 150 mM NaCl, 1.4 mM β-mercaptoethanol, 5% (v/v) glycerol at −80 °C for later use. To test the in vivo functionality of the different sIHF variants, we excised the sIHF mutant coding sequences from pET-15b using NdeI and BamHI, and subcloned them into the integrative plasmid vector pIJ82 carrying the sIHF promoter and terminator sequences. This 8

BBA - General Subjects 1863 (2019) 129405

T. Nanji, et al.

used for the mobility shift assays, were collected at ratios of 1:1, 2:1, and 1:2 (sIHF:DNA) over a range of protein concentrations (0.109–0.434 mM), on a BioSAXS-1000 mounted on a MicroMax-007HF X-ray generator. Data were collected for 20–180 min at each concentration with images refreshing every 20 min. Scattering curves were generated, analyzed and modeled described above.

4.8. Streptomyces phenotypic assays The development of S. coelicolor sIHF mutant and complemented variants was assessed by growing strains on MS agar plates for 4 days at 30 °C before being photographed [39]. Nucleoid areas were assessed for S. coelicolor strains inoculated under angled glass coverslips inserted into MS agar plates, as described previously [12]. After four days, the coverslips were removed from the agar plates, and the adherent cells were fixed with methanol, stained with DAPI (Invitrogen) and washed briefly with sterile water. The coverslips were then mounted onto microscope slides prior to imaging with a Zeiss Axio microscope, using the 100× oil-immersion objective. Nucleoid areas were determined using the particle analysis algorithm (Otsu threshold) in ImageJ. Briefly, DAPI-stained images were opened in ImageJ before being converted to 8-bit images. Images were then processed using the Auto Local Threshold setting, with the Otsu method. The image was then inverted, and particle analyses were run to determine the nucleoid areas, with upper and lower limits set at 15–300 pixels. Nucleoid areas were then presented in box and whisker format, which allow for indication of median nucleoid size (middle line), upper and lower quartiles (boxes), and maximum and minimum nucleoid sizes (whiskers). Variance in nucleoid size, relative to wild type, was assessed using Levene's test for relative variance [29]. n > 270 spores for all strains.

4.6. Negative staining electron microscopy For electron microscopy imaging, sIHF-DNA complexes were assembled in 20 mM Tris pH 8.0, 150 mM NaCl, 10 mM MgCl2, 1.4 mM βmercaptoethanol by adding sIHF and a commercial pUC18 plasmid (2686 bp) to final concentrations of 360 and 1.2 nM, respectively. sIHF can bind to DNA duplexes as short as 6–8 bp, therefore 300–450 are necessary to cover the entire pUC18 plasmid. The complexes were incubated at room temperature for 10 min, followed by 30 min on ice. Five microliters of the sIHF-DNA mixtures were deposited on 400 mesh copper grids (Electron Microscopy Sciences Ltd) with a continuous layer of carbon and incubated for 2 min. The excess of sample was blotted with filter paper and then the grids were stained with 1% (w/v) uranyl acetate for 1 min. Protein and DNA controls were prepared at the same concentrations as the complexes. All samples were prepared from the same DNA stock to minimize variability of the results. Electron micrographs shown in Fig. 3 were imaged at a nominal magnification of 12,200× on a JEOL 1200EX transmission electron microscope equipped with an AMT Digital Camera (FHS Electron Microscopy Facility, McMaster University). An average of 20–30 images per samples were collected from which 60–120 molecules were scored based on the presence/absence of plectonemic supercoils. The samples were blinded and scored by four individuals and the results used to prepare the graph in Fig. 4. Fields of view shown in Supplementary Fig. 4 were imaged at a nominal magnification of 23,000× on a FEI Tecnai G2 Spirit transmission electron microscope equipped with a Gatan Ultrascan 4000 4 k × 4 k CCD camera (Facility for Electron Microscopy Research, McGill University).

Acknowledgements We thank former and current members of the Guarné and Elliot laboratories for stimulating discussions, Dr. Dworkin for helpful discussions on statistical analysis, and Drs. Verdaguer and Nodwell for critical reading of the manuscript. This work was funded by grants from the Canadian Institutes of Health Research MOP-67189 (to A.G.) and the Natural Sciences and Engineering Council of Canada (NSERC, Discovery Grant 04681) and an NSERC Discovery Accelerator Supplement (to M.A.E.). E.J.G. was supported by a Canadian Commonwealth Post-Doctoral Fellowship. C.D.F. was supported by a NSERC-CGS and Ontario Graduate Scholarships.

4.7. sIHF protein detection via immunoblotting

Declaration of Competing Interests

S. coelicolor cultures were grown in a 1:1 mixture of yeast extractmalt extract (YEME) and tryptone soya broth (TSB) for 2 days [39]. Cells were collected by centrifugation, after which they were resuspended in lysis buffer (10 mM Tris-HCl, 10 mM KCl, 50 mM NaCl, 2 mM MgCl2, 1 mM DTT, EDTA-free protease inhibitor (Roche), 0.4 mg/ μL lysozyme). The resulting cell suspensions were incubated for 1 h in a 37 °C water bath before being lysed by sonication. Lysates were then centrifuged at 4 °C for 30 min at 12,000 ×g to separate soluble proteins from cell debris and insoluble compounds, and the supernatant was retained for analysis. Cell-free extracts were generated for different complemented strains grown for 2 days in liquid medium, and their concentrations determined using a Bradford assay as per the manufacturer's instructions (BioRad). Protein samples were heated to 95 °C for 10 min in protein loading buffer (40% glycerol, 200 mM Tris-HCl pH 6.8, 8% SDS, 0.04% bromophenol blue, 5% 2-mercaptoethanol) prior to loading on 15% Tris-tricine SDS-polyacrylamide gels. Samples were electrophoresed for 1.5 h at 200 V, and proteins were either visualized following staining with Coomassie Brilliant Blue (to ensure equivalent protein loading in each lane) or were transferred to a PVDF membrane for immunoblotting (Fig. 4C). Immunoblotting was carried out as described previously [12], with minor modifications to incubation times and antibody concentrations. The initial blocking reaction was carried out in Tris-buffered saline with Tween (20 mM Tris, 150 mM NaCl, 0.01% Tween) (TBS-T) with 5% skim milk powder for 1 h; incubation with the primary (sIHF polyclonal) antibody (1/500 dilution) involved a 1 h incubation in blocking solution; while incubation with the secondary antibody (1/ 3000 dilution) involved a 30 min incubation in blocking solution.

None. Authors contributions T.N., E.J.G., Y.S., M.G., A.H., X.Z., C.D.F., and A.R. performed the experiments, analyzed data and prepared figures. M.A.E. and A.G. designed experiments. J.O., M.A.E., and A.G. analyzed data and wrote the manuscript with input from all other authors. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.bbagen.2019.07.014. References [1] S.C. Dillon, C.J. Dorman, Bacterial nucleoid-associated proteins, nucleoid structure and gene expression, Nat. Rev. Microbiol. 8 (2010) 185–195. [2] M.S. Luijsterburg, M.F. White, R. van Driel, R.T. Dame, The major architects of chromatin: architectural proteins in bacteria, archaea and eukaryotes, Crit. Rev. Biochem. Mol. Biol. 43 (2008) 393–418. [3] R.T. Dame, M.C. Noom, G.J. Wuite, Bacterial chromatin organization by H-NS protein unravelled using dual DNA manipulation, Nature 444 (2006) 387–390. [4] C.J. Lim, L.J. Kenney, J. Yan, Single-molecule studies on the mechanical interplay between DNA supercoiling and H-NS DNA architectural properties, Nucleic Acids Res. 42 (2014) 8369–8378. [5] K.K. Swinger, K.M. Lemberg, Y. Zhang, P.A. Rice, Flexible DNA bending in HU-DNA cocrystal structures, EMBO J. 22 (2003) 3749–3760. [6] M. Hammel, D. Amlanjyoti, F.E. Reyes, J.H. Chen, R. Parpana, H.Y. Tang, C.A. Larabell, J.A. Tainer, S. Adhya, HU multimerization shift controls nucleoid

9

BBA - General Subjects 1863 (2019) 129405

T. Nanji, et al. compaction, Sci. Adv. 2 (2016) e1600650. [7] P. Thaw, S.E. Sedelnikova, T. Muranova, S. Wiese, S. Ayora, J.C. Alonso, A.B. Brinkman, J. Akerboom, J. van der Oost, J.B. Rafferty, Structural insight into gene transcriptional regulation and effector binding by the Lrp/AsnC family, Nucleic Acids Res. 34 (2006) 1439–1449. [8] K.K. Swinger, P.A. Rice, IHF and HU: flexible architects of bent DNA, Curr. Opin. Struct. Biol. 14 (2004) 28–35. [9] C.Q. Pan, S.E. Finkel, S.E. Cramton, J.A. Feng, D.S. Sigman, R.C. Johnson, Variable structures of Fis-DNA complexes determined by flanking DNA-protein contacts, J. Mol. Biol. 264 (1996) 675–695. [10] J.A. Goodrich, M.L. Schwartz, W.R. McClure, Searching for and predicting the activity of sites for DNA binding proteins: compilation and analysis of the binding sites for Escherichia coli integration host factor (IHF), Nucleic Acids Res. 18 (1990) 4993–5000. [11] M.L. Pedulla, M.H. Lee, D.C. Lever, G.F. Hatfull, A novel host factor for integration of mycobacteriophage L5, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 15411–15416. [12] J.P. Swiercz, T. Nanji, M. Gloyd, A. Guarne, M.A. Elliot, A novel nucleoid-associated protein specific to the actinobacteria, Nucleic Acids Res. 41 (2013) 4171–4184. [13] Y.H. Yang, E. Song, J. Willemse, S.H. Park, W.S. Kim, E.J. Kim, B.R. Lee, J.N. Kim, G.P. van Wezel, B.G. Kim, A novel function of Streptomyces integration host factor (sIHF) in the control of antibiotic production and sporulation in Streptomyces coelicolor, Antonie Van Leeuwenhoek 101 (2012) 479–492. [14] N. Sharadamma, Y. Harshavardhana, A. Ravishankar, P. Anand, N. Chandra, K. Muniyappa, Molecular dissection of mycobacterium tuberculosis integration host factor reveals novel insights into the mode of DNA binding and nucleoid compaction, Biochemistry 54 (2015) 4142–4160. [15] A. Mishra, M. Vij, D. Kumar, V. Taneja, A.K. Mondal, A. Bothra, V. Rao, M. Ganguli, B. Taneja, Integration host factor of Mycobacterium tuberculosis, mIHF, compacts DNA by a bending mechanism, PLoS One 8 (2013) e69985. [16] S. Ghosh, B. Mallick, V. Nagaraja, Direct regulation of topoisomerase activity by a nucleoid-associated protein, Nucleic Acids Res. 42 (2014) 11156–11165. [17] R. Rohs, S.M. West, A. Sosinsky, P. Liu, R.S. Mann, B. Honig, The role of DNA shape in protein-DNA recognition, Nature 461 (2009) 1248–1253. [18] J.C. Fromme, G.L. Verdine, Structural insights into lesion recognition and repair by the bacterial 8-oxoguanine DNA glycosylase MutM, Nat. Struct. Biol. 9 (2002) 544–552. [19] R. Gilboa, D.O. Zharkov, G. Golan, A.S. Fernandes, S.E. Gerchman, E. Matz, J.H. Kycia, A.P. Grollman, G. Shoham, Structure of formamidopyrimidine-DNA glycosylase covalently complexed to DNA, J. Biol. Chem. 277 (2002) 19811–19816. [20] D.O. Zharkov, G. Golan, R. Gilboa, A.S. Fernandes, S.E. Gerchman, J.H. Kycia, R.A. Rieger, A.P. Grollman, G. Shoham, Structural analysis of an Escherichia coli endonuclease VIII covalent reaction intermediate, EMBO J. 21 (2002) 789–800. [21] M.C. Pillon, A. Guarne, Complementary uses of small angle X-ray scattering and Xray crystallography, Biochim. Biophys. Acta, Proteins Proteomics 1865 (2017) 1623–1630. [22] D.I. Svergun, Restoring low resolution structure of biological macromolecules from solution scattering using simulated annealing, Biophys. J. 76 (1999) 2879–2886. [23] R.P. Rambo, J.A. Tainer, Accurate assessment of mass, models and resolution by

small-angle scattering, Nature 496 (2013) 477–481. [24] P.V. Konarev, V.V. Volkov, A.V. Sokolova, M.H.J. Koch, D.I. Svergun, PRIMUS: a Windows PC-based system for small-angle scattering data analysis, J. Appl. Crystallogr. 36 (2003) 1277–1282. [25] G. Zheng, X.J. Lu, W.K. Olson, Web 3DNA – a web server for the analysis, reconstruction, and visualization of three-dimensional nucleic-acid structures, Nucleic Acids Res. 37 (2009) W240–W246. [26] A. Thirugnanasambandam, S. Karthik, G. Artheswari, N. Gautham, DNA polymorphism in crystals: three stable conformations for the decadeoxynucleotide d (GCATGCATGC), Acta Crystallogr. D Struct. Biol. 72 (2016) 780–788. [27] Y.S. Chung, T. Brendler, S. Austin, A. Guarne, Structural insights into the cooperative binding of SeqA to a tandem GATC repeat, Nucleic Acids Res. 37 (2009) 3143–3152. [28] A. Guarne, T. Brendler, Q. Zhao, R. Ghirlando, S. Austin, W. Yang, Crystal structure of a SeqA-N filament: implications for DNA replication and chromosome organization, EMBO J. 24 (2005) 1502–1511. [29] B.B. Schultz, Levene's test for relative variation, Syst. Biol. 34 (1985) 449–456. [30] D.E. Brodersen, W.M. Clemons Jr., A.P. Carter, B.T. Wimberly, V. Ramakrishnan, Crystal structure of the 30 S ribosomal subunit from Thermus thermophilus: structure of the proteins and their interactions with 16 S RNA, J. Mol. Biol. 316 (2002) 725–768. [31] S.T. Arold, P.G. Leonard, G.N. Parkinson, J.E. Ladbury, H-NS forms a superhelical protein scaffold for DNA condensation, Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 15728–15732. [32] N. Sharadamma, Y. Harshavardhana, K. Muniyappa, Defining the functionally important domain and amino acid residues in Mycobacterium tuberculosis integration host factor for genome stability, DNA binding and integrative recombination, J. Bacteriol. 199 (2017). [33] P. Salerno, J. Larsson, G. Bucca, E. Laing, C.P. Smith, K. Flardh, One of the two genes encoding nucleoid-associated HU proteins in Streptomyces coelicolor is developmentally regulated and specifically involved in spore maturation, J. Bacteriol. 191 (2009) 6489–6500. [34] M. Szafran, P. Skut, B. Ditkowski, K. Ginda, G. Chandra, J. Zakrzewska-Czerwinska, D. Jakimowicz, Topoisomerase I (TopA) is recruited to ParB complexes and is required for proper chromosome organization during Streptomyces coelicolor sporulation, J. Bacteriol. 195 (2013) 4445–4455. [35] Z. Otwinowski, W. Minor, Processing of X-ray diffraction data collected in oscillation mode, Methods Enzymol. 276 (1997) 307–326. [36] P.V. Afonine, R.W. Grosse-Kunstleve, N. Echols, J.J. Headd, N.W. Moriarty, M. Mustyakimov, T.C. Terwilliger, A. Urzhumtsev, P.H. Zwart, P.D. Adams, Towards automated crystallographic structure refinement with phenix.Refine, Acta Crystallogr. D Biol. Crystallogr. 68 (2012) 352–367. [37] P. Emsley, K. Cowtan, Coot: model-building tools for molecular graphics, Acta Crystallogr. D Biol. Crystallogr. 60 (2004) 2126–2132. [38] D.I. Svergun, M.V. Petoukhov, M.H. Koch, Determination of domain structure of proteins from X-ray solution scattering, Biophys. J. 80 (2001) 2946–2953. [39] T. Kieser, M.J. Bibb, M.J. Buttner, K.F. Chater, D.A. Hopwood, Practical Streptomyces Genetics, John Innes Foundation, Norwich, UK, 2000.

10