Stress induces transient auditory hypersensitivity in rats

Hearing Research 259 (2010) 55–63

Contents lists available at ScienceDirect

Hearing Research journal homepage: www.elsevier.com/locate/heares

Research paper

Stress induces transient auditory hypersensitivity in rats Birgit Mazurek a,*, Heidemarie Haupt a, Ricarda Joachim b, Burghard F. Klapp b, Timo Stöver c, Agnieszka J. Szczepek a a

Molecular Biology Research Laboratory, Department of Otorhinolaryngology, Charité – Universitätsmedizin Berlin, Berlin, Germany Department of Internal Medicine and Psychosomatics, Charité – Universitätsmedizin Berlin, Berlin, Germany c Department of Otorhinolaryngology, Medical University of Hannover, Hannover, Germany b

a r t i c l e

i n f o

Article history: Received 30 January 2009 Received in revised form 9 July 2009 Accepted 13 October 2009 Available online 17 October 2009 Keywords: Stress ABR DPOAE Corticosterone Auditory hypersensitivity Gene expression

a b s t r a c t Exposure to harsh environment induces stress reactions that increase probability of survival. Stress influences the endocrine, nervous and immune systems and affects the functioning of a variety of organs. Numerous researchers demonstrated that a 24-h exposure to an acoustic rodent repellent provokes stress reaction in exposed animals. In addition to the activated hypothalamic–pituitary–adrenal (HPA) axis, exposed animals had pathological reactions in the reproductive organs, bronchia and skin. Here, we examined the effect of above stress model on the auditory system of Wistar rats. We found that 24-h stress decreases the thresholds and increases the amplitudes of auditory brainstem responses and distortion product otoacoustic emissions. Resultant auditory hypersensitivity was transient and most pronounced between 3 and 6 h post-stress, returning to control levels one week later. The concentration of corticosterone and tumor necrosis factor alpha was systemically elevated in stressed animals between 3 and 6 h post-stress, confirming the activation of the HPA axis. In addition, expression of the HPA-axisassociated genes: glucocorticoid receptor (GR) and hypoxia-inducible factor 1 alpha (Hif1a) was modulated in the auditory tissues. In detail, in the inferior colliculus, we found an up-regulation of GR mRNA 3 h post-stress and continuous up-regulation of Hif1a up to 24 h post-stress. In the spiral ganglion, we found no differences in gene expression between stressed and control animals. In the organ of Corti, expression of GR mRNA remained stable, whereas that of Hif1a was significantly down-regulated one week after stress. In addition, the expression of an outer hair cell marker prestin was significantly up-regulated 6 h post-stress. We conclude that 24-h stress induces transient hypersensitivity of the auditory system and modulates gene expression in a tissue-specific manner. Stress-induced auditory hypersensitivity could have evolutionary consequence by giving animals an advantage of hearing better under stress conditions. Ó 2009 Elsevier B.V. All rights reserved.

1. Introduction Stress is a common aspect of life triggered by a stimulus (stressor). Accumulating clinical and experimental evidence implies that stress activates the endocrine (hypothalamic–pituitary–adrenal

Abbreviations: ABR, auditory brainstem response; ANCOVA, analysis of covariance; ANOVA, analysis of variance; Ct, crossing threshold; DPOAE, distortion product otoacoustic emission; GABA, gamma-aminobutyric acid; GR, glucocorticoid receptor; Hif1a, hypoxia-inducible factor 1 alpha; HPA, hypothalamic–pituitary– adrenal; IC, inferior colliculus; IL1-beta, interleukin 1 beta; IL-6, interleukin 6; OC, organ of Corti; OHC, outer hair cell; RT-PCR, reverse transcription polymerase chain reaction; SEM, standard error of the means; SG, spiral ganglion; TNF-alpha, tumor necrosis factor alpha * Corresponding author. Address: Tinnitus Center, Department of Otorhinolaryngology, Charité – Universitätsmedizin Berlin, Charitéplatz 1, D-10117 Berlin, Germany. Tel.: +49 30 450555009; fax: +49 30 450555942. E-mail address: [email protected] (B. Mazurek). 0378-5955/$ - see front matter Ó 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.heares.2009.10.006

(HPA) axis), neuronal (sympathetic nervous system) and immune systems and induces the release of several biologically active compounds: hormones, neurotransmitters and cytokines (Ader et al., 1995; Cacioppo et al., 1998; Chrousos, 1998). Activation of the HPA axis induces production of a major stress hormone: cortisol (in humans) or corticosterone (in rats) that can directly or indirectly impact numerous tissues and organs (Datson et al., 2008; Kyrou and Tsigos, 2007). Cortisol and corticosterone bind to glucocorticoid receptor (GR). GR serves not only as a receptor but also as a transcription factor that activates or trans-represses gene transcription (Heitzer et al., 2007). The exact mechanism of gene transcription regulation and the identification of potential gene targets are a subject of intensive research in the neuroendocrinology (Datson et al., 2008). For instance, GR can down-regulate the expression it its own transcript (Schaaf and Cidlowski, 2002), whereas the transcription factor hypoxia-inducible factor 1 alpha (Hif1a) can up-regulate the transcription of GR under hypoxia

56

B. Mazurek et al. / Hearing Research 259 (2010) 55–63

(Kodama et al., 2003; Leonard et al., 2005). Long-time up-regulation or repression of gene transcription may lead to pathological changes in cells, tissues and the entire organism. Stress can also stimulate production of the pro-inflammatory cytokines, namely tumor necrosis factor alpha (TNF-alpha), interleukin 1 beta (IL1beta) and interleukin 6 (IL-6) (Chesnokova and Melmed, 2002). The cytokines can be measured in serum; providing additional information about stress parameters (Steptoe et al., 2001). Several studies have examined the influence of stress on the inner ear. Clinical reports demonstrated that stress exacerbated the sudden hearing loss, tinnitus or vertigo (Al Mana et al., 2008; Ban and Jin, 2006). Emotional stress precipitated the attacks of Menière’s syndrome (Fowler and Zeckel, 1952). Stress also intensified the tinnitus perception (Hebert and Lupien, 2007). Clinical data associate tinnitus onset and tinnitus severity with a post-traumatic stress disorder (Fagelson, 2007; Hinton et al., 2006). Scientists used prenatal stress, aging stress, restraint stress and an exposure to noise, heat and hypoxia to study their effect on the auditory system (Gagnon et al., 2007; Horner et al., 2001; Ison et al., 2007; Kadner et al., 2006; Muchnik et al., 1992; Murakoshi et al., 2006; Tahera et al., 2006b, 2007; Wang and Liberman, 2002). For the purpose of this work, we concentrate on only two animal models that are closest to the emotional model of stress: the restraint stress and the prenatal stress. The restraint stress is induced by complete immobilization of an animal for 2–4 h and can be used in an acute (1–2 days, one period of stress per day) or in a chronic (up to 10 days, one period of stress per day) setting. Data obtained using the restraint stress model suggested that the acute stress increases cochlear sensitivity in mice (Wang and Liberman, 2002) and chronic stress causes neuronal atrophy in the inferior colliculus (IC) of rats (Dagnino-Subiabre et al., 2005). The prenatal stress induced by frequent handling, cage changing and mock injections of the pregnant rats resulted in offspring having a low-frequency hearing loss (Kadner et al., 2006). The molecular mechanism of stress-induced changes occurring in the auditory system can be to some extent explained by the HPA axis-induced GR signaling. This signaling may for instance lead to a decrease in GR and nuclear factor kappa B protein amount in the spiral ganglion (SG) of mice (Tahera et al., 2006a). Taken together, these results indicate that stress affects the auditory system by modifying cochlear performance on molecular level and by influencing neuronal morphology in the auditory pathway. In the restraint stress model, animals are deprived of food and water during the stressing period. In addition, using restraint times longer than 6 h provokes very aggressive behavior in experimental animals, induces formation and bleeding of gastrointestinal ulcers, increases blood pressure and provokes many other undesirable effects (Buynitsky and Mostofsky, 2009). Therefore, the restraint model is not feasible for studying stress times longer than 6 h. Here, we wanted to study the effects of a 24-h emotional stress on the auditory system; therefore, we applied a sonic stress model that is well accepted in a psychosomatic research. In this model, stress is induced by 24-h exposure to an acoustic rodent repellent. The repellent generates low-frequency and low-intensity sound, which frightens the rodents and makes them run away. In the experimental settings, the animals cannot flee. The inability to escape from an unpleasant situation is the main stressor in that system. During the stressing period, animals retain full mobility and have unrestricted access to food and water. This model was successfully used to investigate the mechanism of stress-triggered abortion (Arck et al., 1995), the impact of stress on skin homeostasis (Arck et al., 2006), bronchial hyperreactivity (Joachim et al., 2003) and experimental colitis (Qiu et al., 1999). We hypothesized that a 24-h emotional stress would influence functioning of the auditory system. To test this hypothesis, we compared the hearing function in stressed animals with that of

controls by measuring the auditory brainstem responses (ABRs) and distortion product otoacoustic emissions (DPOAEs). We also determined the presence of stress markers (corticosterone and pro-inflammatory cytokines) in serum. Lastly, we monitored the transcriptional expression of HPA-axis-associated genes: GR and Hif1a in the organ of Corti (OC), SG and IC. Additionally, we determined the expression of prestin, a marker of the outer hair cells (OHCs; in the OC only). 2. Materials and methods 2.1. Animals Forty-six female Wistar rats, 4–5 weeks old, weighing 110–190 g on the day of experiment, were purchased from the Research Institute of Experimental Medicine, Charité – Universitätsmedizin Berlin, Germany. All experiments were approved by the State Office of Health and Social Affairs (LaGeSo), Berlin, Germany. The animals were acclimatized for at least one week after delivery in the animal care facility with a 12-h light/dark cycle (lights on = 6:00 h) in polycarbonate type IV cages (Ehret, Schönwalde, Germany; W  H  D = 380  200  590 mm, floor surface = 1815 cm2; five animals per cage). Food and water were available ad libitum throughout the experiments. 2.2. Stress model For each stress experiment, two rats were transferred together into a type IV cage and moved to a separate room. Next, an active rodent repellent device (cylindrical, 381  57.2 mm Conrad Electronics Berlin, Germany) was placed in the cage. The device emitted a low-frequency sound of 300 Hz for 1 s in the intervals of 15 s. The sound pressure level measured at six different positions in a cage without animals but with the bottom covered with shavings ranged between 61 and 65 dB A (sound level meter 2231 with ½” condenser microphone 4155, Bruel & Kjaer). In addition to producing the low-frequency and low-intensity sound, the device induced vibration. The animals were exposed to stressor for 24 h (from 8:00 a.m.). The stress factors consisted of handling the animals, changing the environment (new cage and different room), exposure to a low-frequency and low-intensity unpleasant sound, vibration and the inability to escape. The control, unstressed animals stayed in their home cage. 2.3. Experimental protocol Stressed animals were examined at different times post-stress: immediately (15–30 min), 2 h, 3 h, 6 h, 24 h and 7 days. The experimental design is shown in Fig. 1. The number of animals per group was as follows: 15–30 min, n = 5; 2 h, n = 5; 3 h, n = 9; 6 h, n = 6; 24 h, n = 5; 7 days, n = 6. To address possible diurnal variations of corticosterone in serum, the control animals were examined at the same times as the stressed ones (between 8:15 and 14:00) (n = 10). At the end of a stress period, the acoustic rodent repellent was removed from the cage. The short-term survival animals (15–30 min, 2 h, 3 h and 6 h after stress) stayed in their cages until they were anesthetized. Animals examined 24 h and 7 days poststress were returned to their home cages. Prior to the measurements of hearing function, the animals were anesthetized with ketamine/xylazine (100 mg ketamine/kg and 5 mg xylazine/kg, i.m.) with supplementary half-dose injections every hour if required. The body temperature was maintained at 38 °C. The ABRs were recorded consecutively from the left and right ear of all stressed and control animals. ABR measurement took about 10 min per ear. DPOAE were measured subsequently

B. Mazurek et al. / Hearing Research 259 (2010) 55–63

57

whole system was calibrated at each probe placement by means of adapted software. The thresholds were defined as responses of P5 dB above noise (80 summations within 10 s). Control

Stress

2.6. Stress markers in serum

Home cage

24 h stress from 8.00 a.m.

Home cage

0 3 6

24 h

7 days

Time of examination after stress Fig. 1. Schematic representation of the experimental flow. The control animals were examined at the same times as stressed animals (between 8:15 and 14:00).

in the left and right ears of stressed animals (2 and 3 h after finishing stress) and of controls (n = 4 each). DPOAE measurement including calibration takes 20–30 min per ear. Because of the time constrains, DPOAEs were not measured in all animals. Next, to determine the concentration of corticosterone and cytokines in serum, blood samples were taken from the carotid artery. Lastly, the animals were sacrificed and both cochleas were isolated and perfused with RNAlaterÒ (Ambion, Austin, TX, USA). Left and right ICs were dissected from the brain. The whole OC, SG and IC were prepared in RNAlater within 30 min after decapitation, immediately deposited in a lysis buffer (OC and SG – PicoPureTM RNA Isolation Kit, Molecular Devices, Sunnyvale, CA, USA. cat. # KIT0204; IC – RNAeasy minipreparation kit, Qiagen, Düsseldorf, Germany; cat. # 74104) and stored at 80 °C until RNA isolation (Cho et al., 2002; Gross et al., 2003). 2.4. ABR measurements The ABR thresholds and amplitudes were recorded from the active needle electrodes inserted subcutaneously at the vertex and mastoid using a PC-BERA system with an external acoustic stimulator (ESmed, Berlin, Germany). A ground electrode was placed at the forelimb. Test stimuli were alternating (rarefaction/condensation) clicks and Gaussian-shaped tone pulses having carrier frequencies of 0.5, 1, 2, 4, 8, 16, and 32 kHz and a duration of 2 ms each. The test stimuli were randomly delivered (20 s 1) to the ear through a speaker (Sony MDR-94) connected with an ear speculum that beforehand had been inserted into the external auditory meatus under operating microscope (Haupt and Scheibe, 2002). The thresholds were defined as the lowest value reproducing responses of the most prominent wave, typically wave 3, at 5-dB attenuator steps. The amplitudes of the click-evoked ABRs were recorded at a stimulus intensity of 50 dB SPL. 2.5. DPOAE measurements The DPOAE thresholds and input/output functions were measured by means of a module with an extended frequency (f2) range of up to 16 kHz (ESmed, Berlin, Germany) and an adapted ER-10B+ microphone system (Etymotic Research, IL, USA) as previously described (Haupt et al., 2003). Briefly, the DPOAEs (2f1 f2) were plotted over the frequency f2 ranging from 1.5 to 16 kHz, while the f2/f1 ratio was kept at 1.2. The stimulus intensities were L1 = 30–65 dB SPL and L2 = L1 10 dB. A self-made silicone ear speculum was inserted into the external auditory meatus under operating microscope, and the probe was then sealed into it. The

Collected blood (about 1 ml per animal) was coagulated at room temperature for 30 min. Next, serum was separated by centrifugation at room temperature in the Eppendorf minifuge for 10 min at 7000 rpm. Serum was collected into a separate tube and stored at 80 °C until needed. The serum stress markers analyzed included corticosterone and three pro-inflammatory cytokines: TNF-alpha, IL-1beta and IL-6. ELISA/EIA (Enzyme-linked immunosorbent assay) kits were purchased from Invitrogen: TNF-alpha (cat. # KRC3011), IL-1b (cat. # KRC0011) and IL-6 (cat. # KRC0061). ELISA/EIA kit for the detection of rat corticosterone was from Diagnostic Systems Laboratories, Inc.: corticosterone (DSL-10-81100). Experiments were performed following strictly the instructions of manufacturers. All samples were assayed in duplicates. 2.7. Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) The RNA isolation was performed according rigorously to the protocol provided by manufacturer of the PicoPureTM RNA Isolation Kit (Molecular Devices) and RNAeasy (Qiagen). The concentration of RNA was measured spectrophotometrically using RibogreenÒ RNA Quantitation Reagent (Molecular Probes, Göttingen, Germany). RNA was stored at 80 °C until needed. The total amount of RNA isolated from OC or SG ranged between 50 and 100 ng whereas that isolated from IC was between 500 and 3000 ng. We used 50 ng of total RNA in the end volume of 25 ll for the reverse transcription reaction (Promega GmbH, Mannheim, Germany) with a universal oligo dT primer. Obtained cDNA was used in five consecutive PCR reactions, 5 ll per reaction (equivalent of 10 ng of total RNA per reaction). Transcripts of following genes were analyzed: rS16 (a housekeeping gene), GR, Hif1a in OC, SG and IC, prestin in OC only. The primers were previously optimized and used accordingly (Table 1). PCR consisted of 40 cycles performed under optimized conditions in a LightCyclerÒ2.0 system (Roche, Mannheim, Germany). The ‘‘crossing threshold” (Ct) values were automatically calculated by the cycler software version 4.0. The Ct values were consecutively used to calculate relative differences in gene expression between the stressed and unstressed animals. The changes were calculated using the 2 DDCt method (Livak and Schmittgen, 2001). 2.8. Statistics Means ± standard errors of the means (SEM) were calculated for all parameters measured. Separate samples obtained from the left and right sides of each animal were included in the analysis. ABR and DPOAE results were analyzed by two-way analysis of variance (ANOVA). Changes in corticosterone concentration and in the gene expression in peripheral and central auditory tissues were analyzed by one-way ANOVA. Changes that were statistically significant were analyzed further with contrast analysis to compare individual means. To compensate for diurnal variations, corticosterone level in serum was additionally tested by analysis of covariance (ANCOVA) with the time of day as a covariate. The significance of changes in serum TNF-alpha vs. was tested by parameter-free Mann–Whitney U-test because of the high variation. Differences of p < 0.05 were considered to be significant. All statistical test and graphics were made using the software package Statistica 7.1 (StatSoft).

58

B. Mazurek et al. / Hearing Research 259 (2010) 55–63

Table 1 Primer information. Target name

Accession number

Forward primer sequence

Reverse primer sequence

Annealing temp. (°C)

Amplicon size (bp)

rS16 GR Hif1a prestin

XM_341815 NM_012576 NM_024359 NM_030840

GGGTCCGCTGCAGTCCGTTC CTAATTCCCCACCTCCCATT CTATGACGTGCTTGGTGCTGAT CACAGAGTCCGAGCTACACAGTC

CGTGCGCGGCTCGATCATCT CTACTGACGGCGCCTAGAAC CTGTACTGTCCTGTGGTGACTT TCAGTGCGCTGCTGTACAAG

66 62 66 70

127 140 271 162

Next, we evaluated the latencies of the positive waves P1 to P5 and the peak-to-peak amplitudes P1–N1 to P5–N5 (positive wave and negative through) of the click-evoked ABRs. There were no changes in the latencies (Fig. 3, top). However, there was a statistically significant increase in the amplitudes 6 and 24 h post-stress (two-way ANOVA, p < 0.01 and p < 0.05 vs. controls). Comparison with controls revealed a statistically significant enhancement of waves P2–N2 and P3–N3 6 and 24 h post-stress as well as P5–N5 6 h post-stress (Fig. 3, bottom). The amplitudes of waves P1–N1 and P4–N4 remained unchanged. In addition to the ABRs, we also tested the OHC motility by measuring DPOAEs in the randomly selected, stressed animals (2 and 3 h post-stress) and in the control group (each group n = 4 animals, 8 ears). We found a statistically significant decline of

3. Results 3.1. Auditory response to stress Exposure to 24-h stress induced a transient, statistically significant decline of the ABR thresholds (Fig. 2). The increase in the auditory sensitivity began as soon as 15–30 min post-stress in the high frequencies (two-way ANOVA, p < 0.001 vs. controls) and spread with time over the whole frequency range (2–6 h after stress, p < 0.0001 vs. controls). We observed the most pronounced changes 3 and 6 h post-stress. One day later, the decline in the ABR threshold was still present (p < 0.0001). Post-hoc test revealed statistical significance in the middle frequency range (2–8 kHz). ABR thresholds returned to the control level one week after stress.

50

50

15-30 min

40

40

***

6 hours *** ***

30

30

** 20

*

Controls Stress

10

***

20

*** ***

10

***

0

0 0.5

1

2

4

8

16

0.5

32

1

2

4

8

16

32

ABR threshold, dB SPL

50

2 hours

40 *

30

24 hours

40 ***

30

***

**

**

20

*** ***

10

10 0

0 0.5

1

2

4

8

16

0.5

32

1

2

4

8

16

32

50

50 40

20

***

3 hours

** ***

30

30

***

20

7 days

40

20

*** ***

10

***

10 0

0 0.5

1

2

4

8

16

32

0.5

1

2

4

8

16

32

Frequency, kHz Fig. 2. ABR thresholds measured at different times post-stress and compared to the control values. The number of animals in the stress groups was: 15–30 min, n = 5; 2 h, n = 5; 3 h, n = 9; 6 h, n = 6; 24 h, n = 5; 7 days, n = 6. The number of control animals was n = 10. Measurements from both ears were included in the analysis. Shown are the means ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001 vs. controls).

B. Mazurek et al. / Hearing Research 259 (2010) 55–63

There were no statistically significant differences between the left and right ears; therefore, we evaluated the data together.

5.0 4.5

Controls 6 hours 24 hours 7 days

Latency, ms

4.0 3.5 3.0

3.2. Presence of stress markers in serum

2.5 2.0 1.5 1.0 0.5 0.0 P1

P2

P3

P4

P5

10 9

Amplitude, µV

8 * *

7 6

* **

5

59

*

4

A change in the corticosterone concentration is one of the hallmarks of stress. We measured the quantity of corticosterone in serum with corticosterone EIA/ELISA and demonstrated statistically significant difference between the groups tested (one-way ANOVA, p < 0.001). Planned contrast analysis revealed an increase in the corticosterone concentration in serum of experimental animals 3 and 6 h post-stress, as compared to the controls. The corticosterone concentration had returned to the control level 24 h poststress (Fig. 6). The results were confirmed by ANCOVA used to compensate for possible diurnal variation. Furthermore, we have determined the serum concentration of three major pro-inflammatory cytokines implicated in HPA axis activation, namely TNF-alpha, IL-1beta and IL-6. We found that the TNF-alpha concentration increased significantly 3 h post-stress (Fig. 6). The concentrations of IL-1beta and IL-6 were below detection threshold (data not shown).

3 2

3.3. Changes in gene expression in the OC, SG and IC

1 0 P1-N1

P2-N2

P3-N3

P4-N4

P5-N5

Fig. 3. The latencies and amplitudes of the click-evoked ABR waves were measured at different times post-stress and compared to the control values. The number of animals in stress groups was: 6 h, n = 6; 24 h, n = 5; 7 days, n = 6. The number of control animals was n = 10. Measurements from both ears were included in the analysis. Shown are the means ± SEM (*p < 0.05, **p < 0.01 vs. controls).

DPOAE threshold, dB SPL

55 Controls 2 hours 3 hours

50 45 40

**

35

*

***

*

30 25

We analyzed the expression of the two HPA axis-responsive genes, GR and Hif1a in three different auditory tissues: OC, SG and IC. In addition, we analyzed the expression of prestin, which is an OHC marker, exclusively in the OC. In the OC, expression of GR mRNA has not changed after stress (Fig. 7). Interestingly, there were statistically significant changes in the mRNA expression of prestin and Hif1a (one-way ANOVA, p < 0.05). Prestin mRNA was 3.5-fold up-regulated 6 h post-stress, as compared to the controls, and returned to the control level one day later (Fig. 7). Hif1a mRNA was 0.45-fold down-regulated 7 days after stress. In the SG, the number of GR and Hif1a transcripts were unchanged (Fig. 8). In the IC, there was a statistically significant increase in the number of the GR and Hif1a transcripts (one-way ANOVA, p < 0.01). The up-regulation of GR mRNA was significant 3 h poststress, whereas up-regulation of Hif1a was significant immediately after stress until 24 h later, as compared to the controls (Fig. 9). 4. Discussion

20 1.5

2

3

4

6

8

12

16

Frequency f2, kHz Fig. 4. DPOAE thresholds measured in the stressed animals at 2 h post-stress (n = 4), 3 h post-stress (n = 4) and in the control group (n = 4). Measurements from both ears were included in the analysis. The asterisks indicate significant differences between DPOAEs of the 3-h post-stress group and controls at individual frequencies. Shown are the means ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001 vs. controls).

the DPOAE thresholds 3 h post-stress (Fig. 4). Interestingly, the decline of DPOAE threshold affected only the lower frequency range (1.5–4 kHz). For that reason, we evaluated the DPOAE growth curves separately in the lower (1.5–4 kHz) and higher frequency (6–16 kHz) range (Fig. 5). Three hours post-stress, the amplitudes of the whole stimulus range (L1 = 30–65 dB) were higher in the lower frequency range (p < 0.0001 vs. controls). Interestingly, 2 h post-stress, the DPOAE levels were reduced in the higher frequency range (p < 0.001), and had returned to baseline 3 h post-stress. We have not found differences in the slopes between the stress groups and controls.

In the present study, we show that the exposure of Wistar rats to a 24-h emotional stress results in a transient auditory hypersensitivity represented by decreases of the ABR and DPOAE thresholds as well as increases of the ABR and DPOAE amplitudes. Moreover, stressed animals had increased concentration of corticosterone and TNF-alpha in serum. Molecular analysis demonstrated changes in the expression of HPA axis-sensitive genes encoding GR and Hif1a. These changes were time-dependent and tissue-specific. We also noted a temporary increase in prestin gene expression. 4.1. Stress-induced temporary auditory hypersensitivity The first auditory change that we observed in the animals exposed to 24-h emotional stress was a significant decrease in the sound perception threshold, as measured by ABRs and DPOAEs. In addition, we found an increase in the amplitudes of ABRs and DPOAEs. The DPOAE alteration suggests an up-regulation of the OHC motility. The amplitudes of ABR waves P1 and P4 were unaffected by stress, while amplitudes of waves P2, P3 and P5 increased significantly. These differences, which need to be further investi-

60

B. Mazurek et al. / Hearing Research 259 (2010) 55–63

1.5-4 kHz

6-16 kHz

45

45

DPOAE amplitude, dB SPL

40

40

Controls 2 hours 3 hours

35

35

30

30 *

25

25

20

20 *

15 **

10

**

15 10

5

5

0

0

-5

-5 30

35

40

45

50

55

60

65

30

35

40

45

50

55

60

65

Stimulus level L1, dB SPL Fig. 5. DPOAE amplitudes (input/output functions) of the lower (1.5–4 kHz, left) and higher (6–16 kHz, right) frequency range measured in animals 2 h post-stress (n = 4), 3 h post-stress (n = 4) and in the control group (n = 4). Measurements from both ears are included in the analysis. Shown are the means ± SEM (*p < 0.05, **p < 0.01 vs. controls).

Serum 180

1600 Corticosterone (l) TNF-alpha (r)

160 140

**

1200

120

1000

* 100

800 80 600

60

* 400

40

200

20

0

TNF-alpha, pg/ml

Corticosterone, ng/ml

1400

0 Control imm.

2h

3h

6h

24h 7days

Fig. 6. Concentrations of corticosterone and TNF-alpha measured by ELISA/EIA in serum. The serum was collected from the control animals (n = 10) and animals immediately post-stress (imm., n = 5), 2 h post-stress (n = 5), 3 h post-stress (n = 9), 6 h post-stress (n = 6), 24 h post-stress (n = 5), and 7 days post-stress (n = 6). Serum was assayed in duplicates for the presence of corticosterone and TNF-alpha. Shown are the means ± SEM (*p < 0.05, **p < 0.01 vs. controls).

gated, suggest altered activity at the neural generators or modulators of the respective ABR waves that mainly correspond to the cochlear nucleus and the IC (Biacabe et al., 2001; Popelar et al., 2008). The alteration of activity in the auditory pathway may be introduced by a loss of inhibition, which could be a consequence of down-regulation of gamma-aminobutyric acid (GABA) system. Stress is known to reduce the systemic concentration of GABA (Harvey et al., 2004; Vaiva et al., 2006) and to reduce the expression of GABA receptors in the central nervous system (Geuze et al., 2008). Thus, it is likely that systemic inhibition of GABAergic system could lead to loss of inhibition and lead to hyperactivity in the auditory system (Sun et al., 2009). The changes in auditory response that stretched over a broad frequency range and lasted up to one day post-stress can be interpreted as a transient, stress-induced hypersensitivity to sounds, in other words – temporary hyperacusis. The normal hearing was restored 7 days post-stress. Our results are in agreement with a

tendency described earlier by Wang and Liberman (2002). They have observed a slight enhancement in cochlear response measured by compound action potentials and DPOAEs in mice 2 h after finishing the restraint stress. The mentioned tendency was not statistically significant, which could be due to different species used, specific properties of mice strain used, type of stressor (restraint) or duration of stress (two periods of 12-h restraint stress spaced by one period of rest). We observed two different responses of the auditory system to the systemic stress. The ABR threshold decreased first in the upper frequency range and then in all frequencies tested, whereas the DPOAE thresholds decreased only in the lower frequencies. Although the overall ABR alteration could be accounted for by a modulation of the excitatory and inhibitory synaptic currents (Hurley et al., 2002; Imig and Durham, 2005; Salvi et al., 2000), we cannot at present explain why the stress-induced ABR changes have first affected the high frequencies (8–32 kHz), whereas DPOAE responses were increased in the lower frequencies (1.5– 6 kHz). The latter suggests an increased motility of OHCs in the apical part of the OC. Recent studies have demonstrated an important correlation between the lateral plasma membrane lipid composition of the OHCs, prestin function and OHC motility (Organ and Raphael, 2009; Sfondouris et al., 2008). Stress is a well known factor altering lipoprotein metabolism. Although we have not measured the lipoprotein composition, others had demonstrated that Wistar rats subjected to the restrained stress (acute and chronic) had a decreased triacylglycerol concentration in plasma (RicartJane et al., 2002). Moreover, glucocorticoids were shown to alter lipid and protein composition in the T cell membrane (Van Laethem et al., 2003). Consequently, stress may likely affect the lipid composition in the OHCs and in this way modify their motility. The question why stress influences the DPOAEs only in the low frequencies remains open. 4.2. Activation of the HPA axis Changes in the concentration of corticosterone in serum have been widely accepted as a marker for the activation of the HPA axis. In the auditory disorders, patients with Menière’s disease have elevated cortisol concentration in blood (Van Cruijsen et al.,

61

B. Mazurek et al. / Hearing Research 259 (2010) 55–63

Spiral ganglion

Organ of Corti 1.4

1.3 1.2

GR

1.3

1.1

1.2

1.0

1.1

0.9

1.0

0.8

0.9

Control

imm.

3h

6h

24h

7days

Ratio, 2-

CP

0.8 0.7

3.0

Ratio: 2-

Ct

0.7

2.5

GR

Hif1a

2.0 1.5 1.0

Control

imm.

3h

6h

24h

7days

imm.

3h

6h

24h

7days

2.4

Hif1a 2.0 1.6

*

0.5

1.2

0.0 Control

imm.

3h

6h

24h

7days

5.0 4.0

0.8 0.4

Prestin

**

Control

3.0 2.0 1.0 0.0 Control imm.

2h

3h

6h

24h

7days

Fig. 7. Expression of the HPA-axis-associated genes and of prestin in the organ of Corti (OC). Total RNA was isolated from the OC of control rats (n = 10) and from animals immediately post-stress (imm., n = 5), 2 h post-stress (n = 5), 3 h poststress (n = 9), 6 h post-stress (n = 6), 24 h post-stress (n = 5), and 7 days post-stress (n = 6). RNA samples from the left and right OCs were processed separately. Next, RNA was reverse transcribed and amplified using real-time PCR. The crossing threshold (Ct) values were used to calculate relative changes in transcript numbers vs. housekeeping gene rS16 using the 2 DDCt method. Shown are the means ± SEM (*p < 0.05, **p < 0.01 vs. controls).

2005), whereas in tinnitus patients, salivary cortisol was found to be aberrantly produced under stressful conditions (Hebert and Lupien, 2007). Here, we found elevated concentration of corticosterone in serum at 3 and 6 h post-stress. This is consistent with the activation of the HPA axis and represents a general adaptation to the external threats (Bauer et al., 2001; Cao et al., 2002). Another feature of the HPA axis activation is induction of the production and release of pro-inflammatory cytokines (Bierhaus et al., 2006). The concentration of TNF-alpha in serum of stressed animals rose 3 h post-stress. Although the source of serum TNF-alpha was not studied here, our data corroborate that of Avitsur et al. (2005), where splenocytes isolated from mice, that were subjected to stress, produced high level of TNF-alpha. In our experiments, the TNF-alpha concentration in serum of stressed animals returned to a normal level 6 h post-stress. At the same time, the corticosterone reached its highest concentration. Corticosterone suppresses the production of TNF-alpha (Hayashi et al., 2004) and it is very likely that in the stressed animals, systemic increase in corticosteroid concentration negatively influenced the production and release of TNF-alpha. 4.3. Stress-induced modulation of gene expression in OC, SG and IC The GR mRNA and protein is a downstream target of the HPA axis and is negatively regulated by corticosterone. Here, we have

Fig. 8. Expression of the HPA-axis-associated genes in the spiral ganglion (SG). Total RNA was isolated from the SG of control rats (n = 10) and from animals immediately post-stress (imm., n = 5); 3 h post-stress (n = 9); 6 h post-stress (n = 6); 24 h post-stress (n = 5) and 7 days post-stress (n = 6). RNA samples from the left and right SG were processed separately. Next, RNA was reverse transcribed and amplified using real-time PCR. The crossing threshold (Ct) values were used to calculate relative changes in transcript numbers vs. housekeeping gene rS16 using the 2 DDCt method. Shown are the means ± SEM (*p < 0.05, **p < 0.01 vs. controls).

determined that the relative numbers of GR transcripts were unchanged in the auditory periphery (OC and SG) and up-regulated 3 h after stress in the central auditory tissue (IC). This is in agreement with the results obtained by Curtis and Rarey (1995), who also have not observed changes in GR protein concentration in the spiral ligament after the 24 h of restraint stress. The observed by us slight (about 10%) but significant up-regulation of GR mRNA numbers in the IC could be a result of stress-triggered local hypoxia (consistent with Hif1a results discussed below) that affected the IC but not the cochlea (Leonard et al., 2005). Stress induces vasoconstriction via epinephrine/norepinephrine pathway. The immediate effects of the vasoconstriction are hypoxia and ischemia (Sheps et al., 2002). Hif1a, a hypoxia-activated transcription factor, is constitutively expressed on a transcriptional and translational level in the cochleas of rats and mice (Gagnon et al., 2007; Gross et al., 2003). The regulatory network of Hif1a transcriptional expression is very complex and depends not only on external conditions but also on a cell type (Bardos and Ashcroft, 2005). In agreement with that, our results suggest that stress influences Hif1a expression in a tissue-specific manner. The statistically significant down-regulation of Hif1a in the auditory periphery (OC) one week after stress exposure could reflect up-regulation of one of the Hif1a transcriptional inhibitors. In the peripheral neurons (SG), the mRNA expression of Hif1a remained unchanged. In the central auditory system (IC), the expression of Hif1a was up-regulated immediately post-stress and lasted 24 h, implying local hypoxia. Another explanation for the up-regulation of Hif1a transcription is an activation of non-canonical pathway, e.g. via TNF-alpha or nitric oxide signaling (Bardos and Ashcroft, 2005; Haddad and Harb, 2005).

62

B. Mazurek et al. / Hearing Research 259 (2010) 55–63

tissues are more sensitive to HPA axis activation combined with local hypoxia than peripheral auditory tissues. Temporary increase in prestin gene expression implies direct or indirect reaction of the OHCs to stress. Future research will determine which of the transcriptional or post-transcriptional mechanisms are involved in the emotional stress-induced auditory hypersensitivity.

Inferior colliculus 1.2

GR

*

1.1

Acknowledgements

1.0

Ct

0.9

Ratio, 2-

0.8 Control

imm.

3h

6h

24h

7days

1.5 1.4

References

Hif1a **

1.3

**

** *

1.2 1.1 1.0 0.9 Control

This work was supported by grants from the Charité – Universitätsmedizin Berlin (Gr. 2008-750 and 2008-751) and the Sonnenfeld Foundation, Berlin, Germany. We thank Ms. Julia Fuchs, Ms. Olga Hegend and Ms. Astrid Machulik for their excellent technical assistance.

imm.

3h

6h

24h

7days

Fig. 9. Expression of the HPA-axis-associated genes in the inferior colliculus (IC). Total RNA was isolated from the IC of control rats (n = 10) and from animals immediately post-stress (imm., n = 5), 3 h post-stress (n = 9), 6 h post-stress (n = 6), 24 h post-stress (n = 5), and 7 days post-stress (n = 6). RNA samples from the left and right ICs were processed separately. Next, RNA was reverse transcribed and amplified using real-time PCR. The crossing threshold (Ct) values were used to calculate relative changes in transcript numbers vs. housekeeping gene rS16 using the 2 DDCt method. Shown are the means ± SEM (*p < 0.05, **p < 0.01 vs. controls).

Prestin (SLC26A5) is a transmembrane, 12-spanner motor protein, expressed by OHCs (Zheng et al., 2000). The unique properties of prestin allow somatic electromotility of the OHCs; thus, cochlear amplification (Adler et al., 2003; Dallos and Fakler, 2002). Here, we demonstrated significant, 3-fold increase in the number of prestin transcripts 6 h post-stress. There were no changes in the prestin expression that would correlate in time with the enhanced DPOAE sensitivity (3 h post-stress). Our earlier work demonstrated that the number of prestin transcripts is higher in the apical than in the basal part of the OC (Mazurek et al., 2007). Here, we studied the whole OC and could not assess if the increase of the prestin expression involved a specific area or the entire organ of Corti. We also do not know if the increased transcription of prestin was followed by an increased translation and translocation of mature protein to the cell membrane. In addition, we are unaware of studies that address the link between the number of prestin molecules and the OHC motility. All of the above issues are open and need to be answered in the near future. In conclusion, we report here that stress influences rat’s auditory system by inducing temporary hypersensitivity. This could have evolutionary consequence by giving stressed animals an advantage of hearing better than the non-stressed ones. We demonstrated temporary decreases in the ABR and DPOAE thresholds and temporary increases in ABR and DPOAE amplitudes. Further experiments should analyze the mechanism behind the transient auditory hypersensitivity. Dissimilar expression pattern of GR and Hif1a in different auditory structures suggests that the response to stress may be tissue-specific. Up-regulation of GR and Hif1a gene expression in central (IC), but not in peripheral auditory tissues (OC, SG) indicates greater responsiveness of IC to stress in our model. Consequently, this implies that the central auditory

Ader, R., Cohen, N., Felten, D., 1995. Psychoneuroimmunology: interactions between the nervous system and the immune system. Lancet 345 (8942), 99–103. Adler, H.J., Belyantseva, I.A., Merritt Jr., R.C., Frolenkov, G.I., Dougherty, G.W., Kachar, B., 2003. Expression of prestin, a membrane motor protein, in the mammalian auditory and vestibular periphery. Hear. Res. 184 (1–2), 27–40. Al Mana, D., Ceranic, B., Djahanbakhch, O., Luxon, L.M., 2008. Hormones and the auditory system: a review of physiology and pathophysiology. Neuroscience 153 (4), 881–900. Arck, P.C., Merali, F.S., Manuel, J., Chaouat, G., Clark, D.A., 1995. Stress-triggered abortion: inhibition of protective suppression and promotion of tumor necrosis factor-alpha (TNF-alpha) release as a mechanism triggering resorptions in mice. Am. J. Reprod. Immunol. 33 (1), 74–80. Arck, P.C., Slominski, A., Theoharides, T.C., Peters, E.M., Paus, R., 2006. Neuroimmunology of stress: skin takes center stage. J. Invest. Dermatol. 126 (8), 1697–1704. Avitsur, R., Kavelaars, A., Heijnen, C., Sheridan, J.F., 2005. Social stress and the regulation of tumor necrosis factor-alpha secretion. Brain Behav. Immun. 19 (4), 311–317. Ban, J.H., Jin, S.M., 2006. A clinical analysis of psychogenic sudden deafness. Otolaryngol. Head Neck Surg. 134 (6), 970–974. Bardos, J.I., Ashcroft, M., 2005. Negative and positive regulation of HIF-1: a complex network. Biochim. Biophys. Acta 1755 (2), 107–120. Bauer, M.E., Perks, P., Lightman, S.L., Shanks, N., 2001. Are adhesion molecules involved in stress-induced changes in lymphocyte distribution? Life Sci. 69 (10), 1167–1179. Biacabe, B., Chevallier, J.M., Avan, P., Bonfils, P., 2001. Functional anatomy of auditory brainstem nuclei: application to the anatomical basis of brainstem auditory evoked potentials. Auris Nasus Larynx 28 (1), 85–94. Bierhaus, A., Humpert, P.M., Nawroth, P.P., 2006. Linking stress to inflammation. Anesthesiol. Clin. 24 (2), 325–340. Buynitsky, T., Mostofsky, D.I., 2009. Restraint stress in biobehavioral research: recent developments. Neurosci. Biobehav. Rev. 33, 1089–1098. Cacioppo, J.T., Berntson, G.G., Malarkey, W.B., Kiecolt-Glaser, J.K., Sheridan, J.F., Poehlmann, K.M., Burleson, M.H., Ernst, J.M., Hawkley, L.C., Glaser, R., 1998. Autonomic, neuroendocrine, and immune responses to psychological stress: the reactivity hypothesis. Ann. N.Y. Acad. Sci. 840, 664–673. Cao, L., Filipov, N.M., Lawrence, D.A., 2002. Sympathetic nervous system plays a major role in acute cold/restraint stress inhibition of host resistance to Listeria monocytogenes. J. Neuroimmunol. 125 (1–2), 94–102. Chesnokova, V., Melmed, S., 2002. Minireview: neuro-immuno-endocrine modulation of the hypothalamic–pituitary–adrenal (HPA) axis by gp130 signaling molecules. Endocrinology 143 (5), 1571–1574. Cho, Y., Gong, T.W., Stover, T., Lomax, M.I., Altschuler, R.A., 2002. Gene expression profiles of the rat cochlea, cochlear nucleus, and inferior colliculus. J. Assoc. Res. Otolaryngol. 3 (1), 54–67. Chrousos, G.P., 1998. Stressors, stress, and neuroendocrine integration of the adaptive response. The 1997 Hans Selye Memorial Lecture. Ann. N. Y. Acad. Sci. 851, 311–335. Curtis, L.M., Rarey, K.E., 1995. Effect of stress on cochlear glucocorticoid protein. II. Restraint. Hear. Res. 92 (1–2), 120–125. Dagnino-Subiabre, A., Terreros, G., Carmona-Fontaine, C., Zepeda, R., Orellana, J.A., Diaz-Veliz, G., Mora, S., Aboitiz, F., 2005. Chronic stress impairs acoustic conditioning more than visual conditioning in rats: morphological and behavioural evidence. Neuroscience 135 (4), 1067–1074. Dallos, P., Fakler, B., 2002. Prestin, a new type of motor protein. Nat. Rev. Mol. Cell Biol. 3 (2), 104–111. Datson, N.A., Morsink, M.C., Meijer, O.C., de Kloet, E.R., 2008. Central corticosteroid actions: search for gene targets. Eur. J. Pharmacol. 583 (2–3), 272–289. Fagelson, M.A., 2007. The association between tinnitus and posttraumatic stress disorder. Am. J. Audiol. 16 (2), 107–117. Fowler, E.P., Zeckel, A., 1952. Psychosomatic aspects of Meniere’s disease. J. Am. Med. Assoc. 148 (15), 1265–1268. Gagnon, P.M., Simmons, D.D., Bao, J., Lei, D., Ortmann, A.J., Ohlemiller, K.K., 2007. Temporal and genetic influences on protection against noise-induced hearing loss by hypoxic preconditioning in mice. Hear. Res. 226 (1–2), 79–91.

B. Mazurek et al. / Hearing Research 259 (2010) 55–63 Geuze, E., van Berckel, B.N., Lammertsma, A.A., Boellaard, R., de Kloet, C.S., Vermetten, E., Westenberg, H.G., 2008. Reduced GABAA benzodiazepine receptor binding in veterans with post-traumatic stress disorder. Mol. Psychiatry 13 (1), 74–83. Gross, J., Rheinlander, C., Fuchs, J., Mazurek, B., Machulik, A., Andreeva, N., Kietzmann, T., 2003. Expression of hypoxia-inducible factor-1 in the cochlea of newborn rats. Hear. Res. 183 (1–2), 73–83. Haddad, J.J., Harb, H.L., 2005. Cytokines and the regulation of hypoxia-inducible factor (HIF)-1alpha. Int. Immunopharmacol. 5 (3), 461–483. Harvey, B.H., Oosthuizen, F., Brand, L., Wegener, G., Stein, D.J., 2004. Stress–restress evokes sustained iNOS activity and altered GABA levels and NMDA receptors in rat hippocampus. Psychopharmacology (Berl.) 175 (4), 494–502. Haupt, H., Scheibe, F., 2002. Preventive magnesium supplement protects the inner ear against noise-induced impairment of blood flow and oxygenation in the guinea pig. Magnes. Res. 15 (1–2), 17–25. Haupt, H., Scheibe, F., Mazurek, B., 2003. Therapeutic efficacy of magnesium in acoustic trauma in the guinea pig. ORL J. Otorhinolaryngol. Relat. Spec. 65 (3), 134–139. Hayashi, R., Wada, H., Ito, K., Adcock, I.M., 2004. Effects of glucocorticoids on gene transcription. Eur. J. Pharmacol. 500 (1–3), 51–62. Hebert, S., Lupien, S.J., 2007. The sound of stress: blunted cortisol reactivity to psychosocial stress in tinnitus sufferers. Neurosci. Lett. 411 (2), 138–142. Heitzer, M.D., Wolf, I.M., Sanchez, E.R., Witchel, S.F., DeFranco, D.B., 2007. Glucocorticoid receptor physiology. Rev. Endocr. Metab. Disord. 8 (4), 321–330. Hinton, D.E., Chhean, D., Pich, V., Hofmann, S.G., Barlow, D.H., 2006. Tinnitus among Cambodian refugees: relationship to PTSD severity. J. Trauma. Stress 19 (4), 541–546. Horner, K.C., Giraudet, F., Lucciano, M., Cazals, Y., 2001. Sympathectomy improves the ear’s resistance to acoustic trauma – could stress render the ear more sensitive? Eur. J. Neurosci. 13 (2), 405–408. Hurley, L.M., Thompson, A.M., Pollak, G.D., 2002. Serotonin in the inferior colliculus. Hear. Res. 168 (1–2), 1–11. Imig, T.J., Durham, D., 2005. Effect of unilateral noise exposure on the tonotopic distribution of spontaneous activity in the cochlear nucleus and inferior colliculus in the cortically intact and decorticate rat. J. Comp. Neurol. 490 (4), 391–413. Ison, J.R., Allen, P.D., O’Neill, W.E., 2007. Age-related hearing loss in C57BL/6J mice has both frequency-specific and non-frequency-specific components that produce a hyperacusis-like exaggeration of the acoustic startle reflex. J. Assoc. Res. Otolaryngol. 8 (4), 539–550. Joachim, R.A., Quarcoo, D., Arck, P.C., Herz, U., Renz, H., Klapp, B.F., 2003. Stress enhances airway reactivity and airway inflammation in an animal model of allergic bronchial asthma. Psychosom. Med. 65 (5), 811–815. Kadner, A., Pressimone, V.J., Lally, B.E., Salm, A.K., Berrebi, A.S., 2006. Low-frequency hearing loss in prenatally stressed rats. Neuroreport 17 (6), 635–638. Kodama, T., Shimizu, N., Yoshikawa, N., Makino, Y., Ouchida, R., Okamoto, K., Hisada, T., Nakamura, H., Morimoto, C., Tanaka, H., 2003. Role of the glucocorticoid receptor for regulation of hypoxia-dependent gene expression. J. Biol. Chem. 278 (35), 33384–33391. Kyrou, I., Tsigos, C., 2007. Stress mechanisms and metabolic complications. Horm. Metab. Res. 39 (6), 430–438. Leonard, M.O., Godson, C., Brady, H.R., Taylor, C.T., 2005. Potentiation of glucocorticoid activity in hypoxia through induction of the glucocorticoid receptor. J. Immunol. 174 (4), 2250–2257. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 (4), 402–408. Mazurek, B., Haupt, H., Amarjargal, N., Yarin, Y.M., Machulik, A., Gross, J., 2007. Upregulation of prestin mRNA expression in the organs of Corti of guinea pigs and rats following unilateral impulse noise exposure. Hear. Res. 231 (1–2), 73–83.

63

Muchnik, C., Sahartov, E., Peleg, E., Hildesheimer, M., 1992. Temporary threshold shift due to noise exposure in guinea pigs under emotional stress. Hear. Res. 58 (1), 101–106. Murakoshi, M., Yoshida, N., Kitsunai, Y., Iida, K., Kumano, S., Suzuki, T., Kobayashi, T., Wada, H., 2006. Effects of heat stress on Young’s modulus of outer hair cells in mice. Brain Res. 1107 (1), 121–130. Organ, L.E., Raphael, R.M., 2009. Lipid lateral mobility in cochlear outer hair cells: regional differences and regulation by cholesterol. J. Assoc. Res. Otolaryngol. 10, 383–396. Popelar, J., Grecova, J., Rybalko, N., Syka, J., 2008. Comparison of noise-induced changes of auditory brainstem and middle latency response amplitudes in rats. Hear. Res. 245 (1–2), 82–91. Qiu, B.S., Vallance, B.A., Blennerhassett, P.A., Collins, S.M., 1999. The role of CD4+ lymphocytes in the susceptibility of mice to stress-induced reactivation of experimental colitis. Nat. Med. 5 (10), 1178–1182. Ricart-Jane, D., Rodriguez-Sureda, V., Benavides, A., Peinado-Onsurbe, J., LopezTejero, M.D., Llobera, M., 2002. Immobilization stress alters intermediate metabolism and circulating lipoproteins in the rat. Metabolism 51 (7), 925–931. Salvi, R.J., Wang, J., Ding, D., 2000. Auditory plasticity and hyperactivity following cochlear damage. Hear. Res. 147 (1–2), 261–274. Schaaf, M.J., Cidlowski, J.A., 2002. Molecular mechanisms of glucocorticoid action and resistance. J. Steroid Biochem. Mol. Biol. 83 (1–5), 37–48. Sfondouris, J., Rajagopalan, L., Pereira, F.A., Brownell, W.E., 2008. Membrane composition modulates prestin-associated charge movement. J. Biol. Chem. 283 (33), 22473–22481. Sheps, D.S., McMahon, R.P., Becker, L., Carney, R.M., Freedland, K.E., Cohen, J.D., Sheffield, D., Goldberg, A.D., Ketterer, M.W., Pepine, C.J., Raczynski, J.M., Light, K., Krantz, D.S., Stone, P.H., Knatterud, G.L., Kaufmann, P.G., 2002. Mental stressinduced ischemia and all-cause mortality in patients with coronary artery disease: results from the Psychophysiological Investigations of Myocardial Ischemia study. Circulation 105 (15), 1780–1784. Steptoe, A., Willemsen, G., Owen, N., Flower, L., Mohamed-Ali, V., 2001. Acute mental stress elicits delayed increases in circulating inflammatory cytokine levels. Clin. Sci. (Lond.) 101 (2), 185–192. Sun, W., Lu, J., Stolzberg, D., Gray, L., Deng, A., Lobarinas, E., Salvi, R.J., 2009. Salicylate increases the gain of the central auditory system. Neuroscience 159 (1), 325–334. Tahera, Y., Meltser, I., Johansson, P., Canlon, B., 2006a. Restraint stress modulates glucocorticoid receptors and nuclear factor kappa B in the cochlea. Neuroreport 17 (9), 879–882. Tahera, Y., Meltser, I., Johansson, P., Hansson, A.C., Canlon, B., 2006b. Glucocorticoid receptor and nuclear factor-kappa B interactions in restraint stress-mediated protection against acoustic trauma. Endocrinology 147 (9), 4430–4437. Tahera, Y., Meltser, I., Johansson, P., Salman, H., Canlon, B., 2007. Sound conditioning protects hearing by activating the hypothalamic–pituitary–adrenal axis. Neurobiol. Dis. 25 (1), 189–197. Vaiva, G., Boss, V., Ducrocq, F., Fontaine, M., Devos, P., Brunet, A., Laffargue, P., Goudemand, M., Thomas, P., 2006. Relationship between posttrauma GABA plasma levels and PTSD at 1-year follow-up. Am. J. Psychiatry 163 (8), 1446–1448. Van Cruijsen, N., Dullaart, R.P., Wit, H.P., Albers, F.W., 2005. Analysis of cortisol and other stress-related hormones in patients with Meniere’s disease. Otol. Neurotol. 26 (6), 1214–1219. Van Laethem, F., Liang, X., Andris, F., Urbain, J., Vandenbranden, M., Ruysschaert, J.M., Resh, M.D., Stulnig, T.M., Leo, O., 2003. Glucocorticoids alter the lipid and protein composition of membrane rafts of a murine T cell hybridoma. J. Immunol. 170 (6), 2932–2939. Wang, Y., Liberman, M.C., 2002. Restraint stress and protection from acoustic injury in mice. Hear. Res. 165 (1–2), 96–102. Zheng, J., Shen, W., He, D.Z., Long, K.B., Madison, L.D., Dallos, P., 2000. Prestin is the motor protein of cochlear outer hair cells. Nature 405 (6783), 149–155.