- Email: [email protected]
Structural analysis and serological test of arginine periplasmic binding protein 2 from Chlamydophila pneumoniae
Biochemical and Biophysical Research Communications 418 (2012) 518–524
Contents lists available at SciVerse ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Structural analysis and serological test of arginine periplasmic binding protein 2 from Chlamydophila pneumoniae Sung-Ha Park a,b,1, Ji-Eun Chang a,1, Hye-Jin Kim Hawkes c, Yeon-Ho Kang b,⇑,1, Kwang Yeon Hwang a,⇑,2 a
Graduate School of Biotechnology, Korea University, Seoul, Republic of Korea Division of Bacterial Respiratory, National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul, Republic of Korea c School of Biomolecular and Physical Sciences and Eskitis Institute for Cell and Molecular Therapies, Griffith University, Australia b
a r t i c l e
i n f o
Article history: Received 30 December 2011 Available online 20 January 2012 Keywords: Arginine periplasmic binding protein 2 Chlamydophila pneumoniae Structural analysis Immunogenic antigen Serological test Diagnosis
a b s t r a c t The ‘art’ genes encode specific arginine uptake proteins, and are repressed by the repressible promoters of ArgR, affecting transcription of artJ [1,2]. Cpb0502, the arginine-binding periplasmic protein 2 precursor from Chlamydophila pneumoniae TW-183 strains, is responsible for arginine transport. As C. pneumoniae is difficult to isolate and culture, there have been many studies of better ways to detect it. A microimmunofluorescence assay (MIF) is still considered to be the ‘gold standard’ for detecting C. pneumoniae. Although MIF has its own limitations, a number of immunogenic antigens have been shown to be C. pneumoniae specific by this test. Here, we report Cpb0502 as a specific immunogenic antigen against C. pneumoniae as it was detected only in human infection sera of C. pneumoniae but not in Legionella pneumophila and Mycoplasma pneumoniae infection sera, showing high specificity and sensitivity by MIF, western blot and ELISA analysis. And also the crystal structure of Cpb0502 was determined to be a dimer at 2.07 Å, revealing a similar backbone structure to a histidine kinase receptor, HK29S. Therefore we may suggest that Cpb0502 is a candidate immunogenic antigen for better diagnosis of C. pneumoniae. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Chlamydophila pneumoniae is one of the most common community-acquired pneumonias (CAP) and was first isolated in 1965 from a Taiwanese child who was one of the volunteers in a trachoma vaccine trial [3]. C. pneumoniae causes several acute respiratory diseases, such as pneumonia, asthma, bronchitis, sinusitis and pharyngitis [4]. C. pneumoniae is an obligate intracellular pathogen, existing as an elementary body (EB) between hosts. When the EB is ingested by a lung cell, it differentiates into a reticulate body which replicates and is released back into the host as further EBs [5]. To better detect C. pneumoniae, laboratories use a number of diagnostic methods including nucleic acid amplification tests (NAATs) [6], touchdown enzyme time release (TETR) PCR techniques [7], ‘‘light upon extension’’ (LUX) and TaqMan [8]. The microimmunifluorescence assay (MIF) is still recognized as the ‘gold standard’ for detecting C. pneumoniae, but diagnosis remains a problem due to difficulties in isolation and culture of C. pneumoniae [9].
Cpb0502 may be a potential diagnostic antigen as it is a periplasmic protein [10]. ATP-binding cassette (ABC) transporters are transmembrane and translocate substrates ranging from small ions to proteins across the cell membrane utilizing the free energy of ATP hydrolysis in bacteria. Many chlamydial strains degrade arginine and must import it from their host, requiring an arginine periplasmic binding protein as an additional extracellular substrate receptor [11]. T-cells must be present in immunity against C. pneumoniae [12] and new candidate vaccine proteins were identified against C. pneumoniae [13]. Therefore through this research we have investigated and identified features of Cpb0502 as a candidate immunogenic antigen for testing C. pneumoniae infection sera via MIF and ELISA. Also we have determined the crystal structure of Cpb0502 to further investigate functions of Cpb0502 at the structural level.
2. Materials and methods 2.1. Cell culture and inoculation
⇑ Corresponding authors. Fax: +82 2 923 3229 (K.Y. Hwang), +82 2 380 1487 (Y.-H. Kang). E-mail addresses: kyhfi[email protected] (Y.-H. Kang), [email protected] (K.Y. Hwang). 1 These authors contributed equally to this article. 2 These corresponding authors contributed equally to this article. 0006-291X/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2012.01.058
Hep-2 cells were incubated at 37 °C for 24 h and inoculated with C. pneumoniae TW-183EBs, centrifuged at 3500g for 30 min at 10 °C and post-infected at 37 °C for 72 h. Cells were fixed in absolute methanol and stained with a FITC-labeled chlamydialspecific antibody (Pathfinder; Bio-Rad Laboratories) for 30 min to
519
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524 Table 1 IgG/IgM antibody titers of C. pneumoniae infection sera using MIF C. pneumoniae Normal range MIF (IgG)
<1:64
MIF (IgM)
<1:16
Kit (IgG)
–
Patient group 1:128 (n = 3) 1:256 (n = 3 1:256 (n = 5) 1:16 (n = 2) 1:32 (n = 2) 1:64 (n = 2) –
L. pneumoniae Normal range <1:64
<1:16
–
Patient group 1:256 (n = 5) – 1:256 (n = 5) – 1:32 (n = 10) – –
C. pneumoniae Normal range
Patient group
–
–
–
–
<40 AU/ml
P40 AU/ml (n = 10)
Table 2 Data-collection and refinement statistics.
X-ray Source Wavelength (Å) Resolution range (Å) Total reflections Redundancy Completeness (%) R-value/Rfreea (%) No. of protein atoms No. of water molecules RMSD from ideal geometry Bond lengths (Å) Bond angles (°)
Cpb0502 PF-BL-4A 1.00000 50–2.0 (2.0–2.07) 42387 (1867) 2.2 (1.7) 93.3 (78.8) 8.3 (2.6) 18.4/25.1 1817 496 0.022 1.741
Values in parentheses refer to the highest resolution shell (2.0–2.07 Å for Cpb0502). a Rfree is calculated from the randomly selected 5% set of reflections not included in the calculation of the R-value.
Fig. 1. (A) Western blot analysis to determine the specificity of Cpb0502 against C. pneumoniae: eleven C. pneumoniae infection sera (C, n = 3, titer 128; n = 3, titer 256; and n = 5, titer > 256); ten L. pneumophila infection sera (L, titer P 256); ten M. pneumoniae infection sera (M, titer P 40 AU/mL); and ten healthy sera (H, titer 6 64) were analysed. (B) Identification of seroreactivity of C. pneumoniae infection sera in comparison to L. pneumophila and M. pneumoniae infection sera. The seroreactivity of Cpb0502 was determined by ELISA. Results are representative of at least three separate experiments (p < 0.05).
520
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524
Fig. 2. (A) Backbone diagram of Cpb0502 in asymmetric unit. (B) the interaction between molecule A and B. The C-terminal region of molecule A interacts with the loop between a4 and b9 of molecule B. The dot lines had shown to be hydrogen bonding. (C) The monomer structure of Cpb0542 was displayed by ribbon diagram. Cpb0502 is comprised of two domains: I and II. They are connected by the two loops in the hinge regions. The substrate, arginine, is binding in deep active pocket.
determine the level of infection by epifluorescence microscopy [14]. 2.2. Serological test The study protocol was approved by the Medical Ethics and Human Clinical Trial Committee at the National Institute of Health, Korea. L. pneumophila serogroup 1–specific anti human IgG and C. pneumoniae c-chain specific anti-human IgG (Sigma) in serum were used for the MIF test. PLATELIATM M. pneumoniae IgG TMB kit (Bio-Rad) was used for semi-quantitative detection of anti-M. pneumoniae IgG in human serum by ELISA. The optical density was read at 450/620 nm and was converted into AU/ml (Arbitary Units) using a standard curve. 2.3. Elementary body preparation The inoculated cells were carefully removed and lysed by sonication on ice. EBs were separated by centrifuging at 40,000g for 1 h, and Hank’s balanced salt solution with Ca2+and Mg2+ (WelGENE) was added to the pellet. EBs were separated using 20–50% (v/v) Renocal-76 density gradients (Bracco Diagnostics) in sterile highspeed centrifuge tubes at 60000g for 1 h at 4 °C [15]. 2.4. Protein expression and purification Cpb0502 was amplified from C. pneumoniae strain TW-183 using primers: forward (50 -30 : CGACCGGCATATGCCTTTATCTTTAACAAG) and reverse (50 -30 : GATCTCGAGTTCGTAAGCAACTTCA).
Protein was generated from IPTG-induced E. coli BL21 cultures transformed in pET-21c vector. After washing in 20 mM Tris–HCl pH 7.8, proteins were purified by fast protein liquid chromatography [16]. 2.5. Crystallization and data collection The protein was used at 30 mg/ml, and the best crystals were obtained in sodium acetate, pH 4.8, 20% PEG 3350, 1,5-diaminopentane dihydrochloride at 20 °C by the hanging drop vapor diffusion method. Rod-shaped crystals formed within 14 days, and were transferred from drops to cryoprotection solution (sodium acetate, pH 4.8, 20% polyethylene glycol 3350, 1,5-diaminopentane dihydrochloride, and 30% (v/v) ethylene glycol) for X-ray data collection. 2.6. Structure determination and model building X-ray diffraction data for Cpb0502 were collected to 2.07 Å resolution using an ADSC Quantum 210 CCD detector in beam line 4A at Pohang light source (PLS), South Korea. The diffraction data were analyzed by the HKL-2000 programs DENZO and SCALEPACK [17]. The crystals belonged to space group P21 (Native) containing a two-molecule asymmetric unit, with a Matthews coefficient of 2.15 Å3/Da and an estimated solvent content of 42.9%. The unit cell parameters were a = 40.356, b = 51.781, c = 119.745 and a = 90°, b = 91.023°, c = 90°. The X-ray data-collection statistics are summarized in Table 2.
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524
521
Fig. 3. (A) Surface of Cpb0502: the circles drawn in black indicate a ‘hole-like site’. Two ‘hole-like sites’ are open, active sites that form a tunnel through the two domains. (B) The red arrow indicates a hole-like site on the overall structure. (C) Close up view of substrate binding sites on the surface of Cpb0502. (upper) the hydrogen bonding interaction with arginine in active site; (lower) interaction between arginine and Phe58 and Tyr20 via hydrophobic binding.
The crystal structures were determined by the molecular replacement method using Chlamydia trachomatis CT381 (PDB code: 3DEL, referred as ArtJ) [18]as a searching model. All structures were solved using the CCP4 program suite and refined with CNS [19]. Subsequent refinement was performed with REFMAC5 [20] and PHENIX41 [21] together with manual model building in COOT [22]. Further model building was done with the program PYMOL [23]. The final refinement statistics are summarized in Table 2. The final coordinates and structure factors have been deposited in the Protein Data Bank under the accession code 3QAX. 2.7. Western blotting Using 12% SDS–PAGE gels and polyvinylidene fluoride membranes (Amersham Biosciences), the protein samples were western-blotted and visualized using a 1:10000 dilution of streptavidin–horseradish peroxidase-conjugated anti-human IgG secondary polyclonal antibody (Sigma). Enhanced chemiluminescence (ECL; Amersham Biosciences) was used for detection [24]. 2.8. Elisa ELISA analysis was carried out using coating buffer (0.1 M NaHCO3, pH 8.6) and blocking buffer (TPBS with 3% BSA). Anti-human IgG peroxidase conjugate diluted to 1:1000 was used as a secondary antibody. ABTS peroxidase substrate solution (KPL, MD) was added with reaction in the dark for 1 min. Sample concentration was estimated at 405 nm using a SPECTRAMax 250 microplate reader [24].
3. Results 3.1. Selection of C. pneumoniae infection sera C. pneumoniae is a commonly known respiratory infectious agent whose symptoms are pneumonia, asthma, bronchitis, sinusitis and pharyngitis [4]. For primary treatments, erythromycin, tetracycline, or doxycycline are commonly used [25] but C. pneumoniae develops resistance to these antibiotics [26–28]. This suggests that developing improved treatments are required to combat C. pneumoniae. Eleven serum samples were collected from patients with C. pneumoniae for the MIF test. Table 1 shows that C. pneumoniae was detected in all 11 patient samples, showing well above the normal range (<1:64) against IgG antibody: 3 patients with 1:128; three with 1:256; five with >1:256. However, IgM antibody titres indicated that two samples showed the normal range (1:16), while 2 and 7 samples exhibited 1:32 and 1:64 dilutions, respectively. To compare with other pneumonia, 10 samples from L. pneumophila–infected patients were collected and all showed detection above the normal range (1 < 1:64 for IgG, 1 < 1:16 for IgM): 5 patients showed 1:256 and 5 showed >1:256 against the IgG antibody; for IgM antibody titres, all 10 samples showed >1:32. With the same 10 patients’ samples from L. pneumophila, IgG detection was performed using an IgG kit and the result showed P40 AU/ ml, while the normal range is <40 AU/ml. These results have revealed that the detection of C. pneumoniae from the 11 samples using the MIF is quite reliable although 2 samples have shown 1:16, which is the normal range. This could be because IgM antibodies appear only approximately 3 weeks after illness [29].
522
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524
Fig. 4. (A) Structural comparison of Cpb0502 and Histidine kinase receptor (‘3H7 M’). Overlapping structure of Cbp0502 and ‘3H7 M’ for structural comparison: Cbp0502 is colored sky-blue and ‘3H7 M’ is in gold. (B) The tertiary structure of Cpb0502 consists of two lobes that are connected by two long loops. (C) The tertiary structure of ‘3H7 M’ contains two b-pleated sheets. (D) Red boxes depict amino acid sequence alignment of secondary structures of Cpb0502 and ‘3H7 M’ (from G. sulfurreducens). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.2. Specificity and sensitivity of Cpb0502 in detecting C. pneumoniae In order to identify Cpb0502 as an appropriate immunogenic antigen to detect C. pneumoniae in patients, its specificity was tested. C. pneumoniae, L. pneumophila and M. pneumoniae are the most common causes of community-acquired pneumonia (CAP) and the most atypical pathogens [30]. Also C. pneumoniae and M. pneumoniae are well known as causes of asthma, including in children [31]. Therefore, eleven, ten, and ten samples from C. pneumoniae, L. pneumophila, and M. pneumoniae infection sera respectively and ten healthy sera as a control were used to determine the specificity of Cpb0502 using western blot analysis (Fig. 1A). As expected, Cpb0502 was detected in most C. pneumoniae infection sera: the first 5 samples (C1-C5) were shown to contain more Cpb0502 antigen (IgG antibody titers:>1:256) than the next three samples (C6-C8) whose IgG antibody titers were 1:256. There
was no detection recorded from samples C9-C11 that gave 1:128 for IgG antibody titers. No Cpb0502 was detected at all in the nonC.pneumoniae infection sera or in controls from healthy patients. As the western blotting results showed that Cpb0502 was only detected in C. pneumoniae, we further expanded our study using ELISA analysis to determine the sensitivity of Cpb0502. The same samples were used as for western blotting (Fig. 1B) and the results indicated that Cpb0502 was detected in all the diluted samples of C. pneumoniae origin, showing an optical density (OD) above 0.5 and up to over 2.0 in 1:128, 1:256, and >1:256. Although OD values increased upon dilution (>1:256 was the highest, and 1:128 the lowest, in increase), this was not statistically significance (p < 0.05). No Cpb0502 was detected in L. pneumoniae and M. pneumoniae compared with a control group. Therefore Cpb0502 can be used as a candidate antigen to detect C. pneumoniae, and it can contribute to drug development studies.
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524
3.3. Overall structure of Cpb0502 and its substrate-binding site To elucidate the exact mechanism of Cpb0502 at the molecular level, we determined the crystal structure of Cpb0502 at 2.07 Å resolution, which showed the asymmetric unit to be a dimer (Fig. 2A). Statistics on the data collection and refinement are given in Table 2. The two molecules in the dimer interact in a unique way: Val235 and Tyr237 from the C-terminus in molecule A are associated with Arg193 and Ala181 from molecule B via hydrogen bonds, respectively; Tyr237 in the molecule A interacts with Glu99 from molecule B via backbone hydrogen bonds (Fig. 2B). The overall structure of Cpb0502 contains ten a-helixes and eleven b-sheets: as shown in Fig. 2C, domains I and II are composed of five a-helixes and six bsheets, respectively. The secondary structure of domain I in its central sheet is formed by the sequence b1-b2-b3-b4-b5-b11, and the domain II by the sequence b6-b7-b8-b9-b10. In domain A, b1, b3, b4, and b5 sheets are located in a forward direction, and b2 and b11 sheets are located in a reverse direction. On the other hand, b7, b8, b9, and b10 sheets of domain II are located in a forward direction and b6 is located in a reverse direction. The C-terminus is located behind the central sheet of the domain I whereas the Nterminus is at the front. The two domains of Cpb0502 are connected by two loop segments that appear to function as hinge regions, which are flexible sections of polypeptide chains. One loop (yellow-green color) of the hinge region connects between b5 and b6, while the other loop (orange color) connects b8 and b11 (Fig. 2C). ‘Hole-like sites’ are located on both surfaces of the protein, creating a channel as a passage for ligand binding and transporting proteins. One ‘hole-like site’ is surrounded by negatively charged surfaces (Fig. 3A). Fig. 3B shows the overall structure of Cpb0502 with a tunnel of ‘hole-like sites’ indicated by a red arrow. Fig. 3 depicts an overall structure for Cpb0502 of two domains connected to each other with a substrate binding sites. Arginine is bound to the active sites of both domains where negatively charged ‘hole-like sites’ are present. Arginine interacts via hydrogen bonds with the negatively-charged residues Thr19 and Glu24 from one domain and the positively-charged residue, Arg83, from the other domain (Fig. 3C-upper). It also interacts with Phe58 and Tyr20 via hydrophobic interactions (Fig. 3C-lower). 3.4. Comparison of Cpb0502 with a histidine kinase receptor ‘Art’ genes include the specific arginine periplasmic binding protein [32]. In order to compare Cpb0502 and other periplasmic binding proteins, histidine kinase receptors were selected as candidates. Histidine kinase receptors are signal-transduction systems that help bacteria to adapt to various changes of environment [33]. The structure of HK29S (PDB code: 3H7M) from Geobacter sulfurreducens [34] was compared with Cpb0502 using the PyMol program, showing 22.9% sequence homology. Despite the low sequence homology, the overall three-dimensional backbone structures are shown to be similar (Fig. 4). Both proteins contain two domains: when two individual domains of Cpb0502 are compared with those of HK29S, the corresponding domains are conserved with r.m.s.d of 1.8 Å, 2.0 Å for Ca (13I–97V, 98Q–233S) and Ca (100L–108L, 114P–193L), respectively. The only major differences are that two domains of Cpb0502 are connected by two long loops, while two domains of this bi-lobal protein HK29S are connected by two long b-pleated sheets that are extended to the core of the central sheets [34]. 4. Discussion C. pneumoniae is one of the most common causes of community-acquired pneumonia (CAP), and therefore a range of specific
523
detection tools of C. pneumoniae have been developed over the years, including direct immunofluorescence (DIF), which showed 78.4% of positive results from 31 patients [35], and a C. pneumoniae-specific ELISA showing a sensitivity of 66.7% and a specificity of 79.2% compared with direct PCR-based detection assay [36]. Our recent study, and also another research group, introduced specific antigens for better serological diagnosis of C. pneumoniae [24,37]. Therefore, we further extended this research to develop another specific immunogenic antigen for detection. The structural study of arginine-binding Cpb0502 revealed that it is a typical periplasmic binding protein. Also, it shared great similarity in overall structure with another periplasmic binding protein, histidine kinase receptor. Also, the MIF test indicated clearly that Cpb0502 showed high sensitivity and specificity with the highest IgG index value against C. pneumoniae, while Cpb0502 was not detected at all in L. pneumoniae and M. pneumoniae. In conclusion we report another immunogenic antigen, specific to C. pneumoniae, which may be used to further improve diagnostic tools for this organism. Acknowledgments We thank KJ Kim for his assistance in collecting the data at beamlines 4A and 6C of the Pohang Light Source, Korea. This work was supported by grants from the National RD Program for the Functional Proteomics Center, 21C Frontier Program and in part by Global Frontier Program of a National Research Foundation of Korea (NRF) grant funded by the Korean Government. References [1] M. Caldara, P.N. Minh, S. Bostoen, J. Massant, D. Charlier, Argr-dependent repression of arginine and histidine transport genes in Escherichia coli K-12, J. Mol. Biol. 373 (2007) 251–267. [2] M. Caldara, D. Charlier, R. Cunin, The arginine regulon of escherichia coli: whole-system transcriptome analysis discovers new genes and provides an integrated view of arginine regulation, Microbiology 152 (2006) 3343–3354. [3] J.T. Grayston, L.A. Campbell, C.C. Kuo, C.H. Mordhorst, P. Saikku, D.H. Thom, S.P. Wang, A new respiratory tract pathogen: Chlamydia Pneumoniae strain Twar, J. Infect. Dis. 161 (1990) 618–625. [4] D.L. Hahn, R. Golubjatnikov, Asthma and chlamydial infection: a case series, J. Fam. Pract. 38 (1994) 589–595. [5] S. Mukhopadhyay, D. Good, R.D. Miller, J.E. Graham, S.A. Mathews, P. Timms, J.T. Summersgill, Identification of Chlamydia pneumoniae proteins in the transition from reticulate to elementary body formation, Mol. Cell Proteomics 5 (2006) 2311–2318. [6] S. Kumar, M.R. Hammerschlag, Acute respiratory infection due to Chlamydia pneumoniae: current status of diagnostic methods, Clin. Infect. Dis. 44 (2007) 568–576. [7] A.S. Amin, Application of touchdown enzyme time release (tetr)-PCR for diagnosis of Chlamydophila abortus infection, Res. Vet. Sci. 74 (2003) 213–217. [8] S.L. Mitchell, S. Budhiraja, K.A. Thurman, W. Lanier Thacker, J.M. Winchell, Evaluation of two real-time pcr chemistries for the detection of Chlamydophila pneumoniae in clinical specimens, Mol. Cell Probes. 23 (2009) 309–311. [9] S.F. Dowell, R.W. Peeling, J. Boman, G.M. Carlone, B.S. Fields, J. Guarner, M.R. Hammerschlag, L.A. Jackson, C.C. Kuo, M. Maass, T.O. Messmer, D.F. Talkington, M.L. Tondella, S.R. Zaki, Standardizing Chlamydia pneumoniae assays: recommendations from the centers for disease control and prevention (USA) and the laboratory centre for disease control (Canada), Clin Infect Dis. 33 (2001) 492–503. [10] T. Van Der Heide, B. Poolman, ABC transporters: one two or four extracytoplasmic substrate-binding sites, EMBO Rep. 10 (2002) 938–943. [11] R. Fleischer, A. Wengner, F. Scheffel, H. Landmesser, E. Schneider, Identification of a gene cluster encoding an arginine atp-binding-cassette transporter in the genome of the thermophilic gram-positive bacterium Geobacillus stearothermophilus strain DSMZ 13240, Microbiology 151 (2005) 835–840. [12] A. Tvinnereim, B. Wizel, CD8+ T Cell protective immunity against Chlamydia pneumoniae includes an H2–M3-restricted response that is largely CD4+ T cellindependent, J. Immunol. 179 (2007) 3947–3957. [13] O. Finco, A. Bonci, M. Agnusdei, M. Scarselli, R. Petracca, N. Norais, G. Ferrari, I. Garaguso, M. Donati, V. Sambri, R. Cevenini, G. Ratti, G. Grandi, Identification of new potential vaccine candidates against Chlamydia pneumoniae by multiple screenings, Vaccine. 23 (2005) 1178–1188. [14] S. Mukhopadhyay, A.P. Clark, E.D. Sullivan, R.D. Miller, J.T. Summersgill, Detailed protocol for purification of Chlamydia pneumoniae elementary bodies, J. Clin. Microbiol. 42 (2004) 3288–3290. [15] M.L. Tondella, D.F. Talkington, B.P. Holloway, S.F. Dowell, K. Cowley, M. Soriano-Gabarro, M.S. Elkind, B.S. Fields, Development and evaluation of
524
[16] [17] [18]
[19]
[20]
[21]
[22] [23] [24]
[25] [26]
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524 real-time pcr-based fluorescence assays for detection of Chlamydia pneumoniae, J. Clin. Microbiol. 40 (2002) 575–583. E.M. Miller, J.A. Nickoloff, Escherichia coli electrotransformation, Methods Mol. Biol. 47 (1995) 105–113. Z. Otwinowski, W. Minor, Processing of X-ray diffraction data collected in oscillation mode, Methods Enzymol. 276 (1997) 307–326. M. Soriani, P. Petit, R. Grifantini, R. Petracca, G. Gancitano, E. Frigimelica, F. Nardelli, C. Garcia, S. Spinelli, G. Scarabelli, S. Fiorucci, R. Affentranger, M. Ferrer-Navarro, M. Zacharia, G. Colombo, L. Vuillard, W. Daura, G. Grandi, Exploiting antigenic diversity for vaccine design: the chlamydia artj paradigm, J. Biol. Chem. 285 (2010) 30126–30138. A.T. Brunger, P.D. Adams, G.M. Clore, W.L. Delano, P. Gros, R.W. GrosseKunstleve, J.S. Jiang, J. Kuszewski, M. Nilges, N.S. Pannu, R.J. Read, L.M. Rice, T. Simonson, G.L. Warren, Crystallography NMR system: a new software suite for macromolecular structure determination, Acta Crystallogr D Biol. Crystallogr. 54 (1998) 905–921. G.N. Murshudov, A.A. Vagin, E.J. Dodson, Refinement of macromolecular structures by the maximum-likelihood method, Acta Crystallogr. D Biol. Crystallogr. 53 (1997) 240–255. P.D. Adams Pd, P.V. Afonine, G. Bunkoczi, V.B. Chen, I.W. Davis, N. Echols, J.J. Headd, L.W. Hung, G.J. Kapral, R.W. Grosse-Kunstleve, A.J. Mccoy, N.W. Moriarty, R. Oeffner, R.J. Read, D.C. Richardson, J.S. Richardson, T.C. Terwilliger, P.H. Zwart, Phenix: a comprehensive python-based system for macromolecular structure solution, Acta Crystallogr. D Biol. Crystallogr. 66 (2010) 213–221. P. Emsley, K. Cowtan, Coot: model-building tools for molecular graphics, Acta Crystallogr. D Biol. Crystallogr. 60 (2004) 2126–2132. W. Delano, The Pymol Molecular Graphics System, Http://www.pymolorg. 1998–2003. S.H. Park, S.J. Kwon, S.J. Lee, Y.C. Kim, K.Y. Hwang, Y.H. Kang, K.J. Lee, Identification of immunogenic antigen candidate for Chlamydophila pneumoniae diagnosis, J. Proteome Res. 8 (2009) 2933–2943. A. Burillo, E. Bouza, Chlamydophila Pneumoniae, Infect. Dis. Clin. North Am. 24 (2010) 61–71. J. Lenart, A.A. Andersen, D.D. Rockey, Growth and development of tetracyclineresistant Chlamydia suis. Antimicrob. Agents Chemother. 45 (2001) 2198– 2203.
[27] J.H. Song, W.S. Oh, C.I. Kang, D.R. Chung, K.R. Peck, K.S. Ko, J.S. Yeom, C.K. Kim, S.W. Kim, H.H. Chang, Y.S. Kim, S.I. Jung, Z. Tong, Q. Wang, S.G. Huang, J.W. Liu, M.K. Lalitha, B.H. Tan, P.H. Van, C.C. Carlos, Epidemiology and clinical outcomes of community-acquired pneumonia in adult patients in Asian countries: a prospective study by the asian network for surveillance of resistant pathogens, Int. J. Antimicrob. Agents. 31 (2008) 107–114. [28] L. Tormakangas, E. Markkula, K. Lounatmaa, M. Puolakkainen, Chlamydia pneumoniae infection in polarized epithelial cell lines, Infect. Immun. 78 (2010) 2714–2722. [29] Y. Turgeman, P. Levahar, I. Lavi, A. Shneor, R. Colodner, Z. Samra, L. Bloch, T. Rosenfeld, Adult calcific aortic stenosis and Chlamydia pneumoniae: the role of chlamydia infection in valvular calcification, Isr. Med. Assoc. J. 8 (2006) 464– 468. [30] B.A. Cunha, The atypical pneumonias: clinical diagnosis and importance, Clin. Microbiol. Infect. 12 (2006) 12–24. [31] H.L. Von, Role of persistent infection in the control and severity of asthma: focus on Chlamydia pneumoniae, Eur. Respir. J. 19 (2002) 546–556. [32] U. Wissenbach, S. Six, J. Bongaerts, D. Ternes, S. Steinwachs, G. Unden, A third periplasmic transport system for l-arginine in Escherichia coli: molecular characterization of the artPIQMJ genes, arginine binding and transport, Mol. Microbiol. 17 (1995) 675–686. [33] A.H. West, A.M. Stock, Histidine kinases and response regulator proteins in two-component signaling systems, Trends Biochem. Sci. 26 (2001) 369–376. [34] J. Cheung, M. Le-Khac, W.A. Hendrickson, Crystal structure of a histidine kinase sensor domain with similarity to periplasmic binding proteins, Proteins. 77 (2009) 235–241. [35] S. Niemhom, C. Pongkun, W. Petkanchanapong, C. Chintrakarn, Evaluation of direct immunofluorescence test for diagnosis of upper respiratory tract infection by Chlamydia pneumoniae, J. Med. Assoc. Thai. 91 (2008) 1416–1424. [36] J.M. Sueur, K. Beaumont, T. Cabioch, J. Orfila, F. Betsou, Diagnostic value of an elisa using a recombinant 54-kda species-specific protein from Chlamydia pneumoniae, Clin. Microbiol. Infect. 12 (2006) 470–477. [37] S. Bunk, I. Susnea, J. Rupp, J.T. Summersgill, M. Maass, W. Stegmann, A. Schrattenholz, A. Wendel, M. Przybylski, C. Hermann, Immunoproteomic identification and serological responses to novel Chlamydia pneumoniae antigens that are associated with persistent C. pneumoniae infections, J. Immunol. 180 (2008) 5490–5498.
Contents lists available at SciVerse ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Structural analysis and serological test of arginine periplasmic binding protein 2 from Chlamydophila pneumoniae Sung-Ha Park a,b,1, Ji-Eun Chang a,1, Hye-Jin Kim Hawkes c, Yeon-Ho Kang b,⇑,1, Kwang Yeon Hwang a,⇑,2 a
Graduate School of Biotechnology, Korea University, Seoul, Republic of Korea Division of Bacterial Respiratory, National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul, Republic of Korea c School of Biomolecular and Physical Sciences and Eskitis Institute for Cell and Molecular Therapies, Griffith University, Australia b
a r t i c l e
i n f o
Article history: Received 30 December 2011 Available online 20 January 2012 Keywords: Arginine periplasmic binding protein 2 Chlamydophila pneumoniae Structural analysis Immunogenic antigen Serological test Diagnosis
a b s t r a c t The ‘art’ genes encode specific arginine uptake proteins, and are repressed by the repressible promoters of ArgR, affecting transcription of artJ [1,2]. Cpb0502, the arginine-binding periplasmic protein 2 precursor from Chlamydophila pneumoniae TW-183 strains, is responsible for arginine transport. As C. pneumoniae is difficult to isolate and culture, there have been many studies of better ways to detect it. A microimmunofluorescence assay (MIF) is still considered to be the ‘gold standard’ for detecting C. pneumoniae. Although MIF has its own limitations, a number of immunogenic antigens have been shown to be C. pneumoniae specific by this test. Here, we report Cpb0502 as a specific immunogenic antigen against C. pneumoniae as it was detected only in human infection sera of C. pneumoniae but not in Legionella pneumophila and Mycoplasma pneumoniae infection sera, showing high specificity and sensitivity by MIF, western blot and ELISA analysis. And also the crystal structure of Cpb0502 was determined to be a dimer at 2.07 Å, revealing a similar backbone structure to a histidine kinase receptor, HK29S. Therefore we may suggest that Cpb0502 is a candidate immunogenic antigen for better diagnosis of C. pneumoniae. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Chlamydophila pneumoniae is one of the most common community-acquired pneumonias (CAP) and was first isolated in 1965 from a Taiwanese child who was one of the volunteers in a trachoma vaccine trial [3]. C. pneumoniae causes several acute respiratory diseases, such as pneumonia, asthma, bronchitis, sinusitis and pharyngitis [4]. C. pneumoniae is an obligate intracellular pathogen, existing as an elementary body (EB) between hosts. When the EB is ingested by a lung cell, it differentiates into a reticulate body which replicates and is released back into the host as further EBs [5]. To better detect C. pneumoniae, laboratories use a number of diagnostic methods including nucleic acid amplification tests (NAATs) [6], touchdown enzyme time release (TETR) PCR techniques [7], ‘‘light upon extension’’ (LUX) and TaqMan [8]. The microimmunifluorescence assay (MIF) is still recognized as the ‘gold standard’ for detecting C. pneumoniae, but diagnosis remains a problem due to difficulties in isolation and culture of C. pneumoniae [9].
Cpb0502 may be a potential diagnostic antigen as it is a periplasmic protein [10]. ATP-binding cassette (ABC) transporters are transmembrane and translocate substrates ranging from small ions to proteins across the cell membrane utilizing the free energy of ATP hydrolysis in bacteria. Many chlamydial strains degrade arginine and must import it from their host, requiring an arginine periplasmic binding protein as an additional extracellular substrate receptor [11]. T-cells must be present in immunity against C. pneumoniae [12] and new candidate vaccine proteins were identified against C. pneumoniae [13]. Therefore through this research we have investigated and identified features of Cpb0502 as a candidate immunogenic antigen for testing C. pneumoniae infection sera via MIF and ELISA. Also we have determined the crystal structure of Cpb0502 to further investigate functions of Cpb0502 at the structural level.
2. Materials and methods 2.1. Cell culture and inoculation
⇑ Corresponding authors. Fax: +82 2 923 3229 (K.Y. Hwang), +82 2 380 1487 (Y.-H. Kang). E-mail addresses: kyhfi[email protected] (Y.-H. Kang), [email protected] (K.Y. Hwang). 1 These authors contributed equally to this article. 2 These corresponding authors contributed equally to this article. 0006-291X/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2012.01.058
Hep-2 cells were incubated at 37 °C for 24 h and inoculated with C. pneumoniae TW-183EBs, centrifuged at 3500g for 30 min at 10 °C and post-infected at 37 °C for 72 h. Cells were fixed in absolute methanol and stained with a FITC-labeled chlamydialspecific antibody (Pathfinder; Bio-Rad Laboratories) for 30 min to
519
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524 Table 1 IgG/IgM antibody titers of C. pneumoniae infection sera using MIF C. pneumoniae Normal range MIF (IgG)
<1:64
MIF (IgM)
<1:16
Kit (IgG)
–
Patient group 1:128 (n = 3) 1:256 (n = 3 1:256 (n = 5) 1:16 (n = 2) 1:32 (n = 2) 1:64 (n = 2) –
L. pneumoniae Normal range <1:64
<1:16
–
Patient group 1:256 (n = 5) – 1:256 (n = 5) – 1:32 (n = 10) – –
C. pneumoniae Normal range
Patient group
–
–
–
–
<40 AU/ml
P40 AU/ml (n = 10)
Table 2 Data-collection and refinement statistics.
X-ray Source Wavelength (Å) Resolution range (Å) Total reflections Redundancy Completeness (%) R-value/Rfreea (%) No. of protein atoms No. of water molecules RMSD from ideal geometry Bond lengths (Å) Bond angles (°)
Cpb0502 PF-BL-4A 1.00000 50–2.0 (2.0–2.07) 42387 (1867) 2.2 (1.7) 93.3 (78.8) 8.3 (2.6) 18.4/25.1 1817 496 0.022 1.741
Values in parentheses refer to the highest resolution shell (2.0–2.07 Å for Cpb0502). a Rfree is calculated from the randomly selected 5% set of reflections not included in the calculation of the R-value.
Fig. 1. (A) Western blot analysis to determine the specificity of Cpb0502 against C. pneumoniae: eleven C. pneumoniae infection sera (C, n = 3, titer 128; n = 3, titer 256; and n = 5, titer > 256); ten L. pneumophila infection sera (L, titer P 256); ten M. pneumoniae infection sera (M, titer P 40 AU/mL); and ten healthy sera (H, titer 6 64) were analysed. (B) Identification of seroreactivity of C. pneumoniae infection sera in comparison to L. pneumophila and M. pneumoniae infection sera. The seroreactivity of Cpb0502 was determined by ELISA. Results are representative of at least three separate experiments (p < 0.05).
520
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524
Fig. 2. (A) Backbone diagram of Cpb0502 in asymmetric unit. (B) the interaction between molecule A and B. The C-terminal region of molecule A interacts with the loop between a4 and b9 of molecule B. The dot lines had shown to be hydrogen bonding. (C) The monomer structure of Cpb0542 was displayed by ribbon diagram. Cpb0502 is comprised of two domains: I and II. They are connected by the two loops in the hinge regions. The substrate, arginine, is binding in deep active pocket.
determine the level of infection by epifluorescence microscopy [14]. 2.2. Serological test The study protocol was approved by the Medical Ethics and Human Clinical Trial Committee at the National Institute of Health, Korea. L. pneumophila serogroup 1–specific anti human IgG and C. pneumoniae c-chain specific anti-human IgG (Sigma) in serum were used for the MIF test. PLATELIATM M. pneumoniae IgG TMB kit (Bio-Rad) was used for semi-quantitative detection of anti-M. pneumoniae IgG in human serum by ELISA. The optical density was read at 450/620 nm and was converted into AU/ml (Arbitary Units) using a standard curve. 2.3. Elementary body preparation The inoculated cells were carefully removed and lysed by sonication on ice. EBs were separated by centrifuging at 40,000g for 1 h, and Hank’s balanced salt solution with Ca2+and Mg2+ (WelGENE) was added to the pellet. EBs were separated using 20–50% (v/v) Renocal-76 density gradients (Bracco Diagnostics) in sterile highspeed centrifuge tubes at 60000g for 1 h at 4 °C [15]. 2.4. Protein expression and purification Cpb0502 was amplified from C. pneumoniae strain TW-183 using primers: forward (50 -30 : CGACCGGCATATGCCTTTATCTTTAACAAG) and reverse (50 -30 : GATCTCGAGTTCGTAAGCAACTTCA).
Protein was generated from IPTG-induced E. coli BL21 cultures transformed in pET-21c vector. After washing in 20 mM Tris–HCl pH 7.8, proteins were purified by fast protein liquid chromatography [16]. 2.5. Crystallization and data collection The protein was used at 30 mg/ml, and the best crystals were obtained in sodium acetate, pH 4.8, 20% PEG 3350, 1,5-diaminopentane dihydrochloride at 20 °C by the hanging drop vapor diffusion method. Rod-shaped crystals formed within 14 days, and were transferred from drops to cryoprotection solution (sodium acetate, pH 4.8, 20% polyethylene glycol 3350, 1,5-diaminopentane dihydrochloride, and 30% (v/v) ethylene glycol) for X-ray data collection. 2.6. Structure determination and model building X-ray diffraction data for Cpb0502 were collected to 2.07 Å resolution using an ADSC Quantum 210 CCD detector in beam line 4A at Pohang light source (PLS), South Korea. The diffraction data were analyzed by the HKL-2000 programs DENZO and SCALEPACK [17]. The crystals belonged to space group P21 (Native) containing a two-molecule asymmetric unit, with a Matthews coefficient of 2.15 Å3/Da and an estimated solvent content of 42.9%. The unit cell parameters were a = 40.356, b = 51.781, c = 119.745 and a = 90°, b = 91.023°, c = 90°. The X-ray data-collection statistics are summarized in Table 2.
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524
521
Fig. 3. (A) Surface of Cpb0502: the circles drawn in black indicate a ‘hole-like site’. Two ‘hole-like sites’ are open, active sites that form a tunnel through the two domains. (B) The red arrow indicates a hole-like site on the overall structure. (C) Close up view of substrate binding sites on the surface of Cpb0502. (upper) the hydrogen bonding interaction with arginine in active site; (lower) interaction between arginine and Phe58 and Tyr20 via hydrophobic binding.
The crystal structures were determined by the molecular replacement method using Chlamydia trachomatis CT381 (PDB code: 3DEL, referred as ArtJ) [18]as a searching model. All structures were solved using the CCP4 program suite and refined with CNS [19]. Subsequent refinement was performed with REFMAC5 [20] and PHENIX41 [21] together with manual model building in COOT [22]. Further model building was done with the program PYMOL [23]. The final refinement statistics are summarized in Table 2. The final coordinates and structure factors have been deposited in the Protein Data Bank under the accession code 3QAX. 2.7. Western blotting Using 12% SDS–PAGE gels and polyvinylidene fluoride membranes (Amersham Biosciences), the protein samples were western-blotted and visualized using a 1:10000 dilution of streptavidin–horseradish peroxidase-conjugated anti-human IgG secondary polyclonal antibody (Sigma). Enhanced chemiluminescence (ECL; Amersham Biosciences) was used for detection [24]. 2.8. Elisa ELISA analysis was carried out using coating buffer (0.1 M NaHCO3, pH 8.6) and blocking buffer (TPBS with 3% BSA). Anti-human IgG peroxidase conjugate diluted to 1:1000 was used as a secondary antibody. ABTS peroxidase substrate solution (KPL, MD) was added with reaction in the dark for 1 min. Sample concentration was estimated at 405 nm using a SPECTRAMax 250 microplate reader [24].
3. Results 3.1. Selection of C. pneumoniae infection sera C. pneumoniae is a commonly known respiratory infectious agent whose symptoms are pneumonia, asthma, bronchitis, sinusitis and pharyngitis [4]. For primary treatments, erythromycin, tetracycline, or doxycycline are commonly used [25] but C. pneumoniae develops resistance to these antibiotics [26–28]. This suggests that developing improved treatments are required to combat C. pneumoniae. Eleven serum samples were collected from patients with C. pneumoniae for the MIF test. Table 1 shows that C. pneumoniae was detected in all 11 patient samples, showing well above the normal range (<1:64) against IgG antibody: 3 patients with 1:128; three with 1:256; five with >1:256. However, IgM antibody titres indicated that two samples showed the normal range (1:16), while 2 and 7 samples exhibited 1:32 and 1:64 dilutions, respectively. To compare with other pneumonia, 10 samples from L. pneumophila–infected patients were collected and all showed detection above the normal range (1 < 1:64 for IgG, 1 < 1:16 for IgM): 5 patients showed 1:256 and 5 showed >1:256 against the IgG antibody; for IgM antibody titres, all 10 samples showed >1:32. With the same 10 patients’ samples from L. pneumophila, IgG detection was performed using an IgG kit and the result showed P40 AU/ ml, while the normal range is <40 AU/ml. These results have revealed that the detection of C. pneumoniae from the 11 samples using the MIF is quite reliable although 2 samples have shown 1:16, which is the normal range. This could be because IgM antibodies appear only approximately 3 weeks after illness [29].
522
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524
Fig. 4. (A) Structural comparison of Cpb0502 and Histidine kinase receptor (‘3H7 M’). Overlapping structure of Cbp0502 and ‘3H7 M’ for structural comparison: Cbp0502 is colored sky-blue and ‘3H7 M’ is in gold. (B) The tertiary structure of Cpb0502 consists of two lobes that are connected by two long loops. (C) The tertiary structure of ‘3H7 M’ contains two b-pleated sheets. (D) Red boxes depict amino acid sequence alignment of secondary structures of Cpb0502 and ‘3H7 M’ (from G. sulfurreducens). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.2. Specificity and sensitivity of Cpb0502 in detecting C. pneumoniae In order to identify Cpb0502 as an appropriate immunogenic antigen to detect C. pneumoniae in patients, its specificity was tested. C. pneumoniae, L. pneumophila and M. pneumoniae are the most common causes of community-acquired pneumonia (CAP) and the most atypical pathogens [30]. Also C. pneumoniae and M. pneumoniae are well known as causes of asthma, including in children [31]. Therefore, eleven, ten, and ten samples from C. pneumoniae, L. pneumophila, and M. pneumoniae infection sera respectively and ten healthy sera as a control were used to determine the specificity of Cpb0502 using western blot analysis (Fig. 1A). As expected, Cpb0502 was detected in most C. pneumoniae infection sera: the first 5 samples (C1-C5) were shown to contain more Cpb0502 antigen (IgG antibody titers:>1:256) than the next three samples (C6-C8) whose IgG antibody titers were 1:256. There
was no detection recorded from samples C9-C11 that gave 1:128 for IgG antibody titers. No Cpb0502 was detected at all in the nonC.pneumoniae infection sera or in controls from healthy patients. As the western blotting results showed that Cpb0502 was only detected in C. pneumoniae, we further expanded our study using ELISA analysis to determine the sensitivity of Cpb0502. The same samples were used as for western blotting (Fig. 1B) and the results indicated that Cpb0502 was detected in all the diluted samples of C. pneumoniae origin, showing an optical density (OD) above 0.5 and up to over 2.0 in 1:128, 1:256, and >1:256. Although OD values increased upon dilution (>1:256 was the highest, and 1:128 the lowest, in increase), this was not statistically significance (p < 0.05). No Cpb0502 was detected in L. pneumoniae and M. pneumoniae compared with a control group. Therefore Cpb0502 can be used as a candidate antigen to detect C. pneumoniae, and it can contribute to drug development studies.
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524
3.3. Overall structure of Cpb0502 and its substrate-binding site To elucidate the exact mechanism of Cpb0502 at the molecular level, we determined the crystal structure of Cpb0502 at 2.07 Å resolution, which showed the asymmetric unit to be a dimer (Fig. 2A). Statistics on the data collection and refinement are given in Table 2. The two molecules in the dimer interact in a unique way: Val235 and Tyr237 from the C-terminus in molecule A are associated with Arg193 and Ala181 from molecule B via hydrogen bonds, respectively; Tyr237 in the molecule A interacts with Glu99 from molecule B via backbone hydrogen bonds (Fig. 2B). The overall structure of Cpb0502 contains ten a-helixes and eleven b-sheets: as shown in Fig. 2C, domains I and II are composed of five a-helixes and six bsheets, respectively. The secondary structure of domain I in its central sheet is formed by the sequence b1-b2-b3-b4-b5-b11, and the domain II by the sequence b6-b7-b8-b9-b10. In domain A, b1, b3, b4, and b5 sheets are located in a forward direction, and b2 and b11 sheets are located in a reverse direction. On the other hand, b7, b8, b9, and b10 sheets of domain II are located in a forward direction and b6 is located in a reverse direction. The C-terminus is located behind the central sheet of the domain I whereas the Nterminus is at the front. The two domains of Cpb0502 are connected by two loop segments that appear to function as hinge regions, which are flexible sections of polypeptide chains. One loop (yellow-green color) of the hinge region connects between b5 and b6, while the other loop (orange color) connects b8 and b11 (Fig. 2C). ‘Hole-like sites’ are located on both surfaces of the protein, creating a channel as a passage for ligand binding and transporting proteins. One ‘hole-like site’ is surrounded by negatively charged surfaces (Fig. 3A). Fig. 3B shows the overall structure of Cpb0502 with a tunnel of ‘hole-like sites’ indicated by a red arrow. Fig. 3 depicts an overall structure for Cpb0502 of two domains connected to each other with a substrate binding sites. Arginine is bound to the active sites of both domains where negatively charged ‘hole-like sites’ are present. Arginine interacts via hydrogen bonds with the negatively-charged residues Thr19 and Glu24 from one domain and the positively-charged residue, Arg83, from the other domain (Fig. 3C-upper). It also interacts with Phe58 and Tyr20 via hydrophobic interactions (Fig. 3C-lower). 3.4. Comparison of Cpb0502 with a histidine kinase receptor ‘Art’ genes include the specific arginine periplasmic binding protein [32]. In order to compare Cpb0502 and other periplasmic binding proteins, histidine kinase receptors were selected as candidates. Histidine kinase receptors are signal-transduction systems that help bacteria to adapt to various changes of environment [33]. The structure of HK29S (PDB code: 3H7M) from Geobacter sulfurreducens [34] was compared with Cpb0502 using the PyMol program, showing 22.9% sequence homology. Despite the low sequence homology, the overall three-dimensional backbone structures are shown to be similar (Fig. 4). Both proteins contain two domains: when two individual domains of Cpb0502 are compared with those of HK29S, the corresponding domains are conserved with r.m.s.d of 1.8 Å, 2.0 Å for Ca (13I–97V, 98Q–233S) and Ca (100L–108L, 114P–193L), respectively. The only major differences are that two domains of Cpb0502 are connected by two long loops, while two domains of this bi-lobal protein HK29S are connected by two long b-pleated sheets that are extended to the core of the central sheets [34]. 4. Discussion C. pneumoniae is one of the most common causes of community-acquired pneumonia (CAP), and therefore a range of specific
523
detection tools of C. pneumoniae have been developed over the years, including direct immunofluorescence (DIF), which showed 78.4% of positive results from 31 patients [35], and a C. pneumoniae-specific ELISA showing a sensitivity of 66.7% and a specificity of 79.2% compared with direct PCR-based detection assay [36]. Our recent study, and also another research group, introduced specific antigens for better serological diagnosis of C. pneumoniae [24,37]. Therefore, we further extended this research to develop another specific immunogenic antigen for detection. The structural study of arginine-binding Cpb0502 revealed that it is a typical periplasmic binding protein. Also, it shared great similarity in overall structure with another periplasmic binding protein, histidine kinase receptor. Also, the MIF test indicated clearly that Cpb0502 showed high sensitivity and specificity with the highest IgG index value against C. pneumoniae, while Cpb0502 was not detected at all in L. pneumoniae and M. pneumoniae. In conclusion we report another immunogenic antigen, specific to C. pneumoniae, which may be used to further improve diagnostic tools for this organism. Acknowledgments We thank KJ Kim for his assistance in collecting the data at beamlines 4A and 6C of the Pohang Light Source, Korea. This work was supported by grants from the National RD Program for the Functional Proteomics Center, 21C Frontier Program and in part by Global Frontier Program of a National Research Foundation of Korea (NRF) grant funded by the Korean Government. References [1] M. Caldara, P.N. Minh, S. Bostoen, J. Massant, D. Charlier, Argr-dependent repression of arginine and histidine transport genes in Escherichia coli K-12, J. Mol. Biol. 373 (2007) 251–267. [2] M. Caldara, D. Charlier, R. Cunin, The arginine regulon of escherichia coli: whole-system transcriptome analysis discovers new genes and provides an integrated view of arginine regulation, Microbiology 152 (2006) 3343–3354. [3] J.T. Grayston, L.A. Campbell, C.C. Kuo, C.H. Mordhorst, P. Saikku, D.H. Thom, S.P. Wang, A new respiratory tract pathogen: Chlamydia Pneumoniae strain Twar, J. Infect. Dis. 161 (1990) 618–625. [4] D.L. Hahn, R. Golubjatnikov, Asthma and chlamydial infection: a case series, J. Fam. Pract. 38 (1994) 589–595. [5] S. Mukhopadhyay, D. Good, R.D. Miller, J.E. Graham, S.A. Mathews, P. Timms, J.T. Summersgill, Identification of Chlamydia pneumoniae proteins in the transition from reticulate to elementary body formation, Mol. Cell Proteomics 5 (2006) 2311–2318. [6] S. Kumar, M.R. Hammerschlag, Acute respiratory infection due to Chlamydia pneumoniae: current status of diagnostic methods, Clin. Infect. Dis. 44 (2007) 568–576. [7] A.S. Amin, Application of touchdown enzyme time release (tetr)-PCR for diagnosis of Chlamydophila abortus infection, Res. Vet. Sci. 74 (2003) 213–217. [8] S.L. Mitchell, S. Budhiraja, K.A. Thurman, W. Lanier Thacker, J.M. Winchell, Evaluation of two real-time pcr chemistries for the detection of Chlamydophila pneumoniae in clinical specimens, Mol. Cell Probes. 23 (2009) 309–311. [9] S.F. Dowell, R.W. Peeling, J. Boman, G.M. Carlone, B.S. Fields, J. Guarner, M.R. Hammerschlag, L.A. Jackson, C.C. Kuo, M. Maass, T.O. Messmer, D.F. Talkington, M.L. Tondella, S.R. Zaki, Standardizing Chlamydia pneumoniae assays: recommendations from the centers for disease control and prevention (USA) and the laboratory centre for disease control (Canada), Clin Infect Dis. 33 (2001) 492–503. [10] T. Van Der Heide, B. Poolman, ABC transporters: one two or four extracytoplasmic substrate-binding sites, EMBO Rep. 10 (2002) 938–943. [11] R. Fleischer, A. Wengner, F. Scheffel, H. Landmesser, E. Schneider, Identification of a gene cluster encoding an arginine atp-binding-cassette transporter in the genome of the thermophilic gram-positive bacterium Geobacillus stearothermophilus strain DSMZ 13240, Microbiology 151 (2005) 835–840. [12] A. Tvinnereim, B. Wizel, CD8+ T Cell protective immunity against Chlamydia pneumoniae includes an H2–M3-restricted response that is largely CD4+ T cellindependent, J. Immunol. 179 (2007) 3947–3957. [13] O. Finco, A. Bonci, M. Agnusdei, M. Scarselli, R. Petracca, N. Norais, G. Ferrari, I. Garaguso, M. Donati, V. Sambri, R. Cevenini, G. Ratti, G. Grandi, Identification of new potential vaccine candidates against Chlamydia pneumoniae by multiple screenings, Vaccine. 23 (2005) 1178–1188. [14] S. Mukhopadhyay, A.P. Clark, E.D. Sullivan, R.D. Miller, J.T. Summersgill, Detailed protocol for purification of Chlamydia pneumoniae elementary bodies, J. Clin. Microbiol. 42 (2004) 3288–3290. [15] M.L. Tondella, D.F. Talkington, B.P. Holloway, S.F. Dowell, K. Cowley, M. Soriano-Gabarro, M.S. Elkind, B.S. Fields, Development and evaluation of
524
[16] [17] [18]
[19]
[20]
[21]
[22] [23] [24]
[25] [26]
S.-H. Park et al. / Biochemical and Biophysical Research Communications 418 (2012) 518–524 real-time pcr-based fluorescence assays for detection of Chlamydia pneumoniae, J. Clin. Microbiol. 40 (2002) 575–583. E.M. Miller, J.A. Nickoloff, Escherichia coli electrotransformation, Methods Mol. Biol. 47 (1995) 105–113. Z. Otwinowski, W. Minor, Processing of X-ray diffraction data collected in oscillation mode, Methods Enzymol. 276 (1997) 307–326. M. Soriani, P. Petit, R. Grifantini, R. Petracca, G. Gancitano, E. Frigimelica, F. Nardelli, C. Garcia, S. Spinelli, G. Scarabelli, S. Fiorucci, R. Affentranger, M. Ferrer-Navarro, M. Zacharia, G. Colombo, L. Vuillard, W. Daura, G. Grandi, Exploiting antigenic diversity for vaccine design: the chlamydia artj paradigm, J. Biol. Chem. 285 (2010) 30126–30138. A.T. Brunger, P.D. Adams, G.M. Clore, W.L. Delano, P. Gros, R.W. GrosseKunstleve, J.S. Jiang, J. Kuszewski, M. Nilges, N.S. Pannu, R.J. Read, L.M. Rice, T. Simonson, G.L. Warren, Crystallography NMR system: a new software suite for macromolecular structure determination, Acta Crystallogr D Biol. Crystallogr. 54 (1998) 905–921. G.N. Murshudov, A.A. Vagin, E.J. Dodson, Refinement of macromolecular structures by the maximum-likelihood method, Acta Crystallogr. D Biol. Crystallogr. 53 (1997) 240–255. P.D. Adams Pd, P.V. Afonine, G. Bunkoczi, V.B. Chen, I.W. Davis, N. Echols, J.J. Headd, L.W. Hung, G.J. Kapral, R.W. Grosse-Kunstleve, A.J. Mccoy, N.W. Moriarty, R. Oeffner, R.J. Read, D.C. Richardson, J.S. Richardson, T.C. Terwilliger, P.H. Zwart, Phenix: a comprehensive python-based system for macromolecular structure solution, Acta Crystallogr. D Biol. Crystallogr. 66 (2010) 213–221. P. Emsley, K. Cowtan, Coot: model-building tools for molecular graphics, Acta Crystallogr. D Biol. Crystallogr. 60 (2004) 2126–2132. W. Delano, The Pymol Molecular Graphics System, Http://www.pymolorg. 1998–2003. S.H. Park, S.J. Kwon, S.J. Lee, Y.C. Kim, K.Y. Hwang, Y.H. Kang, K.J. Lee, Identification of immunogenic antigen candidate for Chlamydophila pneumoniae diagnosis, J. Proteome Res. 8 (2009) 2933–2943. A. Burillo, E. Bouza, Chlamydophila Pneumoniae, Infect. Dis. Clin. North Am. 24 (2010) 61–71. J. Lenart, A.A. Andersen, D.D. Rockey, Growth and development of tetracyclineresistant Chlamydia suis. Antimicrob. Agents Chemother. 45 (2001) 2198– 2203.
[27] J.H. Song, W.S. Oh, C.I. Kang, D.R. Chung, K.R. Peck, K.S. Ko, J.S. Yeom, C.K. Kim, S.W. Kim, H.H. Chang, Y.S. Kim, S.I. Jung, Z. Tong, Q. Wang, S.G. Huang, J.W. Liu, M.K. Lalitha, B.H. Tan, P.H. Van, C.C. Carlos, Epidemiology and clinical outcomes of community-acquired pneumonia in adult patients in Asian countries: a prospective study by the asian network for surveillance of resistant pathogens, Int. J. Antimicrob. Agents. 31 (2008) 107–114. [28] L. Tormakangas, E. Markkula, K. Lounatmaa, M. Puolakkainen, Chlamydia pneumoniae infection in polarized epithelial cell lines, Infect. Immun. 78 (2010) 2714–2722. [29] Y. Turgeman, P. Levahar, I. Lavi, A. Shneor, R. Colodner, Z. Samra, L. Bloch, T. Rosenfeld, Adult calcific aortic stenosis and Chlamydia pneumoniae: the role of chlamydia infection in valvular calcification, Isr. Med. Assoc. J. 8 (2006) 464– 468. [30] B.A. Cunha, The atypical pneumonias: clinical diagnosis and importance, Clin. Microbiol. Infect. 12 (2006) 12–24. [31] H.L. Von, Role of persistent infection in the control and severity of asthma: focus on Chlamydia pneumoniae, Eur. Respir. J. 19 (2002) 546–556. [32] U. Wissenbach, S. Six, J. Bongaerts, D. Ternes, S. Steinwachs, G. Unden, A third periplasmic transport system for l-arginine in Escherichia coli: molecular characterization of the artPIQMJ genes, arginine binding and transport, Mol. Microbiol. 17 (1995) 675–686. [33] A.H. West, A.M. Stock, Histidine kinases and response regulator proteins in two-component signaling systems, Trends Biochem. Sci. 26 (2001) 369–376. [34] J. Cheung, M. Le-Khac, W.A. Hendrickson, Crystal structure of a histidine kinase sensor domain with similarity to periplasmic binding proteins, Proteins. 77 (2009) 235–241. [35] S. Niemhom, C. Pongkun, W. Petkanchanapong, C. Chintrakarn, Evaluation of direct immunofluorescence test for diagnosis of upper respiratory tract infection by Chlamydia pneumoniae, J. Med. Assoc. Thai. 91 (2008) 1416–1424. [36] J.M. Sueur, K. Beaumont, T. Cabioch, J. Orfila, F. Betsou, Diagnostic value of an elisa using a recombinant 54-kda species-specific protein from Chlamydia pneumoniae, Clin. Microbiol. Infect. 12 (2006) 470–477. [37] S. Bunk, I. Susnea, J. Rupp, J.T. Summersgill, M. Maass, W. Stegmann, A. Schrattenholz, A. Wendel, M. Przybylski, C. Hermann, Immunoproteomic identification and serological responses to novel Chlamydia pneumoniae antigens that are associated with persistent C. pneumoniae infections, J. Immunol. 180 (2008) 5490–5498.