Structural analysis of loci involved in pSAM2 site-specific integration in Streptomyces

PLASMID

21, 59-70

(1989)

Structural Analysis of Loci Involved in pSAM2 Site-Specific Integration in Streptomyces ~DI%UC

BOCCARD, TAMARA ANNKK FRIEDMANN,

Laboratoire

de Biologic et G.hBique Universit6 Paris-&d, Received

October

SMOKVINA, AND MICHEL Mokhdaire, F-91405

JEAN-LUC GUBRINEAU

PERNODET,

URA CNRS D 0086, Bhiment Orsay Cedex, France

18, 1988; revised

December

400,

15, 1988

pSAM2 is an 1 I-kb plasmid integrated in the Streptomyces ambofaciens ATCC23877 and ATCCI 5 154 genomes and found additionally as a free rephcon in an uv derivative. After transfer into S. ambofacins DSM40697 (devoid of pSAM2) or into Streptomyces lividans. specific integration of pSAM2 occurred very efficiently. A 58-bp sequence (art) present in both pSAM2 (attP) and S. ambofhciens strain DSM40697 (attB) attachment regions is found at the boundaries (attL and attR) of integrated pWhI2 in S. amhfaciens strain ATCC23877. The S. lividans chromosomal integration zone contained an imperfectly conserved art sequence (attB), and the integration event of pSAM2 was located within a 49-bp sequence of attB. Only one primary fimctional attB sequence was present in the S. lividans or S. ambofaciens DSM40697 total DNA. The integration zone of S. fiviahs hybridized with the integration zone of S. ambofaciens DSM40697. The two integration zones were homologous only to the right side of the att sequence. The conserved region contained an open reading frame (ORF A) with a stop codon located 99 bp from the attB sequence in both strains. S. ambofaciens DSM40697 contained DNA sequences related to pSAM2 on the left side of the att site. The att sequence was included in a region conserved in Streptomyces antibioticus, Streptomyces actuosus, Streptomyces bikiniensis. Streptomyces coelicolor, Streptomyces glaucestens, and Streptomyces parvulus. Site-specific integration of a pSAM2 derivative was characterized in another unrelated strain, Streptomyces griseofuscus. This strain contained an imperfectly conseryed 58-bp attB sequence, and the integration event took place within a 45-bp sequence of attB. Site-specific integration of pSAM2 in three nonrelated Streptomyces strains suggests the wide host . range of pSAM2 mtegratlon m Streptomyces. 0 1989 Academic Pres$ Inc.

Among actinomycetes, naturally occurring plasmids have been reported in many species (for a review, see Hopwood et al., 1986). Several of these plasmids (SLPl, pSE101, pMEAlO0, pIJ408) exist as integrated sequences in the genomes of different species and, after transfer, can interact physically with the chromosome by a site-specific integration mechanism. SLPl is an integrated element of Streptomyces coelicolor A(3)2 able to be transferred to the closely related Streptomyces fividuns. After this transfer, free plasmids of various sizes or integrated plasmids were found (Bibb et al., 1981; Omer and Cohen, 1984, 1986). pMEA 100 is a 23.7-kb element, present as both an integrated and a free plasmid in Nocardia mediterranei, able to reintegrate specifically into a plasmid-free mutant strain

(Moretti et al., 1985; Madon et al., 1987). Saccharopolyspora erythraea contained the element pSEl0 1 in a chromosomally integrated form as well as in the free state. It was shown that pSE 10 1 can integrate at different locations into the S. lividuns genome (Brown et al., 1988). As cited by Chater et al. (1988) plasmid integration of these three elements involves recombination within a 50-bp sequence shared by the plasmid (attP) and chromosomal (attB) sites. It was recently demonstrated that the pIJ408 element originating from Streptomyces glaucescens (Hopwood et aI., 1984) was able to integrate in S. lividans and the recombination occurred within a 35bp sequence common to the plasmid and chromosomal integration zones (R. Hiitter, personal communication). 59

0147-619X/89

$3.00

Copyi@ Q 1989 by Academic Press, Inc. All ri&ts of reproduction in any form reserved.

60

BOCCARD

pSAM2 is an integrated sequence from Streptomyces ambofaciens ATCC23877 (strain Bl) and ATCClS 154 (strain B2, an uv derivative of strain B 1) and is found additionally as ccc DNA in J132 12 (strain B3, another uv derivative of strain Bl). This plasmid is self-transmissible, able to elicit lethal zygosis (Pemodet et al., 1984), and stimulates chromosomal recombination (Smokvina et al., 1988). In a previous paper (Boccard et al., 1988), we showed that the resident copy of strain B2 was able to be transferred and to integrate specifically into the S. ambofaciens DSM40697 (strain A, devoid naturally of pSAM2) and S. lividans genomes. Integration into S. lividans occurred in a unique chromosomal region, whereas several copies integrated into the S. ambofaciens strain A genome. In that strain, integration of one copy of pSAM2 occurred in a region that hybridized with the S. lividans integration zone, whereas other pSAMZrelated sequences integrated elsewhere in the genome. The same integration pattern was observed when the free pSAM2 form was used to transform these two strains. Recently, we demonstrated that the integration of pSAM2 is promoted by a protein belonging to the integrase family and that pSAM2 in strain Bl is adjacent to a 42-kb segment not found in strain A (Boccard et al., 1989). In this paper, we show that recombination of pSAM2 in several Streptomyces strains was site-specific. The integration occurred through a 58-bp sequence (att) present in the plasmid and in the chromosomes. Analysis of the att sequences in S. ambofaciens strain A, S. lividans, and S. griseofuscus allowed the localization of the crossover region to within a 45-bp sequence of the att sequences. In these three strains, the attB sequence is found adjacent to an inverted repeat sequence. The chromosomal integration zones of S. lividans and S. umbofaciens were similar only on one side of the att sequence. The homologous region contained an open reading frame in both strains, whereas S, umbofaciens contained sequences related to pSAM2 on the other side of the att sequence. The attB site was located in a region

ET AL.

conserved among widely separated Streptomyces species. MATERIALS

AND

METHODS

Strains and Plasmids Streptomyces strains used are listed in Table 1. Streptomyces strains were grown on plates of Hickey-Tresner medium at 29°C (Pridham et al., 1957). Escherichia coli strains used for cloning were HBlO 1 (Boyer and RoullandDussoix, 1969) JMlOl (Messing et al., 1981), and JMlO5 (Yanisch-Perron et al., 1985). The S. ambofaciens strain B3 was used as the source of the free form of pSAM2. The plasmid pD6B (Smokvina, to be published) is a pSAM2 deletion derivative existing only as an integrated sequence in Streptomyces after sitespecific integration. It carries pIJ39 (pBR322 with a 1.8-kb BamHI insert containing the tsr gene (Thompson et al., 1980) of Streptomyces azureus which confers resistance to thiostrepton), allowing propagation in E. coli and selectable resistance to thiostrepton in Streptomyces. Ml3mpl0, mpll (Messing, 1983) mpl8, and mp19 (Yanisch-Perron et al., 1985) were used for cloning and preparation of single-strand DNA templates for sequencing. DNA Isolation

and Cloning Manipulations

Streptomyces total DNA was prepared as described by Hintermann et al. (198 1). Plasmid DNA from Streptomyces was isolated by alkaline lysis (Hopwood et al., 1985) and from E. coli by a cleared lysate or rapid boiling method (Maniatis et al., 1982). Digestion with restriction enzymes, ligation, and transformation of E. coli and Streptomyces were performed as described by Maniatis et al. (1982) and Hopwood et al. (1985). Size markers in agarose gel electrophoresis of restriction fragments were X DNA digested with Hind111 or a I-kb ladder from BRL. Southern Blot Analysis DNA fragments were labeled by nick-translation (Rigby et al., 1977) using [a-32P]dCTP

p!%MZ INTEGRATION

61

IN Streptomyces

TABLE I STREPTOMYCES Stock

S. ambofaciens ATCC23877 and derivatives S. ambofaciens DSM40697 and derivatives S. lividans 66 derivatives Other Streptomyces strains S. actuosus S. antibioticus S. bikiniensis S. coelicolor A3(2) S. glaucescens S. griseofuscus S. parvulus

Genetic

designation

marker

Bl B2 B3 A OS323 OS74 TIC24 OS301

str-I str-6 str-6

str-I

STRAINS pSAM2 or derivative status

Origin

int int int + free int pOS7 int int

ATCC23877 ATCC15154 JI stock No. 32 12 DSM40697 Boccard et al. (1988) Simonet et al. (1987) Hopwood et al. (1983) Boccard et al. (1988)

-

ATCC2542 1 DSM40868 ATCCl1062 Hopwood et al. ( 1985) ETH22794 DSM40191 JI stock No. 2283

Note. ATCC, American Type Culture Collection; DSM, Deutsche Sammlung von Mikroorganismen; Institute, Norwich, England.

and enzymes from Amersham. Synthetic oligonucleotides were labeled using [y-32P]ATP from Ametsham and T4 polynucleotide kinase from Boehringer. Southern hybridization using Hybond-N filters was performed as described previously (Boccard et al., 1988). Filters derived from Southern hybridizations using the 40-mer oligonucleotide probe were finallywashedat53”CinO.lXSSC,O.l%SDS.

JI, John Innes

RESULTS

Sequence Analysis of the pSAM2 Plasmid and S. ambofaciens Strain A and S. lividans Chromosomal DNA Fragments Involved in pSAM2 Integration

In a previous paper (Boccard et al., 1988), we localized the S. ambofaciens strain A and S. lividans chromosomal integration sites of pSAM2 in the 450-bp BarnHI fragment of pOS239 (pBR329 with the 6-kb PstI fragment containing the integration zone of S. amboDNA Sequencing faciens strain A) and in the 850-bp NruI-KpnI DNA sequences .were determined by the fragment of the plasmid pQS229 (pUC 12 with chain termination procedure (Sanger et al., the 7.5kb PstI fragment containing the inte1977) with modifications according to Biggin gration zone of S. lividans), respectively. As et al. (1983). A sequencing kit and [LY- the plasmid integration site of pSAM2 is con35S]dATP were obtained from Amersham. tained within the 430-bp BamHI-BglII fmgUniversal primer or synthetic oligonucleotides ment (Simonet et al., 1987), we deduced that were used as primers. Double-stranded DNA the junction regions of the integrated form of (0.5 pmol), after denaturation in sodium hy- pSAM2 and flanking chromosomal DNA sedroxide, was used as the template for direct quences were located within the 630-bp NruIsequencing of plasmid DNA (Chen and See- BamHI and the 650-bp BgfiI-KpnI fragments burg, 1985) with appropriate oligonucleotides of plasmid pOS22 1 (pBR329 with the 18.5-kb as primers. PstI fragment containing pSAM2 integrated

62

BDCCARD ET AL. Bglll I

P

Nrd

. Sau3A

BamHI 1

NruI L z--

BamHI

BgllI

Sau3A ’

Sau3A '

Sau3A

KpnI I B liv.

KpnI R

L23-u ICJObp

-r: BamHl

BalDHI

Sac1 BamHI B amb.

-

c-1

1. DNA sequencing strategy. I3 [iv. and B amb. indicate respectively the S. lividans and S. ambofaciens strain A chromosomal integration zones. P, R, and L rep resent respectively the plasmid integration zone and the right and left junctions. While boxes represent pSAM2 sequences; black boxes, S. lividans chromosomal sequences; dotted boxes, S. ambofaciens chromosomal sequences; and hatched boxes, ctt sites. Horizontal arrows indicate sequenced DNA fragments and asterisks represent positions of oligonucleotides used as primers. FIG.

attB

and the flanking chromosomal DNA sequences of S. lividuns). The sequencing strategy is presented in Fig. 1. The nucleotide sequence is shown in Fig. 2. DNA sequence analysis of these fragments revealed an imperfectly conserved 58-bp sequence (with two changes) at both the pSAM2 and the S. lividam chromosomal integration sites (Fig. 2). The nucleotide sequence of the junction regions of the integrated plasmid and flanking chromosomal fragments indicate that integration of pSAM2 in the S. lividans genome occurred via a site-specific recombination event within the rightmost 49 bp of the 58-bp sequence. Comparison of the sequence of the S. ambofaciens strain A integration zone with that of the pSAM2 integration zone revealed

liv.

TCGCGACGCCGCCGCCCAGGAACGCGCGGTACGCTCTCCGGGTGCTGTTCCTCTACGACGGCGCG +210 TGCGGCATCCATCGCATCCCTGGGCCAACTATCAGCACCGGTTCCCGCGTGGCACACGCTT +149 TCACCGTCCGACCTGCCGCGGTGAAGGTGAGTGGGAGACACCCCAGCCACGTGCAGAGTGT+ 88 --+*--dp CCTGGT +27 CCCCTGCCCCCGGAACCACTCAGGGGCCCGACCGCTAAGCGGATCAGGCCCCT 0 -20 +20

.*

I

I

I

ACTTCTCTGTCGGGGTGGCGGGATTTGAACCCACGACCTCTTCGTCCCG

RPJCGAAGCGCGC

TACCAAGCTGCGCCACACCCCGATTGTCGCTGCTCGTCGCGGCGACGTCGTTTACTTTAGC

attP

- 34 - g5

--

AGATAGACACGCACAGAAAACAGGTGAGGCAGACCGTAACGTTACGGTCTGCCT -20

9

CCTG

+29

I

GGGTGGGCGCTCGACCTTGGGCCAGTGTGCTTCTCACCTGCGGCGCCAGTCCATGGGTGC

attB

-91

a&.

CGGCCTCGGTCCC TCGGTCGATGCAACAGTGTCGGCCGGACTCGCTGTTCCCCGGCCGTGGCTGCACGAGTTCC CCCCGTGACCGAGGAGGTCCGCCGGAAACGGATCCGGCCCGGGAACCGCAGCCACGC~GG -ATGGACACGCAGACGAAAACAGGTCCCCCTGCCTACTCACATGAGTAGGCAGGGG 4c CCTG 0 +20 -20

GCTACCAAGCTGCGCCACACCCCGATTGTCGCTGCTCGTCGCGGCGACGTCGTCTACTTTA

+212 +lsl + 90 + 29

- g3

2. DNA sequence of pSAM2 attachment regions. The similar core regions are boxed. The central nucleotide of the potential crossover region was chosen as position 0. The sequences of attL and attR can be generated by the appropriate combination of arms from attP and attB. Arrows above the sequences repremnt the inverted repeats. Asterisks indicate the two nucleotide changes in attB of S. lividans. FIG.

pSAM2 INTEGRATION

the same 58bp similarity. This indicates that integration of pSAM2 in S. umbofuciensstrain A could occur within the 58 bp and probably within the common 49 bp. Although we ignored the exact extent of DNA sequence required for site-specific integration of pSAM2, we named the conserved 58-bp sequences attP (pSAMZ), atfB (chromosomes), and atfL and uttR (left and right junctions, respectively). The 58bp uttP sequence was overlapped by a 40-bp palindromic sequence which could be a transcriptional terminator for the int gene required for the pSAM2 integration (Boccard et al., 1989). The S. lividuns chromosomal integration zone harbored an imperfect 2 1-bp inverted repeat which overlapped the uttB site by 7 bp, and this inverted repeat was located at a position similar to that of the 40-bp palindromic sequence in pSAM2. In a similar way, a perfect 20-bp inverted repeat overlapped the S. umbofuciensstrain A uttB sequence by 5 bp (Fig. 2 and see below).

Comparison of the pSAA42utt Site with Those of Similar Integrated Elements among Actinomycetes The attachment site of pSAM2, like that of analogous plasmid sequences, was about 50 bp long. In both pMEA 100 of IV.mediterrunei and pSE 10 1 of Succhuropolysporuerythrueu, plasmid integration involved recombination within a 47-bp sequence shared by the relevent uttP and uttB sites. The core sequence common to pLI408 and S. lividuns (R. Htitter, personal communication) was 35 bp long, whereas the leftmost 50 bp of the SLPI uttB site was sufficient for integration (Lee et al., 1988). The different utt sites contained DNA sequences partially similar (Fig. 3). Madon et al. (1987) compared the 47-bp utt sequence of the plasmid pMEA 100 and the 112-bp utt sequence of the SLP 1 element and proposed that a 5’ TCGAA 3’ sequence surrounded by an inverted repeat of 5 bp could be the region where the recombination event takes place. In the case of pSAM2, one region with some

IN Streptomyces

63

similarity with the potential crossover regions of the pMEAlO0 and SLPl utt sequences could be the crossover region. This region (5’ TTGAA 3’), surrounded by an imperfect 9-bp inverted repeat (Fig. 3), contained six A or T residues among seven nucleotides, whereas the utt sequence of pSAM2 was 60% (G + C)-rich. The pSAM2 utt sites were numbered, with bp 0 assigned to the midpoint of that potential crossover region. Another region of the pSAM2 utt sequence shows similarity with other utt sequences. The 7-bp sequence (5’ ACGACCT 3’) (underlined in Fig. 3) was also present in the pW408 utt site (R. Hiitter, personal communication). A 6-bp, sequence (5’ CGACCT 3’) was also found in the pMEA 100 site and at a similar position relative to the potential crossover region, whereas the 6-bp sequence (5’ ACGACC 3’) is found at another position in the SLPl site. There may be no requirement for this similar sequence in uttB since sequences missing this region can function asuttB in SLPl integration (Lee et al., 1988).

S. lividuns and S. umbofaciens Strain A Total DNAs Contain Only One Primary Integration Sitefor pSAM2 Integration of pSAM2 in S. lividuns occurred at a unique chromosomal region, att of

pMEAlO0

ACGGTGGCCAGGGCCGGG

CG -*&CCGCTTTTCAGG

att of SLPl CGGCTCAGCCTTCCCAGG -Q~%ZCGKGCCAC~GA CG

att of pSAMZ

Frc;. 3. SimiIarities betweenthe differentatt sequences of integrated actinomycetes elements. Alignment of the SLPI (Omer and Cohen, 1986), pMEAlO0 (Madon et al., 1987) and pSAM2 utt sites. Presumed crossover regions are boxed, whereas other similar sequences are underlined. Arrow indicate the inverted repeats. The SLPl sequence starts at residue 18 and ends at residue 64. The pSAM2 sequence starts at residue +2 1.

64

F3OCCARD ET AL.

whereas in S. ambofaciens strain A, integration occurred at several places. To determine the number of potential integration sites in these strains, hybridization using end-labeled oligonucleotides corresponding to 40 bp (from nucleotide +2 1 to nucleotide - 18) of the 58 bp of the att site was performed. Results are presented in Fig. 4. A unique 7.5-kb PstI fragment was detected in S. lividans TK24 (lane 1) and a unique hybridizing 18.5-kb PstI fragment corresponding to integrated pSAM2 was observed in OS301 (S. lividans with pSAM2 integrated, Boccard et al., 1988) (lane 2). This indicated that S. lividans contained only one att site (attB) where the integration event of pSAM2 could take place. In S. ambofaciens strain A, there was in addition to the expected 6-kb PstI fragment, where one integration event of pSAM2 occurred (Boccard et al., 1988), a 0.8-kb PstI fragment that hybridized faintly (Lane 3). In OS323 (strain A with several copies of pSAM2 integrated, Boccard et al.,

-23.1 -

94

-

6.5

-4.3

-

2.3 2.0

1988) (lane 4) and in OS74 (strain A bearing only one integrated copy of pOS7; pOS7 is a derivative of pSAM2, has the same size, and does not contain any PstI sites, Simonet et al., 1987) (lane 5), a 17-kb PstI fragment corresponding to the integrated sequences of pSAM2 or pOS7 was seen, as well as the 0.8kb PstI fragment, This indicates that S. ambofaciens strain A contained, in addition to the functional attB site similar to that of S. lividans, sequences hybridizing with the 40mer oligonucleotide where pSAM2 integration did not occur. Further Southern hybridizations of OS323 total DNA digested by various restriction enzymes, using the 40-mer oligonucleotide as a probe, suggested that the additional integration event(s) did not occur through the plasmid integration site attP (data not shown). In S. ambofaciens strains Bl and B2 (Fig. 4, lanes 6 and 7, respectively), several hybridizing sequences were shown. A 15-kb Pstl fragment corresponding to the pSAM2 resident copy (Pemodet et al., 1984) was detected. The same 0.8-kb PstI faintly hybridizing fragment as that in strain A was seen, as well as a strongly hybridizing 5.5-kb PstI fragment. The 15-kb Pstl fragment contained the sequences attL and attR flanking pSAM2. attR contained the same 58 bp as attP, whereas attL harbored one change among the 58 bp (Boccard et al., 1989). The 5.5-kb PstI fragment contained an art sequence (attX) identical to attP. We have recently shown that DNA sequences located between pSAM2 and attX were 42 kb long and absent from S. ambofaciens strain A (Boccard et al., 1989).

-

A Highly Conserved Region Is Present Only on One Side of the attB Sequences FIG. 4. Southern hybridizations of ‘*P-labeled 40-mer oligonucleotide probe with MI-cleaved total DNA from: track 1, S. lividans TK24; track 2, S. liviah OS30 1; track 3, S. ambofaciens strain A; track 4, S. amhfkciens OS323; track 5, S. ambofaciens OS74; track 6, S. ambofaciens ATCC23877; track 7, S. ambojiiiens ATCC I5 154. The lengths (in kb) and positions of HindIII-cleaved X DNA fragments are indicated. The arrow indicates the position of the PsilO.8-kb hybridizing fragment.

Interestingly, a comparison of the DNA sequences of the two chromosomal integration zones indicated that similarity at only one side of the 58-bp sequence (Fig. 5) was responsible for the hybridization (Boccard et al., 1988). To con&-m this result, Southern hybridization was carried out using sequences located to the

65

pSAM2 INTEGRATION IN Streptomyces +272

+224

-

+74

-1

-76

-226

-301

-350

+123

+48

I

-

-102

I

......... ......... ......... ......... ......... ............................................... ......... ......... ......... ......... ............................................... ......... . . . . :F

II

-177

I

-252

-327

-402

I

I

:

:

-427

......

AA. .

I

... .................. ... I ... .... ... - ..................... .... .... ... .... - .......................... ..... ..... ..... ..... - ............................... ...... ...... ...... ...... - .................................... ....... ....... ......... I -+-----------------------------------------------

-27

I I’

-+-

f149

-151

+198

rl

: : ........................... AA ..... .AA. .... AA. .... .AA ..... ..DD ...................... DF. .FH.

..H

:

I ... ...

.... .HH. ..AA

... ................. A ... .DA. .. .AD. .. .AF. .. ..FH ............ DD .. .AD. .DH. .FF. ..AA ....... AD .D

. . . . .

I

FIG.5. DNA sequence simihity betweentheattB regionsof S. lividansand S. ambofaciens strainA. Similarity was determined using the matrix comparison method of Pustell (Pustell and Kafatos, 1982,1984). Twenty-one base segments of the two sequences were sequentially matched. The program displays the “percentage matching” in a matrix and the matrix is filled using a letter code TV represent each percentage matching (A, 100%; B, 99-9896; C, 97-96’S; . . . H, 87-8696). Similar sequences will lead to a diagonal army of letters. The x axis represent sequences from S. ambofaciens strain A (from nucleotide +224 to -350) and theyaxissequences from S.lividuns(from nucleotide +272 to -427). The boxed letters indicate the similarity due to the uttB sequences.

left of the S. ambofaciens strain A attB site as a probe. The 800-bp BamHI fragment adjacent to the 473-bp BamHI fragment containing the att site in pOS239 (pBR329 with a 6kb PstI fragment containing the integration zone, Boccard et al., 1988) was hybridized to total DNA of S. lividans and S. ambofaciens strain A. No hybridization was detected in S. lividans, whereas the probe hybridized to the 6-kb PstI fragment in S. ambofaciens total DNA (data not shown).

To explain the absence of similarity at one side of the attB sequences, at least four nonexclusive hypotheses can be proposed. First, the att site is located at the end of conserved DNA sequences (for instance, sequences encoding essential functions), and adjacent DNA sequences are not conserved between these strains, which are not closely related. Second, integration of a mobile genetic element in a conserved region containing the att site occurred in one of the strains, disrupting its con-

66

BOCCARD ET AL.

served region. Alternatively, the conserved regions correspond to one end of a mobile genetic element integrated into different regions among the two strains. Last, a deletion occurred in one strain and the end of the deletion is located in the conserved region. Comparison of the nucleotide sequence of the region located on the left of attB in S. ambufaciens strain A with the nucleotide sequence of the pSAM2 region containing attP revealed some similarity between these two sequences. This similarity was especially significant within the 3’ region of the pSAM2 integrase gene. This indicated that the region adjacent to the left of attB in S. ambofaciens strain A could contain a whole or part of a cryptic pSAMZrelated element (Boccard et al., 1989). This result is in agreement with the second hypothesis. Inspection of the DNA sequences in the conserved regions located on the right of attB allowed the detection of an ORF (ORF A), reading toward the att site, in both strains with a stop codon located 99 bp from the attB sites. -427

-367

-307

-247

-187

-127

There were only four bp changes between the two 99-bp sequences (96% identity). For this 99-bp region, S. lividans DNA contained 65 mol% GC residues and S. ambofaciens 68 mol% GC residues. The 470-bp BamHI fragment of S. ambofaciens strain A (Fig. 1) contained the last 74 residues of this ORF, whereas the NruI-KpnI fragment of S. lividans (Fig. 1) contained the last 100 residues (Fig. 6). The sequenced parts of the ORF A of S. lividans and S. ambofaciens contained 74 and 72.5% G and C residues, respectively, and these two sequences were 9 1% identical. Consistent with the high G + C content and the codon usage of Streptomyces genes (Bibb et al., 1984), 83 and 80% G and C residues were present at the first position of the codons, 44 and 40% at the second position, and 95 and 99% at the third position of the S. lividans and S. ambofaciens ORFs A, respectively. Comparison of the two predicted translated sequences revealed that, among 74 residues, 62 are identical, 7 represent conservative changes, and 5 are quite different (as defined in Argos et al., 1986). The

GGTACCGGTGGCCGCTG4XCTGGACTGGCTCCTCCTCACCCCCGCCGGCCGCCTGCACCT ValProValAlaAlaAlaLeuAspTrpLeuLeuLeuThrProAlaGlyArgLeuHisLe A C G CGCCAGGCGGGCCGCATGGCTCCTGTACCCCCTCGCCTACCTGGCCTTCACCCTGGCCCG uAlaArgArgAlaAlaTrpLeuLeuTyrProLeuAlaTyrLeuAlaPheThrLeuAlaAr C G AG G CGGCGAGCTGCTCCTCCCCGGCGCCCAGGACCGCTACCTCTACCCCTTCCTCGACGTCG& gGlyGluLeuLeuLeuProGlyAlaGlnAspArgTyrLeuTyrProPhe~~pVa1~ ThrGluGly

A As

C GG CCAGCACGGCTACAAGATCGTCCTCGGCAACGCCCTCCTCGTCGGCCTCGCCCTCTACGC aGlnHisGlyTyrLysIleValLeuGlyAsnAlaLeuLeuValGlyLe~a~uTyr~ LC!U P GUY A GGC CCTGGCCGTACTCCTCGTGCCTGGACCACATCCGCCCGCCG aLeuAlaValLeuLeuValAlaLeuAspHisIleArgProAspProVal~gArgProAIAm GlyLeu

cc Leu

G =a

G T C C ATAAACCGGATTTCGTCTCCGGCCACCGGTGGGC g***

FIG. 6. Nucleotide sequence and predicted translated sequence of the C-terminal part of the S. lividans ORF A. The sequence is shown in the S-3’ direction from nucleotide -427 to nucleotide -94. The amino acid sequence is shown in the three-letter code. Nucleotides above the nucleotide sequence indicate changes in the S. ambofaciens strain A sequence, whereas amino acid residues below the amino acid sequence indicate changes in the S. ambofaciens strain A translated ORE A. The sequence of S. ambofaciens starts at nucleotide -350.

pSAM2 INTEGRATION

inverted repeat located on the other side of the attB site could play the role of a transcriptional terminator for the ORF A.

Conservation of the att Region among StreptomycesSpecies To determine whether the att sequence was present, and in a conserved region, in a variety of Streptomycesspecies, the 40-mer oligonucleotide included in the att sequence and the 7.5kb PstI fragment containing the integration zone of S lividans were hybridized to total DNA of different Streptomyces.In all strains tested (S. lividans, S. bikiniensis, S. glauces-

tens, S. actuosus,S. coelicolor, S. antibioticus, and S. purvulus), the 40-mer oligonucleotide probe hybridized with at least one PstI fragment of total DNA (Fig. 7). When total DNA of the same strains was probed with the 7.5 kb PstI fragment of S. lividans, hybridization was detected in all strains and in each case, the two probes revealed an identical band. This suggests strongly that the att sequence was present in a similar region among distantly

123456789

FIG. 7. Southern hybridization of “P-labeled 40-mer oligonucleotide probe with Psrl-cleaved total DNA from: track 1, S. Iivihns OS30 1; track 2, S. lividans TK24; track 3, S. bikiniensis; track 4, S. glaucescens; track 5, S. actuosus; track 6, S. coelicolor; track 7, S. antibioticus: track 8, S. parvulus; track 9, S. ambojhciens strain A. Stars indicate common hybridizing fragments when the 7.5-kb Pstl fragment of S. lividans was used as a probe. The lengths (in kb) and positions of HindIII-cleaved X DNA fragments are indicated.

IN

Streptomyces

related strains and that the organization

67 ORF

A-att sequence could be conserved. Site-SpecificIntegration of a pSAiU2 Derivative in S. griseofusus Hybridization using the 40-mer oligonucleotide as a probe was detected in other Streptomycesspecies (data not shown), especially in the restrictionless strain S. griseofuscus (Cox and Baltz, 1984). To determine whether the potential integration site detected in that strain on a 4-kb BstEII hybridizing fragment was functional, protoplasts of S. grise0fLscu.s were transformed with the nonreplicative plasmid pD6B, a pSAM2 derivative containing pBR322 and the thiostrepton resistance gene (see Materials and Methods). Integration of pD6B in the att hybridizing sequence included in the 4-kb BstEII fragment should allow the detection of one 19-kb BstEII (no BstEII site in pD6B) hybridizing band in the transformants. Eight transformants were further analyzed. Southern hybridization of total DNA of these transformants, using pD6B as a probe, demonstrated the specific integration of pD6B in that strain (data not shown). The same integration pattern was obtained in all transformants. One 19-kb BstEII hybridizing fragment was detected. This indicates that pD6B could integrate within the att hybridizing sequence of S. griseofuscus. To demonstrate this hypothesis and determine the nucleotide sequence of the att sequence of S. griseofuscus,total DNA of one transformant was completely digested with BstEII, ligated, and used to transform E. coli. Analysis of plasmid DNA obtained from the E. coli transformants revealed that these plasmids were 19 kb long. The restriction pattern was the one expected from integration through the plasmid attP site. The att sequences flanking pD6B were directly sequenced using as primers oligonucleotides homologous to sequences adjacent to attP. Assuming that integration of pD6B in S. griseofuscusoccurred by mechanism identical to that of pSAM2 in S. lividans, i.e., by a recombination event within two att

68

BOCCARD ET AL.

att ----

-*

TGCCCCCGGAACCACTCAGGGGCCCGACCGCTAAGCGGATACCTGGTACTTCT

.

site an B liv

b+

ACGCAGACGAAAACAGGTCCCCCTGCCTACTCACATGAGTAGGCAG

aHB amb

attX

CGGCCCACACGA.C~~TCTC~

attB

GACACGCACAGAAMCAGGTGAGGCAGACCGTAACGTTACGGTCTGCCTCACCTGGTGTTTCT

att P attR

GCCCCAGAAACCCAGAAGGGGCCCGACCCGCAAAGCGGATCAGGCCCCT~ACCTGGTGTTTCi

attL

----

---

-

griseo

FK. 8. Nucleotide sequence in the S-3 direction of the pSAM2 aft regions. The leftmost 13 bp of the att sequences are boxed. Asterisks indicate the nucleotide changes among the 58 bp. Arrows above the sequences represent the inverted repeats. atrB liv, atrB amb, and affB griseo indicate the atfB sequences of S. lividans. S. ambof2ciens strain A, and S. griseofiscus, respectively. The rightmost 45 bp of affB g&o are identical to that of uffP and are not indicated.

sequences present on the plasmid and the chromosomal genomes, the nucleotide sequence of the att sequences flanking pD6B allowed prediction of the sequence of the att region of S. gr~.seofuscus. The predicted nucleotide sequence of that region, presented in Fig. 8, contains 57 bp of the 58 bp of the att sequence and this sequence is identical to that of attL in S. ambofaciens strain Bl (Boccard et al., 1989). The nucleotide change is located at position +2 1 and this indicated that the integration event occurred within the 45 rightmost bp of the att sequence. A 19-bp imperfect inverted repeat is located at a position similar to those of the attB sequences from S. lividans and S. umbofuciens strain A.

ambofaciensstrain A contains another utt hy-

bridizing sequence which does not appear to function as an attB sequence. Comparison of the plasmid attP site, of three chromosomal attB sites, and of the three att sites of S. ambofaciens strain Bl revealed that, in every case, an inverted repeat of about 20 bp was found overlapping the att site. It is noteworthy that the nucleotide sequence of the inverted repeats overlapping the utt sites is not conserved, whereas structural organization is conserved (Fig. 8). Analysis of two chromosomal integration zones allowed us to show that integration of pSAM2 took place in the vicinity of sequences related to pSAM2 in S. ambofaciens strain A and downstream of an ORF conserved between S. lividuns and S. ambofuciens strain DISCUSSION A. It is not yet known whether inverted repeats The integration of pSAM2 into the S. liviadjacent to the attB sites could be transcripdans chromosome is site-specific and the re- tional terminators of ORF A and whether combination event occurs within a 49-bp se- transcription of this region is necessary for the quence included in the pSAM2 att sequence. pSAM2 integration. It is noteworthy that seThere is only one primary functional attB site quences located between the stop codons of in S. lividans. The integrated copy in 5’. livi- ORF A and the inverted repeats are more condam was able to be transferred and to rein- served that the sequences encoding the ORF tegrate very efficiently in S. lividans (Boccard A. This high degree of similarity for sequences et al., 1988), indicating that site-specific ex- presumed to be noncoding is surprising and cision of pSAM2 could occur within the two could reflect a selection pressure. att sequences flanking integrated pSAM2. In The integration site of pSAM2 is partially S. ambofaciensstrain A, the region where one similar to those of other integrated elements copy of pSAM2 integrated contains a 58-bp among actinomycetes. One sequence, proidentity with pSAM2 (the att sequence). S. posed as the crossover region, contains six A

pSAM2 INTEGRATION

or T residues among seven nucleotides. It is surrounded by an inverted repeat and shares similarity with the potential crossover regions of pMEA100 and SLPI . Regions of dyad symmetry are found in numerous attachment sites and in several cases (bacteriophages X and Pl, yeast plasmid 2 j.~), these sequences serve as binding sites for the site-specific recombinases (Ross and Landy, 1983; Hoess and Abremski, 1984; Andrews et al., 1985). We recently showed that integration of pSAM2 was promoted by a site-specific recombinase of the integrase family, suggesting that the predicted pSAM2 integrase could recognize the inverted repeats surrounding the potential crossover region. Another region of 7 bp of the pSAM2 att site is found at equivalent positions relative to the potential crossover regions in the pMEA100 and pIJ408 att sites. The degree of similarity found between the different att sites was not expected since most of temperate bacteriophages of E. coli, although they have analogous integration systems (Argos et al., 1986) do not share attachment specificities (Landy and Ross, 1977; Hoess et al., 1982; Leong et al., 1985; Pierson and Kahn, 1987). The region containing the att sequence, as well as the att sequences themselves, is conserved among Streptomyces species. In addition, site-specific integration of a pSAM2 derivative was demonstrated in S. griseofuscus, suggesting that pSAM2 could be a wide-hostrange integrative element. Further experiments will be required to determine the minimal extent of attB activity as well as the reasons for the conservation of that region among Streptomyces. ACKNOWLEDGMENTS We thank D. Hopwood for the kind gilt of strains and R. Htltter and S. Lee for communicating results before publication. This work was supported by Research Contact BAP-O268-F (CD) of the Commission of the European Communities and by RhBne-Poulenc Sante. F.B. received a doctoral fellowship from the Minis&e de la Recherche et de I’Enseignement Sup&ieur.

IN Streptomyces

69

REFERENCES ANDREWS, B. J., PROTEAU, G. A., BEATTY, L. G., AND SADOWSKI, P. D. (1985). The FLP recombinase of the 2g circle DNA of yeast: Interaction with its target sequences. Cell 40,795-803. ARGO& P., LANDY, A., ABREMSKI, K., SAN, J. B., HAGGARDLJUNCQUIST, E., HOES.% R. H., KAHN, M. L., KALIONIS, B., NARAYANA, S. V. L., PIERSON,L. S., III, STERNBERG,N., AND LEONG, J. (1986). The integrase family of site-specuic recombinasea: Regional simihuities and global diversity. EMBO J. 5,433-440. BIBB, M. J., WARD, J. M., KIESER, T., COHEN, S. N., AND HOPWOOD, D. A. (198 1). Excision of chromosomal DNA sequences from Streptomyces coelicolor forms a novel family of plasmids detectable in Streptomyces lividans. Mol. Gen. Genet. 184,230-240. BILIB, M. J., FINLXAY, P. R., AND JOHNSON,M. W. (1984). The relationship between base composition and codon usage in bacterial genes and its use in the simple and reliable identitication of protein coding sequences.Gene 30, 157-166. BIGGIN, M. D., GIBSON, T. J., ANLI HONG, G. F. ( 1983). Buffer gradieut gels and “!I label as an aid to rapid DNA sequence determination. Proc. Natl. Acad. Sci. USA 80, 3963-3965. BOCCARD,

F., PERNoDET, J-L., FRIEDMANN, A., AND GLJ&INEALJ, M. (1988). Site-specific integration of plasmid pSAM2 in Streptomwes lividans and S. ambofaciem. Mol. Gen. Genet. 212,432-439. BOCCARD, F., SMOKMNA, T., PERNODET, J-L., FRIED MANN, A., AND GUI%INEAU, M. (1989). The integrated conjugative plasmid pSAM2 of Streptomyces ambofaciens is related to temperate bacteriophages. EMBO J., in press. BOYER, H. W., AND ROULLANDDU~~O~X, D. (1969). A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41, 459-411.

BROWN, D. P., CHIANG, S-J. D., TUAN, J. S., AND KATZ, L. (1988). sitsspec&c integration in Saccharopolyspora erythraea and multisite integration in Streptomyces liviakns of actinomycete plasmid pSE 10 1.J. Back& 170, 22872295.

(ZHATER, K. F., HENDERSON, D. J., BIBB, M. J., AND HOPWOOD, D. A. (1988). In “43th Symposium of the Society of the General Microbiology” (A. M. Kingsman, K. F. Chater, and S. M. Kingsman, Eds.) pp. l-42. Cambridge Univ. Press, Cambridge. CHEN, E. Y., AND SEEBURG,P. H. (1985). Supercoil sequencing: A fast and simple method for sequencing plasmid DNA. DNA 4, 165-170. Cox, K. L., AND BALTZ, R. H. ( 1984). Restriction of bacteriophage plaque formation in Streptomyces spp. J. Bacterial. 159,499-5&I. HINTERMANN, G., CRAMERI, R., KIESER, T., AND HOTTER, R. ( 198 1). Restriction analysis of the Streptomyces

70

BGCCARD ET AL.

glaucescensgenome by agarose 8el electrophoresis. Arch. Microbial. 130,2 18-222. HOESS, R. H., AND ABREMSKI, K. ( 1984). Interaction of the bacteriophage Pl recombinase Cre with the recombining site IoxP. Proc. Natl. Acad. Sci. USA 81, 10261029. HOESS,R. H., ZIESE, M., AND STERNBERG,N. ( 1982). Pl site-specific recombination: Nucleotide sequence of the recombing sites.Proc. NatI. Acad. Sci. USA 79,33983402.

HOP~OOD, D. A., KBER, T., WRIGHT, H. M., AND BIBB, M. J. (1983). Plasmids, recombination and chromosome mappin in Strtptomyces lividarts 66. J. Gen. Microbial. 129,2252269. HOP~OOD, D. A., HINTERMANN, G., KIESER, T., AND WRIGHT, H. M. (1984). Integrated DNA sequences in three Streptomycetes form related autonomous plasmids after transfer to Streptomyces lividans. Plasmid 11, l16. HOPWOOD, D. A., BIBB, M. J., CHATER, K. F., KIESER, T., BRUTON, C. J., KIESER, H. M., LYLXATE, D. J., SMITH, C. P., WARD, J. M., AND !~CHREMPF,H. ( 1985) “Genetic Manipulation of Streptomyces: A Laboratory Manual.” John Innes Foundation, Norwich. HOP~OOD, D. A., KIESER, T., LYDIATE, D. J., AND BIBB, M. J. ( 1986). In “The Ba&ria, IX Antibioticproducin8 Streptomyces” (S. W. Quenner, and L. E. Day, Eds.), pp. 159-229. Academic Preq London. LANDY, A., AND ROSS,W. (1977). Viral integration and excision: Structure of the lambda att sites. Science 197, 1147-l 152. LEE, S. C., OMER, C. A., BRASCH, M. A., AND COHEN, S. N. (1988). Analysis of recombination occurring at SLPl att sites. J. Bacterial., 170, 5806-5813. LEONG, J. M., NUNES-DOBY, S. E., LESSER,C. F., YOUDERIAN, P., SUSSKIND,M. M., AND LANDY, A. ( 1985). The 480 and P22 attachment sites. J. Biol. Chem. 260, 4468-4471.

MADON, J., MORES, P., AND HOTTER, R. ( 1987). Sitespecific integration and excision of pMEAlO0 in Nocardia meditmanei. Mol. Gen. Genet. 2#9,251-264. MANIATIS, T., ERITSCH, E. F., AND SAMBROOK, J. ( 1982) “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. MESSING, J. (1983). New Ml 3 vectors for cloning. In “Methods in Enzymology” (R. Wu, L. Grossman, and K. Moldave, Eds.), Vol. 101, pp. 20-78. Academic Press, New York. ME.SSING,J., CREA, R., AND SEEBURG, P. H. (1981). A systemfor shotgun DNA sequencing. Nucleic Acids Res. 9,309-321. MOREI-II, P., m,

G., AND Hth-tq R. (1985). Isolation and characterization of an extrachromosomal element from Nocardia mediterranei. Plasmid 14,126133.

OMEX, C. A., AM) COHEN,S. N. ( 1984). Plasmid formation in Streptomyces: Excision and integration of the SLP 1 replicon at a speciftcchromosomal site. Mol. Gen. Genet. I%, OMER,

429-438.

C. A., AND COHEN, S. N. (1986). Structural analysis of plasmid and chromosomal loci involved in site-specitic excision and integration of the SLPl element of Streptomyces coelicolor. J. Bacterial. l&9991006. PERNODET, J-L., SIMONET, J-M., AND GUI%NEAU, M. (1984). Plasmids in dilferent strains of Streptomyces ambofaiens: Free and integrated forms of plasmid pSAM2. Mol. Gen. Genet. 198,35-41. PIERSON,L. S., AND KAHN, M. L. (1987). Integration of satellite bacteriophage P4 in Escherichia coli. J. Mol. Biol. l%, 487-496. PRIDHAM, T. G., ANDERSON,P., FOLEY, C., LINDENFEL SER,L. A., HESSELTINE,C. W., AND BENETDICT, R. C. (1957). A selection of media for maintenance and taxonomic study of Streptomyces. “Antibiotics Annual 1956-1957,” pp. 947-953. FW-TELL,

J., AND KAFATOS,

F. C. (1982).

A high speed,

high capacity homology matrix: Zooming through SV40 and polyoma. Nucleic Acids Res. 10,4765-4782. PUSTELL, J., AND KAFATOS, F. C. (1984). A convenient and adaptable package of computer programs for DNA and protein sequence management, analysis and homology determination. Nucleic Acids Res. 1% 643-656. RIGBY, P. W. J., DIECKMANN, M., RHODES, C., AND BERG,P. (1977). Labellin8 deoxyribonucleic acid to high specific activity in vitro by nick-translation with DNA polymerase I. J. Mol. Biol. 113, 237-25 1. Ross, W., AND LANDY, A. (1983) Patterns of X Int reo ognition in the regions of strand exchange. Cell 33,26 l272.

SANGER., F., NICKLEN, S., AND COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74,5463-5467. SIMONET, J-M., EWCARD, F., PERNODET, J-L., GAGNAT, J., AND GUI%NEAU, M. (1987). Excision and integra-

tion of a self-transmissible replicon of Streptomyces ambofaciens. Gene 59, 137-144. SMOKVINA,

T., FRANCOU,

F., AND LUZZNI,

M. (1988).

Genetic analysis in Streptomyces ambofaciens. J. Gen. Microbial. 134, 395-402. THOMPSON, C. J., WARD, M. J., AND HOPWOOD, D. A. (1980). DNA cloning in Streptomyces: Resistance genes from antibioti~producing species.Nature (London) 286, 525-527.

YANISCH-PERRON,C., VIEIRA, J., AND -lNG, J. (1985). Improved M 13 phage cloning vectors and host strains: Nucleotide sequences of the Ml3mpl8 and pUCl9 vectors.

Gene 33, 103-l

19.

Communicated by David A. Hopwood