Structural and functional analysis of PUR2,5 gene encoding bifunctional enzyme of de novo purine biosynthesis in Ogataea (Hansenula) polymorpha CBS 4732T

Microbiological Research 169 (2014) 378–387

Contents lists available at ScienceDirect

Microbiological Research journal homepage: www.elsevier.com/locate/micres

Structural and functional analysis of PUR2,5 gene encoding bifunctional enzyme of de novo purine biosynthesis in Ogataea (Hansenula) polymorpha CBS 4732T Anton Stoyanov, Penka Petrova, Dimitrinka Lyutskanova, Kantcho Lahtchev ∗ The Stefan Angeloff Institute of Microbiology, Bulgarian Academy of Sciences, Sofia, Bulgaria

a r t i c l e

i n f o

Article history: Received 12 March 2013 Received in revised form 22 August 2013 Accepted 28 August 2013 Available online 25 September 2013 Keywords: Purine biosynthesis Ogataea (Hansenula) polymorpha Bifunctional enzyme

a b s t r a c t We describe the cloning, sequencing and functional characterization of gene PUR2,5, involved in de novo purine biosynthesis of the yeast Ogataea (Hansenula) polymorpha. This gene (2369 bp) was cloned by genetic complementation of adenine requiring mutation. It encodes a bifunctional enzyme of 789 amino acids (85 kDa) that catalyzes the second and the fifth steps of de novo purine biosynthesis pathway and shows dual enzymatic activity – of glycinamide ribotide synthetase (GARS, EC 6.3.4.13) and of aminoimidazole ribotide synthetase (AIRS, EC 6.3.3.1). Nucleotide sequence analysis revealed the presence of putative regulatory elements located in the adjacent 5 region. Canonical motives that function as binding sites for BAS1 transcription activator were found at positions (−593) and (−389). The putative TAATTAbox was located at (−20) to (−14) and AT-rich heteroduplex was found in the 3 -non-translated region. We compared the amino acid sequence of OpPUR2,5p with those of the corresponding enzymes of other yeast species as well as with distant organisms like bacteria Escherichia coli and human Homo sapiens. A successful disruption of OpPUR2,5 gene was done. It was found that OpPUR2,5::LEU2 replacement affects both mating and sporulation processes. OpPUR2,5 sequence is deposited in the GenBank of NCBI with accession no. JF967633. © 2013 Elsevier GmbH. All rights reserved.

1. Introduction Purines are key compounds in all living cells. They are structural components of genetic material and are the main carriers of cellular energy. Besides their role as phosphate donors, the purine nucleotides participate in the cellular signaling pathways and serve as cofactors in numerous enzymatic reactions (Cory 2006). Most organisms use either de novo purine nucleotide biosynthesis or purine salvage pathways, allowing generation of DNA and RNA in the presence or absence of external purine sources. The de novo purine biosynthesis pathway is conservative in almost all organisms and includes 10 enzymatic steps, resulting in the synthesis of inosine monophosphate (Fig. 1). It is followed by splitting into two paths to produce either adenosine monophosphate or guanosine monophosphate (Henikoff 1987). Genes involved in de novo and salvage purine pathways are investigated in details in prokaryotes (Neuhard and Nygaard 1987) and eukaryotes (Rolfes 2006) and remain a subject of extended studies. Bacterial enzymes, involved

∗ Corresponding author at: The Stefan Angeloff Institute of Microbiology, Bulgarian Academy of Sciences, Acad. G. Bontchev Str. bl. 26, 1113 Sofia, Bulgaria. Tel.: +359 2 979 31 79; fax: +359 2 87 00 109. E-mail address: [email protected] (K. Lahtchev). 0944-5013/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.micres.2013.08.008

in the de novo purine synthesis usually catalyze one distinct step of the pathway. In contrast, many of their eukaryotic orthologs are multifunctional enzymes, consisting of several domains with a particular activity (Henikoff 1987; Zalkin and Dixon 1992). The existence of such multifunctional genes in eukaryotes maybe due to several related functions: (i) the proximity of two enzyme domains in a single polypeptide gives the possibility for substrate channeling; (ii) in this way the enzymes could be expressed stoichiometrically (Henikoff 1987); and (iii) thus the expression of the different purine genes is probably facilitated and coordinated. The recent interest in purine pathway is raised by the fact that it is considered as an important target for anticancer (GalloisMontbrun et al. 2004; Cappellacci et al. 2008), antiviral (Van Rompay et al. 2003; Williams et al. 2012) and antimicrobial drug development (Kim et al. 2009; Dinesh et al. 2012; Vitali et al. 2012). Genetic mechanisms involved in human diseases caused by purine deprivation can be clarified by using baker yeast, as a model system (Guetsova et al. 1997). Saccharomyces cerevisiae is used as a powerful tool for such studies (Rébora et al. 2001). All 10 purine genes were sequenced and characterized (Jones and Fink 1982; Tibbetts and Appling 1997) and yeast strains containing their deletion variants were used for drugs testing (Kowalski et al. 2008). The study of de novo purine synthesis pathway revealed that the genes

A. Stoyanov et al. / Microbiological Research 169 (2014) 378–387

379

Fig. 1. Ten consecutive steps of the de novo purine biosynthetic pathway. Abbreviations of the enzyme names and the number of the catalyzed step: PPAT – glutamine phosphoribosyl-pyrophosphate amidotransferase (1); GARS – glycinamide ribotide synthase (2); GART – glycinamide ribotide transformylase (3); FGAMS – formylglycinamide synthase (4); AIRS – aminoimidazole ribotide synthase (5); CAIRS – aminoimidazole ribotide carboxylase (6); SAICARS – succinylaminoimidazolecarboxamide ribotide synthase (7); ASL – adenylosuccinate lyase (8); AICART – aminoimidazole carboxamide ribotide transformylase (9); IMPCH – inosine monophosphate cyclohydrolase (10); (http://themedicalbiochemistrypage.org).

involved differ in their regulation among various yeast species and need additional investigation (Zalkin and Dixon 1992). The methylotrophic yeast Ogataea (Hansenula) polymorpha is attractive because of its ability to utilize methanol as a sole carbon and energy source (Van Zutphen et al. 2010) and it’s remarkable heat tolerance (Ischuk et al. 2009). Furthermore, it is the preferred host for industrial production of foreign proteins such as enzymes and vaccines (Gellissen 2000; Gellissen et al. 2005; Kang and Gellisen 2005). However, very few data about the genes responsible for purine biosynthesis of this organism have been reported so far. Gene PUR7 was cloned and used as a selectable marker for target chromosomal integration (Haan et al. 2002). Putative PUR8 gene encoding adenylosuccinate lyase (EC 4.3.2.2) was cloned incidentally by the same authors. Both PUR7 and PUR8 showed a low level of homology with the similar proteins of other yeast species, indicating that purine pathway in O. polymorpha has probably a different organization and regulation. Nucleotide sequences of several PUR2,5 genes were determined by annotation of full genomes sequences of various yeast species, including O. polymorpha (Ramezani-Rad et al. 2003). However, the genome sequence of O. polymorpha CBS4732T is Reihn Biotech GmbH (Germany) property and is not available to the public. In addition, there is no systematic analysis of the nucleotide and protein structure of PUR2,5, as well as of its possible cellular functions. In our previous study we reported that a large collection of O. (Hansenula) polymorpha mutants with impaired purine biosynthetic pathway were isolated and the mutations were allocated into 11 genes (Lahtchev et al. 2002). Adenine-requiring mutants of a gene, preliminary designated as ade3-5, appeared with the highest frequency. This mutant was selected for further work because of its low reversion rates and good growth on rich YPD medium. The aim of the present work is to substitute the mutant allele by complementation, using genomic library of O. polymorpha and thus identifying this unknown gene. Here we report cloning of a DNA fragment, carrying PUR2,5 and its first detailed nucleotide sequence analysis. We compared the deduced PUR2,5 protein sequence with those reported for homologous enzymes. Additionally, the cellular functions of OpPUR2,5 were investigated and the data obtained,

revealed involvement of OpPUR2,5p in sexual developmental pathways. 2. Materials and methods 2.1. Strains and plasmids S. cerevisiae strain Y1058 (MATa pur2,5::KnR his3 leu2 met15 ura3) and plasmid pPUR2,5 CEN LEU2 were kindly provided by Dr. Daignan-Fornier, University of Bordeaux, France (Rébora et al. 2001). The isolation and construction of multiply marked strains, belonging to O. polymorpha CBS 4732T whose genetic breeding stock was previously described (Lahtchev et al. 2002). Auxotrophic mutations arg1-11, ade1-37, ade2-88, ade3-5, leu2-2, ura3-11, met22 and met4-220 require arginine, adenine, leucine, uracil and methionine for growth, respectively. After identification of the mutant genes, the mutants were designated according to the number of steps of purine biosynthesis, catalyzed by the corresponding protein. Mutations designated previously as ade1-37 and ade2-88 are located in PUR6 and PUR7 genes, respectively. The original ade3-5 mutation was renamed pur2,55 and the allele, obtained by gene disruption, was designated as pur2,5::LEU2. Two sets of haploid strains carrying pur2,5-5 or pur2,5::LEU2 alleles together with complementary auxotrophic markers were used in experiments for studying copulation ability. The other set of diploid strains was used for determination of the sporulation capacity. The genotypes of the used haploids and diploids are listed in Table 1A. Escherichia coli strain DH5␣ [F− endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG 80dlacZM15 (lacZYA-argF) U169, hsdR17 (rK − mK + ), –] was used as a genetic library host and in cloning experiments. O. polymorpha genomic library was initially prepared by Prof. James Cregg (Keck Graduate Institute of Applied Life Sciences, USA) and kindly provided by Dr. Jan Kiel (Groningen University; The Netherlands). This library contains random chromosomal

380

A. Stoyanov et al. / Microbiological Research 169 (2014) 378–387

Table 1 Strains and plasmids used in this work. (A) Ogataea polymorpha (H. polymorpha) haploid and diploid strains and the corresponding genotypes. (B) Plasmids used in this study. Haploids

Diploids

Strain

Genotype

Strain

Genotype

(A) 12-M2

ura3-11 met2-2

DS1

11-A1

leu2-2 arg1-11

DS2

ADE3-A

DS3

7-6X

pur2,5(ade3-5)leu2-1 ura3-11 ade1-37 (pur6) ura3-11

DS4

15-8A

ade2-88 (pur7) ura3-11

DS5

25-M2

ura3-11 met2-2 pur2,5

DS6

5-Н25

ura3-11 pur2,5::LEU2

DS7

3-6X

ade1-37(pur6) leu2-2

DS8

2-8A

ade2-88(pur7) leu2-2

DS9

17-A1

leu2-2 arg1-11 pur2,5

DS10

5-M7

leu2-2 pur2,5::LEU2

DS11

7-A1

pur2,5

DS12

9-M7

pur2,5::LEU2

DS13

arg1-11 ARG1 met2-2 MET2 ura3-11 URA3 ura3-11 URA3 ura3-11 URA3 leu2-2 LEU2 leu2-2 LEU2 ura3 URA3 ura3 URA3 leu2-2 LEU2 leu2-2 LEU2 leu2-2 LEU2 leu2-2 LEU2

leu2-2 LEU2 ura3-11 URA3 met2-2 MET2 met2-2 MET2 met2MET2 pur6 pur6 pur7 pur7 met2-2 MET2 met2-2 MET2 pur6 PUR6 pur7 PUR7

URA3 ura3-11 PUR6 pur6 PUR7 pur7 PUR2,5 pur2,5 PUR2,5 pur2,5::LEU2 ura3-11 URA3 ura3-11 URA3 pur2,5 pur2,5 pur2,5::LEU2 pur2,5::LEU2 PUR2,5 pur2,5 PUR2,5 pur2,5 pur2,5 pur2,5::LEU2 pur2,5::LEU2 pur2,5

Plasmid

Markers

Source or reference

(B) pYT3 pYT3-ADE pJET1.2/blunt pJA pJAL pPUR2,5 CEN LEU2

AmpR, LEU2 AmpR, LEU2, PUR2,5 AmpR AmpR, PUR2,5 AmpR, LEU2 PUR2,5, LEU2

Tan et al. (1995) This study Thermo Scientific Inc. This study This study Rebora et al. (2001)

fragments, obtained by Sau3A partial digest and inserted into BamHI site of E. coli/yeast shuttle vector pYT3 (Tan et al. 1995) (Table 1B). The complementing plasmid pYT3-ADE was isolated from O. polymorpha strain and was sub-cloned in E. coli DH5␣ host.pJET1.2/blunt cloning vector (Thermo Fisher Scientific Inc., Waltham, USA) was used for cloning purposes. The plasmids, constructed and used in this work are listed at Table 1. 2.2. Media and cultivation conditions E. coli strain were cultured in Luria-Bertani (LB) medium (Scharlau Chemie S.A., Barcelona, Spain) with ampicillin (50 ␮g/ml) added, when required. For LB Plates 1.5% agar was used. Yeast strains were grown in the following media: YPD, containing 1% (w/v) yeast extract, 2% (w/v) peptone (Alfa Aesar GmbH&Co KG, Karlsruhe, Germany), and 2% (w/v) glucose; MIN (synthetic minimal medium): 0.67% yeast nitrogen base without amino acids (YNB, Alfa Aesar) and 2% (w/v) glucose); SC (synthetic complete medium) that is MIN medium, supplemented with arginine, adenine, leucine, uracil or methionine (Sigma–Aldrich Co., St. Luis, USA), added to a final concentration of 50 ␮g/ml; drop out media (SC-Leu, SCAde) that is SC medium, deficient in one of the amino acids or purine listed above. SPOMAL medium, containing 1% maltose (w/v) (Sigma–Aldrich) was used for induction of sporulation and mating competence of O. polymorpha strains. When it was needed, the media were solidified by addition of 2% agar (Oxoid, Thermo Fisher Scientific, Hampshire, UK). All strains were cultivated aerobically, with a vigorous shaking: E. coli and O. polymorpha strains at 37 ◦ C; whereas S. cerevisiae – at

MET2 met2-2 LEU2 leu2 LEU2 leu2-2 LEU2 leu2-2 LEU2 leu2-2

LEU2 leu2-2 URA3 ura3-11 URA3 ura3-11 URA3 ura3-11 URA3 ura3-11 URA3 ura3-11

ARG1 arg1

ARG1 arg1-11

MET2 met2-2 MET2 met2-2 MET2 met2-2 MET2 met2-2

30 ◦ C, The experiments for induction of sporulation or mating competence were performed at 27 ◦ C. 2.3. DNA isolations, sequencing and sequence analysis Total genomic DNA from yeasts was isolated using GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific Inc., Waltham, USA). Plasmid purifications were performed either by the maxipreparative alkaline procedure (Sambrook and Russel 2001) or by GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific Inc.). The inserts were sequenced by Macrogen Inc. (Amsterdam, The Netherlands) after a consecutive use of the primers Y1, Y2 and Y3 (Table 2). The sequence analysis was performed by the programs Chromas, CAP3 (http://genome.cs.mtu.edu/cap), BLASTX, BLASTN Table 2 List of primers used for sequencing or PCR amplification. Primer

Sequence (5 -3 )

Target region

YF YR YR2 YF3 AdeF AdeR LeuF LeuR

CAACAAGTATTCCAGGGGG CGGCCTTACGACGTAGTCG CATCTTGTCCTTCTTGGG GTGGCCAACATCAGTTCTA CAGAGAGGAGGCCGTTCGTACC GAGAATGGCAGTTACACTACAA GTTACAGGGACCCGAAGACCAGCTTGGAGACTACGGb GTTACAGGGACCCGAGCAGATCTGAGTGGGTGAGTA CGTAAGb

pYT3 – MCSa pYT3 – MCSa PUR2,5 PUR2,5 PUR2,5 PUR2,5 LEU LEU

a b

Multi-cloning sites sequence. The inserted sites recognized by SandI endonuclease are underlined.

A. Stoyanov et al. / Microbiological Research 169 (2014) 378–387

(Altschul et al. 1997) and ClustalW (Thompson et al. 1997). The nucleotide sequence was deposited in NCBI Gene Bank database under accession number JF967633. 2.4. Construction of PUR2,5 disruption cassette Genes PUR2,5 and LEU2 were obtained as PCR fragments using the primer pairs AdeF/AdeR and LeuF/LeuR (Table 2), purchased from Biomers.net GmbH, Ulm, Germany, and PCR mix of GeneAmp® High Fidelity PCR System (Applied Biosystems, CA, USA). The template in both cases was purified chromosomal DNA of O. polymorpha. The total volume of one PCR amplification mix was 50 ␮l, the final concentrations of the primers was 0.5 pmol/␮l, and of the template DNA – 2 ng/␮l. PCR was carried out in QB-96 Satellite Gradient thermal cycler (LKB Vertriebs GmbH, Vienna, Austria) under the following temperature profile: 3 min, 95 ◦ C; 45 cycles: 1 min, 94 ◦ C, 45 s, 68 ◦ C, 2 min, 72 ◦ C; final elongation 7 min at 72 ◦ C. The PCR amplified OpPUR2,5 gene was cloned in pJET 2.1/blunt vector (2974 bp), following the instructions of CloneJETTM PCR Cloning Kit (Thermo Fisher Scientific Inc., Waltham, USA) and this construct was denoted pJA. It was linearized by SanDI restriction enzyme digest and was treated with calf intestinal phosphatase (New England Biolabs, Massachusetts, USA) to remove 5 end phosphates. Then LEU2-PCR fragment, containing introduced SanDI restriction sites was inserted into OpPUR2,5 gene of pJA and the construct was named pJAL. After verification of its sequence, the 4028 bp disruption cassette was amplified by the primer pair AdeF/AdeR on the template pJAL (Table 2) and was used for transformation of the strain 11-A1 (leu2-2 arg1-11). Leu+ Ade− transformants were selected on minimal medium, supplemented with adenine and arginine. 2.5. E. coli and O. polymorpha transformations E. coli DH5␣ competent cells were prepared by TransformAidTM bacterial transformation kit (Thermo Fisher Scientific Inc.). O. polymorpha transformation was performed by electroporation according to the method of Faber et al. (1994), using 100 ␮l cell suspension, 0.2 mm cuvette and MicroPulser electroporator (Bio-Rad Laboratories Inc., Life Science Group, Hercules, CA, USA). In OpPUR2,5 gene cloning experiments, strain ADE3-A (pur2,5 leu2-1 ura3-11) and the genomic library described above were used. The transformed cells were plated onto synthetic complete media, deficient in leucine (SC-Leu) and grown for 5–7 days. More than 35,000 Leu+ colonies have been isolated and replica plated on synthetic adenine-lacking medium (SC-Ade). The Ade+ Leu+ Ura− transformants were identified and further characterized. 2.6. Other methods Classical genetic analysis of O. polymorpha strains was performed according to the methods described by Gleeson and Sudbery (1988) and Lahtchev et al. (2002). The mating was assayed by auxotrophic marker complementations, as previously described (Lahtchev et al. 2002). Two sets of haploid strains, marked with the complementary auxotrophic markers were used. These strains were plated as large parallel lines on two YPD plates and incubated overnight at 37 ◦ C. The strains 12-M8, 7-6X, 1 5-8A, 25-M2 and 5-H25 (for their genotypes see Table 1A) were plated as horizontal lines, and other set of strains (11-A1, 3-6X, 2-8A, 17-A1 and 5-H25) were plated as vertical lines. The grown haploid strains were crossed and transferred for induction of mating competence on sporulation medium SPOMAL. After three days of incubations at room temperature, the crossed strains were replica plated on MIN medium,

381

supplemented with adenine. On such medium parental haploid strains were unable to grow, in contrast to the resulting diploid cells. The appearance of confluent diploid growth on mating squares on plates with MIN medium, supplemented with adenine was indicative for successful mating events. The diploid nature of the hybrids was confirmed by several criteria: a larger size of its colonies and cells, doubled DNA content and segregation of parental auxotrophic markers. From the same crossing experiments, a set of diploid strains (Table 1A) was isolated and used for determination of sporulation capacity. Diploids were plated on SPOMAL medium and incubated at 27 ◦ C for 5–10 days. Sporulation was scored by microscopic counting and was shown as a ratio of the number of four-spored asci to all cells inspected. 3. Results 3.1. Cloning and sequencing of OpPUR2,5 gene Adenine requiring mutant ade3-5 was isolated in our previous work (Lahtchev et al. 2002) and used for the construction of multiply marked strain ADE3-A. This strain was transformed with genomic library, containing random O. polymorpha DNA fragments inserted into the shuttle vector pYT3 (Table 1B) and carrying S. cerevisiae LEU2 gene as a selectable marker (Tan et al. 1995). Transformation experiments resulted in 35,000 Leu+ colonies able to grow on synthetic complete media lacking leucine (SC-Leu). These colonies were replica plated on synthetic adenine-lacking medium (SC-Ade) and two Ade+ Leu+ Ura− transformants were further characterized. Total genomic DNA was isolated and one of the vectors containing inserts designated pYT3-ADE was rescued by sub-cloning in E. coli. Its ability to complement the adenine-requiring mutation of O. polymorpha was proved again by re-introduction of pYT3-ADE into the mutant strain ADE3-A. The sequencing of the 4.3 kb insert revealed that it contains two potential open reading frames (ORF). The first one (SGS1) is incomplete and shows 70% similarity with the gene encoding putative helicase in methylotrophic yeast Pichia pastoris. The second ORF encompasses 2369 bp and encodes a protein of 789 amino acids (aa) (Fig. 2A). Its deduced amino acid sequence shows a high degree of homology with PUR2,5 proteins of several yeast species: S. cerevisiae, Candida glabrata, Wickerhamomyces ciferrii and Lodderomyces elongisporus. The calculated molecular mass (85 kDa) and isoelectric point (pI 5.0) of this putative polypeptide were also similar to those of other yeast PUR2,5 proteins. The observed high degree of homology and identity indicates that the cloned gene encodes for bifunctional enzyme of yeast purine pathway. Correspondingly, the gene cloned was designated as OpPUR2,5, the original mutation ade3-5 was renamed as pur2,5 and this designation is further used in our work. 3.2. Disruption of OpPUR2,5 gene Aiming at confirming the presumptive role of OpPUR2,5 gene in purine nucleotide biosynthesis, a mutant strain, containing disrupted OpPUR2,5 allele was generated. The experiments were performed by inserting of O. polymorpha LEU2 gene into OpPUR2,5 coding region (pJAL). Strain 11-A1 was transformed with the disruption cassette (see Fig. 2A and “Materials and methods”) and, as a result, several transformants with Ade− Leu+ Arg− phenotype were isolated. The strains, carrying PUR2,5::LEU2 allele were crossed with strains carrying original ade3-5 (pur2,5) mutation. All resulted diploids were adenine requiring, which suggests that the gene disruption and the original mutation are allelic. The random spore analysis of diploids heterozygous for HpPUR2,5::LEU2

382

A. Stoyanov et al. / Microbiological Research 169 (2014) 378–387

Fig. 2. (A) Schemes of the complementing DNA fragment carrying OpPUR2,5 gene and the disruption cassette. The genes and their parts are shown as arrows. The main restriction sites are presented. The gene SGS1 showed 70% identity with the gene encoding ATP-dependent DNA helicase in Pichia pastoris GS115. OpPUR2,5 encodes bifunctional enzyme catalyzing steps two and five of de novo purine biosynthesis. LEU2 encodes the enzyme beta-isopropylmalate dehydrogenase in O. polymorpha. (B) The promoter region of OpPUR2,5. Translation initiation codon ATG is shown in bold and the nucleotides conserved in promoters of highly expressed yeast genes are underlined. (C) Sequence analysis of the 3 end of OpPUR2,5 and its flanking region. The stop codons are shown in bold italics.

revealed normal Mendelian segregation for the meiotic products, analyzed (1543Ade+ :1512Ade− ), demonstrating that the cloned DNA fragment really encodes for a single OpPUR2,5 protein. The new isolated OpPUR2,5::LEU2 mutation was used for construction of a set of haploid and diploid strains that were employed in studying the role of OpPUR2,5 gene in cellular functions (Table 1A).

3.3. Analysis of the 5 and 3 flanking regions Analysis of 5 and 3 regions adjacent to OpPUR2,5 gene in search for cis- and trans- acting consensus sequences, which may serve as regulatory proteins binding sites was performed. The presence of two canonical motifs 5 TGACTC3 in the 5 adjacent region (Fig. 2B)

A. Stoyanov et al. / Microbiological Research 169 (2014) 378–387

383

Fig. 3. Comparison of amino acid sequences of PUR2,5 proteins found in various yeast species. Designations of PUR2,5 derived from: CBS – Ogataea polymorpha CBS4732T ; DL-1 – O. polymorpha DL-1; P.m. – Pichia (Ogataea) methanolica ADJ67785; P.p.GS115 – Pichia (Komagataella) pastoris GS115; L.e.NRRLYB – L. elongisporus NRRL YB-4239; W.c. – W. ciferrii CCH44160; C.g. CBS138 – C. glabrata CBS 138; S.c.VL3 – S. cerevisiae VL3 EGA86992. The degree of conservatism of the amino acid residues are shown with different shades of gray.

was revealed. The first BAS1 binding site is located at positions (−593) within the neighboring helicase gene, whereas the second site is situated at (−389) in the intergenic spacer (Fig. 2B). In the 5 – region, the putative 5 TAATTA3 box that functions as a translation initiation site was found at positions (−20) to (−14) (Fig. 2B). Two AT-rich motifs that could be used for translation initiation were detected at positions (−47) to (−35) and (−29) to (−15) as well. The comparison of the sequence around the ATG start codon revealed G at position (−3) (Fig. 2B). The occurrence of purine nucleotide at such a position is the most important feature of ATG context in all eukaryotic organisms and has a dramatic positive effect on translation initiation efficiency (Miyasaka 1999). The analysis of the nucleotide composition of the sequences located downstream of the stop codons (Fig. 2C) revealed signature motifs characteristic for a binding site for REB 1 regulatory protein whose abilities are described in “Discussion” (Daignan-Fornier and Fink 1992). 3.4. Analysis of OpPUR2,5 protein sequence OpPUR2,5p deduced protein sequence was compared with those, obtained by complete genomes sequencing of evolutionary close or distant yeast species. The amino acid alignment presented in Fig. 3 it is evident the high degree of identity of several yeast PUR2,5 proteins. OpPUR2,5p showed 100% identity with those of strain O. polymorpha NCYC495, a 98% identity with those of O. polymorpha DL1 and a high percentage of similarity to other yeast species that are able to utilize methanol as a carbon and energy

source: Pichia (Komagataella) pastoris shows a 74% identity and 86% homology and Pichia (Ogataea) methanolica shows 80% identity and 89% homology. In contrast, OpPUR2,5p shows only 62% identity and 75% homology with the same protein of S. cerevisiae, C. glabrata shows 64% identity and 79% homology, W. ciferrii – 69% identity and 83% homology and L. elongisporus – 70% identity and 81% homology. The analysis of amino acid sequence of OpPUR2,5p revealed that it is a protein with two enzyme activities that catalyze steps two and five of purine pathway and consists of five domains in the following order (from N terminus): domain I (PRGS N), domain II (PRGS ATP-grasp A), domain III (PRGS C), domain IV (AIRS), and domain V (AIR C) (Fig. 4). The domains are separated by linkers with a varied length, comprising 17% of the overall amino acids content. GARS and AIRS are fused by a linker consisting of 43 aa. The first three domains determine glycinamide ribotide synthetase (GARS, EC 6.3.4.13), an activity that catalyses step two of the purine pathway. By this reaction, glycine is ligated to an amino group of phosphoribosyl amine in an ATP-dependent manner and provides atoms C4 , C5 and N7 of the purine base. The domains IV and V determine the activity of aminoimidazole ribotide synthetase (AIRS, EC 6.3.3.1) that catalyses the fifth step of the purine biosynthesis. This enzyme uses the FGAM (N-formylglycinamide ribonucleotide) and ATP to produce AIR, ADP and Pi . In this reaction the purine ring is formed. We compared the deduced amino acid sequence of OpPUR2,5 protein with the corresponding evolutionary distant proteins from bacteria (E. coli) and vertebrates (Homo sapiens). In this way, the evolution of domains GARS and AIRS, building these proteins could

384

A. Stoyanov et al. / Microbiological Research 169 (2014) 378–387

Fig. 4. Amino acid sequence comparison of bifunctional PUR2,5p of O. polymorpha with ortholog proteins of E. coli and Homo sapiens. Domain numbering is in accordance to yeast PUR2,5 enzymes. The sequences that are included in the comparison are: PUR D and PUR M of E. coli; PUR2,5p of O. polymorpha; and GART of Homo sapiens. Identical amino acid residues are marked with asterisks; the highly conserved stretches are underlined; amino acids in domain’s linkers are in brackets.

be discussed (Fig. 4). In E. coli GARS is encoded by a gene, designated as purD, AIRS – by purM. In contrast to bacteria, in yeasts GARS and AIRS enzyme activities are fused in a bifunctional PUR2,5p. In vertebrates (as Homo sapiens), they are united in a tri-functional enzyme GART, displaying GARS, AIRS and GART (glycinamide ribonucleotide transformylase) activities (Aimi et al. 1990; Welin et al. 2010). GARS enzyme is a member of the ATP-grasp super family and is found in all purine biosynthetic pathways. Its overall length is similar in all organisms investigated and is about 424–428 amino acids, allocated in three domains, designated as A, B and C for E. coli and as PRGS N, PRGS ATP-grasp (A) and PRGS C for the GARS part of OpPUR2,5 (Fig. 4). AIRS in E. coli consists of 345 amino acids and contains two structural domains (Zhang et al. 2008). Similar domains were obtained in AIRS which is also part of OpPUR2,5p. Domain IV of OpPUR2,5p consists of 93 aa and domain V is composed of 170 aa.

3.5. Analysis of cellular functions of OpPUR2,5 protein The monoauxotrophic strains 7-A1 and 9-M7, carrying pur2,5 and pur2,5::LEU2 mutations showed defective growth on adeninedeficient medium and thus demonstrated the decisive role of OpPUR2,5p in de novo purine pathway in O. polymorpha. The addition of extracellular adenine or inosine compensates the growth defect, suggesting that the salvage pathway is not affected. It was observed that under specific conditions purine nucleotide imbalance impairs growth of S. cerevisiae mutants (Saint-Marc et al. 2009). Our experiments revealed that auxothrophy caused by mutations in OpPUR2,5 gene is not accompanied by any growth problems.

The functional analysis of OpPUR2,5 gene was performed by studying its expression in homologous and heterologous host cells, as well as by investigation of mating and sporulation abilities of strains, carrying pur2,5 and pur::LEU2 alleles. In attempts to estimate the degree of functional complementation of PUR2,5 gene in different hosts, S. cerevisiae strain Y1058 and O. polymorpha strain ADE3-A were used. Both strains are adenine requiring due to mutations in PUR2,5 genes and additionally carried mutations in LEU2 genes. The strains were transformed with plasmids pPUR2,5 CEN LEU2 (S. cerevisiae) and pYT3-Ade3 (O. polymorpha), carrying homologous and/or heterologous LEU2 and PUR2,5 genes. In three independent experiments a large number of Leu+ transformants were isolated and tested for their Ade+ phenotypes that could only result from the expression of PUR2,5 gene. When homologous transformation was performed, 100% complementation was observed. Nevertheless in all experiments PUR2,5 gene from S. cerevisiae was not able to complement pur2,5 mutation of O. polymorpha and no Ade+ transformants were observed among all 3500 Leu+ transformants tested. PUR2,5 gene from O. polymorpha partially (66%) complemented the mutation in baker yeasts: 1759 Ade+ out of 2650 Leu+ colonies were obtained. This result suggests functional and structural divergence of PUR2,5 genes in these two yeast species. In additional experiments we tried to obtain more information concerning cellular functions of OpPUR2,5p that are not related to purine biosynthesis. For these purposes two sets of haploid strains, carrying complementary auxotrophic markers and mutations involved in purine pathway were constructed and applied (Table 1A). These strains were crossed as indicated in Fig. 5 and induced for mating. The copulation efficiency was detected by diploids growth, as mating “squares” appeared on minimal medium, supplemented with adenine. The crosses between strains

A. Stoyanov et al. / Microbiological Research 169 (2014) 378–387

385

produced a very low number of sporulated cells (less than 10% of asci). The observed impairment in mating and sporulation pathways suggests that OpPUR2,5 protein participates in sexual developmental pathways by a mechanism yet unknown.

4. Discussion

Fig. 5. Mating ability of strains carrying mutations in OpPUR2,5 gene. The parental haploid strains 12-M8, 7-6X, 15-8A, 25-M2 and 5-H25 were plated as horizontal lines, whereas the strains 11-A1, 3-6X, 2-8A, 17-A1 and 5-H25 were plated as vertical lines. The picture shows the growth of obtained diploids on minimal medium supplemented with adenine after two days of incubation at 37 ◦ C. The colonies of the diploids resulting from crossing of strains 15-8A with 2-8A are red pigmented.

without mutations in the purine pathway led to confluent growth on mating squares after 24 h of incubation. The resulted diploids were prototrophs and their appearance indicated normal mating efficiency. Similar results were obtained in crosses between the strains carrying mutations in PUR6 and PUR7 genes with strains of wild type. In crosses pur6 × pur6 and pur7 × pur7 a good growth of adenine requiring diploids was observed, suggesting that mutations in the genes PUR6 and PUR7 did not affect the mating ability. In contrast, strains carrying pur2,5 or pur2,5::LEU2 alleles revealed reduced mating ability in cases of homo- and hetero-allelic crosses pur2,5 × pur2,5; pur2,5::LEU2 × pur2,5::LEU2 or pur2,5 × pur2,5::LEU2. The adenine requiring diploid colonies appeared after 48 h and its growth on mating squares was poor, suggesting the impairment of the mating pathway (Fig. 5). The strains, obtained in the crosses were isolated, purified to single colonies and its diploid nature was confirmed. They were spread on sporulation plates and tested for sporulation efficiency. Diploids strains, without purine genes mutations, as well as those with mutations in purine genes in heterozygous state (pur6/PUR6; pur7/PUR7 and pur2,5/PUR2,5) showed good sporulation ability after 3–5 days of incubation at lowered temperatures (27 ◦ C). They developed pale pink color due to the formation of a high percent (usually more then 40%) of four spored asci (Table 3). Similar sporulation rates were obtained for diploids, carrying pur6 and pur7 mutations in homozygous state (pur6/pur6; pur7/pur7). In contrast to them, the diploids, formed by pur2,5 homozygous strains (pur2,5/pur2,5; pur2,5/pur2,5::LEU2 or pur2,5::LEU2/pur2,5::LEU2) remained white, even after prolonged cultivations (12 days) and Table 3 Percent of sporulated cells of diploid strains carrying various adenine requiring mutations. Diploid strain

Sporulated cells (%)

DS1 DS2 DS3 DS4 DS5 DS6 DS7 DS8 DS9 DS10 DS11 DS12 DS13

82 63 58 51 53 44 42 7 6 40 55 6 7

± ± ± ± ± ± ± ± ± ± ± ± ±

3 4 5 3 2 3 5 2 3 2 2 3 3

We have described the cloning, sequencing and functional analysis of OpPUR2,5 gene of methylotrophic yeast O. polymorpha CBS4732T . The gene was cloned by genetic complementation and encodes bifunctional enzyme involved in steps two and five of the de novo purine pathway. It does not contain introns and its length and the features of the deduced protein are in good agreement with the homologous genes and proteins of other yeasts. The comparative analysis of the nucleotide and amino acid sequences has revealed a high degree of homology with the corresponding proteins of the same domain structure from evolutionary distant organisms as well. The most convincing evidence that the cloned gene is PUR2,5 were obtained by complementation of the disrupted allele pur2,5::LEU2 with the original PUR2,5 allele. The large size of OpPUR2,5 (2369 bp) is in accordance with the high frequency of mutations in this gene, as it was previously reported (Lahtchev et al. 2002). The results, presented here extend the knowledge concerning the structural and functional properties of bifunctional PUR2,5. Both GARS and AIRS are composed of separated but interacting domains. As it was noted, in bacteria each enzyme involved in de novo purine biosynthesis is encoded by a particular gene, while their eukaryotic orthologs are often encoded by multifunctional genes (Henikoff 1987; Zalkin and Dixon 1992). Recently, mono-functional GARS protein of 50 kDa that is produced by alternative splicing was found together with a tri-functional GART protein in Homo sapiens. Both GART and GARS proteins are differentially expressed during human brain development and temporally over-expressed in cerebellum of individuals with the Down syndrome (Brodsky et al. 1997). Evolutionary relation to distant organisms such as E. coli and Homo sapiens was proved by multiple sequences alignment of GARS and AIRS domains. Several “signature motifs” in GARS and AIRS proteins were found thus indicating its conservation in the evolution process. The identical amino acids are clustered in stretches, composed of four to eight identical residues. They are mostly conservative in GARS domain II (Fig. 4), where the amino acid glycine is present with remarkable frequency (23%). However these domains differ in their length as well as the length of the separating spacers. Analysis of the 5 -noncoding region revealed several consensus sequences that act as binding sites for regulatory proteins, involved in transcription initiation. According to our results, the initiation of OpPUR2,5 transcription is controlled by the action of BAS1. This protein is a global transcriptional activator, involved in the de novo purine biosynthesis and it was found to affect other S. cerevisiae purine biosynthetic genes too (Daignan-Fornier and Fink 1992). Binding sites of this regulator are located far from PUR2,5 start codon, in agreement with the same observations for S. cerevisiae genes under BAS1 transcription control. Analysis of BAS1 functions in S. cerevisiae revealed that the proximal BAS1 binding site is both necessary and sufficient for regulation, whereas the distal site augments the function of the proximal site (Rolfes et al. 1997). Besides, the same hexanucleotide sequence acts as a binding site for another global regulatory protein GCN4p, which is involved in amino acids biosynthesis and stimulates expression of PUR2,5 under conditions of purine limitation (Rolfes and Hinnebusch 1993). Existence of these recognition sites opens the possibility for the co-regulation of OpPUR2,5 gene by regulatory proteins, involved in different yeast metabolic pathways. Such coregulation of genes is usually achieved by the same transcription

386

A. Stoyanov et al. / Microbiological Research 169 (2014) 378–387

factor(s) that bind to a common target sequence in the different target promoters. We suppose that involvement of OpPUR2,5 in mating and sporulation processes, observed in our experiments, is due to the existence of such co-regulation. The action of the BAS1 activator is usually supported by the BAS2 protein (known as 5PHO2p5 and GRF10p), which is also a global transcriptional activator. BAS2 binds to S. cerevisiae PUR2,5 promoter but its specific binding sites however have not yet been identified (Daignan-Fornier and Fink 1992). Our observations support the assumption of Rolfes et al. (1997) that both AT rich elements located at 5 non coding region upstream PUR2,5 promoter, most probably serve as a BAS2 monomer binding site. The observation of 3 non-coding region after PUR2,5 gene reveals the existence of REB 1 recognition site. REB 1 is a DNA binding protein, known to be involved in the activation of transcription by polymerase II, as well as in the termination of transcription by polymerase I, and in the organization of nucleosomes in S. cerevisiae (Lang and Reeder 1993). However, our data are not sufficient to prove the role of the observed canonical sequences. They are probably involved in the transcription activation of the next 3 -located gene of O. polymorpha. The results from our experiments could contribute to O. polymorpha taxonomy. There are three O. polymorpha strains with a high biotechnological value, identified in the 1950s. They are of independent origin: CBS4732 was isolated from soil samples (de Morais and Maia 1959), NCYC495 – from the gut of insects (Wickerham 1951; Teunison et al. 1960), and DL-1 – from spoiled concentrated orange juice (Levine and Cooney 1973). Recently, the taxonomic position of several strains, affiliated to the former genus Hansenula has been discussed. The type strain H. polymorpha was renamed to Ogataea polymorpha CBS4732T (Yamada et al. 1995; Kurtzman et al. 2011a). However, both other strains have unclear phylogenetic relationship with CBS4732T . The study of sequence homology showed 98.8% identity of OpPUR2,5 genes and 100% identity of the protein sequences between the strains CBS4732 and NCYC495, thus suggesting that these isolated strains belong to the same yeast species. Such a conclusion is supported by our mating experiments in which strains, originating from CBS4732 were crossed with a strain, isolated from NCYC495. These strains were able to copulate in all possible combinations showing good copulation activity. Diploids resulting from such crosses have revealed a high percentage of sporulation and normal segregation of parental markers. In contrast to these observations, the comparison of protein sequences of PUR2,5 of CBS4732T with those of DL-1 shows differences in 13 amino acids. Mating experiments revealed that strains, originating from DL-1 are amenable to sporulate and are deprived of any mating ability: no cases of copulation were obtained in the crosses DL-1 × DL-1. Nevertheless, in crosses between strains originating from DL1 with strains belonging to CBS4732T and/or NCYC495 (crosses DL-1 × CBS4732 and DL-1 × NCYC495) we succeeded in observing rare mating events and the appearance of a limited number of diploid colonies. The obtained diploids sporulated poorly by giving irregular segregations of parental markers (data not shown). Results from PUR2,5 sequences comparison and mating/sporulation experiments suggest a close relationship between strains belonging to O. polymorpha group. The strain DL-1 is probably very close, but different species from the strains CBS4732T and NCYC495. According to some authors, DL1 isolate belongs to the newly described species, designated as Ogataea parapolymorpha (Suh and Zhou 2010; Kurtzman 2011b). The transformation of S. cerevisiae and O. polymorpha with plasmids, carrying homologous and/or heterologous PUR2,5 gene(s) has revealed that these proteins are not functionally equivalent. The lack of expression of S. cerevisae PUR2,5 gene in O. polymorpha and the partial expression of OpPUR2,5 gene in S. cerevisiae are in

agreement with the moderate nucleotide and protein PUR2,5 sequence homology of these species. Mating between haploid strains carrying pur2,5 mutation has been studied. The sporulation of diploid hetero- and homozygous pur2,5 mutants has been observed as well. This is the first investigation of the ability of O. polymorpha adenine requiring mutants to mate and sporulate. In this organism both processes are poorly explored and most of the genes, involved in their control, are still unknown. Our preliminary investigations suggest that the O. polymorpha mating system differs from those described in S. cerevisiae and other ascomycetous yeasts. O. polymorpha strains of opposite mating types are still not found and every strain is able to mate with any isogenic strain. Both mating and sporulation are repressed during normal vegetative growth and the transition to sexual differentiation is influenced by various genetic, environmental, physiological and other factors. However, incubation on specific starvation medium has been found to be crucial for the induction of mating competence and sporulation ability. This medium contains fermentable carbon source, but lacks ammonium ions. Such an observation suggests the existence of common initiation steps of these two processes and explains the relation between the lowered mating ability of pur2,5 haploids and the lowered sporulation of pur2,5/pur2,5 diploids. Our results have revealed mating between haploids carrying pur6 and pur7 mutations (Fig. 4) and also sporulation of diploids, homozygous by these mutations (Table 3). Therefore, adenine deficiency could not probably affect sexual differentiation processes. The observed lowered mating between strains carrying pur2,5 mutations (Fig. 4) as well as the very poor sporulation of diploids homozygous by pur2,5 (Table 3) is quite unusual and still has not been reported for the other yeast species yet. We suggest a possible structural role of PUR2,5 protein on factor(s), involved in the initiation of both sexual differentiation processes. It is possible that PUR2,5 protein has moonlighting functions. Moonlighting proteins perform multiple autonomous and often unrelated functions without the partitioning of these functions into different domains of the protein (Huberts and van der Klei 2010). Reported example of moonlighting protein in O. polymorpha is enzyme pyruvate carboxylase. This is a highly conserved enzyme, which catalyses the carboxylation of pyruvate into oxaloacetate, thereby replenishing the tricarboxilic acid cycle. However, pyruvate carboxylase is also essential for the proper targeting and assembly of the peroxysomal protein alcohol oxydase (Ozimek et al. 2003). Therefore, the existence of moonlighting proteins in O. polymorpha is not unusual and PUR2,5p displays all features, typical for the moonlighting proteins. In conclusion, we have reported new data, concerning the nucleotide sequence and cellular functions of the OpPUR2,5 gene. The present study is an elucidation of the structural and functional properties of this gene. Clarification of the domain structure of PUR2,5 reveals the evolution from mono- to bifunctional enzymes appearing in yeasts. We have found that mutations in OpPUR2,5 gene cause sexual developmental pathways impairment, suggesting the important role of PUR2,5 in cellular functions of O. polymorpha. The cloned OpPUR2,5 gene could be used as a new selectable marker in the generation of a novel host-vector system for transformation experiments in O. polymorpha.

Acknowledgments The research leading to these results has received funding from the European Community’s Seventh Framework Programme (FP7/2007–2013) under Grant Agreement No. 222628 (www.polymode.eu). The authors would like to express their gratitude to Dr. J.A.K.W. Kiel, University of Gröningen, the Netherlands, for O. polymorpha genomic library and Dr. Daignan-Fornier,

A. Stoyanov et al. / Microbiological Research 169 (2014) 378–387

University of Bordeaux, France, for providing the plasmid pPUR2,5 CEN LEU2.

References Aimi J, Qiu H, Williams J, Dixon JE. De novo purine nucleotide biosynthesis: cloning of human and avian cDNAs encoding the trifunctional glycinamide ribonucleotide synthetase-aminoimidazole ribonucleotide synthetase-glycinamide ribonucleotide transformylase by functional complementation in E. coli. Nucleic Acids Res 1990;18(22):6665–72. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. PSI-BLAST: a new generation of protein database sequence programs. Nucleic Acids Res 1997;25(17):3389–402. Brodsky G, Barnes T, Bleskan J, Becker L, Cox M, Patterson D. The human GARS-AIRSGART gene encodes two proteins which are differently expressed during human brain development and temporally overexpressed in cerebellum of individuals with Down syndrome. Human Mol Genet 1997;6(12):2043–50. Cappellacci L, Franchetti P, Vita P, Petrelli R, Lavecchia A, Jayaram HN, et al. Ribose-modified purine nucleosides as ribonucleotide reductase inhibitors. Synthesis, antitumor activity, and molecular modeling of N6-substituted 3 -Cmethyladenosine derivatives. J Med Chem 2008;14(51):4260–9. Cory JG. Purine and pyrimidine nucleotide metabolism. In: Devlin TM, editor. Textbook of biochemistry with clinical correlations. New York: Wiley-Liss Inc.; 2006. p. 789–822. Daignan-Fornier B, Fink GR. Coregulation of purine and histidine biosynthesis by the transcriptional activators BAS1 and BAS2. Proc Natl Acad Sci U S A 1992;89(15):6746–50. de Morais JOF, Maia MHD. Estudos de microorganismos encontrados em leitos de despejos de caldas de destilarias de Pernambuco II. Una nova especie de Hansenula: H. polymorpha. Anais de Escola Superior de Quimica de Universidade do Recife 1959;1:15–20. Dinesh S, Shikha G, Bhavana G, Nidhi S, Dileep S. Biological activities of purine analogues: a review. J Pharm Sci Innovation 2012;1(2):29–34. Faber KN, Haima P, Harder W, Veenhuis M, AB G. Highly-efficient electrotransformation of the yeast Hansenula polymorpha. Curr Genet 1994;25(4):305–10. Gallois-Montbrun S, Veron M, Deville-Bonne D. Antiviral nucleoside analogs phosphorylation by nucleoside diphosphate kinase. Mini Rev Med Chem 2004:361–9. Gellissen G. Heterologous protein production in methylotrophic yeasts. Appl Microbiol Biotechnol 2000;54(6):741–50. Gellissen G, Kunze G, Gaillardin C, Cregg JM, Berardi E, Veenhuis M, et al. New yeast expression platforms based on methylotrophic Hansenula polymorpha and Pichia pastoris and on dimorphic Arxula Adeninivorans and Yarrowia lipolytica – a comparison. FEMS Yeast Res 2005;5(11):1079–96. Gleeson MAG, Sudbery PE. Genetic analysis in the methylotrophic yeast Hansenula polymorpha. Yeast 1988;4(4):293–303. Guetsova ML, Lecdoq K, Daignan-Fornier B. The isolation and characterization of Saccharomyces cerevisiae mutants that constitutively express purine biosynthetic genes. Genetics 1997;147(2):383–97. Haan GJ, van Dijk R, Kiel JAKW, Veenhuis M. Characterization of the Hansenula polymorpha PUR7 gene and its use as selectable marker for targeted chromosomal integration. FEMS Yeast Res 2002;2(1):17–24. Henikoff S. Multifunctional polypeptides for purine de novo synthesis. Bioassays 1987;6(1):8–13. Huberts D, van der Klei IJ. Moonlighting proteins: an intriguing mode of multitasking. Biochim Biophys Acta 2010;1803(4):520–5. Ischuk O, Voronovsky A, Abbas C, Sibirny A. Construction of Hansenula polymorpha strains with improved thermotolerance. Biotechnol Bioeng 2009;104(5): 911–9. Jones EW, Fink GR. Regulation of amino acid and nucleotide biosynthesis in yeast. In: Strathern JN, Jones EW, Broach JR, editors. The molecular biology of the yeast Saccharomyces: metabolism and gene expression. New York: Cold Spring Harbor Laboratory Press; 1982. p. 181–300. Kang HA, Gellisen G. Hansenula polymorpha. In: Gellissen G, editor. Production of recombinant proteins. Novel microbial and eukaryotic expression systems. Weinheim: Wiley-VCH; 2005. p. 111–42. Kowalski D, Pendyala L, Daignan-Fornier B, Howell S, Huang Y. Dysregulation of purine nucleotide biosynthesis pathways modulates cisplatin cytotoxicity in Saccharomyces cerevisiae. Molecular Pharmacol 2008;74:1092–100. Kim JN, Blount KF, Puskarz I, Lim J, Link KH, Breaker RR. Design and antimicrobial action of purine analogues that bind guanine riboswitches. ACS Chem Biol 2009;4(11):915–27. Kurtzman CP. A new methanol assimilating yeast, Ogataea parapolymorpha, the ascosporic state of Candida parapolymorpha. Antonie Van Leeuwenhoek 2011b;100(3):455–62. Kurtzman CP, Yamada OY, Maeda & Mikata K. Kurtzman CP, Fell JW, Boekhout T, editors. The yeasts, a taxonomic study. New York: Elsevier; 2011a. p. 645–71 (1994).

387

Lahtchev KL, Semenova VD, Tolstorukov II, van der Klei I, Veenhuis M. Isolation and properties of genetically defined strains of the methylotrophic yeast Hansenula polymorpha CBS4732. Arch Microbiol 2002;177(2):150–8. Lang WH, Reeder RH. The REB1 site is an essential component of a terminator for RNA polymerase I in Saccharomyces cerevisiae. Mol Cell Biol 1993;13(1):649–58. Levine DW, Cooney CL. Isolation and characterization of a thermotolerant methanol – utilizing yeast. Appl Microbiol 1973;26(6):982–90. Miyasaka H. The positive relationship between codon usage bias and translation initiation AUG context in Saccharomyces cerevisiae. Yeast 1999;15(8):633–7. Neuhard J, Nygaard P. Biosynthesis and conversion of nucleotides, purines and pyrimidines. In: Neihardt FC, Ingraham JI, Low KB, Magasanik B, Schaechterand M, Umbager HE, editors. Escherihia coli and Salmonella typhimurium cellular and molecular biology. Washington, DC: American Society for Microbiology; 1987. p. 445–73. Ozimek P, van Dijk R, Latchev K, Gancedo C, Wang DW, van der Klei IJ, et al. Pyruvate carboxylase is an essential protein in the assembly of yeast peroxisomal oligomeric alcohol oxidase. Mol Biol Cell 2003;14(2):786–97. Ramezani-Rad M, Hollenberg CP, Lauber J, Wedler H, Griess E, Wagner C, et al. The Hansenula polymorpha (strain CBS4732) genome sequencing analysis. FEMS Yeast Res 2003;4(2):207–15. Rébora K, Desmoucelles C, Borne F, Pinson B, Daignan-Fornier B. Yeast AMP pathway genes respond to adenine through regulated synthesis of a metabolic intermediate. Mol Cell Biol 2001;21(23):7901–12. Rebora K, Desmoucelles C, Borne F, Pinson B, Daignan-Fornier B. Yeast AMP pathway genes respond to adenine through regulated synthesis of a metabolic intermediate. Mol Cell Biol 2001;21:7901–12. Rolfes RJ, Hinnebusch AG. Translation of the yeast transcriptional activator GCN4 is stimulated by purine limitation: implications for activation of the protein kinase GCN2. Mol Cell Biol 1993;13:5099–111. Rolfes RJ. Regulation of purine nucleotide biosynthesis: in yeast and beyond. Quick View. Biochem Soc Trans 2006;34(Pt 5):786–90. Rolfes RJ, Zhang F, Hinnebusch AG. The transcriptional activators BAS1, BAS2, and ABF1 bind positive regulatory sites as the critical elements for adenine regulation of ADE5,7. J Biol Chem 1997;272(20):13343–54. Saint-Marc C, Pinson B, Coulpier F, Jourden L, Lisova O, Daignan-Fornier B. Phenotypic consequences of purine nucleotide imbalance in Saccharomyces cerevisiae. Genetics 2009;183(10):529–38. Sambrook J, Russel DW. Plasmids and their usefulness in molecular cloning. In: Irwin N, Janssen KA, editors. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory Press; 2001. Suh SO, Zhou JJ. Methylotrophic yeast Ogataea (Hansenula) polymorpha: a proposal of Ogataea angusta comb. nov. and Candida parapolymorpha sp. nov. FEMS Yeast Res 2010;10(5):631–8. Tan X, Waterham HR, Veenhuis M, Cregg JM. The Hansenula polymorpha PER8 gene encodes a novel peroxisomal integral membrane protein involved in proliferation. J Cell Biol 1995;128(3):307–19. Teunison DJ, Hall HH, Wickerham LJ. Hansenula angusta, an excellent species for demonstration of the coexistence of haploid and diploid cells in a homothallic yeast. Mycologia 1960;52(2):184–8. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;25(24):4876–82. Tibbetts AS, Appling DR. Saccharomyces cerevisiae expresses two genes encoding isozymes of 5-aminoimidazole-4-carboxamide ribonucleotide transformylase. Arch Biochem Biophys 1997;340(2):195–200. Van Rompay AR, Johansson M, Karlsson A. Substrate specificity and phosphorylation of antiviral and anticancer nucleoside analogues by human deoxyribonucleoside kinases and ribonucleoside kinases. Pharmacol Ther 2003;100(2):119–39. Van Zutphen T, Baerends R, Susanna K, de Jong A, Kuipers OP, Veenhuis M, et al. Adaptation of Hansenula polymorpha to methanol: a transcriptome analysis. BMC Genomics 2010;11:1. Vitali LA, Petrelli D, Lambertucci C, Prenna M, Volpini R, Cristalli G. In vitro antibacterial activity of different adenosine analogues. J Med Microbiol 2012;61(Pt 4):525–8. Welin M, Grossmann JG, Flodin S, Nyman T, Stenmark P, Tresaugues L, et al. Structural studies of tri-functional human GART. Nucleic Acids Res 2010;38(20):7308–19. Wickerham LJ. Taxonomy of yeast. In: US Dept Agr Tech Bull no. 1029. Washington, DC: US Dept Agr; 1951. p. 1–56. Williams JD, Khan AR, Harden EA, Hartline CB, Jefferson GM, Keith KA, et al. Synthesis and antiviral activity of certain second generation methylenecyclopropane nucleosides. Bioorg Med Chem 2012;20(12):3710–8. Yamada Y, Matsuda M, Maeda K, Mikata K. The phylogenetic relationships of methanol-assimilating yeasts based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Komagataella gen nov. (Saccharomycetaceae). Biosci Biotechnol Biochem 1995;59(3):439–44. Zalkin HZ, Dixon JE. De novo purine nucleotide biosynthesis. Prog Nucleic Acid Res Mol Biol 1992;42:259–87. Zhang Y, Morar M, Ealick SE. Structural biology of the purine biosynthetic pathway. Cell Mol Life Sci 2008;65(23):3699–724.