Structural and functional characterisation of the αS1-casein (CSN1S1) gene and association studies with milk traits in Assaf sheep breed

Livestock Science 157 (2013) 1–8

Contents lists available at ScienceDirect

Livestock Science journal homepage: www.elsevier.com/locate/livsci

Structural and functional characterisation of the αS1-casein (CSN1S1) gene and association studies with milk traits in Assaf sheep breed J.H. Calvo a,b,n, E. Dervishi a, P. Sarto a, L. González-Calvo a, B. Berzal-Herranz a,1, F. Molino a, M. Serrano c, M. Joy a a

Unidad de Tecnología en Producción Animal, CITA, 59059 Zaragoza, Spain ARAID, 50004 Zaragoza, Spain c Departamento de Mejora Genética animal, INIA, 28040 Madrid, Spain b

a r t i c l e i n f o

abstract

Article history: Received 14 March 2013 Received in revised form 6 June 2013 Accepted 7 June 2013

Genetic polymorphisms in genes encoding milk proteins are of interest to the animal breeding and dairy industry due to their effects on production traits, milk composition and milk quality. For this purpose, the total length of the CSN1S1 gene has been sequenced and characterised in Assaf animals with an extreme phenotype for milk protein content. In the present study, some of the polymorphisms were genotyped for association analysis studies with milk protein content in a population of 444 Assaf ewes. Furthermore, the influences of these polymorphisms on the transcription rate of this gene were also evaluated in 45 Churra Tensina ewes. An 18427-bp DNA-sequence of the CSN1S1 gene, including the entire CDS, 5′and 3′UTR regions, and the promoter region, was analysed, leading to the identification of 61 polymorphisms. Two polymorphisms detected in the 5′ flanking region were located within possible trans-acting factor binding sites, modifying the putative CdxA and GATA-1 consensus sites. The SNP (JN560175: g.1123C4A) that modifies a putative CdxA consensus site showed a significant effect on the expression of the CSN1S1 gene (P¼0.043), but no effect was found for protein content. A SNP in exon 17 (g.16101C4T) produces a nonconservative substitution of isoleucine to threonine at position 209 in the pre-protein (GenBank accession no. JN560175), but no significant associations with milk protein content were found. Finally, two SNPs located in exons 18 (g.16721C4A) and 19 (g.17826G4A) modify a putative target site for two bovine miRNA (bta-miR-631 and bta-miR-1224, respectively). Only the SNP in exon 18 showed a lightly significant additive genetic effect (Po0.1), with protein content for the CC genotype (4.43%) that accounts for 2.37% of the population mean (4.33%) for this trait. The results of the association and expression studies in exon 18 (g.16721C4A) were consistent, as the expression of the CSN1S1 gene in animals with the CC genotype was approximately 1.8 times greater than the expression of the GG genotype. Further studies concerning cheese yield and casein content as well as functional studies of transcription factors and miRNA binding activity are needed to elucidate the function of these SNPs and their application to breeding schemes. & 2013 Elsevier B.V. All rights reserved.

Keywords: Sheep Milk CSN1S1 Polymorphism Functional

1. Introduction n

Corresponding author at: Unidad de Tecnología en Producción Animal, CITA, 59059 Zaragoza, Spain. Tel.: 34 976716471. E-mail address: [email protected] (J.H. Calvo). 1 Present address: Instituto de Parasitología y Biomedicina “LópezNeyra”, IPBLN-CSIC, Parque Tecnológico de Ciencias de la Salud, Avda. del Conocimiento s/n, Armilla, 18100 Granada, Spain. 1871-1413/$ - see front matter & 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.livsci.2013.06.014

Caseins are the major proteins in sheep milk, accounting for 76–83% of the total protein (Park et al., 2007). They constitute the essential structure of the cheese matrix, which represents approximately 80% of the cheese milk

2

J.H. Calvo et al. / Livestock Science 157 (2013) 1–8

proteins (Hinrichs, 2004). The heterogeneity of caseins is determined either by the presence of genetic variants or by other factors, such as a discrete phosphorylation level, variation in the extent of glycosylation of the κ-casein fraction, and the coexistence of proteins with different chain lengths due to alternative splicing events (Ferranti et al., 1995, 1998; Giambra et al., 2010a; Park et al., 2007). Different alleles of αs1-casein have been associated with an effect on the milk protein, casein and fat contents, as well as on cheese yield in ruminants (Amigo et al., 2000; Boettcher et al., 2004; Chianese et al., 1997; Martin et al., 2002; Pirisi et al., 1999). In recent years, these alleles of αs1-casein in ovine milk have been identified by protein electrophoresis and high performance liquid chromatography (HPLC) analysis (Chianese et al., 1996; Giambra et al., 2010a, 2010b; Pirisi et al., 1999). These are designated A, B, C, D, E, F, G, H and I, in line with the nomenclature proposed for cow or goat milk caseins. According to the DNA analysis, primary structures have been found for A, C, D, E, H, and I. Variants A, C and D differ in their degree of mobility as a result of different phosphorylation levels, which are due to two amino acid substitution. The C allele differs from A by having a Pro instead of Ser at position 13 (Ser13Pro), which determines the loss of the phosphate group at position 12 of the protein chain (SerP12Ser) in the mature protein. A further substitution, SerP68Asn, causes the disappearance of both phosphate groups in the phosphorylated residues Ser64 and Ser66 in variant D. The amino acid changes Ser13Pro and SerP68Asn are caused by SNPs in exons 3 (X03237: c.143C4T) and 9 (X03237: c.309G 4A). Ovine CSN1S1*E (Chianese et al., 2007), H (Giambra et al., 2010a) and I (Giambra et al., 2010b, 2010c) are characterised by the absence of exon 10, 8 and 7, respectively, due to alternative splicing mechanisms. In addition, using PCR-SSCP (Single Strand Conformation Polymorphims) analysis, Ceriotti et al. (2004) found a C4T transition in exon 17 that leads to the amino acid exchange Ile186Thr and shifts the C variant to C′ and C″ (Ceriotti et al., 2005). Pariset et al. (2006) described an additional SNP within the 5′-UTR of the gene. In Spain, there are approximately 3.5 million dairy sheep (FAOSTAT, 2010). Dairy sheep are mainly used for cheese making and often have a regional or local connotation regarding origin and quality (Ugarte et al., 2001), which plays an important economic role in less-favoured rural regions. Assaf sheep is the main breed used in dairy sheep farms, with approximately 700,000 heads belonging to the Spanish Assaf (Assaf.E) population (Legaz et al., 2011). A genetic breeding programme based on the traditional quantitative goals has been recently established for the Spanish Assaf breed (Gutiérrez et al., 2007; Jiménez and Jurado, 2005), and an appreciable genetic gain in milk yield has been achieved. In 2012, the breeding programme added milk quality traits (protein and fat content) to the genetic scheme (Jiménez and Jurado, personal communication) because payment systems based on milk composition are used in the sheep milk industry. In this context, Carta et al. (2009) noted the impact of the incorporation of molecular information to increase the efficiency of dairy sheep breeding programmes. Because the milk of Spanish

Assaf ewes is primarily used for the production of cheese, improved characterisation of ovine raw milk is important to enable cheese producers to optimise the process according to the technological properties of the milk. The genetic polymorphisms of genes encoding milk proteins are of great interest for animal breeding and the dairy industry due to their implications in milk yield, composition and quality. This work focuses on the characterisation and evaluation of the ovine αS1-casein (CSN1S1) gene as a candidate gene related to protein content in a Spanish Assaf population. For this purpose, the total length of the CSN1S1 gene was sequenced and characterised in animals with extreme phenotypes for milk protein content. Some polymorphisms were genotyped and analysed for their associations to milk traits. Finally, the influence of these polymorphisms in the rate of transcription of the CSN1S1 gene was evaluated. 2. Material and methods 2.1. Structural characterisation and association studies 2.1.1. Animal samples From July 2008 to February 2009, the milk yield and milk contents were recorded monthly from three flocks of Spanish Assaf (n¼650) located in Teruel province. These flocks belong to the Teruel Association of Dairy and Cheese Producers, which was established with the aim of promoting artisan cheese production to obtain a Protected Geographical Indication (PGI). Records of the total milk yield (MY) as well as the fat (FC), protein (PC), lactose (LC) and total solid contents (TSC) were used for statistical analysis. The milk composition was measured using a MilkoScan FT120. Only multiparous ewes with two or more lactations and at least three test day records during one lactation were considered. The records of 444 of the 650 ewes with three test day records between 2 and 7 years old from 3 flocks, A (n¼ 281), B (n ¼29) and C (n¼134), were used for the association studies. The animal effects for the MY, FC, PC, LC and TSC characteristics were estimated by fitting a Repeatability Mixed Model that included the herd-test day, the number of lambs born and the days in milk as fixed effects and the ewe herself as a random effect. The search for polymorphisms in the CSN1S1 gene was carried out in 20 Spanish Assaf sheep (4.5% of the 444 ewes with three test day records) with extreme phenotypes for milk protein content. The mean protein content of the milk was 6.83 (70.327) and 4.38 ( 70.208)% for the ewes of high (n¼10) and low (n ¼10) protein content, respectively. The association studies between polymorphisms and milk traits were carried out using the 444 ewes that were genotyped for the SNPs of interest. 2.1.2. CSN1S1 gene structural characterisation Genomic DNA was extracted from the lymphocytes of 20 Spanish Assaf sheep with extreme phenotypes for the animal effect on PC using the SpeedTools DNA Extraction kit (Biotools, Madrid, Spain). Primers designed from the sheep genome vs. 1 and 2 (http://www.livestockgenomics.csiro.au/sheep/oar2.0.php)

J.H. Calvo et al. / Livestock Science 157 (2013) 1–8

were used to obtain the total length of the CSN1S1 gene including the promoter region (Supplementary Table S1). The genomic DNA (150 ng) was amplified in a final PCR reaction volume of 25 ml containing 5 pmol of each primer, 200 nM dNTPs, 2.5 mM MgCl2, 50 mM KCl, 10 mM Tris– HCl, 0.1% Triton X-100, 0.5 U Pfu and 1 U Taq polymerase (Madrid, Biotools, Spain). Standard amplification cycles were used. The PCR products were sequenced in both directions using an ABI Prism 3700 (Applied Biosystems, Madrid, Spain) and standard protocols. The homology searches were performed using BLAST (National Center for Biotechnology Information: http:// www.ncbi.nlm.nih.gov/BLAST/). To align the sequences, the CLUSTALW (http://www.ebi.ac.uk/clustalw/) software was used. The Polyphen software (http://genetics.bwh. harvard.edu/pph2/index.shtml; Adzhubei et al., 2010), which predicts the possible impact of an amino acid substitution on the structure and function of a protein, was used. The search for putative regulatory elements within the promoter was carried out with the TFSearch (http://www.cbrc.jp/research/db/TFSEARCH.html) and Signal scan (http://www-bimas.cit.nih.gov/molbio/signal/) softwares. Antisense matches to individual miRNAs in the 3′UTR sequences of the sequenced ovine CSN1S1 gene were searched using MicroInspector (http://bioinfo.uniplovdiv.bg/microinspector/; Rusinov et al., 2005). 2.1.3. CSN1S1 polymorphism genotyping Four SNPs in the ovine CSN1S1 gene were genotyped in the 444 Assaf ewes. Only SNPs located in putative functional active sites were genotyped. Genomic DNA was extracted from ovine lymphocytes and milk somatic cells, as described above, for gene structural characterisation. Detailed information on the locations and positions of the markers, primer sequences, their corresponding product sizes and annealing temperatures are given in Table 1. The g.1123C4A and g.16721C4A polymorphisms were analysed by PCR-RFLP analyses with the restriction enzymes MseI and DdeI, respectively. The genomic DNA (50 ng) was amplified by PCR in a final volume of 25 ml containing 5 pmol of each primer, 200 nM dNTPs, 2.2 mM MgCl2, 50 mM KCl, 10 mM Tris–HCl, 0.1% Triton X-100 and 0.5 U Taq polymerase (Biotools, Madrid, Spain). Standard amplification cycles were used. The PCR-RFLP bands were visualised on 3% agarose gels stained with SYBR Safe (Invitrogen, Carlsbad, CA, USA). The g.16101C4T and g.17826G4A polymorphisms were genotyped using TaqMan SNP genotyping assays designed by Applied Biosystems (Applied Biosystems, Madrid, Spain) with an ABI Prism 7500 platform (Applied Biosystems, Madrid, Spain). Real-time PCR (RTPCR) was performed using 7.5 μl of TaqMan 2  universal master mix (Applied Biosystems, Madrid, Spain), 0.25 μl of the primer-probe (36 μM and 8 μM, respectively), 6.25 μl of RNase- and DNase-free water, and 1 μl of sample DNA (50 ng) in a total volume of 15 μl per reaction. 2.2. CSN1S1 gene functional characterisation 2.2.1. Animal samples The impact of three SNPs, listed in the CSN1S1 polymorphisms genotyping section, on CSN1S1 gene expression

3

was evaluated in an experimental flock of Churra Tensina sheep because it was impossible to obtain a mammary gland biopsy during lactation from Assaf ewes. Only the SNPs located in regulatory regions of the gene that can affect gene expression were analysed (g.1123C4A, g. 16721C4A and g.17826G4A polymorphisms). Forty-five multiparous single-bearing Churra Tensina ewes from to the experimental flock at La Garcipollera Research Station in the Pyrenees (north-eastern Spain, 4237N, 030W, 945 m above sea level, a.s.l.) that were as unrelated as possible were used (46.574.42 kg body weight and 3.070.20 of body condition score in a 1–5 scale, Russel et al., 1969). The ewes were fed on mountain pastures ad libitum (43–46% neutral detergent fibre and 18–20% crude protein). The pasture was composed of 22% legumes (mainly Trifolium repens), 68% grass (the main species were Festuca arundinacea, Festuca pratensis and Dactylis glomerata) and 10% other species (mainly Rumex acetosa and Ranunculus bulbosus). To evaluate the effect of the g.1123C4A, g. 16721C4A and g.17826G4A SNPs on CSN1S1 gene expression within the mammary gland of the Churra Tensina sheep at the fifth week of lactation, mammary gland tissue was collected with a biopsy needle (Tru-Cuts, CareFusion, France). The animal handling and procedures were in accordance with current (EU directive 86/609/EEC, 1986) and supervised by the Animal Welfare Committee of the institution (protocol number 2009-01_MJT). Immediately after biopsy, the mammary tissue sample was stored in RNAlater solution (QIAGEN, Madrid, Spain), frozen and stored at −80 1C. 2.2.2. Real-time PCR analysis Total RNA was extracted from the mammary gland biopsy of the Churra Tensina ewes with TRI@REAGENT (Sigma-Aldrich, Madrid, Spain) according to the manufacturer's instructions. The concentration and quality of the RNA were determined by nanophotometric analysis (Implen, Madrid, Spain). To exclude the possible amplification of contaminating genomic DNA, the samples were treated with DNAse. Single-stranded cDNA was synthesised from 1 μg of RNA with the SuperScriptsIII Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer's recommendations. The gene expression levels were determined by RT-PCR on an ABI Prism 7500 platform (Applied Biosystems, Madrid, Spain). The primers used for RT-PCR were as follows: 5′-TCCACTAGGCACACAATACACTGA-3′ and 5′-GCCAATGGGATTAGGGATGTC-3′ (Bevilacqua et al., 2006). Before performing the RT-PCR reactions, a conventional PCR was performed to test the primers and verify the amplified products. The PCR products were sequenced to confirm gene identity with an ABI Prism 3700 (Applied Biosystem, Madrid, Spain) and standard protocols. The homology searches were performed with BLAST (National Center for Biotechnology Information: http://www.ncbi.nlm.nih.gov/BLAST/) to confirm the identity of the amplified fragments. The PCR reaction was performed in a 10-μl PCR total reaction mixture containing SYBR Green PCR Master Mix (Applied Biosystem, Madrid, Spain). Each reaction was performed in triplicate, and the average was used to calculate the relative amount of the target gene. To normalise the results of the target genes, 8 candidate housekeeping genes were tested: tyrosine 3-monooxygenase

4

J.H. Calvo et al. / Livestock Science 157 (2013) 1–8

Table 1 Detailed information on the locations and positions of the SNPs genotyped, the primer sequences used, their corresponding product sizes and the annealing temperatures (Tm). The g.1123C 4A and g.16721C4 A polymorphisms were detected with the MseI and DdeI restriction enzymes, respectively, while the g.16101C 4T and g.17826G 4A polymorphisms were genotyped using a TaqMan SNP genotyping assay. Polymorphisms Location Position in OAR 3.0

Position in GenBank JN560175

Primers

Tm (ºC)

Product size (bp)

1

Promoter OAR6: 85087801

g.1123C4A

Forward: AACAATGCCATTCCATTTCC Reverse: GACTGGGAAGAAGCAGCAAG

55

250

2

Exon 17

OAR6: 85102965

g.16101C4T

Forward: CCCATTGGCTCTGAGAACAGT Reverse: CGGCAGCAATATGCAGTCATTTAAA Probe 1: FAM-TGGCATAGTAGTCTTTC Probe 2: VIC-TGGCATAGTAATCTTTC

60

81

3

Exon 18 (3′UTR)

OAR6: 85103385

g.16721C4A

Forward: TGCTGGGAAAATTAGTGCTCA Reverse: TGGACATTTAAATCTGTTTTCTT

58

519

4

Exon 19 (3′UTR)

OAR6: 85104490

g.17826G4 A

Forward: TTTCTATATGGAAAATGTTTTTAAAGCCTTTGAATCA Reverse: AGACAAAATCTCAGTTACTGCACACA Probe 1: FAM-CCTCTCCTGTAAGTGCCAT Probe 2: VIC-CTCTCCTGTAAATGCCAT

60

95

(YWHAZ), ribosomal protein L19 (RPL19), glyceraldehyde-3phosphate dehydrogenase (GAPDH), glucose-6-phosphate dehydrogenase (G6PDH), beta actin (ACTB), ubiquitin C (UBC), beta-2-microglobulin (B2M), and succinate dehydrogenase (SDHA). The sequences of the primers and the RT-PCR conditions are described in Dervishi et al. (2011). Standard curves for the genes were generated to calculate the amplification efficiency. The efficiency of PCR amplification for each gene was calculated using the standard curve method (E¼ 10(−1/ slope) ). The standard curves for each gene were generated using a 5-fold serial dilution of the pooled cDNA. The amplification conditions were an initial step of 10 min at 95 1C, followed by 40 cycles at 95 1C for 15 s and 59 or 60 1C for 30 s, depending on the gene. The specificity of the amplification products and the lack of primer dimers were confirmed by melting curve analysis in all cases. To quantify the relative gene expression, the standard curve method was used according to the recommendation of Larionov et al. (2005). The normalised RT-PCR data were transformed to the fold-change relative to the control group (AA, CC and GG genotype for the g.1123C4A, g.16721C4A and g.17826G4A polymorphisms, respectively); thus, the data in the group were transformed to obtain a perfect mean of 1. The PCRnormalised data are presented as the n-fold relative change. 2.3. Statistical analyses The Hardy–Weinberg equilibrium of the Assaf and Churra Tensina populations was assessed using Genepop version 3.3 (Raymond and Rousset, 1995).

of the three genotypes for each SNP were fitted as covariables. Heterogeneous residual variance was fitted for the three milk records taken over the same animal. The model was as follows: y ¼ m þ Htd þ bðDimÞ þ Nlb þ b1 x þ b2 x þ animal þ e where y is the phenotype (milk yield and contents), μ¼population mean, b1x is the additive effect (AA¼ 1; AB ¼0 and BB ¼−1), b2x is the dominant effect (AA¼0; AB ¼1 and BB ¼0) and e is the residual effect. An alternative model similar to that described above but including the genotype as a fixed effect was also tested. The allele substitution effects were also estimated using the mixed model procedure in which additive and dominant genotype effects were included as covariates. The Bonferroni correction was applied. 2.3.2. Gene expression studies The effect of the polymorphisms in the CSN1S1 gene expression rate was analysed using the GLM procedure in SPSS software (version 15). The equation of the model used was: y¼μ+b1x+e, where y¼normalised CSN1S1 expression data; μ¼overall mean; b1x ¼the additive effect of the three genotypes (AA¼ 1; AB¼0 and BB ¼−1); and e¼the residual error. A Bonferroni post-hoc test was performed to identify the differences between genotypes. The significance threshold level was established at P o0.05. Separate analyses were carried out for each polymorphism. 3. Results

2.3.1. Association studies The analyses were conducted using SAS software (Version 10; SAS Inst. Inc., Cary, NC, USA). The relationships between the polymorphisms in the CSN1S1 gene and the MY, FC, PC, LC and TSC traits were performed by fitting to a Repeatability Mixed Model that included the herd test day (Htd), the number of born lambs (Nlb) as fixed effects, and the animal and residual as random effects. The days in milk (Dim), and the additive and dominant genetic effects

3.1. Isolation of the ovine CSN1S1 gene and polymorphism detection A 18427-bp sequence of the CSN1S1 gene (including the entire CDS, 5′ and 3′UTR regions, and 1163 bp of the promoter region) was obtained by sequencing. The exons were identified by comparison with bovine and goat sequences (X59856 and AJ504711, respectively). Thus, we

J.H. Calvo et al. / Livestock Science 157 (2013) 1–8

were able to confirm that the ovine gene is split into 19 exons, ranging in size from approximately 24 (exons 5, 6, 7, 8, 10,13 and 16) to 385 nucleotides (exon 19). In addition to the 645-bp coding region, sequences of 65 and 421 bp corresponding to the 5′ and 3′ flanking region of the ovine CSN1S1 gene were also sequenced. The entire exon 1 and the beginning of exon 2 (12 bp) as well as exons 18 and 19 were untranslated sequences. A sequence gap of 189 nucleotides in intron 11 was present in the assembled sequence due to the low number and quality of the sequences obtained for this region. The sequence was submitted to NCBI GenBank under the accession no. of JN560175. Splice donor and acceptor consensus sequences conforming to the AG/TG rule were identified at the exon/ intron boundaries. Sequencing of the full length of the CSN1S1 gene (except the sequence gap of 189 nucleotides) from 20 Assaf ewes with extreme phenotypes for the animal effect for milk protein content revealed 61 polymorphisms (Fig. 1): 5 polyT, 1 poly A, 1 GT microsatellite, 2 indels and 52 SNPs. Two polymorphisms in the 5′ flanking region were located within possible trans-acting factor binding sites, modifying the putative CdxA (g.1123C 4A) and GATA-1 (g.1131T4C) consensus sites. Two SNPs were located in the coding region. The SNP in exon 14 (g.13252T4C) was a synonymous substitution, while the SNP in exon 17 (g.16101C 4T) generated a nonconservative substitution of isoleucine to threonine at position 209 of the pre-protein, including the signal peptide (GenBank accession no. JN560175). The amino acid substitution supposes a large change in the hydropathy plot of the CSN1S1 gene. The possible impact of the amino acid substitution on the structure and function of the protein was studied using the Polyphen software. This prediction, based on a number of features including the sequence, phylogenetic and structural information characterising the substitution, was probably damaging to the protein function/ structure (with a score of 0.997). The non-conservative replacement of Thr for Ile thus appears to be unusual and limited to sheep. The ancestral nucleotide was identified as “C” (aCt coding for Thr), based on a (BLAST) comparison with the vast majority of mammal orthologs. Finally, two SNPs located in exons 18 (g.16721C4A) and 19 (g.17826 G 4A) modify putative target sites of two bovine microRNAs (miRNA): bta-miR631 and bta-miR-1224, respectively. According to DNA analysis, we did not identify the polymorphisms within

5

CSN1S1 leading to CSN1S1*A, D, H or I and all 20 sequenced samples were C′ or C′′ alleles. In the rest of the animal material we did not type for the polymorphisms leading to the other CSN1S1 variants and only for C′ and C′′. As CSN1S1*A, D, H and I also carry g.16101T and not g.16101C these alleles can be hidden behind C′′. 3.2. Association studies Only SNPs located in putative functional active sites of CSN1S1 were genotyped, in the 444 Assaf ewes. These included one within the promoter region (g.1123C 4A) and three in exons 17 (g.16101C 4T), 18 (g.16721C4A) and 19 (g.17826G 4A). The SNP located at the GATA-1 consensus site (g.1131T 4C) was not genotyped because, after sequencing the promoter region in 65 animals (20 Assaf and 45 Churra Tensina ewes from animals used to look for polymorphism and in functional studies, respectively), the frequency of the C allele was lower than 10% (P(C)¼0.08). The frequencies for the other four polymorphisms genotyped are shown in Table 2. The g.1123C4A SNP contains a MseI recognition site and leads to a restriction fragment polymorphism. Allele A constitutes a new recognition site for MseI, leading to PCR fragments that are 121, 68, 27, 17 and 16 bp in length, in contrast to allele C, where the fragments lengths are 121, 68, 43 and 17 bp. The g.16721C4A polymorphism was typed using DdeI. The occurrence of allele C leads to the 269, 144 and 106 bp fragments, whereas allele G destroys one DdeI restriction site (269 and 250 bp fragments). The allele frequencies for the total Assaf population genotyped are shown in Table 2. The genotype frequencies were within the Hardy-Weinberg equilibrium for the four SNPs. Table 2 Allele frequency of the 4 CSN1S1 SNPs genotyped. The nucleotide positions of the polymorphisms are indicated according to GenBank sequence JN560175. SNP

Allele

Churra Tensina ewesa (n¼ 45)

Assaf ewesb (n¼ 444)

g. 1123C 4A g. 16101C 4T g. 16721C 4A g. 17826G 4A

C C G A

0.46 0.36 0.38 0.16

0.76 0.23 0.22 0.23

a b

Ewes used for functional characterization. Ewes used for the association studies.

Fig. 1. Schematic representation of ovine CSN1S1. The white boxes show coding exons. The sequencing studies revealed 61 polymorphisms: 5 polyT, 1 poly A, 1 GT microsatellite, 2 indels and 52 SNPs. The SNPs and poly (T/A) are shown with solid and dotted black arrows, respectively. The indel and microsatellite polymorphisms are indicated with solid grey lines. Two polymorphisms in the 5′ flanking region were located within possible trans-acting factor binding sites, modifying putative CdxA and GATA-1 consensus sites. The SNP in exon 14 was a synonymous substitution, while the SNP in exon 17 generated a nonconservative substitution of isoleucine to threonine at position 209 of the pre-protein, including the signal peptide (described by Ceriotti et al. (2004) as I186T). The two SNPs located in exons 18 and 19 modify putative target sites for two bovine miRNA (bta-miR-631 and bta-miR-1224, respectively).

6

J.H. Calvo et al. / Livestock Science 157 (2013) 1–8

The effect of the Htd, DIM and Nlb were significant for MY, FC, LC and TSC for the four SNPs (P o0.001). No significant results were found for the additive genetic effect between the tested SNPs and MY, FC, LC or TSC traits. The animal variance estimates took values of 0.35, 0.17, 0.10, 0.63 and 0.01 for MY, FC, PC, TSC and LC, respectively. In general, residual variance estimates were higher for the second test-day record (data not shown). For the PC, the Htd effect and DIM were significant (Po0.001), and the g.16721C4A SNP in exon 18 showed a trend (P¼ 0.0738) but without Bonferroni correction (Table 3). In this case, ewes with the CC genotype showed a protein content of 4.43%, which accounts for 2.37% of the population mean (4.33%) for this trait.

Normfinder software were RPL19 (stability value ¼0.11) and GAPDH (stability value ¼0.11). These housekeeping genes were selected to normalise the expression data of CSN1S1 in the mammary gland tissue. Effects of the polymorphisms on CSN1S1 gene expression were analysed. Only, the g.1123C 4A polymorphism, located in the promoter region of the gene, showed a significant effect on CSN1S1 gene expression (P ¼0.043) (Fig. 2). The expression of the CSN1S1 gene in animals with the g.1123AA genotype was approximately 1.8 times greater than in those with the CC genotype.

3.3. Functional studies

Twenty Assaf sheep with extreme phenotypes for the animal effect for milk protein content were used to search for polymorphisms, increasing the probability of detecting mutations associated with the trait. In total, 61 polymorphisms were found. None of them had been associated to the described phenotypes of CSN1S1 in dairy sheep by other authors, except for the SNP in exon 17 (g.16101C4T), which was described previously by Ceriotti et al. (2004). These authors described the mutation as a SNP responsible of a non-conservative substitution of isoleucine to threonine at position 186, a substitution that was not identifiable at the protein level by standard typing methods and shifted the C variant to C′ and C″. In our work, this mutation is located at position 209 (GenBank accession no. JN560175) because we described the complete preprotein, including the signal peptide, while exon 16 was missing in the study of Ceriotti et al. (2004). This SNP has also been previously described in several European sheep breeds (Pariset et al., 2006). Then in silico prediction of the substitution effect of the Thr209Ile was most likely damaging based on a number of features comprising the sequence and the phylogenetic and structural information.

4. Discussion

For accurate gene expression measurements, 8 housekeeping genes were tested to normalise the results of the target gene studied in the mammary gland tissue. The genes that exhibited the greatest stability value using

Table 3 Regression analyses for the additive and dominant genetic effects of the g. 16721C 4A polymorphisms for milk protein content. Effects a

Htd Dimb Nlbc Additive genetic Dominant genetic

Degrees of freedom

F-value

P-value

11 1 3 1 1

40.15 67.62 2.47 3.2 0.19

o 0.0001 o 0.0001 0.0605d 0.0738d 0.6619

a

Htd: Herd test day. Nlb: number of lambs born. c Dim: days in milk. d Po 0.10. b

Gene expression fold-change

1.4 1.2

a a a

a a

1 0.8

a b

a

0.6

a

0.4 0.2 0 AA CA CC (n=11) (n=26) (n=8)

g. 1123C>A (promoter)

CC CG GG (n=17) (n=26) (n=2)

g. 16721C>A (exon 18)

GG AG AA (n=35) (n=8) (n=2)

g. 17826G>A (exon 19)

SNPs Fig. 2. CSN1S1 gene expression grouped by SNP genotypes observed in Churra Tensina sheep breed The nucleotide positions of the polymorphisms are indicated according to GenBank sequence JN560175 . Different letters differ with at least P o0.05. The error bars represent standard error.

J.H. Calvo et al. / Livestock Science 157 (2013) 1–8

However, no significant associations were found between this SNP and the milk protein content. Because this polymorphism affects the mature protein, it is plausible that this mutation does not affect the protein content, but rather the functionality of the protein, thus influencing cheese yield and organoleptic characteristics. In silico analysis showed that two polymorphisms detected in the 5′ flanking region were located within possible trans-acting factor binding sites, modifying the putative CdxA (g.1123C 4A) and GATA-1 (g.1131T4C) consensus sites. In the same way, two SNPs located in exons 18 (g.16721C 4A) and 19 (g.17826G 4A) modify the putative target sites for two bovine miRNA (bta-miR-631 and bta-miR-1224, respectively). The expression studies for these putative functional SNPs only revealed significant effects of the g.1123C 4A SNP on gene expression. The g.1123C4A SNP modifies a putative CdxA consensus site. CdxA is one of the most frequently occurring promoter elements in humans (Bajic et al., 2006). The transcription factor CdxA is a homeodomain protein originally described in the early stages of the morphogenesis of the chicken intestinal tract (Frumkin et al., 1994), but its role in the morphogenesis of the mammary gland or the regulation of milk genes has apparently not been addressed. However, no effect on protein content has been found in the association studies. In this sense, Martin et al. (2002) found a different casein content in milk (11% between alternative genotypes for αS1-casein) from cows carrying specific mutations in the promoter region and also showed different binding efficiencies of transcription factors to different allele probes of SNPs contained in the promoter region using mobility shift assay (EMSA) competition experiments. In our study, we did not measure the casein content, and it might be possible that the altered expression in CSN1S1 is associated with changes in casein content but not in total protein content. This is because caseins are the major proteins in sheep milk and form 76– 83% of the total protein (Hinrichs, 2004; Park et al., 2007), and αs1-casein accounts for 32.0–39.9% of the total protein (Bramanti et al., 2003; Law, 1992; Moatsou et al., 2004). The functionality of this SNP could be elucidated in further studies by analysing its transcription factor binding activity using band shift or luciferase reporter assays. A trend was observed for an additive genetic effect for the g.16721C4A SNP in exon 18 (P ¼0.0738), with an average effect of the C allele substitution of 0.1029 for protein content (a 2.37% of the protein content of the population mean). The SNP located in exon 18 modifies a putative target site for a bovine microRNA (bta-miR-631). miRNAs are a family of small, non-coding RNAs that regulate the posttranscriptional expression of target genes (Ambros, 2004; Bartel, 2004; He and Hannon, 2004). They usually act by base pairing to a partially complementary segment within the 3′ UTR transcript of a target gene, which causes translation inhibition and/or mRNA cleavage and leads to a reduced expression of the target gene. In this sense, no significant differences were found in gene expression, but it was remarkable that an unbalanced number of genotypes in the studied population were found (17 CC, 26 CT and 2 GG) for the g.16721C 4A SNP. The results of the association and expression studies were consistent

7

because the expression of the CSN1S1 gene in the CC genotype, which was associated with higher protein content, was also found to be approximately 1.8 times greater than the expression in the GG genotype (Fig. 2). In conclusion, a new αS1-casein (CSN1S1) gene polymorphism associated with CSN1S1 expression has been identified. Further studies concerning cheese yield and casein content as well as functional studies for TF and miRNAs binding activity are needed. Further studies including all CSN1S1 polymorphisms and the other casein loci are necessary to establish associations for all casein polymorphisms and the effect of such haplotypes on milk production traits. Conflict of interest None.

Acknowledgements The authors wish to thank the Teruel cheese producers association, COTEVE, and the staff of La Garcipollera and of CITA de Aragón for their assistance in sample collection and analysis. E. Dervishi was supported by a doctoral grant from AECI (Agencia Española de Cooperación Internacional) and L. Gonzalez-Calvo from INIA (Instituto Nacional de Investigaciones Agrarias). This study was partially financed by the research projects INIA-PET2007-01-C07-06, INIARTA-2009-0091-C02 and INIA-RZP-2009-005 and the Research Group Funds of the Aragón Government (A49). Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j. livsci.2013.06.014.

References Adzhubei, I.A., Schmidt, S., Peshkin, L., Ramensky, V.E., Gerasimova, A., Bork, P., Kondrashov, A.S., Sunyaev, S.R., 2010. A method and server for predicting damaging missense mutations. Nat. Methods 7, 248–249. Ambros, V., 2004. The functions of animal microRNAs. Nature 431, 350–355. Amigo, L., Recio, I., Ramos, M., 2000. Genetic polymorphism of ovine milk proteins: its influence on technological properties of milk—a review. Int. Dairy J. 10, 135–149. Bajic, V.B., Brent, M.R., Brown, R.H., Frankish, A., Harrow, J., Ohler, U., Solovyev, V.V., Tan, S.L., 2006. Performance assessment of promoter predictions on ENCODE regions in the EGASP experiment. Genome Biol. 7 (S3), 1–13. Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297. Bevilacqua, C., Helbling, J.C., Miranda, G., Martin, P., 2006. Translational efficiency of casein transcripts in the mammary tissue of lactating ruminants. Reprod. Nutr. Dev. 46, 567–578. Boettcher, P.J., Caroli, A., Stella, A., Chessa, S., Budelli, E., Canavesi, F., Ghiroldi, S., Pagnacco, G., 2004. Effects of casein haplotypes on milk production traits in Italian Holstein and Brown Swiss cattle. J. Dairy Sci. 87, 4311–4317. Bramanti, E., Sortino, C., Onor, M., Beni, F., Raspi, G., 2003. Separation and determination of denatured αs1-, αs2-, b- and k-caseins by hydrophobic interaction chromatography in cows', ewes' and goats' milk, milk mixtures and cheeses. J. Chromatogr. A 994, 59–74.

8

J.H. Calvo et al. / Livestock Science 157 (2013) 1–8

Carta, A., Casu, S., Salaris, S., 2009. Invited review: current state of genetic improvement in dairy sheep. J. Dairy Sci. 92, 5814–5833. Ceriotti, G., Chessa, S., Bolla, P., Budelli, E., Bianchi, L., Duranti, E., Caroli, A., 2004. Single nucleotide polymorphisms in the ovine casein genes detected by polymerase chain reaction-single strand conformation polymorphism. J. Dairy Sci. 87, 2606–2613. Ceriotti, G., Chiatti, F., Bolla, R., Martini, M., Caroli, A., 2005. Genetic variability of the ovine αs1-casein. Ital. J. Dairy Sci. 4, 64–66. Chianese, L., Garro, G., Mauriello, R., Laezza, P., Ferranti, P., Addeo, F., 1996. Occurrence of five αs1-casein variants in ovine milk. J. Dairy Res. 63, 49–59. Chianese, L., Mauriello, R., Ferranti, P., Tripaldi, C., Taibi, L., Dell′Aquila, S., 1997. Relationship between αs1-casein variants and clotting capability of ovine milk. In: Proceedings of IDF Seminar Milk Protein Polymorphism 2, Palmerston North, New Zealand, pp. 316–323. Chianese, L., Caira, S., Garro, G., Addeo, F., 2007. Primary structure of ovine deleted variant αs1-CN E. In: Procceedings of the 5th International Symposium on the challenge to sheep and goats milk sectors, Alghero/Sardinia, Italy, pp. 58–60. Dervishi, E., Serrano, C., Joy, M., Serrano, M., Rodellar, C., Calvo, J.H., 2011. The effect of feeding system in the expression of genes related with fat metabolism in semitendinous muscle in sheep. Meat Sci. 89, 91–97. European Union (EU) Directive No. 86/609/CEE, 1986. Council Directive of 24 November 1986 on the approximation of laws, regulations and administrative provisions of the Member States regarding the protection of animals used for experimental and other scientific purposes. Off. J. Eur. Union 358, 1–32. FAOSTAT, 2010. Agriculture Data. Food and Agriculture Organization Statistics, Rome, Italy. Ferranti, P., Malorni, A., Nitti, G., Laezza, P., Pizzano, R., Chianese, L., Addeo, F., 1995. Primary structure of ovine αs1-caseins: localization of phosphorylation sites and characterisation of genetic variants A, C and D. J. Dairy Res. 62, 281–296. Ferranti, P., Chianese, L, Malorni, A., Migliaccio, F., Stingo, V., Addeo, F., 1998. Copresence of deleted protein species generates structural heterogeneity of ovine αs1-casein. J. Agricul. Food Chem. 46, 411–416. Frumkin, A., Pillemer, G., Haffner, R., Tarcic, N., Gruenbaum, Y., Fainsod, A., 1994. A role for CdxA in gut closure and intestinal epithelia differentiation. Development 120, 253–263. Giambra, I.J., Chianese, L., Ferranti, P., Erhardt, G., 2010a. Molecular genetic characterisation of ovine αS1-casein allele H caused by alternative splicing. J. Dairy Sci. 93, 792–795. Giambra, I.J., Jäger, S., Erhardt, G., 2010b. Isoelectric focusing reveals additional casein variants in German sheep breeds. Small Rumin. Res. 90, 11–17. Giambra, I.J., Ferranti, P., Chianese, L., Erhardt, G., 2010c. Genomics and proteomics of deleted ovine CSN1S1*I. Int. Dairy J. 20, 195–202.

Gutiérrez, J.P., Legaz, E., Goyache, F., 2007. Genetic parameters affecting 180-days standardised milk yield, test-day milk yield and lactation length in Spanish Assaf (Assaf.E) dairy sheep. Small Rumin. Res. 70, 233–238. He, L., Hannon, G.J., 2004. MicroRNAs: small RNAs with a big role in gene regulation. Nat. Rev. Genet. 5, 522–531. Hinrichs, J., 2004. Mediterranean milk and milk products. Eur. J. Nutr. 43. Suppl 1:I/12-17. Jiménez, M.A., Jurado, J.J., 2005. Esquema de selección de la raza Assaf en León. ITEA 101, 117–128. Larionov, A., Krause, A., Miller, W., 2005. A standard curve based method for relative real time PCR data processing. BMC Bioinf. 6, 62. Law, A.J.R., 1992. Quantitative fractionation of ovine casein by cationexchange FPLC. Milchwissenschaft 47, 279–282. Legaz, E., Cervantes, I., Pérez-Cabal, M.A., De la Fuente, L.F., Martínez, R., Goyache, F., Gutiérrez, J.P., 2011. Multivariate characterisation of morphological traits in Assaf E sheep. Small Rumin. Res. 100, 122–130. Martin, P., Szymanowska, M., Zwierzchowski, L., Leroux, C., 2002. The impact of genetic polymorphisms on the protein composition of ruminant milks. Reprod. Nutr. Dev. 42, 433–459. Moatsou, G., Samolada, M, Katsabeki, A., Anifantakis, E., 2004. Casein fraction of ovine milk from indigenous Greek breeds. Lait 84, 285–296. Pariset, L., Cappuccio, I., Ajmone-Marsan, P., Bruford, M., Dunner, S., Cortes, O., Erhardt, G., Prinzenberg, E.M., Gutscher, K., Joost, S., PintoJuma, G., Nijman, I.J., Lenstra, J.A., Perez, T., Valentini, A., Econogene Consortium, 2006. Characterisation of 37 breed-specific singlenucleotide polymorphisms in sheep. J. Hered. 97, 531–534. Park, Y.W., Juarez, M., Ramos, M., Haenlein, G.F.W., 2007. Physicochemical characteristics of goat and sheep milk. Small Rumin. Res. 68, 88–113. Pirisi, A., Piredda, G., Papoff, C.M., Di Salvo, R., Pintus, S., Garro, G., Ferranti, P.m., Chianese, L., 1999. Effects of sheep alpha S1-casein CC, CD and DD genotypes on milk composition and cheesemaking properties. J. Dairy Res. 66, 409–419. Raymond, M., Rousset, F., 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J. Hered. 86, 248–249. Rusinov, V., Baev, V., Minkov, I.N., Tabler, M., 2005. MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence. Nucl. Acids Res. 33, W696–700. Russel, A.J.F, Doney, J.M., Gunn, R.G., 1969. Subjective assessment of body fat in live sheep. J. Agricul. Sci. 72, 451–454. Ugarte, E., Ruiz, R., Gabina, D., de Heredia, I.B., 2001. Impact of highyielding foreign breeds on the Spanish dairy sheep industry. Livest. Prod. Sci. 71, 3–10.