Structural Basis for a Convergent Immune Response against Ebola Virus

Article

Structural Basis for a Convergent Immune Response against Ebola Virus Graphical Abstract

Authors Hadas Cohen-Dvashi, Matthias Zehner, Stefanie Ehrhardt, Michael Katz, Nadav Elad, Florian Klein, Ron Diskin

Correspondence [email protected]

In Brief Cohen-Dvashi et al. elucidate the molecular basis for VH3-15/Vl1-40 mAbs, a common and effective immune response in individuals vaccinated with, or exposed to, the glycoprotein spike complex of the Ebola virus. Structural data for various antibodies reveals a convergent mechanism of binding and insight into how this response is elicited.

Highlights d

People exposed to the GP spike complex of EBOV develop VH3-15/Vl1-40 mAbs

d

Cryo-EM reveals VH3-15/Vl1-40 mAbs target the NPC1receptor binding site on GP

d

VH3-15/Vl1-40 mAbs avoid using CDRH3 and mostly utilize the light chain for binding

d

Key interacting residues used by VH3-15/Vl1-40 mAbs are already encoded by germline genes

Cohen-Dvashi et al., 2020, Cell Host & Microbe 27, 1–10 March 11, 2020 ª 2020 Elsevier Inc. https://doi.org/10.1016/j.chom.2020.01.007

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

Cell Host & Microbe

Article

Structural Basis for a Convergent Immune Response against Ebola Virus Hadas Cohen-Dvashi,1 Matthias Zehner,2 Stefanie Ehrhardt,2 Michael Katz,1 Nadav Elad,3 Florian Klein,2,4,5 and Ron Diskin1,6,* 1Department

of Structural Biology, Weizmann Institute of Science, Rehovot 76100, Israel of Experimental Immunology, Institute of Virology, Faculty of Medicine and University Hospital of Cologne, University of Cologne, Cologne 50931, Germany 3Department of Chemical Research Support, Weizmann Institute of Science, Rehovot 76100, Israel 4German Center for Infection Research, Partner Site Bonn-Cologne, Cologne 50931, Germany 5Center for Molecular Medicine Cologne (CMMC), University Hospital of Cologne, Cologne, Germany 6Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.chom.2020.01.007 2Laboratory

SUMMARY

Ebola virus disease is a severe health problem in Africa. Vaccines that display the Zaire ebolavirus glycoprotein spike complex are a prime component for the effort to combat it. The VH3-15/Vl1-40-based class of antibodies was recently discovered to be a common response in individuals who received the Ebola virus vaccines. These antibodies display attractive properties, and thus likely contribute to the efficacy of the vaccines. Here, we use cryo-EM to elucidate how three VH3-15/Vl1-40 antibodies from different individuals target the virus and found a convergent mechanism against a partially conserved site on the spike complex. Our study rationalizes the selection of the VH3-15/Vl1-40 germline genes for specifically targeting this site and highlights Ebolavirus species-specific sequence divergences that may restrict breadth of VH3-15/Vl140-based humoral response. The results from this study could help develop improved immunization schemes and further enable the design of immunogens that would be efficacious against a broader set of Ebolavirus species. INTRODUCTION Periodic outbreaks of viruses from the Ebolavirus genus, which often cause fatal Ebola virus disease (EVD), make a severe health problem in West Africa and increasingly manifest themselves as global health concern. Various combinations of therapeutic monoclonal antibodies (mAbs) provide a promising putative mean to treat EVD patients (Corti et al., 2016; Davey et al., 2016; Moekotte et al., 2016; Qiu et al., 2014; Saphire et al., 2018). In addition, experimental vaccines based on chimpanzee adenovirus 3 (ChAd3) (De Santis et al., 2016; Stanley et al., 2014) and recombinant vesicular stomatitis virus (rVSV) (Marzi et al.,

2015; Wong et al., 2014) that display the Zaire ebolavirus (EBOV) glycoprotein spike (GP) complex are in advanced clinical development (Kennedy et al., 2017). Detailed analyses of the immune responses and mechanisms of protection of these experimental vaccines are highly needed for devising optimal immunization schemes and developing more efficient vaccines. We recently reported a deep repertoire analysis of the antiEbolavirus B cell response in rVSV-ZEBOV-vaccinated individuals (Ehrhardt et al., 2019). A striking observation was the presence of a class of antibodies combining the VH3-15/Vl1-40 germline immunoglobulin gene segments in all vaccinated individuals (Ehrhardt et al., 2019). Remarkably, in a recent analysis of ChAd3-ZEBOV-vaccinated individuals that was conducted by Rijal and colleagues, a group of VH3-15/Vl1-40 antibodies was also identified (Rijal et al., 2019). In both cases, the VH315/Vl1-40 mAbs were found to compete (Ehrhardt et al., 2019; Rijal et al., 2019) with a known mAb (mAb114) that targets the receptor-binding (head) domain on GP (Misasi et al., 2016) and is applied under compassionate use protocols. Moreover, VH315/Vl1-40 antibodies were also observed in an EVD survivor (Bornholdt et al., 2016). Hence, people that are exposed to the EBOV GP, either by vaccination or during natural infection, develop a VH3-15/Vl1-40-derived humoral immune response that targets the receptor-binding domain of GP. Studies with mAb114 demonstrated that it is capable of neutralizing viruses as well as inducing antibody-dependent cellular cytotoxicity (ADCC), which are two advantageous properties that ultimately allow it to confer protection from lethal EBOV challenge in macaques (Corti et al., 2016). The ability to both neutralize and induce ADCC is a general feature of anti-receptor-binding site mAbs (Saphire et al., 2018) that is further correlated with the abilities of such mAbs to protect animals (Gunn et al., 2018; Saphire et al., 2018). Indeed, various VH3-15/Vl1-40 mAbs derived from both ChAd3-ZEBOV- and rVSV-ZEBOV-vaccinated individuals display noticeable neutralization capacities (Ehrhardt et al., 2019; Rijal et al., 2019), and a VH3-15/Vl1-40 antibody exhibited therapeutic value in vivo (Bornholdt et al., 2016). Neutralization of VH3-15/Vl1-40 mAbs is generally restricted to EBOV, as most of these mAbs do not cross-react with other viruses like Sudan ebolavirus Cell Host & Microbe 27, 1–10, March 11, 2020 ª 2020 Elsevier Inc. 1

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

Figure 1. Structural Overview of EBOV GP Recognition by VH3-15/Vl1-40 mAbs (A) Structures of EBOV GP/5T0180, EBOV GP/ 1T0227, and EBOV GP/3T0265 shown as ribbons inside semi-transparent and 15 A˚ low-pass-filtered density maps. The complexes are shown in ‘‘side’’ views, and the gold standard FSC resolution values are indicated. Density maps span the EBOV GP core and the VHVL regions of the Fabs and are mostly lacking density for the EBOV GP stalk and for the CH1CL regions of the Fabs. (B) Superimposition based on the EBOV GP of the three structures. The EBOV GP and the Fabs are shown with surface and ribbon representations, respectively, and are differentially color coded as indicated. All mAbs recognize the same region of the GP1 core. (C) The structure of EBOV GP/5T0180 (EBOV GP in ribbon and 5T0180 in surface representations using the same color coding as in B) is superimposed with a crystallographic antibody-free structure of EBOV GP (PDB: 5JQ3, shown as blue ribbon). The binding angle of the mAbs is such that they avoid making contacts with the glycan cap region of EBOV GP. See also Figure S1 and Table S1.

(SUDV) or Bundibugyo ebolavirus (BDBV) (Ehrhardt et al., 2019). Nevertheless, some VH3-15/Vl1-40 mAbs seem to be able to cross react with other viral species (Rijal et al., 2019). Thus, the class of VH3-15/Vl1-40 mAbs makes an important part of the vaccine-elicited humoral immune response, which likely contributes to the overall efficacy of the vaccines and may even allow targeting of other Ebolavirus species. We have used single-particle cryoelectron microscopy (cryo-EM) analysis (SPA) to elucidate the molecular details of EBOV GP recognition by three distinct VH3-15/Vl1-40 mAbs from three different vaccinated individuals. We discover a convergent immunological solution against a conserved site on the GP. Our data further explain the molecular basis for the usage of the VH3-15/Vl1-40 germline gene segments and highlight structural determinants that affect the breadth of the response, which may enable the design of superior anti-Ebolavirus immunogens. RESULTS Convergent Targeting of GP by VH3-15/Vl1-40 mAbs In order to elucidate how VH3-15/Vl1-40 mAbs target the GP, we selected three mAbs (i.e., 5T0180, 1T0227, and 3T0265), each from a different rVSV-ZEBOV-vaccinated individual 2 Cell Host & Microbe 27, 1–10, March 11, 2020

(Ehrhardt et al., 2019) as a representative set. We paired the Fab portions of the mAbs with a trimeric EBOV GP that is lacking the mucin-like and transmembrane domains (Zhao et al., 2016). Each EBOV GP-Fab complex was investigated using SPA, and near-atomic resolution maps were obtained for the three complexes (Figure S1A; Table S1). Gold-standard FSC resolutions were determined to be 2.9 A˚, 3.5 A˚, and 3.0 A˚ for EBOV GP in complex with mAbs 5T0180, 1T0227, and 3T0265, respectively (Figures 1A and S1B). For the three structures, we enforced C3 symmetry and obtained sufficiently complete angular coverage (Figure S1C). The EBOV GP is a class I fusogen, composed of three GP1-GP2 heterodimers (Lee et al., 2008). The density maps span the core regions of the GP1 receptor-binding and GP2 membrane-fusion modules, as well as the VHVL region of the antibodies (Figure 1A). Densities for the CH1CL regions of the Fabs were either completely missing (5T0180) or poorly resolved (1T0227 and 3T0265) (Figure 1A). Also, in all three structures, only poor density was obtained for the stem regions, and no density was observed for the glycan cap regions, indicating high flexibility and conformational heterogeneity of these EBOV GP regions. We built and refined models for the VH/VL regions of the three Fabs in complex with the central part of GP (Figure S1D). Density maps provide detailed near-atomic views for GP recognition by the mAbs (Figure S1E) at local resolution values that are 3.0 A˚ or better (Figure S1A). Superimposing the three structures by aligning the GPs reveals that all three VH3-15/ Vl1-40 mAbs, although derived from different individuals, target the same overall epitope on the apex of GP (Figure 1B). The epitopes exclusively span residues at the GP1 receptor-binding

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

Figure 2. VH3-15/Vl1-40 mAbs Target a Partially Conserved Epitope on GP (A) Close-up view of the epitope on EBOV GP (magenta) that is recognized by VH3-15/Vl1-40 mAbs, exemplified with 5T0180 (orange and yellow surface representations for the heavy and light chains, respectively). The different patches that make the recognition site are colored in blue, green, red, and gray. The main residues on GP that make the epitope are labeled. (B) Multiple sequence alignments of EBOV, SUDV, and BDBV (accession codes NP_066246, YP_138523, and YP_003815435, respectively). Residue numbering is of EBOV. The relevant parts that make the epitope on EBOV GP are labeled and highlighted using the same colors as in (A). (C) Footprints of the three VH3-15/Vl1-40 mAbs. The buried surface areas are shown on a single EBOV GP1 protomer in different colors for each of the mAbs. The calculated buried solvent accessible areas upon complex formation are indicated for each mAb. (D) VH3-15/Vl1-40 mAbs sterically prevent NPC1 binding. Superimposition of a single EBOV GP/5T0180 protomer (orange, yellow, and violet for the heavy chain, light chain, and GP, respectively) with the model of NPC1 bound to EBOV GP (PDB: 5F1B, blue—showing NPC1 only). 5T0180 and NPC1 occupy the same volume and, hence, cannot bind at the same time. (E) VH3-15/Vl1-40 mAbs retain binding to EBOV GPcleaved in acidic pH. This plot is showing single cycle kinetic experiments at pH 5.5 using EBOV GPcleaved as analyte that was injected at the indicated concentrations over mAbs 1T0227 (blue curve) and 5T0180 (red curve) that were conjugated to a sensor chip. Since this configuration enables high avidity (three potential binding sites per trimer), we did not attempt to derive kinetic parameters. (F) 1T0227 and 5T0180 compete with NPC1 for binding to EBOV GPcleaved. EBOVcleaved (50 nM) was injected over immobilized NPC1 at pH 5.5 alone (blue curve) or in the presence of 500nM mAbs 1T0227, 5T0180, or 3T0331 (anti-GP2 mAb, serves as a negative control). See also Figure S2.

Cell Host & Microbe 27, 1–10, March 11, 2020 3

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

Figure 3. A Residue at Position 224 Is a Major Restricting Factor for Binding of VH3-15/Vl1-40 mAbs (A) An asparagine residue is modeled instead of a glycine at position 224 of EBOV GP. Asn224 is shown using red sticks and is indicated in the three mAbs-GP complexes. In all cases, the most frequent rotamer clashes with the light chains. Rotameric rearrangements of Asn224 alone cannot prevent its side chain from clashing with neighboring atoms. (B) G224N mutation in EBOV GP affects the binding of VH3-15/Vl1-40 mAbs. Binding curves from ELISA assays with either EBOV GP wild-type (WT) or the G224N for the three different VH3-15/Vl1-40 mAbs. Error bars show standard deviations of technical replicates. The binding assays were repeated twice. (C) Introducing a glycine to BDBV GP enables binding by VH3-15/Vl1-40 mAbs. Binding curves from ELISA assays with either BDBV GP WT or the N224G for the three different VH3-15/Vl1-40 mAbs. Error bars show standard deviations of technical replicates. The binding assays were repeated three times. See also Figure S3.

domain, and the VH3-15/Vl1-40 mAbs bind GP in an orientation that allows three Fabs to bind a single trimeric GP simultaneously (Figure 1B). The fact that density is not visible for the glycan cap regions of GP (Figure 1A) indicates that VH3-15/ Vl1-40 mAbs do not interact with this region. Indeed, superimposing EBOV GP/5T0180 with a previously determined crystal structure of GP reveals that the binding orientation of VH3-15/ Vl1-40 mAbs allow them to completely avoid the glycan cap regions (Figure 1C). This attribute distinguishes VH3-15/Vl1-40 4 Cell Host & Microbe 27, 1–10, March 11, 2020

mAbs from mAb114 (Misasi et al., 2016), which binds this region in a different manner and interacts with the glycan cap as part of its epitope (Figure S2). Avoiding the glycan cap may be an advantageous property for VH3-15/Vl1-40 mAbs because the glycan cap is highly variable in sequence among Ebolavirus species (Lee et al., 2008). Overall, these structures demonstrate that rVSV-ZEBOV, and likely ChAD3-ZEBOV as well, elicits convergent VH3-15/Vl1-40-based humoral response against the receptor-binding site on GP1.

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

Figure 4. Epitope Recognition by VH3-15/Vl1-40 mAbs (A) The heavy-chain contribution to the paratope. The heavy chains of the three mAbs are shown using ribbon representation together with a single light chain (mAb 5T0180, yellow) that is shown in a surface representation. The relevant EBOV GP fragment that makes the epitope is shown with ribbons using the same colors as in Figure 2A. The residues that contact EBOV GP are shown as sticks and are labeled. Grey-dashed lines indicate salt bridges. (B) Each VH3-15/Vl1-40 mAb utilizes a distinct CDRH3 for binding. Close-up views of the CDRH3 of the three mAbs, represented as wires. The single amino acid from each CDR that interacts with EBOV GP is highlighted using stick representations. Each CDR adopts a different conformation. (C) The light-chain contribution to the paratope. The light chains of the three mAbs are shown as ribbons and the residues that contact EBOV GP are shown as sticks. A single heavy chain (mAb 5T0180) is shown using surface representation for clarity. Polar contacts are shown using dashed gray lines. See also Figure S4.

Structural Basis for the Specificity of VH3-15/Vl140 mAbs At the center of the recognition site of GP by VH3-15/Vl1-40 mAbs is a short loop (‘‘Main I’’, residues 114–119 between b7 and b8) that is buried in a groove formed between the VH and the VL domains and accounts for a significant portion of the binding interface (Figure 2A). In addition, a second nearby loop (‘‘Main II’’, residues 144–146 between b9 and b10) contributes to the binding site (Figure 2A). These two loops are mostly conserved in other Ebolavirus species with the exception of a single Pro116 to Ala substitution in BDBV compared to EBOV and SUDV (Figure 2B). Two additional residues on EBOV GP (Glu231 and Gly224) complete the epitope (the ‘‘Auxiliary’’ region, between b14 and b15) and are not conserved among Ebolavirus species (Figures 2A and 2B). The three VH3-15/ Vl1-40 mAbs contact almost identical regions on EBOV GP, burying 1329 A˚2 on average upon complex formation

(Figure 2C). A substantial part of this epitope overlaps with the Niemann-Pick C1 (NPC1) receptor-binding site (Wang et al., 2016) on EBOV GP (Figure 2D), suggesting that VH315/Vl1-40 mAbs neutralize viruses in a similar way to mAb114 (Misasi et al., 2016) by interfering with binding to NPC1. Indeed, VH3-15/Vl1-40 mAbs retain binding to a thermolysine-cleaved EBOV GP (GPcleaved) that is lacking the glycan cap in acidic pH (Figure 2E) and compete with the binding of EBOV GPcleaved to NPC1 (Figure 2F). Of the various epitope sequence variations among the Ebolavirus species (Figure 2B), the change of Gly224 to asparagine seems to be the most critical one for VH3-15/Vl1-40 mAbs as it may sterically interfere with their binding (Figure 3A). In accordance with this observation, the binding of mAbs 1T0227 and 3T0265 to EBOV GP is completely abrogated upon introducing a G224N mutation, and the binding of mAb 5T0180 is reduced (Figure 3B). These results correlate to the fact that Cell Host & Microbe 27, 1–10, March 11, 2020 5

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

Figure 5. Structural Basis for the Selection of VH3-15/Vl1-40 mAbs. (A) Germline residues that make the paratope. Sequence alignments of the three heavy and light chains with the respective VH3-15 and Vl1-40 germline consensus sequences. The paratope residues that appear in the germlines are highlighted in pink and are labeled. Paratope residues that resulted from somatic hypermutation are highlighted in green. (B) Lys52 supports the proper orientation of Trp33. A close-up view of the CDRH1 of the three mAbs showing a kinked conformation that allows the proper positioning of Trp33 for binding the Main I region of EBOV GP. Trp33 is stabilized by Lys52 from CDRH2. A shorter CDRH2 will orient the aspartic acid to a different direction. (C) A residue with bulky side chain at position 93 of the light chain will alter the paratope. A close-up view shows the light chains of the three mAbs (ribbon representation) and the two-germline tyrosine residues that make the binding site to EBOV GP. A bulky side chain for residue in position 93 cannot be accommodated in the observed configuration of CDRL1 due to potential clashes with either Leu5 or Ile30. (D) A bulky residue at position 93 of the light chain prevents binding to EBOV GP. Single-cycle kinetic analyses of the binding of EBOV GP as an analyte to mAb 1T0227 (blue) and to mAb 1T0227-S93L mutant. The EBOV GP was injected at the indicated concentrations. Inset shows Coomassie-stained SDS-PAGE analysis of the two mAbs. This image was cropped from the original gel to eliminate irrelevant lanes as well as high- and low-molecular-weight regions. The mAbs were immobilized on a protein-A sensor chip at equal densities. This analysis was repeated twice, and a representative plot is shown. See also Figure S5.

mAb 5T0180, but not mAb 1T0227 or mAb 3T0265, displays some residual binding toward the GPs of BDBV and SUDV (Figure S3). Moreover, introducing a glycine residue to BDBV GP at the 224 position enables all the VH3-15/Vl1-40 mAbs to efficiently bind it (Figure 3C). Hence, the 224-asparagine alteration in BDBV and SUDV is a major factor that restricts cross-reactivity of VH3-15/Vl1-40 mAbs. CDRH3 of VH3-15/Vl1-40 mAbs Do Not Play a Major Role in Antigen Binding Structural analyses of the VH3-15/Vl1-40 mAbs-EBOV GP complexes reveal that the heavy chains of the mAbs make only few direct contacts with the GP antigen (Figure 4A). Trp33, which is located at the very end of the complementarity-determining region (CDR) of heavy chain-1 (CDRH1), is making the cavity wall that buries the Main I loop of EBOV GP (Figure 4A). Asp56 is located on CDRH2 and is forming a salt bridge with EBOV 6 Cell Host & Microbe 27, 1–10, March 11, 2020

Lys114, which is also part of the Main I epitope (Figure 4A). Strikingly, the CDRH3 of the various mAbs do not display any common conformation (Figure 4A) and seems to barely make any interactions with EBOV GP (Figure 4B). Specifically, a single but different residue at the base of each CDRH3 (Phe103, His101, and Pro102 for mAbs 5T0180, 1T0227, and 3T0265, respectively) interacts with the aliphatic region of the EBOV Asp117 side chain (Figure 4B). In addition, EBOV Asp117 makes a hydrogen bond with the main-chain amine group of Phe103 in the case of mAb 5T0180 and has a potential to form a hydrogen bond (as a putative hydrogen donor) with a main-chain carbonyl of Pro102 in the case of mAb 3T0265 (Figure 4B). The limited usage in CDRH3 for antigen binding is intriguing because antibodies often utilize this CDR as a central component for antigen recognition. This observation explains the surprising lack of convergence in CDRH3 sequences, as we previously observed (Ehrhardt et al., 2019).

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

Figure 6. Inferred Germline mAbs Bind EBOV GP Inferred germline mAbs bind EBOV GP. ELISA assays using inferred germline versions of mAbs 1T0227 and 5T0180 (green and orange triangles, respectively) as well as the mature versions (green and orange circles, respectively) to GPs from EBOV, BDBV, and SUDV as indicated. Binding specificity is shown using the unrelated gp140 of HIV-1. Positive controls for BDBV GP, SUDV GP, and HIV-1 gp140 are shown in gray circles and squares. Error bars represent standard deviations of technical replicates.

In contrast to the restricted contacts that the heavy chains make with the EBOV GP antigen in general and the limited usage in CDRH3 in particular, the light chains of VH3-15/Vl1-40 mAbs seem to have a more substantial role for binding GP (Figure 4C). Two tyrosine residues that are located at CDRL1 (Tyr34) and at the base of CDRL3 (Tyr94) make tight hydrophobic interactions with two proline residues at the Main II (Pro146) and Main I (Pro116) regions on EBOV GP, respectively (Figure 4C). The two tyrosine residues are positioned in a way that their sidechain phenol rings are parallel to the cyclic pyrrolidine side chain of the proline residues. Asp100 at the CDRL3 makes additional important contacts with EBOV GP by forming a hydrogen bond network involving the side chain of Thr144 from Main II and the main chain amine group of Gly224 from the Auxiliary region of EBOV GP (Figure 4C). In addition, in mAbs 5T0180 and 3T0265, there are arginine residues in position 99 that form salt bridges with Glu231 of EBOV GP (Figure 4C). In mAb 1T0227, there is a serine residue in position 99 that does not contribute to binding to GP. Altogether, the light chains of VH3-15/Vl1-40 mAbs make critical contacts with EBOV GP, mostly through their CDRL3 segments. Structural Basis for VH3-15/Vl1-40 Usage A critical question is why is this specific combination of VH3-15 and Vl1-40 selected to target this epitope on EBOV GP. Analyzing the sequences of the three mAbs and comparing them with the germline sequences reveal that the two critical residues of the heavy chains (Figure 4A) that mediate the interaction with EBOV GP (i.e., Trp33 and Asp56) are already present in the VH3-15 gene (Figure 5A). This combination of tryptophan and aspartic acid in positions 33 and 56, respectively, is not common but does appear in other VH genes, especially in the VH3 family (Figure S4). A closer look at the sequences of the VH3 family reveals that the few other VH genes that have both Trp33 and an aspartic acid at the CDRH2, like VH3-7 and VH3-74, have shorter CDRH2 loops (Figure S5), which will prevent from the aspartic acid to engage with GP in a similar configuration as seen in the VH3-15/Vl1-40 mAbs. Moreover, unlike other genes in the VH3 family, the VH3-15

has a lysine at position 52 of CDRH2 (Figure S5) that stabilizes Trp33 in the GP-bound conformation (Figure 5B). Alternative residues in this position like serine, which is the consensus residue, may be less suitable for supporting Trp33 in its bound configuration. Hence, multiple differences account for the specific selection of the VH3-15 germline gene. Of the four light chain residues that contact EBOV GP (Figure 4C), the two tyrosine residues (i.e., Tyr34 and Tyr94) are already present in the Vl1-40 germline gene (Figure 5A). The other two CDRL3 residues (Asp100 and Arg99, except in the case of mAb 1T0227) differ from the Vl1-40 germline gene sequence (Figure 5A) and are thus likely a result of affinity maturation. Sequence alignment of the Vl germline genes shows that a combination of two tyrosine residues at positions 34 and 94 is infrequent (Figure S4). Trying to rationalize the selection of Vl140, we noticed that all other Vl genes, as in Vl8-61 or Vl7-43, there is a bulky residue preceding Tyr94 (Figure S4). A bulky residue like leucine, instead of a serine in the case of Vl1-40, will not be able to pack the same way, as we observe in our structures, due to steric interference with either Ile30 or Leu5 (Figure 5C). In such a scenario, we postulate that the relative orientation between Tyr34 and Tyr94 that is compatible with binding to EBOV GP will not be maintained. Indeed, mutating Ser93 to leucine in the light chain of mAb 1T0227 completely abrogated its ability to bind EBOV GP (Figure 5D). A closer look within the Vl1 family shows that only Vl1-40 has the two required tyrosine residues (Figure S5). Hence, the selection of both VH3-15 and Vl1-40 is rationalized by the presence of key interacting residues at the level of the germline genes. We next tested whether inferred germline versions of the mAbs would bind EBOV GP. We thus constructed, expressed, and purified the inferred germline mAbs of 1T0227 and 5T0180, as two representative mAbs, and tested binding to EBOV GP (Figure 6). Remarkably, both germline mAbs showed binding to EBOV GP (Figure 6), indicating that the specific germline residues that we have indicated above in the heavy and light chains are sufficient for mediating binding. Furthermore, at the concentration range that we have tested, some binding is visible in the case of BDBV GP but not in the case of SUDV GP (Figure 6). Cell Host & Microbe 27, 1–10, March 11, 2020 7

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

This suggests that BDBV may also elicit VH3-15/Vl1-40-based humoral responses. DISCUSSION The discovery of a robust VH3-15/Vl1-40-based humoral response that is generally elicited by the experimental EBOV GP-displaying vaccines rVSV-ZEBOV and ChAd3-ZEBOV is remarkable. Reproducibly eliciting similar immune responses in different individuals is a highly desired trait for vaccines. Using structural information for three mAbs in complex with EBOV GP, we demonstrated that the class VH3-15/Vl1-40 antibodies, albeit elicited in different vaccinated individuals, target the very same epitope on EBOV GP using highly similar mechanisms of binding. This mechanism is uncommon because it makes an elaborated usage in light-chain interactions and almost completely avoids the use of CDRH3. A notable discovery is that most of the main contacts that VH3-15/Vl1-40 utilize to target EBOV GP are already present in the germline genes (Figures 4A, 4C, and 5A), which by themselves are capable of binding EBOV GP (Figure 6). Besides rationalizing the actual selection of VH3-15 and Vl1-40, these findings suggest that maturation of VH3-15/Vl1-40 mAbs requires very few somatic hypermutation events, further implying that this branch of the humoral response could develop rapidly and in high probability. Preferred germline usage for targeting viral glycoproteins at specific sites was documented before. We have previously investigated highly efficient neutralizing mAbs that target the CD4 receptor-binding site on gp120 of HIV-1 (Diskin et al., 2011; Scheid et al., 2011) and found structural constrains that dictated a specific usage of VH1-2 (West et al., 2012). Another interesting example is a strong bias toward VH3-21/ Vl1-40 and VH3-11/Vl1-40 antibodies that was discovered in infants who were infected by respiratory syncytial virus (RSV) (Goodwin et al., 2018). These mAbs were effective against RSV even in the absence of somatic hypermutation and, similarly to the anti EBOV VH3-15/Vl1-40 mAbs, made critical usage of Tyr34 and Tyr94 from the Vl1-40 gene to bind the antigen (Goodwin et al., 2018). This highlights the Vl1-40 germline gene as a critical component of early response against a diverse set of viral glycoproteins. Achieving cross protection against more than a single Ebolavirus species with a single vaccine would be highly beneficial. The epitope that the VH3-15/Vl1-40 antibodies target is mostly conserved among Ebolaviruses with the exception of the Auxiliary region, which is the least conserved part of the epitope (Figure 2B). Asparagine residue at position 224 of GP as it appears in SUDV and BDBV, instead of glycine as in EBOV, is a particularly important change because it sterically prevents VH3-15/Vl1-40 antibodies that were elicited against EBOV GP from efficiently targeting other GPs (Figures 3B, 3C, 6, and S3). Engineering the Auxiliary region of the GPs to include an asparagine in position 224 may provide immunogens that would support the binding of the VH3-15/Vl1-40 germline mAbs on one hand (Figure 6) and, on the other hand, may further elicit a broader VH3-15/Vl1-40-based immune response. Overall, our findings inform on current vaccine regimens and offer possibilities for future improvements. 8 Cell Host & Microbe 27, 1–10, March 11, 2020

STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d d

d d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS B Cell Lines METHOD DETAILS B Vector Construction, and Mutagenesis B Protein Production and Purification B Generating EBOV GPcleaved B ELISA Analysis to Determine Antibody-Binding Activity to GPs B Cryo-EM Image Acquisition, Data Processing, and Model Building B Structure Analysis and Visualization B Generation of Alignments B Surface Plasmon Resonance (SPR) measurements QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. chom.2020.01.007. ACKNOWLEDGMENTS We thank all the members of the Diskin and Klein labs for their comments and discussions. Electron microscopy studies were supported in part by the Irving and Cherna Moskowitz Center for Nano and Bio-Nano Imaging at the Weizmann Institute of Science. The lab of R.D. is funded by the I-CORE Program of the Planning and Budgeting Committee and the Israel Science Foundation (grant nos. 1775/12 and 682/16), the Moross Integrated Cancer Center, the Dr. Barry Sherman Institute for Medicinal Chemistry, the Jeanne and Joseph Nissim Center for Life Sciences Research, and the Estate of Emile Mimran. Support was further provided by the German Center for Infection Research (DZIF to F.K.), the German Research Foundation (CRC1310 to F.K.), and the European Research Council (ERC-StG639961 to F.K.). Coordinate files and density maps were deposited and are available at the protein data bank under accession codes: 6S8D, 6S8I, and 6S8J for EBOV GP/1T0277, EBOV GP/ 3T0265, and EBOV GP/5T0180, respectively. AUTHOR CONTRIBUTIONS R.D. and F.K. designed and oversaw the project. H.C.-D. and M.K. produced proteins. H.C.-D. performed binding studies. H.C.-D. and N.E. collected EM data. R.D. and H.C.-D. solved structures and performed structural analysis. M.Z. and S.E. cloned and produced antibodies. M.Z. produced proteins and performed binding experiments as well as generated sequence alignments. R.D. wrote the manuscript with the help of all other authors. DECLARATION OF INTERESTS A patent application encompassing aspects of this work has been filed by the University of Cologne and the Weizmann Institute of Science, listing S.E., M.Z., R.D., and F.K. as inventors. Received: November 14, 2019 Revised: December 31, 2019 Accepted: January 14, 2020 Published: February 13, 2020

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

REFERENCES Adams, P.D., Afonine, P.V., Bunko´ czi, G., Chen, V.B., Davis, I.W., Echols, N., Headd, J.J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010). PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221.

Kennedy, S.B., Bolay, F., Kieh, M., Grandits, G., Badio, M., Ballou, R., Eckes, R., Feinberg, M., Follmann, D., Grund, B., et al.; PREVAIL I Study Group (2017). Phase 2 Placebo-Controlled Trial of Two Vaccines to Prevent Ebola in Liberia. N. Engl. J. Med. 377, 1438–1447. Lee, J.E., Fusco, M.L., Hessell, A.J., Oswald, W.B., Burton, D.R., and Saphire, E.O. (2008). Structure of the Ebola virus glycoprotein bound to an antibody from a human survivor. Nature 454, 177–182.

Baize, S., Pannetier, D., Oestereich, L., Rieger, T., Koivogui, L., Magassouba, N., Soropogui, B., Sow, M.S., Keı¨ta, S., De Clerck, H., et al. (2014). Emergence of Zaire Ebola virus disease in Guinea. N. Engl. J. Med. 371, 1418–1425.

Lopez, M.E., Klein, A.D., Dimbil, U.J., and Scott, M.P. (2011). Anatomically defined neuron-based rescue of neurodegenerative Niemann-Pick type C disorder. J. Neurosci. 31, 4367–4378.

Bornholdt, Z.A., Turner, H.L., Murin, C.D., Li, W., Sok, D., Souders, C.A., Piper, A.E., Goff, A., Shamblin, J.D., Wollen, S.E., et al. (2016). Isolation of potent neutralizing antibodies from a survivor of the 2014 Ebola virus outbreak. Science 351, 1078–1083.

Marzi, A., Halfmann, P., Hill-Batorski, L., Feldmann, F., Shupert, W.L., Neumann, G., Feldmann, H., and Kawaoka, Y. (2015). Vaccines. An Ebola whole-virus vaccine is protective in nonhuman primates. Science 348, 439–442.

Cohen-Dvashi, H., Kilimnik, I., and Diskin, R. (2018). Structural basis for receptor recognition by Lujo virus. Nat. Microbiol. 3, 1153–1160.

Misasi, J., Gilman, M.S., Kanekiyo, M., Gui, M., Cagigi, A., Mulangu, S., Corti, D., Ledgerwood, J.E., Lanzavecchia, A., Cunningham, J., et al. (2016). Structural and molecular basis for Ebola virus neutralization by protective human antibodies. Science 351, 1343–1346.

Corti, D., Misasi, J., Mulangu, S., Stanley, D.A., Kanekiyo, M., Wollen, S., Ploquin, A., Doria-Rose, N.A., Staupe, R.P., Bailey, M., et al. (2016). Protective monotherapy against lethal Ebola virus infection by a potently neutralizing antibody. Science 351, 1339–1342. Crooks, G.E., Hon, G., Chandonia, J.M., and Brenner, S.E. (2004). WebLogo: a sequence logo generator. Genome Res. 14, 1188–1190. Davey, R.T., Jr., Dodd, L., Proschan, M.A., Neaton, J., Neuhaus Nordwall, J., Koopmeiners, J.S., Beigel, J., Tierney, J., Lane, H.C., Fauci, A.S., et al.; PREVAIL II Writing Group; Multi-National PREVAIL II Study Team (2016). A Randomized, Controlled Trial of ZMapp for Ebola Virus Infection. N. Engl. J. Med. 375, 1448–1456. De Santis, O., Audran, R., Pothin, E., Warpelin-Decrausaz, L., Vallotton, L., Wuerzner, G., Cochet, C., Estoppey, D., Steiner-Monard, V., Lonchampt, S., et al. (2016). Safety and immunogenicity of a chimpanzee adenovirusvectored Ebola vaccine in healthy adults: a randomised, double-blind, placebo-controlled, dose-finding, phase 1/2a study. Lancet Infect. Dis. 16, 311–320.

Mittler, E., Schudt, G., Halwe, S., Rohde, C., and Becker, S. (2018). A Fluorescently Labeled Marburg Virus Glycoprotein as a New Tool to Study Viral Transport and Assembly. J. Infect. Dis. 218 (suppl_5), S318–S326. Moekotte, A.L., Huson, M.A., van der Ende, A.J., Agnandji, S.T., Huizenga, E., Goorhuis, A., and Grobusch, M.P. (2016). Monoclonal antibodies for the treatment of Ebola virus disease. Expert Opin. Investig. Drugs 25, 1325–1335. Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng, E.C., and Ferrin, T.E. (2004). UCSF Chimera–a visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612. Punjani, A., Rubinstein, J.L., Fleet, D.J., and Brubaker, M.A. (2017). cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat. Methods 14, 290–296.

Diskin, R., Scheid, J.F., Marcovecchio, P.M., West, A.P., Jr., Klein, F., Gao, H., Gnanapragasam, P.N., Abadir, A., Seaman, M.S., Nussenzweig, M.C., and Bjorkman, P.J. (2011). Increasing the potency and breadth of an HIV antibody by using structure-based rational design. Science 334, 1289–1293.

Qiu, X., Wong, G., Audet, J., Bello, A., Fernando, L., Alimonti, J.B., FaustherBovendo, H., Wei, H., Aviles, J., Hiatt, E., et al. (2014). Reversion of advanced Ebola virus disease in nonhuman primates with ZMapp. Nature 514, 47–53.

€hling, V., Cohen-Dvashi, H., Kreer, C., Elad, N., Ehrhardt, S.A., Zehner, M., Kra Gruell, H., Ercanoglu, M.S., Schommers, P., Gieselmann, L., et al. (2019). Polyclonal and convergent antibody response to Ebola virus vaccine rVSVZEBOV. Nat. Med. 25, 1589–1600.

Rijal, P., Elias, S.C., Machado, S.R., Xiao, J., Schimanski, L., O’Dowd, V., Baker, T., Barry, E., Mendelsohn, S.C., Cherry, C.J., et al. (2019). Therapeutic Monoclonal Antibodies for Ebola Virus Infection Derived from Vaccinated Humans. Cell Rep. 27, 172–186.

Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501.

Rohou, A., and Grigorieff, N. (2015). CTFFIND4: Fast and accurate defocus estimation from electron micrographs. J. Struct. Biol. 192, 216–221.

Flyak, A.I., Shen, X., Murin, C.D., Turner, H.L., David, J.A., Fusco, M.L., Lampley, R., Kose, N., Ilinykh, P.A., Kuzmina, N., et al. (2016). CrossReactive and Potent Neutralizing Antibody Responses in Human Survivors of Natural Ebolavirus Infection. Cell 164, 392–405.

Sanchez, A., and Rollin, P.E. (2005). Complete genome sequence of an Ebola virus (Sudan species) responsible for a 2000 outbreak of human disease in Uganda. Virus Res. 113, 16–25.

Gilchuk, P., Kuzmina, N., Ilinykh, P.A., Huang, K., Gunn, B.M., Bryan, A., Davidson, E., Doranz, B.J., Turner, H.L., Fusco, M.L., et al. (2018). Multifunctional Pan-ebolavirus Antibody Recognizes a Site of Broad Vulnerability on the Ebolavirus Glycoprotein. Immunity 49, 363–374. Giudicelli, V., Chaume, D., and Lefranc, M.P. (2005). IMGT/GENE-DB: a comprehensive database for human and mouse immunoglobulin and T cell receptor genes. Nucleic Acids Res. 33, D256–D261.

Saphire, E.O., Schendel, S.L., Gunn, B.M., Milligan, J.C., and Alter, G. (2018). Antibody-mediated protection against Ebola virus. Nat. Immunol. 19, 1169–1178. Scheid, J.F., Mouquet, H., Ueberheide, B., Diskin, R., Klein, F., Oliveira, T.Y., Pietzsch, J., Fenyo, D., Abadir, A., Velinzon, K., et al. (2011). Sequence and structural convergence of broad and potent HIV antibodies that mimic CD4 binding. Science 333, 1633–1637. Schro¨dinger (2016). The PyMOL Molecular Graphics System.

Goodwin, E., Gilman, M.S.A., Wrapp, D., Chen, M., Ngwuta, J.O., Moin, S.M., Bai, P., Sivasubramanian, A., Connor, R.I., Wright, P.F., et al. (2018). Infants Infected with Respiratory Syncytial Virus Generate Potent Neutralizing Antibodies that Lack Somatic Hypermutation. Immunity 48, 339–349.

Stanley, D.A., Honko, A.N., Asiedu, C., Trefry, J.C., Lau-Kilby, A.W., Johnson, J.C., Hensley, L., Ammendola, V., Abbate, A., Grazioli, F., et al. (2014). Chimpanzee adenovirus vaccine generates acute and durable protective immunity against ebolavirus challenge. Nat. Med. 20, 1126–1129.

Gunn, B.M., Yu, W.H., Karim, M.M., Brannan, J.M., Herbert, A.S., Wec, A.Z., Halfmann, P.J., Fusco, M.L., Schendel, S.L., Gangavarapu, K., et al. (2018). A Role for Fc Function in Therapeutic Monoclonal Antibody-Mediated Protection against Ebola Virus. Cell Host Microbe 24, 221–233.

Tiller, T., Meffre, E., Yurasov, S., Tsuiji, M., Nussenzweig, M.C., and Wardemann, H. (2008). Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J. Immunol. Methods 329, 112–124.

Cell Host & Microbe 27, 1–10, March 11, 2020 9

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

von Boehmer, L., Liu, C., Ackerman, S., Gitlin, A.D., Wang, Q., Gazumyan, A., and Nussenzweig, M.C. (2016). Sequencing and cloning of antigen-specific antibodies from mouse memory B cells. Nat. Protoc. 11, 1908–1923. Wang, H., Shi, Y., Song, J., Qi, J., Lu, G., Yan, J., and Gao, G.F. (2016). Ebola Viral Glycoprotein Bound to Its Endosomal Receptor Niemann-Pick C1. Cell 164, 258–268. West, A.P., Jr., Diskin, R., Nussenzweig, M.C., and Bjorkman, P.J. (2012). Structural basis for germ-line gene usage of a potent class of antibodies tar-

10 Cell Host & Microbe 27, 1–10, March 11, 2020

geting the CD4-binding site of HIV-1 gp120. Proc. Natl. Acad. Sci. USA 109, E2083–E2090. Wong, G., Audet, J., Fernando, L., Fausther-Bovendo, H., Alimonti, J.B., Kobinger, G.P., and Qiu, X. (2014). Immunization with vesicular stomatitis virus vaccine expressing the Ebola glycoprotein provides sustained long-term protection in rodents. Vaccine 32, 5722–5729. Zhao, Y., Ren, J., Harlos, K., Jones, D.M., Zeltina, A., Bowden, T.A., PadillaParra, S., Fry, E.E., and Stuart, D.I. (2016). Toremifene interacts with and destabilizes the Ebola virus glycoprotein. Nature 535, 169–172.

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Donkey Anti-Human IgG H&L (HRP)

abcam

Cat# ab102429; RRID: AB_10711395

HRP- conjugated goat anti-human IgG antibody

Jackson ImmunoResearch

Cat# 109-035-003; RRID: AB_2337577

Antibodies

Chemicals, Peptides, and Recombinant Proteins EBOV GP Foldon His

This manuscript

N/A

BDBV GP Foldon His

This manuscript

N/A

EBOV GP Avi GCN4 His

(Ehrhardt et al., 2019)

N/A

BDBV GP Avi GCN4 His

(Ehrhardt et al., 2019)

N/A

SUDV GP Avi GCN4 His

(Ehrhardt et al., 2019)

N/A

NPC1 TEV Fc

This manuscript

N/A Cat# 12338018

FreeStyle 293 Expression Medium

Life Technologies

PEI 25kDa and PEI Max 40kDa

Polysciences

Cat# 23966 and 24765

Papain

Sigma

Cat# P4762

Thermolysin

Sigma

Cat# T7902

TMB

Sigma

Cat# T0440

ABTS

ThermoFisher Sci.

Cat# 002024

EBOV GP/1T0277

This manuscript

PDB: 6S8D

EBOV GP/3T0265

This manuscript

PDB: 6S8I

EBOV GP/5T0180

This manuscript

PDB: 6S8J

Invitrogen

Cat# R79007

G224N zEBOV GP For Primer: CGCTACCAGGCCACAAACTTCGGCACCAACGAG

This manuscript

N/A

G224N zEBOV GP Rev Primer: CTCGTTGGTGCCGAAGTTTGTGGCCTGGTAGCG

This manuscript

N/A

N224G BDBV GP For Primer: GAACTATGTAGCCGACGGTTTCGGGACAAATATGAC

This manuscript

N/A

N224G BDBV GP Rev Primer: GTCATATTTGTCCCGAAACCGTCGGCTACATAGTTC

This manuscript

N/A

1T0277 LC S93L For Primer: GATTATTACTGCCAGCTCTATGACATCAGGC

This manuscript

N/A

1T0277 LC S93L Rev Primer: GCCTGATGTCATAGAGCTGGCAGTAATAATC

This manuscript

N/A

NPC1 TEV Fc For Primer: CGCGGATCCACCACCAATCCTGTAGAGCTC

This manuscript

N/A

NPC1 TEV Fc Rev Primer: GGGGTACCGTCACTGTTACTTTCCCG

This manuscript

N/A

EBOV foldon His pHLsec

This manuscript

N/A

BDBV foldon His pHLsec

This manuscript

N/A

EBOV Avi GCN4 His pCAGGS

(Ehrhardt et al., 2019)

N/A

BDBV Avi GCN4 His pCAGGS

(Ehrhardt et al., 2019)

N/A

SUDV Avi GCN4 His pCAGGS

(Ehrhardt et al., 2019)

N/A

G224N EBOV Avi GCN4 His pCAGGS

This manuscript

N/A

Deposited Data

Experimental Models: Cell Lines Human: HEK293F cells Oligonucleotides

Recombinant DNA

(Continued on next page)

Cell Host & Microbe 27, 1–10.e1–e4, March 11, 2020 e1

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

N224G BDBV foldon His pHLsec

This manuscript

N/A

mAb 1T0227 p3BNC Light chain

(Ehrhardt et al., 2019)

N/A

mAb 1T0227 p3BNC Heavy chain

(Ehrhardt et al., 2019)

N/A

Germline mAb 1T0227 p3BNC Light chain

This manuscript

N/A

Germline mAb 1T0227 p3BNC Heavy chain

This manuscript

N/A

mAb 3T0265 p3BNC Light chain

(Ehrhardt et al., 2019)

N/A

mAb 3T0265 p3BNC Heavy chain

(Ehrhardt et al., 2019)

N/A

mAb 5T0180 p3BNC Light chain

(Ehrhardt et al., 2019)

N/A

mAb 5T0180 p3BNC Heavy chain

(Ehrhardt et al., 2019)

N/A

Germline mAb 5T0180 p3BNC Light chain

This manuscript

N/A

Germline mAb 5T0180 p3BNC Heavy chain

This manuscript

N/A

mAb 1T0227 S93G p3BNC Light chain

This manuscript

N/A

NPC1 (Mouse) His EGFP

(Lopez et al., 2011)

Addgene (#53521)

NPC1 Tev Fc pHLsec

This manuscript

N/A

cryoSPARC V2 suite

(Punjani et al., 2017)

https://pymol.org/2/

CTFFIND4

(Rohou and Grigorieff, 2015)

https://grigoriefflab.umassmed. edu/ctffind4

Geneious 10.1

N/A

https://www.geneious.com/

WebLogo3

(Crooks et al., 2004)

https://weblogo.berkeley.edu/

UCSF chimera

(Pettersen et al., 2004)

https://www.cgl.ucsf.edu/chimera/

Phenix

(Adams et al., 2010)

https://www.phenix-online.org/

PyMol

(Schro¨dinger, 2016)

https://pymol.org/2/

Coot

(Emsley et al., 2010)

https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/

Software and Algorithms

LEAD CONTACT AND MATERIALS AVAILABILITY This study did not generate new unique reagents. Further information and requests for resources or any particular plasmid that was used in this study should be directed to, and will be fulfilled by, the Lead Contact, Ron Diskin ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell Lines HEK293F cells were obtained from Invitrogen and maintained in FreeStyle Medium (Life Technologies) at 37  C with 8% CO2, shaking at 130 rpm in a humidified incubator. At a concentration of 1 3 106 cells ml 1, transfections were performed using either 25 kDa or 40kDa polyethylenimine (PEI, Polysciences) with 1 mg DNA ml 1 cell suspension. Cells were maintained for under two months before returning to lower-passage frozen stock. METHOD DETAILS Vector Construction, and Mutagenesis For structure determination the ectodomain of Zaire Ebola virus (EBOV; PDB Seq ID: 5JQB_A) GP was chemically synthesized (Genscript) to eliminate the mucin-like region and to include a C-terminal trimerization domain of T4 fibritin (foldon) followed by a His-tag as previously reported (Zhao et al., 2016). The truncated EBOV GP gene was subcloned into a modified pHLsec expression vector (BD Biosynthesis). G224N mutation was introduced to EBOV using mutagenesis PCR. For binding experiments, recombinant Ebolavirus GP constructs were designed as previously described (Ehrhardt et al., 2019). Briefly, EBOV Makona (GenBank: KJ660347 (Baize et al., 2014)), BDBV (GenBank: FJ217161 (Flyak et al., 2016)), and SUDV Gulu (GenBank: AY729654.1 (Sanchez and Rollin, 2005)) lacking the TM domain (D651-676) were cloned into pCAGGS backbone (Mittler et al., 2018). GP constructs carried an Avi-tag, a His-tag for purification, and GCN4 domain for C-terminal trimerization (Corti et al., 2016). Bondibugyo virus (BDBV) GP was chemically synthesized (Synbio Tech.) and subcloned similarly to the EBOV GP generated for structural studies. N224G mutation was introduced to BDBV using mutagenesis PCR. e2 Cell Host & Microbe 27, 1–10.e1–e4, March 11, 2020

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

For cloning of the EBOV GP-specific mAbs, variable antibody regions were introduced into mAb expression vectors by sequenceand ligation-independent cloning (SLIC) as previously described (Ehrhardt et al., 2019; von Boehmer et al., 2016). Briefly, fragments were amplified by standard PCR using Q5 High Fidelity polymerase (NEB) with described primer sets (Tiller et al., 2008). Amplicons were purified (GeneJET Gel Extraction and DNA Cleanup Micro Kit, Macherey Nagel), and cloned into expression vectors containing the IgG1 constant region by SLIC reaction using T4 DNA polymerase (NEB) and subsequently transduced into E.coli DH5a. S93G mutation was introduced to the light chain of mAb 1T0227 using mutagenesis PCR. For generation of the inferred germline mAbs the sequences of VH3-15*01 and Vl1-40*01 (IMGT/GENE data base (Giudicelli et al., 2005)) were used and the CDR3s of 1T0227 (CDRH3: TTDVPDYNSAYYWVY, CDRL3: QSYDSSLSGSYV) or 5T0180 (CDRH3: TTGPFYCDTCGPNDY, CDRL3: QSYDSSLSGSVV) inserted. For cloning of fusion protein NPC1-Fc, residues 374-620 (domain C) of mouse NPC1 (a kind gif of Matthew Scott (Lopez et al., 2011), Addgene vector #53521) were cloned upstream to a human Fc region derived from IgG1 and downstream a signal peptide using BamHI / KpnI restriction sites as previously described (Cohen-Dvashi et al., 2018) Protein Production and Purification For structure determination, the EBOV GP construct was transfected into HEK293F cells (Invitrogen) using 40 kDa polyethylenimine (PEI-MAX) (Polysciences) at 1 mg of plasmid DNA per 1 L of cells at a density of 1M cells/mL. To inhibit the formation of complex glycosylation, the mannosidase inhibitor kifunensine (Cayman Chemical) was added to a final concentration of 5 mM. Media were collected after 6 days and supplemented with 0.02% (w/v) sodium azide and PMSF. Media were collected and buffer exchanged to TBS (20 mM Tris-HCl pH 8.0, 150 mM sodium chloride) using a tangential flow filtration system (Merck Millipore). Protein was captured using a HiTrap IMAC FF Ni+2 (GE Healthcare) affinity column followed by size exclusion chromatography (SEC) purification with a Superdex200 10/300 column (GE Healthcare). Anti-EBOV IgG clones 1T0227, 3T0265 and 5T0180 were expressed in HEK293F suspension cells (Invitrogen) by co-transfecting the heavy and light chains encoding vectors. Transfections were carried out using PEI-MAX. Media were collected after 6 days of incubation and IgG were captured using protein-A affinity chromatography (GE Healthcare). IgGs were digested using Papain (Sigma-Aldrich) with enzyme and protein ratio being 1:20. Digestion proceeded for 60 min at 37 C in a buffer containing 20 mM Cystein-HCl (Sigma-Aldrich) and 10mM EDTA titered to pH 7.0. Fabs were separated from Fc fragments by collecting the flowthrough fraction from a protein-A column, followed by SEC on Superdex75 10/300 column. Fabs were mixed with EBOV ectodomain at a molar ratio of 1:2, and the GP/Fabs complexes were isolated by SEC on Superdex200 10/300. NPC1-Fc fusion protein was produced by transfecting the encoding vector to HEK293F cells using PEI-MAX. Further purification was similar to that of the IgG clones. For binding assays, Ebolavirus GP constructs were transduced into HEK293F cells using 25 kDa polyethylenimine (PEI, Polysciences). Supernatants were harvested after 7 days, filtered (0.45 mm filter; Nalgene, Thermo Fisher Scientific), and His-tagged proteins bound to Protino Ni-NTA (nitrilotriacetic acid) agarose beads (Macherey Nagel) overnight. Beads were pelleted, transferred into a column and washed 1x with NPI-10 (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) and 1x with NPI-20 (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0) buffer. Glycoproteins were eluted using NPI-100 (50 mM NaH2PO4, 300 mM NaCl, 100 mM imidazole, pH 8.0) and buffer was exchanged to PBS using centrifugal filter units (Amicon MWCO 30 kDa, Merck). Anti-EBOV IgG heavy and light chain-encoding plasmids were co-transfected into HEK293E cells with PEI reagent as described above. Cell-free supernatants were harvested after 7 days, and incubated with Protein G Sepharose (Merck) at 4 C overnight. Beads were transferred to columns, washed three times with PBS and antibodies were eluted with 0.1 M Glycine (pH 3.0). Subsequently, pH of eluate was neutralized with 1 M Tris-HCl (pH 8.0) and buffer was exchanged to PBS as described above. Generating EBOV GPcleaved Purified EBOV GP as was used for structure studies was digested with thermolysin (Sigma) to remove the glycan cap domain as previously described (Gilchuk et al., 2018). Briefly, 1 mg of EBOV GP was incubated with 0.2 mg/mL thermolysin (Sigma) in TBS buffer at 37 C for 1 h. Reaction was stopped by addition of phosphoramidon at a final concentration of 500 mM (sigma) at 4 C. ELISA Analysis to Determine Antibody-Binding Activity to GPs For EBOV GP G224N ELISA: High binding 96-well ELISA plates (Corning) were coated with 2.5 mg/mL GPs at 4 C overnight. After 3 x washing with PBST (PBS, 0.05% Tween-20), plates were blocked with PBST/5% BSA (Carl Roth) for 60 min at RT. mAbs were tested at 4-fold (1:3) dilutions with starting concentrations of 10 mg/mL. After 90 min of incubation at RT, plates were washed 3 x and incubated with horseradish peroxidase-conjugated goat anti-human IgG antibody (Jackson ImmunoResearch, 1:2000 in PBST/2% BSA) for 60 min at RT. Reaction was initiated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) solution (ABTS, Thermo Fisher Scientific) and absorbance (OD 415 nm - 695 nm) was measured with absorbance reader (Tecan). For BDBV GP N224G ELISA: High binding 96-well ELISA plates (Greiner Bio one inc) were coated with 2.5 mg/mL GP at 4 C overnight. After 3 x washing with PBST (PBS, 0.005% Tween-20), plates were blocked with PBST/1% BSA (MP biomedicals) for 60 min at 37 C. mAbs were tested at 10-fold dilutions in PBST/1% BSA with starting concentrations of 100 mg/mL. After 60 min of incubation at 37 C, plates were washed 3 x and incubated with horseradish peroxidase-conjugated donkey anti-human IgG antibody (abcam, 1:10000 in PBST/1% BSA) for 30 min at 37 C. Reaction was initiated with 3,3,5,5-Tetramethylbenzidine liquid substrate solution (TMB, Sigma Aldrich), and absorbance (OD 370nm) was measured with absorbance reader (Tecan). Cell Host & Microbe 27, 1–10.e1–e4, March 11, 2020 e3

Please cite this article in press as: Cohen-Dvashi et al., Structural Basis for a Convergent Immune Response against Ebola Virus, Cell Host & Microbe (2020), https://doi.org/10.1016/j.chom.2020.01.007

Cryo-EM Image Acquisition, Data Processing, and Model Building Complexes of EBOV / Fabs (0.4 mg/mL) were applied to a glow-discharged Quantifoil R 2/2 Cu 300 holey carbon grids (EMS) and plunge frozen in liquid ethane, using ThermoFisher Vitrobot plunger (2.5 s blotting time, 100% humidity). Cryo-EM data were collected on a Titan Krios electron microscope (FEI) operated at 300 kV. Coma-free alignment was performed with AutoCTF (FEI) and beam size was 1.9 mm. Movies were recorded on a falcon 3EC direct detector (ThermoFisher). Movies were collected in super-resolution counting mode at a nominal magnification of 96,000X corresponding to a physical pixel size of 0.849 A˚. The total dose rate was set to 1 electron per physical pixel per second and the total exposure time was 29.6 s, resulting in an accumulated dose of 40 electrons per A˚2. Each Movie was fractionated into 39 frames of 0.76 s. Nominal defocus range was 0.5 to 2.5 mm. A total of 602, 893, and 1199 movies were recorded to EBOV GP/1T0227, EBOV GP/3T0265, and EBOV GP/5T0180, respectively. The entire data processing was conducted using the cryoSPARC V2 suite (Punjani et al., 2017). Movies were motion-corrected and contrast transfer functions were fitted using CTFFIND4 (Rohou and Grigorieff, 2015) (for EBOV GP/1T0227 and EBOV GP/5T0180) or with the cryoSPARC own implementation (for EBOV GP/3T0265). Templates for auto picking were derived by 2D classification of manually picked particles. Following template-based autopicking, a total of 37,140, 73,375, and 100,499 good particles were selected based on iterative reference-free 2D classifications for reconstruction of EBOV GP/1T0227, EBOV GP/3T0265, and EBOV GP/5T0180, respectively. Initial reference maps were calculated using Ab-initio reconstruction and high-resolution maps were obtained by imposing C3-symmetry in non-uniform 3D refinement. Working maps were locally filtered based on local resolution estimates. Models were initially assembled by rigid-body fitting the crystallographic structure of EBOV GP (PDB: 5JQ3) (Zhao et al., 2016) into density maps using UCSF chimera (Pettersen et al., 2004) as well as of the VHVL portions from crystallographic structure of anti EBOV mAb (PDB: 6QCU), after eliminating its CDRs. All structures were subsequently completed and refined in an iterative manner using the Phenix real-space refinement tool (Adams et al., 2010) and by manually modeling and fitting them into density maps using Coot (Emsley et al., 2010). Structure Analysis and Visualization We used UCSF chimera (Pettersen et al., 2004) as well as PyMol (Schro¨dinger, 2016) for visualizing and analyzing the structures. Generation of Alignments Germline sequences were obtained from IMGT/GENE data base (Giudicelli et al., 2005) and alignments were done with Geneious software (version 10) using BLOSUM (BLOcks Substitution Matrix) with residue-specific and hydrophilic gap penalties (open gap penalty of 10, extended gap penalty 0.2). For sequence logo plots the software WebLogo3 (Crooks et al., 2004) was used. Surface Plasmon Resonance (SPR) measurements Binding of EBOV GP or EBOV GPcleaved to mAbs 5T0180 or 1T0277, and to NPC1–Fc fusion protein were measured using a Biacore T200 instrument (GE Healthcare). For binding of EBOV GPcleaved to mAbs, purified mAbs 5T0180 and 1T0277 were first immobilized at a coupling density of 1000 response units (RU) on a series S sensor chip protein A (GE Healthcare) in TBS and 0.02% sodium azide buffer. One of the four flow cells on the sensor chip was empty to serve as a blank. EBOV GPcleaved was then injected at a series of concentrations (i.e., 15.625, 31.25, 62.5, 125, and 250 nM) in sodium acetate pH 5.5 buffer, at a flow rate of 60 mL/min for single-cycle kinetics analysis. The sensor chip was regenerated using 10 mM Glycine-HCl pH 1.5 buffer. For assessing binding capability to mutant mAb 1T0277, the same upper mentioned procedures were followed, with the exception of using EBOV GP as the analyte in TBS (pH 8.0) buffer. For the binding of EBOV GPcleaved to NPC1 and competition with 1T0227, NPC1-Fc was amine coupled at 1000 RU on a CM5 sensor chip (GE Healthcare), followed by injection of EBOV GPcleaved (50 nM), either without or with 500 nM of mAb 1T0227 in sodium acetate pH 5.5 buffer. The chip was regenerated using TBS (pH 8.0). QUANTIFICATION AND STATISTICAL ANALYSIS All binding experiments were repeated at least twice, unless otherwise is mentioned. Data are reported as standard deviation from mean of four biological replicates. DATA AND CODE AVAILABILITY Accession codes: coordinates and structure factors were deposited in the Protein Data Bank with accession codes PDB: 6S8D, PDB: 6S8I and PDB: 6S8J.

e4 Cell Host & Microbe 27, 1–10.e1–e4, March 11, 2020