Structural modifications induced by the mtDBP-C protein in the replication origin of Xenopus laevis mitochondrial DNA

Biochimie (1990) 72, 65-72 t~) Soci6t6 de Chimie biologique/Elsevier, Paris

65

Structural modifications induced by the mtDBP-C protein in the repfication origin of Xenopus laevis mitochondrial D N A B Mignotte1., B Theveny2, B Revet2 ILaboratoire de Biologie G~n~rale, B~timent 400, Universit~de Paris Sud, 91405 Orsay Cedex; 2Laboratoire de Microscopie Cellulaire et Mol#culaire, lnstitut Gustave Roussy, 94805 Viilejuif Cedex, France (Received 6 December 1989; accepted after revision 15 January 1990)

Summary - The structure of the non-coding region of Xenopus laevis mitochondrial DNA has been studied by electron microscopy analysis of DNA molecules end-labelled with streptavidin- ferritin. We have shown that the effect of a protein modifying the shape of the DNA double-helix can be studied and precisely located by this method. It was found that the non-coding region contains curved segments and that the mitochondrial protein mtDBP-C preferentially enhances the curvature of the promoters-replication origin region. electron microscopy / DNA-binding pro,rein / mitochondrial DNA / DNA bending / DNA curvature

Introduction

The initiation of transcription of the 2 strands of vertebrate mitochondrial DNA (mtDNA) occurs in the noncoding region, and the origin of heavy-strand DNA synthesis (OH) is located doswnstream from a major promoter called LSP (light-strand promoter) [1, 2]. This promoter is also implicated in priming DNA synthesis which suggests that mitochondrial RNA polymerase and transcription factors could be involved in the RNA primer synthesis process. A major step in the switch from RNA synthesis to DNA replication could be the action of a RNAprocessing endoribonuclease (RNaseMRP) which cleaves RNA at one of the transition sites [3]. However, this site (a sequence conserved during evolution called CSB2) is not the major switch site in vivo. One possibility to explain this difference is that initiation of mtDNA synthesis is a complex process mediated by higher-order nucleoprotein complexes, as has been observed in various other systems [4-7]; this could modify the RNAse MRP specificity of cleavage in vivo. The formation of such a protein- nucleic acid structure would involve structural proteins as has been shown in the cases of Ori-C and Ori-A, where the E coli histonelike protein HU appears involved in the formation of the prepriming complexes [4, 8]. We previously isolated from Xenopus laevis mitochondria a protein called mtDBP-C, which displays the properties expected for a structural component of the

mitochondrial nucleoids (mtDNA/protein complexes). This protein binds cooperatively to DNA [9], introduces superhelical turns in covalently closed relaxed circular DNA in the presence of topoisomerase I [10] and seems to stabilize DNA loops in the molecules [9]. The protein HU also has these three properties [11-13], and it could be that the two proteins have similar functions. Specific properties of the DNA molecules in the replication origin regions also contribute to the initiation of this process. Lacking possibilities to easily transfect DNA into mitochondria or to reconstitute in vitro replication assays, directed mutagenesis cannot be used t-o identify the mtDNA sequences involved in the initiation of replication. However, elements maintained throughout evolution have been found at several levels. Conserved sequence blocks (called CSB1, 2 and 3) have been described [14]. Collective physical properties conserved during evolution (secondary structures, A T / G C constraints) have also been observed in the region of the switch-over from RNA primer to DNA synthesis [15, 16]. In some other systems an intrinsic bending of the DNA molecule was observed in the region necessary for the initiation of DNA replication [17-19]. Recently an intrinsic DNA curvature located in front of the light-strand replication origin of human mtDNA has been described [20], but has not been studied in the case of H-strand origin of replication. The present work is a study of the mtDNA structure

*Correspondence and reprints: Laboratoire d'Oncologie Mol6culaire, Institut Gustave Roussy, 94805 Villejuif Cedex, France

66

B Mignotte et al

in the Xenopus laevis H-strand replication origin region by electron microscopic analysis of ferritin endlabelled DNA fragments. We have shown that the effect of a protein that modifies the shape of the d o u b l e - h e l i x can be a n a l y z e d a n d precisely located b y this m e t h o d a n d we have s t u d i e d h o w the b i n d i n g o f the m i t o c h o n d r i a l protein m t D B P - C affects the curvature o f this region.

Materials and Methods Materials

The plasmid pXlmE2 corresponds to pUC18 with the EcoRI-HpAI fragment (nucleotides 2089-3995 according to Dunon et al [21]) which includes the promoters (LSP and HSP), the CSBs region and the origin of repfication (fig 1). Enzyme EcoRI and Pstl were purchased from Biolabs; BioUTP and streptavidin were from BRL; the protein mtDBP-C was purified as described in [10].

labelled fragments was passed through a Superose 6 column to eliminate the unbound ferritin. The purified solution of DNA fragments (0.5/~g/ml) was then incubated with the protein mtDBP-C at a concentration of 0.02/~g/ml so that the molecular ratio of protein to DNA was in the range of 400. This ratio corresponded approximately to that found in the mitochondria. After 5 min of incubation at room temperature in 5 mM Tris/HC! (pH 7.5), 0.2 mM EDTA, 200 mM NaCI, 0.5 mM 2-mercaptoethanol and 4% glycerol, an aliquot of 5/.d was deposited on a grid previously ionized with pentylamine as described by Dubochet et al [23]. The grid, washed with 3 drops of 2% aqueous uranyl acetate, was dried and observed under the electron microscope in dark-field mode [24]. The solution of ferritin end-labelled DNA molecules not incubated with the protein was prepared and observed in the same manner. The mitochondrial DNA fragment (1926 bp) and plasmid fragment (2664 bp) were easily distinguished by their length. All the measurements and the analyses carried out in this work study always refer to the fragment containing the insert of mitochondrial DNA.

Methods

The DNA samples prepared for electron microscopic observations w e r e purified by HPLC on a Superose 6 column (Pharmacia); DNA molecules were observed under a Zeiss 902 M electron microscope; images were analyzed with an image anlayzer Kontron (IPS Image Processing System). a"

Preparationof samples

°

"'°

•

t..~.~ "'" '~ i . .

The supercoiled plasmid (50/Lg/ml) was linearizedby the endonuclease EcoRI and then end-labelled with biodUTP as described by Theveny and Revet [22]. The linear molecule labelled at both ends was c u t by Pstl and incubated for 15 min with streptavidinfe~ritin (62/Lg/ml). The DNA solution containing the two end-

i

/

O

i .. '%. i

J

ip / tt 1160

! i

t,

TCTCAAAGTGGCTAACAGTGCAGA~ACGTAATAGGGT~GGACATATGGTCTTATCGGCT

i

AAGACGTACAC ~%AGTATTAT~ECATG GTGTTAAAAATGAAT~CATGACTGACATATTTT 1280 . T . . ACCCTTAATCAGAACGTGTTCCTCAGCTTTCCTATTATTATCCACC~GGGTTGAGAATTT 1340 TCTAATAAAAGACGTTTTTGCGCGCTAA~CCCCCCTACCCCCCAAATTAGCTTTTCCTGT 1400 . . CSB2.

!

% "'-%,

,,/B C"/,,..,""

AA~CCTTGTATTTTCCGTCA~CCCeAAAA=CGaA~.AATTTTACAT~C CAAT~ 1460

C8B3

TATTCTAAC CAAAACTCCT~I~GAGTTCCT/~CTTAG CTGTATAGAAGACATTTCTC CT GG 1520 ACTGTTAGC6TTGTATAGAATGACTAGAATAGGG~GCCATTACCCAAACCCATGTTATAC 1580 AI-~-I"I-rGTATATATATCGTA~ATA~CGTGATAAAKACTATATTAGTCTTTCCACTAGCAC 1640 . LSP. AACACTATTTCCATTACACATTATAACGTTAAAGTTAATTAATATCTTTTTGTACTGCT ~ 1700 . .HSP . ACGTAGCTTAAGTAAAGCACAGCACTGAAGATGCTGAGATGAGCCCTAG~t~GCTCCGAA 1760 AGCATAAAGGTTTGGTC CTAGCCTTATTATCAACTTTTTCTGAACTTACACATG CAA G CA 1820 TCCGCACTCCCGTGAAAATGCCCTTAAGCCTCTTAAACAGGGGATAAGGAGCCGGTATCA 1880 GGCACAACTAATAGCCCATGACACCTTGCTCTGCCACACCCACAAGGGAA •

.

.

.

F'g 1. Nucleotide sequence of L-strand of the promoters and replication origin region of X e n o p u s laevls m t D N A (from Dunon-Bluteau et al [21, 38] and Cairns et al [39, 40]): the position of the promoters (HSP and LSP), conserved sequence blocks (CSB 1, 2 and 3) and R N A - D N A synthesis transition sites (T) are indicated. The numeration corresponds to that of the studied fragment (! 926 bp).

D=s/d II

Fig 2. Calculation of the curvature: each micrograph is defined as a 512 × 512 pixels image. 4 0 0 - 5 0 0 points are taken along the molecule. The ratio S D = s / d , where s stands for the curvilinear distance and d for the linear distance, is calculated between two points separated by 150 bp. SD is calculated every 30 bp so that 64 local values are determined. The average of the local values of SD ebtained on each molecule is calculated and a final map of curvature is constructed by conversion of SD in w (expressed in degree per base pair).

67

Structure of the mtDBP-C protein / mtDNA complexes

Image analysis 200 individually-labelled molecules of naked DNA and 200 orientated molecules of DNA incubated with the mtDBP-C were recorded on video tape and analyzed with an image analyzer. An image was made of 512 x 512 pixels (picture elements). Each individual molecule was digitized by taking 400-500 couples of coordinates along its contours. The digitization always began at the unlabelled end. Using the coordinates X and Y maps of curvature were calculated for naked DNA and for DNA incubated with the protein as follows. We have previously shown that it is possible to quantify the curvature of a DNA molecule observed by electron microscopy (EM) [25] using an extension of the formula of Landau and Lifshitz [26]. In the present work we have used the ratio S D = s / d [27] where s is the curvilinear distance between two points of the trajectory and d is the linear distance between the same points (fig 2); this ratio is then transformed in w (expressed in degrees per base pair) as described by Muzard et al [28]. The distance in base pairs between two points was chosen equal to 510 A (150 bp), as this value is close to the persistence length [29, 30] and under these conditions the fluctuation of the ratio s / d is mainly attributed to the variations of the shape of the molecule rather than to the variations in its flexibility [29]. The ratio is calculated every 30 bp (64 values of SD for a fragment of 1926 bp) and the curvature maps obtained by taking the average of the local values of w for the 200 molecules. Each point of the curve is.the mean of 200 values. We have previously shown that 150 molecules are needed to construct a map of curvature with sufficient reproducibility. This number was determined by a statistical analysis and comparison of maps obtained in groups of increasing number of molecules [28].

Results

Curvature Naked D N A Some characteristic naked DNA molecules with streptavidin-ferritin linked at one e na ~ro presented in figure 3A and 3B. The yield of the labelling was determined to be 58%. The trajectories of the DNA molecules observed in the pictures appear to be without strong folding or sharp bends and loops do not frequently occur. The map of curvature obtained for these molecules is presented in figure 4B. Variations in w are observed along the molecule. The straight line indicates the mean of the 64 experimental values of w used to make the map. Two regions of high curvature are found. One spans from position 150-750 bp and a second from position 1250-1480 bp. Each region has a binodal aspect: peaks a, b for region I and peaks c, d in the region II. The values of curvature in these peaks are as high as those obtained for the highly curved regions of pBR322 analyzed under the same conditions (0.9°/bp 1261). A theoretical map of curvature constructed using the model improved by Trifonov et al [30, 31] is shown in figure 4A. The theoretical values of curvature expressed in o / b p are calculated by an analysis of the trajectory in the space of the DNA path. The coordinates of each base pair are obtained as described [28] with a window

of 150 bp and a step of 30 bp. The correlation between the experimental and the theoretical maps can be appreciated. Their global shapes are unchanged, especially in the region 1200 bp to 1926 bp. The main difference between the two curves consists of a shift to upper values in the experimental graph. The mean experimental curvature is roughly twice that obtained from the theoretical map. Another difference is observed in the region spanning position 800-1200 bp which exhibits some curvature in the experimental graph, but none in the theoretical map. DNA incubated with the protein mtDBP-C It is known lhat the interaction of the protein mtDBPC with supercoiled, relaxed or linearized DNA is cooperative. We have previously visualized and analyzed this phenomen by electron mlcroscopy [9]. The fixation of one molecule of protein is quickly followed by the binding of a second one, so that the molecule of DNA appears rapidly condensed. Such highly condensed molecules were not taken into account in this analysis as their path cannot be clearly defined. However, the countour of the DNA molecules which have interacted with only a few of the proteins can be followed. This fraction of the population of such weakly condensed DNA molecules represents 20-25% of the total. We have focused our interest on this type of molecule in order to study the initiation of cooperative fixation of the protein. It should be noted that the protein mtDBP-C also interacts with the fragment of pUC18 DNA which is condensed in a similar manner. The DNA molecules are characterized by numerous l~,~,r~c ll~;r, llr~ iqi,,,lllqi,,illp~ 9 J [ I L I I I J [ I L O

r~r ch~r~ kenrlc ~llli,ll, l p 7 llllbll~

'lllP]L

~ ! ! f~~ llg~i ~ r. J~C lnl [

Lllll

t h e i r tr2j~t.tr~r/~c LllIO'll

Wwl~lJg t ~ l , I J l l ~ L ,

~F

in pictures C, D, E, F, G, H, I of figure 3. The protein is not easily visualized, but its presence is revealed by a densification of the double helix in the region of interaction as indicated by arrows in pictures G and H. It should be noted that DNA-protein interactions forming loops have already been visualized by the same electron microscopic procedure in our laboratory [32, 33]. The proteins in these cases, oligomers of hormone receptors (110 kDa for the monomer) and lac repressor (152 kDa), were clearly identified because their molecular weights are greater than that of the mtDBP-C used in this study (31 kDa) [10]. Figure 4C shows the map of curvature obtained for the DNA incubated with the protein mtDBP-C. The graph is divided in two parts. One extends from 1-1200 bp with a level of curvature equal to that measured for the naked DNA w = 0.8°/bp. On the contrary, the second part of the curve (1000-1926) differs from the map in figure 4B. The position of the main peaks is not modified, but the level of curvature is higher (w= 1.2° / bp instead of 0.93° / bp). The cu~ed region overlaps the position of the CSB region. This analysis reveals that the main effect of the protein

6~q

B Mignotte et al

B

F

;4 (/

#- :: ...... .li~. , t

-

,-j

Hg 3. Electron micrographs: A and B: naked D N A molecules. The end labelled with streptavidin-ferritin is easily identified. C and D: DNA molecules incubated with the mtDBP-C. E - I : high magnification of the different structures observed in the presence of the protein. Loops: E, H, I. Sharp bend: F, G. Kink: H, I. Bar: 50 nm.

Structure of the mtDBP-Cprotein/ mtDNA complexes •

b

c

is located in the region containing the sequences where the replication and transcription starts. It is visualized on the electron micrographs H, I, J, K, L where loops and kinks often occur near the labelled end.

cl

\ / ~

Loops When a loop is observed in the DNA path, its location can be determined by the position where the strands crossed in the DNA molecule. This point is characterized by two coordinates, P1 and P2 (in base pairs). P2 is always bigger than P1 as we progress along the molecule from position 1 to position 1926 (labelled with streptavidin-ferritin; see fig 2). The repartition of the loops can be visualized in a diagram where the position of the intersection (coordinates P1, P2) of each loop is represented by a point. In figure 5A, the position of each loop is indicated for the naked DNA and in figure 5C for the DNA incubated with the protein.

0.6

a

I

I B

"

n

¢

d

0.9

Naked D NA Generally, naked DNA molecules make only rare loops when spread on the grid (fig 3A and 3B). Eightyfour loops were numbered within the 200 molecules analyzed (mean 0.42 loop per molecule). As P2 is always higher than P1, the points in figure 5A are scattered in the upper part of the graph. Crossing occurs along the DNA, with some region of higher frequency. These regions are indicated by arrows in the histogram of figure 5B. In this histogram the DNA is divided into 20 classes of 100 bp, and the number of intersections is counted for each class. Regions with a higher density of loops are located at positions

0.8

/

! 0.7

,

, i

!

|

,

i

w

i

~

,

i

,

!

i

|

|'

|

i"'

Ar'

?O(~ ANti ~l'll)--"/flfl, wvv ~.,vv • vv

A

uv~

'\,4v

! 0

I

|

I

i

"

! Q.S

i

!

!

!

"1 I

l

|

•

I

T CSB ,,111 I' I

i I.S

i

,

1 ~ IG ~

P m

R N N - - 1 .it 1J . VNVf i

u~.l,L.s

~.,-I

i.~l • ~.l

1L 9~ . vN, vA - - 1

Jt

.C j ~ lN n LA r

hi . ,~i ] ~ .

l~ach of these regions contains a peak of curvature. This result shows that a consequence of curvature is to bring closer regions which are distant on the DNA path. Figure 5A also shows that the length of the loops varies between 100-800 bp. No points are present in the upper left part of the diagram.

/

0.7

69

,

P~ •

Fig 4. Maps of curvature: A: Theoretical map of curvature: the theoretical map of curvature of the studied fragment was constructed according to Muzard et al [28]. B: Experimental fluctuations of w (curvature) along the DNA molecule as measured by electron microscopy are shown in this diagram. C: Experimental map of curvature of the DNA incubated with the protein mtDBP-C. The segment between the promoters LSP and HSP is indicated by black boxes and the conserved sequences CSB and transition site positions are shown as vertical bars at the bottom of the figure.

DNA incubated with the protein mtDBP-C Figures 5C and 5D are obtained with the same type of analysis used for the DNA incubated with the protein. The mean number of loops is now equal to 1.5 (301 loops for 200 molecules). The density of loops increases all along the molecule, but an evident region of higher density located at position 1 200-1 800 is revealed a both representations. This region, underlined in diagram 4D, is located over the CSB and the promoter regions. The length of the loops in this case is not scattered in all the upper part of the graph. The protein mtDBP-C brought closer together regions that were very distant. Points in the upper left part of the diagram reveal that two sequences near each extremity of the molecule are brought closer by the protein. Such a situation was not seen with the naked DNA. Loops

70

B Mignotte et al

protein. This change in direction also occurs in less than 200 bp but, in this case, the two strands are not closely associated and the change in direction is not always equal to 180° (fig 3F). We have grouped these two events under the generic term of folds. The D N A molecules are divided into 10 classes of 200 base pairs and the number of folds is counted for each class. Histograms of distribution are presented for naked DNA and for D N A incubated with the protein (fig 6).

of over 800 bp often occur in the presence of the protein. The condensation of the DNA by the protein is accompanied by the formation of loops of various lengths. Sequences separated by more than 1 000 bp can be brought into contact.

Kinks and sharp bends We have localized and counted the kinks and sharp bends along each molecule of naked DNA and of D N A incubated with the protein. These two particular structures are defined as follows. A kink is a sudden change of direction in the path of the DNA so that the double helix reverses the direction within less than 100 bp (fig 3I). In this case, the two strands stick to each other. A sharp bend, essentially observed on DNA incubated with the protein, is defined as an area where the trajectory is anomalously deviated from its direction in a way that can be explained only by the binding of the BP

2

,

°

~

] "1

o

."

°

1

g~"

° o

%

o

°

"

•

A

o

a cb

%"0

° 130

[] ,n

rio

g°

C;O

-4 .o .

a

o

°

°

cb I

BP

Naked DNA The number of folds counted for naked DNA fluctuates between 2 and 4 per class (fig 6A). They occur with a frequency which is equally distributed along the molecule. The number counted is 28 for 200 molecules, proving that such events are not frequent in the path of the naked double helix.

,,10 a e.2

•.4

~L~

•JI

|

12

1.~

IAI,

r_p

|.•

2

= d

° o

° ®°%= a~ ~ a

°-" ,-,-a;.~ ~

~~o

C

:

"

D

i

I

o

u"

't " C : :

,,n P

,

,

" ,t ' .L r ~ .

.

.p .

Fig 5. Analysis of the loops: A and C: position of the loops observed on 200 DNA moiecules. Each point corresponds to the intersection of trajectories found on the molecule. Position P1 is picked up at the first passage and position P2 at the second. B and D: histogram of the number of intersections counted per class along the DNA molecule. A and B: naked DNA molecules. C and D: DNA molecules incubated with the protein mtDBP-C. The promoters LSP and HSP, conserved sequences CSB and transition site positions are indicated by black boxes at the bottom of the figure.

Structure of the mtDBP-C p r o t e i n / m t D N A complexes

DNA incubated with the protein In histogram 5B, 4 - 2 0 folds are counted per class and their repartition is not homogeneous. A greater number of folds is observed in the second part of the DNA 1 200-1 400 where the sequences CSB and the promoter region are located.

Discussion

We have previously shown that it is possible to quantify the local curvature of a DNA molecule by electron microscopy analysis of DNA molecules labelled at one end with streptavidin-ferritin [25, 28]. This avoids having to study several overlapping restriction fragments. The present work is an application of this

tO.l~ ffl "CO. O) .D

A

+,+,e a.tO0

-

e~

61HI

e~

BI

"a

i 211o

i Ill

I 1410

1111~

IZlll

laQO

t l

11111

"-- _/ :tom

--I :lll.ll

=ilBJl41 e"

~/~

7 /

t

111,110

]/

I,t.alD

~

IL 00

~

ILIJO

o

+ 200

i +tO0

HnR i IkO0

,

,

II00

10011

i 1ZIIg

IIII

]].

/'J

w 141011

IIII

t csb

i I lJO0

i /] i IIIND

ZIIIII

m

P

Fig 6. Analysis of kinks and sharp bends: the DNA molecule is divided into classes of 200 bp and the kinks and sharp bends are counted for each class. Histogram of their repartition along the naked DNA molecule (A) and along DNA incubated with the protein (B) are presented. The promoters LSP and HSP, conserved sequences CSB and transition site are indicated by black boxes at the bottom of the figure.

71

method. We show here that the effect of a protein that modifies the shape of DNA can be analyzed and precisely localized. Theoretical and experimental studies of the region containing the origin of replication of the mtDNA of Xenopus laevis show that it contains two intrinsically bent regions. Even if a difference is observed between the experimental and theoretical mean level of curvature probably due to the observation of the DNA molecu!es on a plane, the general shape of the map of curvature is maintained. As the theoretical model used is based on the effect of adenine and thymine tracks, this result confirms that the) are the main supports of the curvature. One of the bent regions found encompasses the promoters of transcription and CSB sequences. Bogenhagen and Romanelli have shown that mutations near LSP and HSP affect the relative transcription efficiency of the two promoters [34]; they have suggested a possible role of DNA bending mediated by the A-rich segments found close to the promoters (see fig 1). The computer data reveals that this region belongs to the most bent sequences of the entire mitochondriat DNA and that it is strongly decreased by these mutations (data not shown). This property could facilitate some nucleoprotein interactions which allow the formation of initiation complexe~ for both replication and transcription [35]. It has previously been shown that the mtDBP-C cooperatively compacts the DNA by the formation of superhelical loops [9]. Although the protein mtDBP-C is not a sequence-specific DNA-binding protein, our results reveal that the cooperative compaction of the • -1:- -~ 1:". . t l a t. e. u. . 1I! 1 1. . ~ l.t ~.l l.l l .i ~.l l. . I.. :~tuutg;u ~ preferentia lly "-"~ mtDNA ~ the region of the promoters. The fixation of the protein is accompanied by the formation of loops, sharp bends and kinks located mainly in this region. This observation suggests that it could have a higher affinity for bent DNA in which such structures can be more easily formed. The intrinsic bending ef the promoter region may facilitate the formation of a first loop stabilized by the protein mtDBP-C and the proximity of the two strands may favor the fixation of other mtDBP-C proteins in this region. However, in the two bent regions found in the sequence studied, the replication origin is not the more bent region, which suggests that other properties of the DNA molecule may influence either the effect of the bound protein or the affinity of the mtDBP-C to DNA. We have previously shown that some properties of the double-helix are conserved in evolution in this region [16]. These properties (for example, flexibility) could also facilitate the binding of the mtDBP-C to the promoters and replication origin region. Although a preliminary analysis of the pUC18/ mtDBP-C complexes suggests that this fragment does

72

B Mignotte et al

not contain a region of preferential folding, additional experiments are needed: (i), to unambiguously demonstrate that the region of the primary interaction of the protein with mtDNA does not depend on its position relative to the ferritin-labelled end; and (ii), to determine how othe: mtDNA fragments behave in the same test. Nevertheless, one can speculate that the binding of the mtDBP-C to the promoters and replication origin could modify the affinity of some proteins for their binding site, as has been shown for the protein HI2 [11]. It was observed that this protein inhibits mitochondrial transcription which is itself sensitive to the supercoiling of the mtDNA template [36]. It could also participate in the initiation of mtDNA replication which has been shown to occur in highly supercoiled molecules [37]. In conclusion, the non-coding region of Xenopus laevis mtDNA is curved and the protein mtDBP-C preferentially enhances the curvature of the promoterreplication origin region. One of the functions of this protein could be to bring closer together regions of DNA that are distant from one another.

Noted added in proof During the submission of this manuscript, G Pepe et ai (Nucleic Acids Res (1989) 17 (21), 8803-8819) showed by a different approach (gel electrophoresis) that the promoter-replication origin region of the rat mtDNA is curved and interacts specifically with a matrix protein.

Acknowledgments We are grateful to Drs M Barat-Gueride and L Stratford for their critical reading of the manuscript and to D Couland for assistance with photography. We thank the CNRS, the INSERM (CRE 862009) and the ARC for their financial support.

References 1 Chang DD, Fisher RP, Clayton DA (1987) Biochem Biophys Acta 909 (2), 85-91 2 Topper JN, Chang DD, Fisher RP, Clayton DA (1988) In: Cancer Cell, E,~karyotic DNA ReplP ~tion. Cold Spring Harbor Laboratory, 207-212 3 Chang DD, Clayton DA (1987) EMBO J 6, 409-417 4 Baker TA, Bertsch LL, Bramhill D, Sekimizu K, Wahle E, Yung B, Kornberg A (1988) In: Cancer Cell, Eukaryotic DNA Replication. Cold Spring Harbor Laboratory, 19-24 5 Mac Macken R, Mensa-Wilmot K, Alfano C, Seaby S, Carroll K, Gomes B, Stephens K (1988) In: Cancer Cell, Eukaryotic

DNA Replication. Cold Spring Harbor Laboratory, 25-34 6 Wold MS, Li J J, Weinberg DH, Virshup DM, Sherley JL, Verheyen E, Kelly T (1988) In: Cancer Cell, Eukaryotic DNA Replication. Cold Spring Harbor Laboratory, 133-141 7 Fairman MP, Prelich G, Tsurimoto ?, Stillman B (1988) In: Cancer Ceil, Eukaryotic DNA Replication. Cold Spring Harbor Laboratory, 143-151 8 Mensat-Wilmot K, Carroll K, Mac Macken R (1989) EMBO J 8, 2393-2402 9 Mignotte B, Delain E, Rickwood D, Barat-Gueride ? (1988) EMBO J 7, 3873-3879 10 Mignotte B, Barat M (1986) Nucleic Acids Res 14, 5969-598') 11 Flashner Y, Gralla JD (1988) Cell 54, 713-721 12 Rouviere-Yaniv J, Yaniv M, Germond JE (1979) Cell 17, 265 -274 13 Johnson RC, Simon MI (1987) Trends Genct 3, 262-267 14 Walberg MW, Clayton DA (1981) Nucleic Acids Res 9, 5411-5421 15 Brown GG, Galaleta G, Pepe G, 5accone C, Sbisa E (1986) J Mol Biol 192, 503-511 16 Migaotte B, Dunon-Bluteau D, Reiss C, Mounolou JC (1987) J Theor Biol 124, 57-69 17 Deb S, DeLucia AL, Koff A, Tsui S, Tegtmeyer P (1986) Mol Cell Biol 6, 4578-4584 18 Zhan K, Blattner FR (1987) Science 236, 416-422 19 Poljak LG, Gralla JD (1987) Biochemistry 26, 295-303 20 Welter C, Dooley S, Blin N (1989) Nucleics Acids ICes 17, 6077-6086 21 Dunon-Biuteau DC, Volovitch M, Bran G (1985) Gene 36, 65-78 22 Theveny B, Revet B (1987) Nucleic Acids Res 15, 947-958 23 Dubochet J, Ducommun M, Zollinger M, Kellenger E (1971) J Ultrastruct Res 35,147-167 24 Revet B, Delain E, Bauer R (1986) Proc XIth Int Congr Electron Microsc Kyoto, 2409 25 Theveny B, Coulaud D, Le Bret M, Revet B (1988) Structure and Expression, DNA Bending and Curvature. Adenine Press, 3, 39-55 26 Landau DL, Lifshitz EM (1958) In: Statistical Physics. Addison Wesley, MS, 148-149 27 Tan RKZ, Harvey SC (1988) J Biomolec Struct Dyn 5,497- 512 28 Muzard G. Thevenv B. Revet B (1990~E M B O J 9 (4~ (in nre~.~ 29 Trifonov EN, Tan RKZ, Harvey S (1988)-Structureand Expr'ession, DNA Bending and Curvature. Adenine Press, 3, 243-253 30 Ulanovsk~ L, Bodner M, Trifonov EN, Choder M (1986) Proc Nati Acad Sci USA 83, 862-866 31 Ulanovsky L, Trifonov EN (1987) Nature 326, 720-722 32 Kr/imer H, Niem611erM, Amouyal M, Revet B, von WilckenBergmamm B, Muller-Hill B (1987) EMBO J 6, 1481-1491 33 Theveny B, Bailly A, Rauch C, Delain E, Miigrom E (1987) Nature 329, 79-81 34 Bogenhagen DF, Romanelli MF (1988) Mol Cell Biol 8, 2917-2924 35 Echols H (1986) Science 233, 1050-1056 36 Barat-Gueride M, Rickwaod D, Dufresne C (1989) Eur J Biochem 183, 297-302 37 Callen JC, Tourte M, Denaebouy N, Mounolou JC (1983) Exp Cell Res 157, 207-217 38 Dunon-Bluteau DC, Bran GM (1987) Biochem lnt 14,643-657 39 Cairns SS, Bogenhagen DF (1986) J Biol Chem 261,8481-8487 40 Bogenhagen DF, Yoza BK, Cairns SS (1986) J Biol Chem 261, 8488-8494