Structural organization and characterization of the promoter region of a human carboxylesterase gene

Biochimica et Biophysica Acta 1350 Ž1997. 65–74

Structural organization and characterization of the promoter region of a human carboxylesterase gene Thomas Langmann, Alfred Becker, Charalampos Aslanidis, Frank Notka, Heidrun Ullrich, Heinz Schwer, Gerd Schmitz ) Institute for Clinical Chemistry and Laboratory Medicine, UniÕersity of Regensburg, Franz-Josef-Strauß-Allee 11, 93042 Regensburg, Germany Received 10 May 1996; revised 11 July 1996; accepted 19 July 1996

Abstract A gene encoding a human liver carboxylesterase has been isolated and characterized. Analysis of three overlapping genomic l clones revealed that the gene spans about 30 kb and is made of 14 exons being 39 to 379 bp in length. The encoded protein is 550 amino acids long and is highly homologous to carboxylesterases of various mammalian species. The transcription start site was determined by 5X-RACE PCR. An additional 900 bp of DNA from the 5X flanking region of the gene was cloned and sequenced in order to elucidate the structure of the promoter. In this sequence several possible binding sites for transcription factors have been identified, but no TATA-box was present. When different parts of the putative promoter region were ligated in front of the luciferase gene and the constructs were transfected into CHO cells, the reporter gene was effectively transcribed, as demonstrated by the expression of enzyme activity. Keywords: Human carboxylesterase; Genomic organization; Promoter

1. Introduction Carboxylesterases ŽE.C. 3.1.1.1. are a group of serine esterases that are found in a wide range of tissues and organisms. Whereas the biological role of Abbreviations: 5X-RACE, 5X rapid amplification of cDNA ends; PCR, polymerase chain reaction; CHO cells, Chinese hamster ovary cells; ACEH, acid cholesteryl ester hydrolase; BSSL, bile salt stimulated lipase; pGL, plasmid GeneLight; DMEM, Dulbecco’s modified Eagle’s medium; DOTAP, N-w1-Ž2,3-dioleoyloxy.propylx-N, N, N-trimethylammonium methylsulfate; MNP, mononuclear phagocyte; ac-LDL, acetylated low density lipoprotein; SRE, sterol regulatory element; CD, cluster of differentiation; LPDS, lipoprotein-deficient serum. ) Corresponding author. Fax: Žq49. 941 9446202.

some of these enzymes, e.g., acetylcholinesterase, is clearly known, the function of the remaining enzymes is not so evident. Mammalian liver carboxylesterases hydrolyze various xenobiotics and endogenous substrates such as esters, thioesters, or amide bonds and are thought to function mainly in drug metabolism and detoxification of many harmful chemicals w1–3x. These enzymes have been shown to be predominantly present and highly active in liver microsomes w4x, but have also been found in a great number of other mammalian tissues. Some forms have been purified and shown to differ in biochemical, immunological, and genetic properties w5,1,2,6–9x. Therefore, mammalian carboxylesterases are now considered to constitute a family of isoenzymes w10x.

0167-4781r97r$17.00 Copyright q 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 7 8 1 Ž 9 6 . 0 0 1 4 2 - X

66

T. Langmann et al.r Biochimica et Biophysica Acta 1350 (1997) 65–74

Recently, some carboxylesterases were found to function as lipases, preferentially hydrolyzing certain lipids, such as acylcarnitines, palmitoyl-CoA, monoand diacylglycerols, and were suggested to participate in transport of fatty acids across the endoplasmic reticulum or in maintenance of the membrane structure w9x. Some members of the carboxylesteraserserine esterase multigene family like the acid cholesteryl ester hydrolase Ž ACEH. or the bile salt stimulated cholesteryl esterase ŽBSSL. , catalyze the hydrolysis of cholesteryl esters w11x. Current data from several laboratories have suggested a role of the cholesteryl esterase in mediating cholesterol absorption in the gut w12x. In view of observations that the rate and efficiency of cholesterol absorption may be important determinants in regulating plasma cholesterol level and hypercholesterolemia w13x, it is important to understand the regulatory mechanisms that may control the expression of these genes. It has been shown that the bile salt stimulated cholesteryl esterase is also involved in the esterification of cholesterol within the villus cell w14–16x. Another member of the carboxylesterase multigene family has been shown to play a role in human cellular cholesterol homeostasis w17x. Little information is currently available concerning the regulation and the biosynthesis of this enzyme under physiological conditions. In this paper, we report the isolation and characterization of the complete human liver carboxylesterase gene. The genomic structure and the characterization of the promoter will help to understand the mechanism governing the regulation of this carboxylesterase gene.

2. Materials and methods 2.1. Library screening and DNA sequence analysis A commercialy available human placental genomic DNA library in Lambda FIXII ŽStratagene, Heidelberg, Germany. was screened with a w a 32 Px-labeled 1.7-kb cDNA fragment isolated from a human liver cDNA library w17x as well as with fragments from various regions of the cDNA. Approximately 5 = 10 6 phage clones were screened as described elsewhere

w18x. Plaques were lifted to nylon filters ŽAmersham, Braunschweig, Germany.. Hybridization was performed in 6 = SSC, 5 = Denhardt’s solution, 1% SDS and 0.1 mgrml denatured salmon sperm DNA at 658C for 14 h w18x. The filters were washed twice at room temperature in 2 = SSC–0.1% SDS for 15 min, once at room temperature in 0.1 = SSC–0.1% SDS for 30 min, and once at 658C in 0.1 = SSC–0.1% SDS for 30 min. The filters were autoradiographed with Kodak X-AR film at y708C with intensifying screens. Positive clones were isolated and characterized by restriction endonuclease mapping and Southern blot analysis. Nucleotide sequences were determined by the dideoxy chain-termination method w19x with T7 DNA polymerase and fluorescent dye-labeled primer using an automated DNA sequencer Ž Pharmacia Biotech, Freiburg, Germany.. 2.2. Reporter gene analysis To study the promoter, seven genomic DNA fragments derived from the proximal part of the carboxylesterase gene were isolated and cloned in the luciferase expression vector pGL2-basic ŽPromega.. pB01, the plasmid with the largest insert, was constructed by cloning a SacI-KpnI fragment of the genomic clone l-F in front of the luciferase coding region. The fragment extended from nucleotide y945 to q1400, with q1 referring to the transcription initiation site, and contained part of the first intron. Shorter fragments of the carboxylesterase-promoter region were derived from pB01 upon amplification using internal primers with SacI and KpnI sites at their ends for cloning in pGL2-basic. Primers for pB 02 w ere, G L 1 Ž 5 X T G T A T C T T A T G G TACTGTAACTG3X . and AC119 Ž5X GGGAGCTCCCCAAGCCGCGGAAGCAGAGAGAGTGG3X . ; pB03, AC-459 Ž 5X GGGGTACCGATCGCTTCCAAGCTTGAGAGCCTGG3X . and AC119; pB04, AC-250 Ž 5X GGGGTACCGCTCTCTGTAATCTGACAGTAGAGTCC3X . and AC119; pB05, GL2 Ž5X CTTTATGTTTTTGGCGTCTTCCA3X . and AC250; pB06, AC-110 Ž5X GGGGTACCGGCAGCGCAGGGCGGTAACTCTGG3X . and AC119; pB07, AC-80 Ž5X GGGGTACCGGGCGCCAGGGCTGGACAGCAC3X . and AC119. PCR conditions were as previously described w20x. The PCR products were

T. Langmann et al.r Biochimica et Biophysica Acta 1350 (1997) 65–74

purified by Qiaex ŽQiagen, Hilden, Germany., digested with SacI and KpnI and cloned into the luciferase vector that had also been cut with SacI and KpnI. pB02, pB03, pB04, pB06 and pB07 had a common 3X terminus located at nucleotide q119, which is the last nucleotide of exon 1, the inserts differ in length from 2345 bp to 130 bp. In pB05 the promoter fragment extended from y195 to q1400 in the first intron. 2.3. Transient transfection of CHO-cells CHO cells were cultured at a 10% CO 2 atmosphere at 378C, in DMEM-medium Ž Biowhittaker, Verviers Belgium. supplemented with 10% fetal calf se ru m Ž P a n S y ste m s, A id e n b a c h . a n d penicillinrstreptomycinrfungizone ŽGIBCO BRL, Berlin.. CHO cells at a density of 60–70% were transiently transfected with 7.5 m g of plasmid DNA using DOTAP-lipofection ŽBoehringer, Mannheim, Germany. as described by the manufacturer. The transfected cells were incubated for 40 h in 10% CO 2 at 378C. In each experiment, CHO cells were transfected with pGL2-basic and pGL2-promoter plasmids that served as negative and positive controls, respectively. The pGL2-basic construct has no eukaryotic promoter or enhancer elements upstream of the luciferase gene. The pGL2-promoter plasmid contains the SV40 early promoter driving the expression of luciferase mRNA transcripts. To standardize the transfection efficiency, 2 m g of pSVb-galactosidase plasmid ŽPromega, Madison, USA. were always cotransfected. 2.4. Luciferase assays Transfected cells were harvested 40 h after transfection and lysed in 500 m l of reporter lysis buffer ŽPromega, Madison, USA.. 100 m l aliquots of lysates were mixed with 100 m l luciferase assay reagent containing luciferyl-CoA ŽPromega, Madison, USA.. The luciferase activity was measured in a Lumat LB9501 ŽBerthold, Munich, Germany.. Protein concentrations of the cell extracts were determined using the biuretic method w21x. b-gal activity was determined in a standard color reaction w18x to detect differences in transfection efficiency.

67

2.5. 5X-RACE (rapid amplification of cDNA ends) PCR In order to identify the 5X end of the carboxylesterase gene, the 5X-RACE-Ready cDNA prepared from human leukocyte polyŽ A.q RNA ŽClontech, Palo Alto, CA. was amplified according to the instructions of the manufacturer. A primary PCR reaction was conducted with the provided anchor primer and the gene specific primer AC173i Ž 5X CCTCAGGGGTCCAAGAGGCGGC3X . complementary to nucleotide positions q174 to q192 with respect to the ATG codon. An aliquot of the initial PCR reaction served as template in a secondary PCR reaction Žnested PCR. with the anchor primer and the nested gene specific primer AC31i Ž5X CCAAGCCGCGGAAGCAGAGAG3X . matching bases q31 to q51 with respect to the ATG codon, resulting in a 159 bp amplification product. An additional 5X-RACE PCR was performed using primer AC198i Ž5X GGTTCTGCAGGCTGCGGTGGAG3X . and primer AC173i resulting in a 302 bp PCR product. Both PCR products were analyzed on a 2% agarose gel, blotted onto nylon membranes and hybridized with primer AC-12 Ž5X GACTCGCCCTTCACGATGTGGCTCC3X .. The verified DNA fragments were cloned in pUC18 and sequenced. 2.6. Northern blot analysis Total RNA was isolated from human monocytes and 7-day cultured MNP by the isothiocyanatercesium chloride method w22x. RNA was separated on a 1.2% agarose gel containing formaldehyde and blotted to nylon membranes. Hybridization conditions have been described previously w23x. 2.7. CultiÕation of human monocyte deriÕed MNP Human monocyte derived MNP were isolated and cultivated as described previously w24x. Briefly, monocytes were isolated from normolipidemic volunteers by leukapheresis and subsequent counterflow centrifugation. Those fractions containing ) 90% CD14 positive cells were pooled and cultured for 7 days in 100 mm B dishes. Thereafter, cells were

68

T. Langmann et al.r Biochimica et Biophysica Acta 1350 (1997) 65–74

incubated in the presence of LPDS or in the presence of 100 m grml ac-LDL for 18 h before RNA was isolated. 2.8. Chemical modification of LDL LDL was acetylated by repeated addition of acetic anhydride followed by dialysis against PBS Ž pH 7.4.. Modified LDL showed enhanced mobility on agarose gel electrophoresis at pH 8.6.

3. Results To isolate genomic clones we screened a human placental genomic library using a full-length 32 Plabeled human carboxylesterase cDNA w17x. Screening of 5 = 10 6 recombinant phages yielded several positive clones, which have been isolated, with five of them, designated l-A, l-F, l-9, l-12 and l-21 being further analyzed. Incubation of the DNA of these clones with several restriction enzymes followed by Southern blotting and hybridization with various parts of the carboxylesterase cDNA as probe indicated that the clones l-F, l-12 and l-21 contain the entire carboxylesterase gene. Sequencing of restriction fragments from the three clones, equating to positive bands on Southern hybridization, resulted in the complete esterase coding region with about 1000 bp of 5X flanking region. The gene spanned a region of approximately 30 kb of DNA ŽFig. 1.. Comparison of the published cDNA sequence with the DNA sequence obtained from the genomic fragments cloned

in pUC 18 revealed all exon-intron boundaries in the carboxylesterase gene. The gene consists of 14 exons and 13 introns with all introns being flanked by the canonical dinucleotides GT and AG, consistent with the consensus sequences for splice junctions in eukaryotic genes w25x ŽTable 1.. Another group w10x previously reported the genomic structure of another carboxylesterase, which is highly homologous but not identical to the gene presented here. Thus, we compared all exon sequences obtained from our genomic clones with the sequences of the gene characterized by these authors. Differences in five nucleotides in the coding region were found when the published cDNA sequences were compared and five alterations within the noncoding region ŽFig. 2.. Interestingly, all of the nucleotide differences were located within the first exon. Nucleotide substitutions at positions q78, q83, q86, and q101 resulted in four amino acid changes in the protein. These four amino acids are part of the postulated signal peptide of the carboxylesterase w17x. The fifth nucleotide change in exon 1 at position q82 was a silent change affecting the third base of a codon and thus did not result in a change of the amino acid. As a first step toward characterizing the promoter of the carboxylesterase gene we used 5X-RACE PCR to determine the position of transcription initiation ŽFig. 3.. In a nested PCR-reaction the oligonucleotides AC173i and AC31i have been used. The resulting 159 bp PCR product was cloned and sequenced and was shown to start 67 nucleotides upstream from the ATG codon Ž Fig. 4.. This transcription start point

Fig. 1. Restriction map and organization of the human carboxylesterase-gene. Exons are numbered and depicted as boxes. The intron sizes were determined by Southern blot analyses, direct sequencing, or polymerase chain reaction. Exons and introns are shown in scale. The cDNA probes used for library screening are shown at the top. Three overlapping clones lF, l12, and l21 were isolated from a human genomic library. The location of restriction sites is shown with abbreviations: A, ApaI; B, BamHI; H, HindIII; S, SacI; Sl, SalI; Sp, SpeI.

T. Langmann et al.r Biochimica et Biophysica Acta 1350 (1997) 65–74

69

Table 1 Intron-exon boundaries of the human carboxylesterase gene No.

Exon Žbp.

Intron Žkb.

5X splice donor

3X splice acceptor

1 2 3 4 5 6 7 8 9 10 11 12 13 14

119 205 145 134 154 108 105 39 141 84 148 132 73 379

4.0 2.6 2.4 1.9 0.8 0.7 2.6 4.4 2.2 0.2 4.2 3.2 0.5

CGGCTTGGG gtgagt CCCTCCTAT gtaagc AGGCTGCCG gtaagt ATTCTTCAG gtaaga TTCGTTCTT gtgagt TTGGCTGAG gtaggt TTGAAAATG gtaggt CCCAGAGAG gtaagg ATTCCAATG gtgaga CCCCTTGTT gtaaga ACCACAGAG gtgagt TTTTAAAAG gtaatg TCGCAATGG gtgagg

agccag GGCATCCGT ccccag GTGCACCCA gcccag GTGATGGTG tcacag CACAGGGGA tgtcag GTTTTGTCT ttgcag CAAATTGCT tcacag AAATTCTTA ccccag AGTCAACCC ttttag CAGTTGATG tttcag TGCATTGCT tctcag ATGCTGGAG ccacag AGGGTGCCT ttccag AAACCCCAA

Note: exon sequences are shown in capital letters; intron sequences are represented by lowercase letters.

was verified by an additional 5X-RACE PCR using the primers AC198i and AC173i which are downstream of the primers mentioned above. The same transcription start point could be detected by RNase Protection Assay Žunpublished results.. To investigate the promoter region of the carboxylesterase gene, a 3-kb DNA fragment derived from the clone l-F has been sequenced. This DNAfragment contains the exon 1, parts of intron 1 and extends 945 bp upstream of the transcription start point, and presumably contains the promoter. The complete nucleotide sequence of this 5X flanking sequence is shown in Fig. 4. No TATA box has been found to precede the transcription start site. Potential binding sites for transcription factors have been identified by sequence comparison. These include a GATA 1 binding site w26–28x, a CTF-binding site w29x, two Sp1-binding sites w30x, an inverted repeat which is found in the jun B promoter w31x, a consensus sequence for the sterol-dependent transcription factor NF-Y w32,33x and a binding site for the macrophage and B-cell specific factor PU1 w34x. In addition, a sterol regulatory element ŽSRE.-like sequence w35x was identified at nucleotide position y799 to y789. Table 2 summarizes all potential promoter elements and their position in the DNA sequence. The presence of multiple transcription factor-binding sites in the 5X flanking sequence implied that the 3-kb SacI-KpnI genomic fragment contained the

functional carboxylesterase promoter. Potential promoter activities of carboxylesterase-gene DNA fragments were ascertained by designing fusion con-

Fig. 2. Alignment of the DNA sequences Žexon 1. of the gene presented here and the carboxylesterse gene reported by Shibata et al. w10x. Nucleotides are numbered, with q1 referring to the transcription start site. The nucleotides that are different are shown in boldface letters and are underlined; the amino acids that are different among the sequences are depicted in three-letter code above the sequences. Four differences in the first exon, at positions q78, q83, q86 and q101 result in four amino acid changes; one nucleotide change at position q82 does not affect the corresponding amino acid. In addition, there are five alterations within the noncoding region of exon 1.

T. Langmann et al.r Biochimica et Biophysica Acta 1350 (1997) 65–74

70

Fig. 3. Mapping of the 5X end of the human carboxylesterase mRNA by 5X-RACE PCR. The upper diagram ŽA. shows schematically the positions of the primers used for nested PCR reactions and the resulting products. Product 1 Ž159 bp. for primer combination AC173irAC31i and product 2 Ž302 bp. for primer combination AC198irAC173i, are depicted as boxes. A, anchor; AP, anchor primer. ŽB. An agarose gel of 5X-RACE PCR products is shown. Lanes 1 and 5 contain product 2 Ž302 bp., lanes 3 and 6 contain product 1 Ž159 bp., and lanes 2, 4, and 7 are negative control reactions without template DNA. Lane M is 0.5 m g of 123-bp ladder. ŽC. Corresponding Southern blot probed with an 25-bp oligonucleotide spanning position q56 to q81 in the first exon.

structs of the 5X flanking region linked to luciferase gene as a reporter in the pGL2-vector. Seven different promoter-luciferase fusions have been constructed ŽFig. 5.. The chimeric plasmids were transiently transfected into CHO cells and assayed for luciferase activity. No activity was detected in the lysate of cells transfected with the pGL2-basic plasmid, which does not contain a promoter. As positive control served the pGL2-promoter plasmid, which contains

the SV40 promoter. Plasmid pB01 contains the largest carboxylesterase genomic fragment and resulted in luciferase activity in CHO cells. The luciferase activity from this construct was 18% of the SV40 promoter. Deletion of parts of the first intron from pB01 increased maximal promoter activity in pB02 to 52%. The highest promoter activities were identified in pB03 Ž65%. and pB04 Ž55%., which extend to y459 and y195, respectively. Plasmid pB05 which like

Table 2 Putative regulatory elements in the 5X flanking region of the carboxylesterase gene Element SRE GATA-1 CS JUNB-US3 c-mos-DS1 PU-box H2B-CCAAT NF-Y Sp1-CS2 SP1-IE3r34

Sequence X

X

5 -ATCACCCCTAC-3 5X-TGATAAC-3X 5X-AGTGCACT-3X 5X-TGGTTT-3X 5X-GAGGAAA-3X 5X-CCAATTA-3X 5X-ATTGGC-3X 5X-GGGCGG-3X 5X-TGGGCGGGGC-3X

Position

Consensus sequence

Žy799ry789. Žy637ry631. Žy261ry254. Žy164ry159. Žy94ry88. Žy65ry60. Žy45ry40. Žy34ry29. Žy22ry13.

5X-ATCACCCCAC-3X 5X-WGATAMS-3X 5X-AGTGCACT-3X 5X-TGGTTT-3X 5X-GAGGAAA-3X 5X-CCAATNA-3X 5X-ATTGGC-3X 5X-GGGCGG-3X 5X-TGGGCGGGGC-3X

Note: list of the putative regulatory elements corresponding to the consensus sequences and their positions relative to the transcription initiation site.

T. Langmann et al.r Biochimica et Biophysica Acta 1350 (1997) 65–74

71

Fig. 4. The 945 bp-long DNA sequence preceding exon 1 Žbold letters. is shown. Putative binding sites for transcription factors are underlined. The start codon is emphasized by a double line. The mRNA start point Žassigned q1. is indicated by an arrow.

Fig. 5. Promoter activity of carboxylesterase-luciferase gene chimeras transiently transfected in CHO cells. The localization of the tested promoter fragments are shown to the left. Numbers indicate the relative positions with respect to the start of transcription. The first exon is represented by a solid box. Transfection efficiencies were normalized by cotransfection with the pSVb-galactosidase plasmid. Data represent the means and standard deviation of three separate experiments, each performed in triplicate. Relative promoter activity equal to 100% corresponds to the luciferase activity of the SV40 promoter. pGL2 denotes the pGL2-basic plasmid which has no promoter.

72

T. Langmann et al.r Biochimica et Biophysica Acta 1350 (1997) 65–74

pB01 contains 1.4-kb of intron 1 but extends to y195 at the 5X end shows only 11% relative promoter activity. Very low luciferase activity was detected when CHO cells were transfected with constructs pB06 and pB07, which start at y43 and y11, respectively, and are deficient of all putative binding sites for transcription factors ŽFig. 5.. Taken together, these data suggest that the elements involved in basal transcription are located within the construct pB04, spanning from y195 to q119 bp with respect to putative transcription initiation site. In addition, other cis-acting positive elements required for high levels of transcription may be located between nucleotides y459 and y195. Northern Blot analysis showed that the carboxylesterase-mRNA is present in human macrophages. The existence of a sterol regulatory element in the 5X flanking region led us to investigate whether the human enzyme in macrophages is also regulated by cholesterol loading or depletion. Human monocytes were isolated by leukapheresis and subsequent counterflow centrifugation. This preparation contains ) 90% monocytes as judged by the pres-

Fig. 6. Cholesterol-dependent upregulation of carboxylesterasetranscription. Northern blots with total RNA isolated from 7-day cultured mononuclear phagocytes ŽMNP. which were incubated for 18 h in 10% LPDS or in 10% LPDS supplemented with 100 m grml ac-LDL were probed with the 1.7 kb liver carboxylesterase-cDNA. As control for even RNA loading the ribosomal RNAs were compared on the agarose gel by ethidium bromide staining. LPDS, lipoprotein-deficient serum; ac-LDL, acetylated LDL.

ence of the lipopolysaccharide receptor CD14 on the surface of the cells. Monocytes were differentiated into macrophages by culturing for seven days in Petri dishes. Mature macrophages were incubated for 18 h either in 10% lipoprotein-deficient serum ŽLPDS. to deplete cholesterol stores or in 10% LPDS supplemented with 100 m grml acetylated low density lipoprotein Ž ac-LDL. to induce cholesteryl ester storage. Thereafter, total RNA of the cells was isolated and probed with carboxylesterase cDNA in Northern blots ŽFig. 6.. In total RNA from 7-day cultured MNP incubated in LPDS carboxylesterase mRNA is almost absent, whereas in 7-day cultured MNP loaded with ac-LDL there is a massive increase in the message. This is strong evidence that the message for the enzyme is upregulated in response to lipoprotein loading of macrophages.

4. Discussion More than 30 proteins with primary structures similar to that of carboxylesterase have been identified up to now. These proteins are presumed to have evolved from a common ancestral gene encoding a carboxylesterase. The proteins evolved divergently as a result of gene duplications into different groups w10x. In this paper we describe the isolation and characterization of genomic clones containing the gene for a human carboxylesterase and its 5X flanking sequence. This gene spans at least 30 kb of DNA and consists of 14 relatively small exons interspaced with 13 introns. All of these exons except 2 and 14 were less than 200 bp in size. The following evidence suggests that we have isolated a functional gene: Ž1. the exon sequences match perfectly with the published cDNA sequence w17x; Ž 2. all splice acceptor and donor sequences match the consensus sequence of the splice junctions w25x; and Ž 3. the DNA upstream of the first exon contains a functional promoter. When we compared the cDNA and the amino acid sequence of the gene presented here with other carboxylesterases, we found striking homology especially to a member of the carboxylesterase multigene family which has been described previously w10x. Both genes consist of 14 exons and 13 introns and there are no differences in the coding sequence of the

T. Langmann et al.r Biochimica et Biophysica Acta 1350 (1997) 65–74

mature enzymes Žexon 2–exon 14.. In the first exon we have identified more than 10 nucleotide variations ŽTable 2.. These alterations have been confirmed by sequencing of both DNA strands. Because of these differences we believe that both carboxylesterases are representing two highly homologous but not identical members of the carboxylesterase multigene family. The high homology of the cDNA and protein sequences is also reflected by the identical location of exons in the genes. In addition, considerable homology is also present to several other members of the carboxylesterase gene family w36–40x. All types of these esterases are highly homologous to each other but not identical. We have examined the 5X flanking sequence of the carboxylesterase gene in order to identify sequences relevant for promoter activity. By determination of the major transcription initiation site of the gene, we have identified the location of the postulated promoter. The sequence of the 945 bp 5X flanking DNA of the gene has been analyzed. The transcription of the gene appears to initiate at an unique site. The 945-bp long DNA-sequence preceding the transcription start point was analyzed for putative promoter elements. As found in the promoters of many houskeeping genes w41x, the proximal region of the carboxylesterase is G q C-rich. No classical TATA box sequence at the appropriate distance relative to the transcription initiation site was found. Several potential binding sites for transcription factors GATA1, CTF, Sp1, NF-Y, PU1, and SREBP1 are present in the DNA sequence preceding the transcription start point. The nature of the promoter region is thus consistent with the broad distribution of expression in various tissues Žunpublished observations.. Previously we reported that the level of the carboxylesterase messsage is induced upon cholesterol loading of human macrophages w17x. Thus, it will be interesting to determine which element in the gene is responsible for sterol-dependent transcriptional activation. Currently, the significance of the SRE-like sequence in regulating sterol-dependent promoter activity is unknown. Nonetheless, the 945 bp 5X flanking DNA-sequence of the carboxylesterase directed the efficient expression of a luciferase reporter gene, indicating that this DNA sequence contains a func-

73

tional promoter. Using this promoter activity assay and other techniques like gelshift or footprinting experiments, we are currently analyzing the regulation of the carboxylesterase promoter under various physiological conditions especially after sterol stimulation. We believe that the data presented here are a major contribution in the analysis of domain and functional structure of carboxylesterases and other related esterases in this superfamily. To further characterize the function of the carboxylesterase, we are currently expressing this enzyme in Sf9 insect cells using Bacculoviruses. The availability of the recombinant protein will permit detailed studies on the relevance of the carboxylesterase in cellular cholesterol homeostasis. Acknowledgements The technical assistance of R. Glatzl, ¨ S. Potra and U. Stockl is appreciated. Part of this study was ¨ supported by a grant from the Deutsche Forschungsgemeinschaft within the Forschergruppe ‘Molekulare Grundlagen der Differenzierung und Aktivierung mononuklearer ¨ Phagozyten’. References w1x Heyman, E. Ž1980. in Enzymatic Basis of Detoxification Vol. II, 291–323. w2x Heyman, E., Jakoby, W.B., Bend, J.R. and Caldwell, J. Ž1982. in Metabolic Basis of Detoxification, 229–245. w3x Satoh, T. Ž1987. Rev. Biochem. Toxicol. 8, 155–181. w4x Robbi, M., Beaufay, H. and Octave, J.N. Ž1990. Biochem. J. 269, 451–458. w5x Ketterman, A.J., Bowles, M.R. and Pond, S.M. Ž1989. Int. J. Biochem. 21, 1303–1312. w6x Mentlein, R., Heiland, S. and Heyman, E. Ž1980. Arch. Biochem. Biophys. 200, 547–559. w7x Mentlein, R. and Heyman, E. Ž1984. Biochem. Pharmacol. 33, 1243–1248. w8x Mentlein, R., Schumann, M. and Heyman, E. Ž1984. Arch. Biochem. Biophys. 234, 612–621. w9x Mentlein, R., Ronai, A., Robbi, M., Heyman, E. and Deimling, O. Ž1987. Biochim. Biophys. Acta 913, 27–38. w10x Shibata, F., Takagi, Y., Kitajima, M., Kuroda, T. and Omura, T. Ž1993. Genomics 17, 76–82. w11x Nilsson, J., Blackberg, L., Carlsson, P., Enerback, ¨ ¨ S. and Bjursell, G. Ž1990. Eur. J. Biochem. 192, 543–550.

74

T. Langmann et al.r Biochimica et Biophysica Acta 1350 (1997) 65–74

w12x Gallo, L., Clark, S.B., Myers, S. and Vahouny, G.V. Ž1984. J. Lipid Res. 25, 604–612. w13x Kesaniemi, Y.A. and Miettinen, T.A. Ž1987. Eur. J. Clin. Invest. 17, 391–395. w14x Bhat, S.G. and Brockman, H.L. Ž1982. Biochem. Biophys. Res. Commun. 109, 486–492. w15x Gallo, L., Newbill, T., Vahouny, G.V. and Treadwell, C.R. Ž1977. Proc. Soc. Exp. Biol. Med. 156, 277–281. w16x Gallo, L., Chiang, Y., Vahouny, G.V. and Treadwell, C.R. Ž1980. J. Lipid Res. 21, 537–545. w17x Becker, A., Bottcher, A., Lackner, K.J., Fehringer, P., Notka, ¨ F., Aslanidis, C. and Schmitz, G. Ž1994. Arterioscler. Thromb. 14, 1346–1355. w18x Sambrook, J., Maniatis, T. and Fritsch, E.F. Ž1989. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. w19x Sanger, F., Nicklen, S. and Coulson, A.R. Ž1977. Proc. Natl. Sci. USA 74, 5463–5467. w20x Aslanidis, C. and De Jong, P.J. Ž1990. Nucl. Acids. Res. 18, 6069–6074. w21x Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J. and Klenk, D.C. Ž1985. Anal. Biochem. 150, 76–85. w22x Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. Ž1979. Biochemistry 18, 5294–5299. w23x Virca, G.D., Northemann, W., Shiels, B.R., Widera, G. and Broome, S. Ž1990. Biotechniques 8, 370–371. w24x Muller, G., Kerkhoff, C., Hankowitz, J., Pataki, M., Kovacs, ¨ E., Lackner, K.J. and Schmitz, G. Ž1993. Arterioscler. Thromb. 13,1317–1326. w25x Mount, S.M. Ž1982. Nucleic Acids Res. 10, 459–472 w26x Evans, T. and Felsenfeld, G. Ž1989. Cell 58, 877–885.

w27x Tsai, S.F., Martin, D.I.K., Zon, L.I., D’Andrea, A.D., Wong, G.G. and Orkin, S.H. Ž1989. Nature 339, 446–451. w28x Winick, J., Abel, T., Leonard, M.W., Michelson, A.M., Chardon-Loriaux, I., Holmgren, A., Maniatis, T. and Engel, J.D. Ž1993. Development 119, 1055–1065. w29x Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger, C. and Chambon, P. Ž1980. Science 209, 1405– 1414. w30x Briggs, M.R., Kadonaga, J.T., Bell, S.P. and Tjian, R. Ž1986. Science 234, 47–52. w31x De Groot, R.P. and Kruijer, W. Ž1990. Biochem. Biophys. Res. Comm. 168, 1074–1081. w32x Jackson, M.S., Ericsson, J., Osborne T.F. and Edwards, P.A. Ž1995. J. Biol. Chem. 270, 21445–21448. w33x Spear, D.H., Ericsson, J., Jackson, S.M. and Edwards, P.A. Ž1994. J. Biol. Chem. 269, 25212–25218. w34x Klemsz, M.J., McKercher, S.R., Celada, A., VanBeveren, C. and Maki, R.A. Ž1990. Cell 61, 113–124. w35x Smith, J.R., Osborne, T.F., Goldstein, J.L. and Brown, M.S. Ž1990. J. Biol. Chem. 265, 2306–2310. w36x Zschunke, F., Salmassi, A., Kreipe, H., Buck, F., Parwaresch, M.R. and Radzun, H.J. Ž1991. Blood 78, 506–512. w37x Munger, J.S., Shi, G.P., Mark, E.A., Chin, D.T., Gerard, C. and Chapman, H.A. Ž1991. J. Biol. Chem. 266, 18832– 18838. w38x Riddles, P.W., Richards, L.J., Bowles, M.R. and Pond, S.M. Ž1991. Gene 108, 289–292. w39x Long, R.M., Calabres, M.R., Martin, B.M. and Pohl, L.R. Ž1991. Life Sci. 48, 43–49. w40x Kroetz, D.L., McBride, O.W. and Gonzalez, F.J. Ž1993. Biochemistry 32, 11606–11617. w41x Azizkhan, J.C., Jensen, D.E., Pierce, A.J. and Wade, M. Ž1993. Crit. Rev. Eucaryot. Gene Expr. 3, 229–254.