Structural requirements for the function of a yeast chromosomal replicator

Cell, Vol. 37, 299-307,

May 1984. Copyright

0092-8674/&l/05029%09

((3 1984 by MIT

Structural Requirements of a Yeast Chromosomal Stephen Kearsey Laboratory of Molecular Biology Medical Research Council Centre Hills Road Cambridge CB2 2QH, England l and C. Ft. C. Molecular Embryology Department of Zoology Downing Street Cambridge CB2 3EJ, England

for the Function Replicator

Group

Summary A sequence closely linked to the Saccharomyces cerevisiae HO gene confers autonomous replication in yeast. I have subjected this putative replication origin to deletion and point mutagenesis in order to identify structural features that are important requirements for autonomous replication in vivo. This analysis identifies a 14 bp core region, which is crucial for function and shows partial sequence conservation between a number of autonomously replicating sequences. Point mutations within the core region can abolish autonomous replication. The core region is flanked on one side by a sequence of about 20 bp, which is important for efficient autonomous replication. Deletion of this flanking sequence reduces, but does not necessarily eliminate, autonomous replication. Introduction Yeast transformation has provided an assay for DNA sequences that are good eucaryotic candidates for chromosomal origins of replication. These sequences, designated ARS elements, confer on plasmids the ability to replicate autonomously, allowing artificially constructed DNA molecules to be maintained in yeast as minichromosomes (Stinchcomb et al., 1979; Hsiao and Carbon, 1979). The apparent ability of ARS elements to confer autonomous replication on colinear DNA may reflect the requirement for a specific origin of replication in the transforming plasmid. This would suggest that ARS elements from the yeast genome are good candidates for chromosomal origins of replication, and circumstantial evidence has emerged to support this hypothesis (for review see Struhl, 1983). What constitutes an ARS element? Hybridization studies by Stinchcomb et al. (1979) indicated that AR3 does not contain a repetitive sequence element, and suggested that similarities between the sequences of different ARS elements would be limited. This was corroborated by sequence comparison between a 1.45 kb fragment containing ARS7 and a 100 bp region encompassing ARS2, which failed to show extensive homology (Tschumper and Carbon, 1982). Sequence comparison between seven yeast ’ Present address.

$02.00/O

ARS elements has, however, allowed the derivation of an ARS consensus sequence 5’ (A/T)TTTATPuTTT(A/T) 3’ that could be a crucial requirement for ARS function (i.e., supporting autonomous replication) (Broach et al., 1983; see also Stinchcomb et al., 1981). While sequences flanking this consensus element may also be essential, such a region appears to be restricted to a 75 bp region in the 2~ circle ARS (Broach et al., 1983) and to regions smaller than 60 bp in two other chromosomal ARS elements (Kearsey, 1983). Definition of the DNA sequence at origins of replication in procaryotic systems has contributed to the identification of proteins that play a part in the initiation process. This has been of particular interest since procaryotes control DNA replication at the level of initiation. As a step towards characterizing analogous events in eucaryotes, I have carried out an in vitro mutagenesis study of a yeast chromosomal ARS that is closely linked to the HO gene. This analysis identifies a very small region of 14 bp that is critically important in ARS function. Results Deletion Mapping of the HO ARS I have previously shown that an ARS element closely linked to the HO gene of S. cerevisiae is located within a 57 bp region (Kearsey, 1983). Random fragments of the HO gene region, produced by sonication, were cloned into the yeast integration vector M13se102 and fragments with ARS function were selected for by yeast transformation. Sequences of the ARS-containing fragments could subsequently be obtained, and the sequence held in common between a number of such fragments defined a small region essential for autonomous replication. The results from this analysis are extended in Figure 1, which includes data from three clones whose ARS-containing inserts terminate within the previously described region, now defining a sequence of 46 bp or less as essential for autonomous replication. The results from the sonication method include regions of DNA essential for ARS function but do not show that all of the 46 bp region is required. This was explored by making directed deletions into the HO ARS sequence using the exonuclease Bal 31. The construction of these deletions and the subsequent assay for ARS function are described in Experimental Procedures. The results from this analysis (Figure 1) show that not all of the region previously defined using the sonication method is essential for autonomous replication. On the right-hand side of the HO ARS region, deletion of 8 nucleotides within the “R” boundary has no major effect on ARS function (clones i70 and i85, Figure 1). However, deletion of 11 to 24 nucleotides has a variable effect on ARS function. In some mutants there is a major quantitative effect on autonomous replication in that transformants have slow growth rates, implying defective replication of the plasmid whose presence is being selected for (e.g., clones i91, i71, and i95).

I

vector

sequence

YEAST SEQUENCE

I[

(clone _.~~~~.

k6 derivatives: ~~~~ ~~~

~~

deletions ~~~~~~~~~_

CCATTTTTAGACTT'lTTCTTAACTCGAATGCTGGAGTAGTzUTACGCCASa from ~~~~.

5'

side1 ~~~~,

t&s

________________________________________--------------------------------------------------------------------------------------------------------------------------------around

gOI

in chromosome

<

5'<< < < < <<<< AAAATGTGTATATTAGTTTATTGTATGTAATAAAIC 6;)

70

d

L*II*

.

.

'R'

-SORE+

< 9;

100

110

120

130

.

> >

.

> >> >> >> 140

150

160

7'

aide)

.I

I.

. . . ACTTTTTCTTAACTCGAATGCTGGAGTAG-----------,GACTTTT-----------------------------------

~tcttggcgtaatcatggtcatagctgtttcctgtgtgaaattg Icgtaatc*rggtcatagctgtttcctgtgtgaaattgttgtt~t= ~caagcttggcgtaatcarggrcaragctgtrrcctgrgrgaa :ggtcatagcrgttrccrgtgrgaaarrgtrarccgcrcacaattccacac ~ggcgraarcatggtcatsgctgtttccrgrgtgtg~=~ttgtt~t~=g=t~~ ~gcttggcgraarcatggrcaragctgrtrccrgrgtgaaattgttatccgc caragctgtftcctgtgtgaaattgttarccgctcacaatt======~===~~=g~

ttgraaaacgacggccagrgaatrccccggggatcATA

ttgraaaacgacggccagrgaartcccggggatcATA

trgraaaacgacggccagrgaartcccggggatcATAILAAGTAAAATTTAA' PATTTTGG~tgrrtcctgtgtgaaettgttatccgctcacaattccacacaaca~acgagccggaag regtaaaacgacggccagrgaarrcccggggarcATlULA PATTTTGG:Agtcatagctgtrrcctgtgtgaaattgttatccgctcacaactccacacaacatacgagc rcgraaaacgacggccagtgaaetcccggggaecATAAAAGTAAAATTTAATggtcaragctgcrtcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagc tcgtaaaacgacggccagrgaarrccccgggSatcAT~Gagc~g~ttcc~g~g~Saaa~~Stta~ccSctcacaattccacacaacatacSa~ccSSaaScataaaStStaaaScc~S

and Ars Phenotypes

>3' 170 Sal1

ttgtaaaacgacggccagtgaattcccggggatc~ ttgtaaaacgacggccagrgaettcccggggatc~ ttgraaaacgacggccagtgaarrcccggggarc~ ttgtaaaacgacggccagtgaatrccccggggatc~

Figure 1. Sequences

k 82 k 39 1 23 1 28 1 26 k 30 1 15 k104 13 1 14 k 96 k 78

. >>

acolu xma1 ttgt*aaacgacggccBgtgaattcccggggat (clone h12 derivatives: delefinnc frnm ttgraaaacgacggccagtgaarrcccggggatcATAAAAGTAl rtgtaaaacgacggccagtgaattcccggggarcATAAAAGTAl trgtaaaacgacggccagrgaattcccggggatcATLTAAAAGTAl trgtaaaacgacggccagtgaattcccggggatcATAAAAGTAI

k 6‘

.

MAAAAAiCATTTTTAGiCTTTTTCTThCTCGAATGiTGGAGTACThTACGCCAg; EAAATTTAATATTTTGGATGAAAAAAA CCATTTTTAGACTTTTTCTTaUCTCGAATGCTGGAGTAGTAATACGCCAge, a CCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAATACGCCAga PGAAAAAAACCATTTTTAGACTTTTTCTMACTCGAATGCTGGAGTAGTAATACGCCA~a PGAAAAAUCCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAATACGCCAga ATGAAAAAAACCA'lTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAATACGCCAga RTGAAAMAACCATTTTTAGACTTTTTCTTAACTCG~TGCTGGAGTAGTAATACGCCAga CCATTlTTAGACTTTTTCTCAACTCGAATGCTGGAGTAGTAATACGCCAga --------------------------TTTAGACmTTCTTAGCCAg* ---------------------------TTAGACTTTTTCTT~CTCG~T~TG~GTAGTMTACGCCAga -----------------------------~ACTTAGCCAg=

ggc~r~~~~-nrrc,, ,.,+~~~~~~-~~~~~~~~~~~~~~-TTT~TA~TT~ATG

sequence

1 Ars phenotype

Hind111 Sal1 atgattacgccaagcttggctgcaggtcgacggatcAAAA

of Deletion Mutations

. i i i i i i 1 i i 1 i j j j

82 69 62 70 85 91 8 71 83 15 95 25 17 22

in the HO ARS

The boxed sequence is that of the chromosome in the vicinity of the HO ARS. and is numbered as before (Kearsey. 1983). The < and > symbols above the sequence indicate the left and right endpoints of randomly generated Ars+ clones derived from this region using the sonication method (Kearsey, 1983). These data include three sequences not previously given, which further reduce the size of the element essential for ARS function. The boundariis of this region are labeled “L” and “Ft.” The sets of deletion mutants derived from k6 and h12 parental clones are shown aligned with the HO ARS sequence and also with the sequence of the intact parental clones. Uppercase, underlined letters indicate yeast DNA sequence, lowercase letters or hyphens indicate Ml3 vector sequence. The Ars phenotypes of the clones, as defined in the Experimental Procedures, are designated. Clones that showed marginal (+) Ars phenotypes were plaque-purified and retested to ensure that their Ars phenotype did not result from low-level contamination with Ars+ DNA.

In other mutants, ARS function is abolished (e.g., clone i83). The reason for this variability may be explained by the differential “position effect” imposed by new flanking sequence brought in by the deletion, although no attempt has been made to interpret Ars phenotypes in terms of the new flanking sequences. Deletions removing more than 24 nucleotides inside the “R” boundary all show an Ars- phenotype (e.g., clone j25). On the other side of the ARS element, sequence important for autonomous replication appears to be close to the left-hand boundary (‘IL”), since deletion of only 8 nucleotides diminishes ARS function (clone I 28), and all larger deletions are Ars (clone I 26). These data are summarized in Figure 2. A “core” element, defined as sequence essential for ARS function, is localized by these data to a 14 bp stretch. Sequence flanking this element, although not essential for autonomous replication, appears to have a major quantitative effect on ARS function. The flanking region appears to be more extensive on the right-hand side of the core element, as shown in Figure 1. Here six mutants with deletions spanning a 16 bp region of high AT richness show defec-

tive or negative ARS function. On the other side of the core element, only one of the deletion mutants analyzed showed an Ars phenotype, which was intermediate between wild-type and negative.

Sequence Comparison between the HO ARS and Other ARS Elements Comparison of the HO ARS core region with other short ARS elements reveals significant similarities. The 14 bp core sequence is largely composed of an AT-rich element that almost matches the consensus element derived by Broach et al. (1983) from a comparison of seven ARS sequences. The HO ARS core and flanking sequence is compared to regions of four small ARS elements (Cl00 bp), and to two longer elements (~250 bp) from heterologous DNA that show clear homology to the consensus sequence in Figure 2. The e35, e57, e59, and f82 ARS elements were isolated directly from total DNA of S. cerevisiae or Xenopus laevis using the M13se102 vector as described previously (Kearsey, 1983; Mechali and Kearsey, submitted). This comparison reveals no impressive sequence conservation outside the consensus element

Structural

Requirements

for Autonomous

Replication

301

sequence comparison specifically is required.

itself, although the right-hand flanking sequence of most of the ARS elements is AT-rich (>75%) except for ARS2. The e57, ARS2, 2~ circle ARS, and e35 sequences all contain the motif GTATAC or GTA-TAC, but this is absent from the HO ARS, f82, and e59 sequences. Although this palindromic feature is intriguing, it is absent from most of the ARS elements compared by Broach et al. (1983). In five of the seven ARS elements the consensus is immediately followed by a G nucleotide, but this feature is not prominent in the comparison by Broach et al. (1983). Thus, although the deletion analysis suggests that the sequence flanking the core element is relevant to ARS function, this

Ftgure 2. Comparison

Point Mutations in the HO ARS Sequence comparisons between twelve ARS elements aligned by their consensus elements reveals that certain of the nucleotides in the HO -4% core are completely conserved (denoted by + symbols, Figure 2). This result suggests that these positions are crucial for autonomous replication and that mutation of these conserved bases would be most likely to have a dramatic effect on ARS function. The phenotype of a number of point mutations in the HO ARS confirms this expectation. The strategy for constructing point mutants used a recombinant Ml3 clone where the ARS DNA insert contributes a short reading frame, inserted in register with the reading frame of the vector ,&galactosidase (/acZ) gene. This clone produces functional P-galactosidase in a suitable E. coli strain, detected as a blue plaque color on indicator plates. Directed mutations were introduced into the ARS fragment of this clone, which created nonsense codons in the P-galactosidase reading frame (Figure 3 and Experimental Procedures). These mutants could be easily detected in a population largely consisting of nonmutant phages by screening on indicator plates. Classical mutagenesis methods subsequently allowed the isolation of further point mutations where the nonsense codon had been mutated to sense, and 8-galactosidase was again produced by the phages (see Experimental Procedures). These revertants did not necessarily have the same sequence as the wild-type ARS, and thus a series of point mutations could be obtained from a single directed mutation (Figures 4 and 5). The effects of point mutations on ARS function are striking in that the two point deletions and the one basesubstitution mutation outside the region of the HO ARS that matches the ARS consensus have little effect on the Ars phenotype, whereas the series of point mutations within this conserved region have lost ARS function. Of particular interest is the 1048 mutation, which is Ars- and yet differs by only one nucleotide from the Ars+ 956

of a Number of ARS Elements

The HO ARS region, as defined in the sonication method, is shown and the extents of the “core” and “flanking” regions, as defined by the Bal 31. derived deletion mutants, are indicated (see text). The regions of the other ARS elements given are those that show best homology to the ARS consensus sequence as defined by Broach et al. (1983). The ’ symbols Indicate nucleotide positions homologous to the HO ARS sequence in the alignment shown. The + symbols indicate nucleotides of the HO ARS sequence that are conserved between 12 ARS elements, namely all the elements presented in the given alignment and those presented by Broach et al. (1983). Underlining shows the position of the GTA(-)TAC motif, present in some ARS elements. The e35, e57, e59, and f82 ARS elements were Isolated as described In Kearsey (1983) from total DNA of S. cerevisiae or X. laevis. Dot hybridization (Kafatos et al., 1979) was used to confirm that Xenopus DNA was the source of the e35 and e57 clones (not shown). The ARSP sequence is taken from Tschumper and Carbon (1982). the 2p circle ARS is taken from Broach et al. (1983), and the f82 sequence has also been published previously (Kearsey, 1983).

I 5'

I h48

T T phage

P A F E (+) strand

L

R

K

S

L

K

M

V

F

gives no clear picture as to what

F

I <

Q N core

I

K >

F

Y

F

Y

gatcattactactccagcattcgagttaagaaaaagtctaaaaa~ggtttt~~~ca~ccaaaa~at~aaa~~t~ac~~~~a~ga~c.. CTAGTAATGATGAGGTCGTAAGCTCAATTCTTCTTTTTCAGATTTTTACC AAAAAAAGTAGGTTTTATAATTTAAAATGAAAATACTAG < > --HO ARS insert Q N I * (5' caaaatatttgattttac 3') mut-1 primer 3' GTTTTATAAAATTAAAATG 5' V (5’

mut-2 Figure 3. Strategy

primer

Used for Isolation of Point Mutations

3'

F

F

I

D

..rest

of 3'

B galactosidase a-peptide

5'

*

gtttttttcatctaaaat

3’)

CAAAAAAAGTAGATTTTA -

5'

in the HO ARS

The sequence shown IS that of the 78 bp HO ARS insert plus flanking Sau 3A sites of the vector in clone l-148, the lowercase sequence representing the viral (+) strand of the phage. The predicted amino acid sequence of the reading frame encoded by the HO ARS insert is shown, and this is in frame with the /acZ gene in the M13mp93 vector. The sequences of the two 18.mer primers are shown in uppercase letters and the bases that differ form the ARS sequence are underlined. The introduction of these changes into the ARS element introduces nonsense codons into the lacZ reading frame, indicated by the asterisks. The HO ARS reading frame used in the h48 clone is not likely to be part of the HO gene reading frame (unpublished resuits). Note that the orientation of the sequence in this figure is reversed with respect to sequence in the other figures.

Cell 302

Ars

allele

<

core

and flanking cclre >

< L +t+++i+ ATAAAAGTAAAATTTAATATTTTGGATG

region

>

R AAAAAAACCATTTTTAGACTTTTTCTTAACTCGAATGCTGCTGGAGTAGTAAT

5’

mut-2 mutant . ATAAAAGTAAAATTTAATATTTTaGATGnut-2 series . ATAAAAGTAAAATTTAATATTTTsGATG ATAAAAGTAAAATTTAATATTcTaGATG -Frgure 4. Sequences

co-trans -formation +

3’

deletion series ATAAAAGTMAATTTAATATTTTGGATG AAMAACCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT ATAAAAGTAMATTTAATATTTTGGATGAAAAAAA CCA TTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT lmlt-1 mutant . ATAAAAGTAAAATmTATTTTGGATG at-1 series . ATtUAAGTAAAATsAATATTTTGGATG ATAAAAGTAAAATeTATTTTGGATG ATAAAAGTAAAAgTgAATATTTTGGATG ATAAAAGTAAAAccaAATATTTTGGATG ATAAAAGTAAAASTATTTTGGATG

phenotype

(clone) wt(h48)

after uRA3 insertion

+

nt nt

871 952

+ +

851(h51)

-

'AAAAAAA CCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT AAAAMACCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT AAAAAAACCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT AAAAAAACCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTMT AAAAAAACCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT

870 918

-

917

-

nt

887 922

-

nt

*AAAAAAA

956(i56)

+

+

1062 1048(j48,

+ -

+

*AAAAAAA

CCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT

CCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT

AAAAAACCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT AAAAAAACCATTTTTAGACTTTTTCTTAACTCGAATGCTGGAGTAGTAAT

kg)

of Point Mutations

in the HO ARS

The top sequence IS that of the h4S parental clone with the domarns of the ARS element Indicated. The + symbols indicate nucleotide positions whose sequence is conserved between 12 AR.9 sequences as described in Figure 2. The differences between the mutant and h4f3 (wild-type) sequences are indicated by lowercase letters and underlining, and the Am phenotypes, as described by cotransformation and after reconstructron with the UFtA3 gene, are indrcated (nt = not tested). The two point-deletion mutants were isolated from the h12 clone by mutagenesis with acridine yellow during growth in E. coli, followed by screening for blue plaques. The mutants in the mut-I series were obtained from the h51 clone by screening for blue plaques after mutagenesis with ultravrolet light. The mut-2 series of mutants was obtarned from the i56 clone by screening after mutagenesis with 2-aminopurine.

1062

870 Figure 5. Sequencing The nucleotides

918

Gels Showing the HO ARS Core Region of a Number of the Mutants Shown in Figure 4

that differ from the wild-type

sequence

are in lower case letters.

887

1048

Structural 303

Requirements

for Autonomous

Replication

mutation. This suggests that the sequence specificity required for ARS function is exacting. Also of note is the 918 mutation, which shows that AT richness alone is not sufficient to permit autonomous replication. This mutation differs from the wild-type sequence by a double T:A to A:T transversion, which thus preserves the AT richness of the sequence and yet has an Ars- phenotype. A transition mutation (956) affecting the G nucleotide, which appears to be partly conserved in the comparison shown in Figure 2, does not abolish autonomous replication. Marker Rescue of the Ars Phenotype Using an 18 Nucleotide Primer An adaptation of the marker rescue technique (see Hutchison and Edgell, 1971) was used to show unambiguously tha a single-nucleotide change can eliminate autonomous replication. The 18 nucleotide mut-2 primer mutated the wild-type ARS sequence by a single transition to produce a sequence (956) that is still Ars+ (Figure 3). An additional single-nucleotide change in this sequence, giving the 1048 allele, is accompanied by loss of ARS function (Figure 4). Reversal of this additional sequence change, back to the 956 sequence, was shown to be accompanied by a reacquisition of ARS function in this marker-rescue experiment using the mut-2 primer. Single-stranded k9 DNA, which contains the 1048 mutation and the lJRA3 gene, was hybridized to either the mut-1 or the mut-2 primer as described in Experimental Procedures and used to transform the SX34-4D yeast strain to Ura+. The transformation with the k9 DNA plus annealed mut-2 primer produced a significant number of transformants unstable for the Ura+ phenotype (lo-lOO/ Kg DNA). Recombinant Ml3 DNA was rescued from a number of these transformants and sequenced to reveal the introduction of a single transition in the HO ARS at the position determined by the mut-2 primer (to give the 956 allele). The recovery of the Ars+ phenotype was clearly determined by the 18 nucleotide mut-2 primer and not by, for instance, a gene-conversion event involving the chromosomal HO locus, since no unstable Ura+ transformants were recovered in the control transformation using the k9 DNA plus mut-1 primer. Furthermore, the 956 allele differs in sequence from the wild-type HO ARS. Discussion These results demonstrate the sequence requirements for autonomous replication of the HO ARS element in yeast. A 14 bp core region is critically important for ARS function as determined by deletion mapping and the effect of point mutations. This region is largely composed of an AT-rich sequence previously recognized as a conserved consensus element in autonomously replicating sequences (Stinchcomb et al., 1981; Broach et al., 1983). A series of point mutations within the part of the core region corresponding to the ARS consensus completely eliminates ARS function. These mutations may identify nucleotide

positions within the core element that must have their wildtype sequence in order for autonomous replication to occur. This is also suggested by the complete conservation of sequence at these positions in the comparison shown in Figure 2. Seven nucleotide positions of the core element show either partial or no conservation in the comparison, suggesting that some sequence changes would be tolerated. Indeed, a single point mutation within the core element but immediately adjacent to the ARS consensus does not prevent autonomous replication. The I 28 deletion mutant, which removes one nucleotide of the HO ARS sequence matching the ARS consensus, is not Ars-, but that position of the consensus element contains an A or T ambiguity that also matches the new sequence of the deletion mutant. The results from the deletion analysis imply that the ability of a sequence to confer autonomous replication is a quantitative property. In mechanistic terms this may equate with the probability that an ARS element will function as a replicator in a particular S phase, perhaps by “firing” as an origin of replication. Thus the full ARS function of the HO ARS may be provided by the extent of sequence necessary to maximize that probability. The deletion analysis suggests that sequence flanking the core (the righthand side in Figure 1) is necessary for full ARS function. It should be stressed that the assay used to detect ARS function gives limited quantitative information about the efficiency of autonomous replication. Thus the assay does not define precisely the structural boundaries of sequence required for full ARS function, but clearly shows its approximate location. A more accurate description of the sequence requirements for full ARS function would require a direct quantitative assay, as may be provided by the segregation behavior of centromere-containing plasmids (see Murray and Szostak, 1983). Sequence comparisons between various well-defined ARS elements give no unambiguous indications as to what structural features are important, in addition to the core element, for full ARS function. However, the high AT richness of the HO ARS flanking region is a feature common to the environment of a number of ARS elements. Two point deletions within this flanking sequence do not have a major effect on autonomous replication, suggesting that the exact sequence of this region is not required for its role in ARS function. Preliminary results obtained using AR.9 are consistent with the data presented here (Tschumper and Carbon, 1980; Stinchcomb et al., 1981). In the AR.9 sequence, a perfect match to the ARS consensus element is located adjacent to a Bgl II site and this allows sequence only five nucleotides 3’ to the consensus element to be replaced after cutting with Bgl II. Such constructs are either Ars* or Ars-, depending on what new sequence is introduced. It is clearly not possible to deduce a detailed model as to how ARS elements function from nucleotide sequences alone, but certain inferences may be drawn. The relatively small size of the HO ARS core element and the specificity

of effect that point mutations have on ARS function are compatible with the probable role of ARS elements as recognition sites for proteins that mediate autonomous replication. It is also possible to reject hypotheses that invoke certain nonspecific features of DNA sequence as being solely responsible for ARS function. Thus although the high AT richness of ARS elements is consistent with the requirement to melt the double helix at the origin of replication in order to initiate priming, the Ars- phenotype of the 918 mutation, where the AT richness has not been changed, indicates that base composition alone is not sufficient for ARS function. It is of interest that short ATrich sequences are important features of well-characterized replication origins from mammalian viruses (Soeda et al., 1979; Bergsma et al., 1982; Tamanoi and Stillman, 1983) and bacteriophages (Tsurimoto and Matsubara, 1983; Fuller et al., 1983). Characterization of the agents that are involved in the recognition of ARS elements would help to establish their probable identity as origins of DNA replication and might contribute to an understanding of the mechanism that controls DNA replication in yeast. Given the dramatic effects that point mutations can have on ARS function, it would be of interest to see if suppressor mutations can be obtained that restore autonomous replication of such mutants This would be analogous to the approach used by Shortle et al. (1979) who showed that secondary mutations in the SV40 T-antigen gene could suppress the defective phenotype of point mutations in the SV40 origin region. Similarly, mutations in the yeast genome that alleviate the effects of point ARS mutations may help to identify genes whose products interact with autonomously replicating sequences. Experimental

Procedures

Enzymes and Chemicals Restriction enzymes, exonuclease Bal 31, and T4 DNA ligase were purchased from New England Biolabs, and were used as recommended by the manufacturer. Klenow DNA polymerase I was from Boehringer. or-“PdATP was from Amersham. Strains E. coli JMlOl (F’ traD36 proAT /acP ZAM15, Akpro thi supE) and E. co11 WJMlOl (F’ fraD36 proAT /acP ZAM15, Akpro fh) were used as hosts for vectors derived from phage M13. E. coli SE142 (F’ /acZ::TnlO (TetR). (Thr-), leuB6, proA2, fhi, recAl3, hsdff-, hsdW, pyrF74::Tn5) was used to detect the presence of the URA3 gene rn phage Ml3 genomes. This is derived from strain 6507, from Dr. D. Botstern. S. cerevfsiae SX34. 4D (hmla mah hmra mar7 a&8-70 ura3-52 /eu2-3,112 trpl his3) was usad for all transformations. Media Selective media for yeast lackrng uracil were as described by Sherman et al. (1982). Media for E. coli and phage Ml3 culture are described in Miller (1972). Indicator plates, showing the blue color reaction for phage Ml3 clones that produce functional fl-galactosidase a-peptrde, contained 40 rg/ ml bromo-chloro-indolyl-galactosidase (BCIG) and 40 AM isopropylthiogalactosrde. and were used as described by Messing (1983). Preparation of DNA Phage Ml3 RF DNA was prepared as described in Messing (1983) or by using a rapid alkaline-lysis method (Birnboim and Doly, 1979) described in

Manratis et al. (1982). Phage Ml3 according to Sanger et al (1980).

srngle-stranded

DNA was prepared

Transformation Competent E. coli JMlOl or WJMlOl was prepared and transfected with phage Ml3 DNA as described in Messing (1983). Yeast strarn SX34-4D was transformed according to a modification of the Baggs (1978) procedure described in Sherman et al. (1982). using 2.5 pg carrier E. coli DNA rn all transformations. Construction of the Deletion Mutations Derived Using Exonuclease Sal 31 The Bal 31 deletion mutants were made from derivatives of the 965 and f47 clones, which lack the URA3 gene (Table 1). The 965 and f47 clones are known to have ARS function since they can transform ura3 yeast strains at high efficiency, and the Ml3 clone DNA can be rescued from yeast transformant DNA by transfection of E. coli (Kearsey, 1983). Furthermore, Southern blots of the yeast transformant DNA show drrectly that the DNA is being marntained autonomously (not shown). The AR.7 elements in the 965 and f47 clones appear to confer autonomous replication with similar efficrencies to clones containing more extensrve segments of DNA encompassing the HO ARS region (Kearsey. 1983) but the growth-rate assay used in this comparison would not detect minor differences in ARS function. In CEN3-containing plasmids, the HO ARS confers a segregation frequency srmrlar to that shown by ARSl (unpublrshed results, see Murray and Szostak, 1983). The h12 clone was constructed by subcloning the ARS Insert from the g65 clone as an Eco RI-Sal I restrictron fragment in M13mp93 RF DNA, usrng standard procedures described in Maniatis et al. (1982). The k6 clone was derived from f47 RF DNA by cutting with Hind III and reclosrng with T4 DNA ligase. The deletion mutants were constructed by cutting h12 or k6 RF DNA at the unique Sal I site (Figure 1) and digesting for various times with exonuclease Bal31. Since h12 and k6 contain the ARS insert In opposite orientations, deletions were obtained extending into both the left and nghthand sides of the ARS. The ends of the digested molecules were repaired by Incubating with Klenow DNA polymerase and dNTPs and reclosed by ligating wrth T4 DNA ligase. After transfection of E. coli JMIOI, singlestranded phage DNA was prepared from 120 plaques and the sizes of the deletrons In these clones were determrned by partial dideoxy sequencing (Sanger et al., 1980). Interesting deletions were sequenced completely. Dideoxy sequencing (Sanger et al., 1977) was carried out using the “universal” primer (Duckworth et al., 1981). Phage Ml3 Mutagenesis Oligonucfeofide-Direct Mufagenesis of Ml3 Clones Oligonucleotide-directed mutagenesis was performed upon the h48 clone, where the HO ARS insert does not frameshift the reading frame of the /acZ gene. In spite of the extra amino acids encoded by the ARS insert, functional @-galactosidase a-peptide is expressed, since the clone produces blue plaques on BCIG indicator plates. The h48 clone was derived from the hl2 clone by cutting hi2 RF DNA with Eco RI and Xma I, after which the staggered ends were made flush by incubation with Klenow DNA polymerase and dNTPs, and the Irnearized molecules were reclosed with T4 DNA ligase. This had the predicted effect of deleting a single C:G from between the two restriction sites (Figure 1) and clones with this sequence were Identified by transfecting E. coli WJMlOl and screening for phages producrng blue plaques by platrng out onto rndrcator agar. This mutatron does not affect ARS function. Mutagenesis was done using the two-primer modification (Norris et al., 1983) of the primer-mutagenesis method (Zoller and Smith, 1983). The 18 nucleotrde mut-1 and mut-2 primers, Imperfectly complementary to the HO ARS Insert in the h48 angle-stranded DNA (Figure 3), were synthesized by B. Sproat using the continuous-flow phosphotriester method for solid-phase syntheses of olrgonucleotides (Sproat and Bannwanh, 1984). The mut-I primer was designed to mutate 2 nucleotrdes rn the core element that are completely conserved between the sequences shown rn Figure 2. The mut2 primer was used to mutate the partly conserved G:C base pair Immediately adjacent to the part of the core region that matches the ARS consensus. These two mutations introduced a UGA or UAA nonsense codon Into the

$tr&rral

Requrrements

for Autonomous

Replication

Table 1. Phage Ml3 Clones Used

Designation

Description

Ml 3mp9

(Messing,

1983)

M13mp93

Essentially

wild-type

M13se102

M13mp9 containing (Kearsey, 1983)

M 13sef47

M13se102 containing HO ARS fragment site (Kearsey, 1983)

(nucleotides

87-168)

inserted into flush-ended

$5

M13se102 containing HO ARS fragment site (Kearsey, 1983)

(nucleotides

86-162)

inserted

from 965, inserted as Eco RI-Sal I fragment

Ml 3mp9 i.e., not Sup&dependent S. cerevlsiae

containing

MA3

HO ARS fragment

gene as a 1 .I kb fragment

h12

M13mp93

h48

As h12 but C:G deleted between

h51

As h48. but containing

two point mutations

i56

As h48, but containing

single point mutation

j48

As h48, but containing

k6

M13mp9

k9

As j48, but containing

containing

(J. Messing,

two point mutations

(allele 956) introduced

inserted

into flush-ended

blue

-

white

Barn HI

+

white

Bam HI

+

white

+

pale blue blue

by mut-1 primer

-

whrte

by mu-2 primer

+

white

-

blue (on SupE strain)

+

pale blue

-

white

inserted into unique Hind III site

/acZ reading frame and the desrred mutants could be identified after transfection of E. co11 by their white plaque color. The primers were kinased as described in Zoller and Smith (1983). 0.2 pg of h48 single-stranded DNA was hybridized to 2 pmoles of the mut-1 or mut-2 primer. and 2 pmoles of “universal” sequencing primer in 10 pl of HIN buffer (10 mM tris-HCI, pH 8.0, IO mM MgCb, 50 mM NaCI) by heating to 100°C in a sealed capillary and cooling slowly to room temperature. After hybridization, 2.5 U Klenow DNA polymerase I and 400 U T4 DNA ligase were added in 10 pl HIN buffer also containing 0.5 mM ATP, 10 mM DTr and 0.5 mM dNTPs. After incubation for 1 hr at room temperature, the mixture was used to transform competent E. coli JMlOl or WJMIOI, and white plaques (frequency -lOTa) were characterized by sequencing the phage DNA. The h51 and i56 mutant clones, derived using the mut-I and mut-2 primers, were plaque-purified extensively before determination of Ars phenotype and any subsequent mutagenesis experiments. Classical Mutagenesis of Phage Ml3 The two mutants obtained by olgonucleotide-directed mutagenesis, h51 and i56, were subsequently used for obtaining further point sequence changes in the HO ARS. Classical mutagenesis of the h51 and i56 phage followed by screening for blue plaques on BCIG indicator plates allowed the isolation of a number of revertants where usuatly the single nonsense codon in the /acZ gene had been mutated to sense. This method is similar to the strategy used by Traboni et al (1982) to isolate mutations in a tRNA promoter. Ultraviolet light, which has the potential to induce transitions, transversions, and more complex mutations (Coulondre and Miller, 1977) was most useful for producing derivatives from the h51 clone. This mutagen was less useful with the i56 mutant, since the most common mutation was a transition back to the wild-type ARS sequence. In this case, 2-aminopurine, whrch induces A:T to G:C transitions (Coulondre and Miller, 1977) was used to isolate the 1048 mutation. Sequences of the mutations obtained by the i&al primer mutagenesis and the subsequent screening for blue plaque revertants are shown in Figures 4 and 5. Mutagenesis was carried out essentially as described in Miller (1972). A phage stock was prepared by picking a plaque into a 1.5 ml culture of E. coli JMIOI in early-log phase and growing for 5-6 hr. For mutagenesis with ultraviolet light, the initial 1.5 ml phage stock was diluted 1 :lO with M9 medium. This culture and an uninfected culture of E. co11 JMlOl growing in 2x Ty medium (ODem -0.1) were irradiated with ultraviolet light to achieve approximately 0.1% survival. Then the cultures were mixed, afiquoted into 1 ml cultures, and incubated overnight. The cultures were plated out on BCIG indicator plates at a density of about 105 plaques per -10m5) were plaque-purified and plate. Blue plaque mutants (frequency characterized by sequencing.

blue

-

+

as Eco RI-Sal I fragment

1 .I kb URA3 Hind Ill fragment

-

into the Hind Ill site

(allele 1048)

HO ARS from f47 inserted

Plaque Color on lacZAM15 Strain

unpublished)

Eco RI and Xma I sites (allele 851) introduced

Ars Phenotype

For P-amrnopurrne mutagenesis, 0.01 ml of a 10d dilutron of the orrginal phage culture was added to 5 ml 2x M medrum containing 600 pg/ml mutagen and shaken at 37°C for 24 hr. Phages were screened as before to Isolate blue plaque mutants (frequency -IO-‘). Two single-base deletions within the HO ARS were also isolated from the h12 clone. Since the ARS insert disrupts the reading frame of the /acZ gene in this clone, resulting in a white (in fact, pale blue) plaque phenotype, screening for blue plaques after mutagenesis allowed the isolation of frameshift mutations. Unfortunately, this method was of limited use srnce most mutations occurred in a “hot spot” consrsting of a seven consecutive A:T base pairs. These frameshift mutations were isolated by adding 0.1 ml of a IO6 dilutron of the original phage stock to 5 ml of enriched M9 medium containing 40 pg/ml acridine yellow, and growing for 24 hr. Phages producing blue plaques were detected by plating out on BCIG-containing medium as before. The point mutants were assayed for ARS function by transformation of the SX344D yeast strain with the single-stranded DNA of the Ml3 phage clones, either using cotransformation with M13se102 DNA as with the deletion mutants, or using derivatives of the mutants where the URA3 gene had been reinserted into the recombinant Ml3 genome rn vitro. Reconstruction of URA3-Conteining Ml3 Clones This was achieved by cutting the clone RF DNA with Hind Ill and ligating to a 1.l kb Hind Ill fragment containing the MA3 gene using T4 DNA ligase. The legation mix was used to transform E. coli SE142. and the desired recombinants could be identified by their abrlity to complement the pyrF mutatron (Bach et al., 1979). Alternatively, plaque color in E. coli JMlOl could be used with a number of the mutants to detect recombinants. The structure of the recombinants was checked by restriction mapping and sequencing. All the reconstructions used contained the URA3 gene in the same orientation as the original 965 clone. Assay for AR.9 Function MI3 Clones Lacking the URA3 Gene ARS function of the recombinant Ml3 clones lacking the selectable MA3 gene, such as the deletion mutants, was assayed by cotransformrng yeast strain SX344D with 0.2 pg clone single-stranded DNA and 1 pg M13se102 RF DNA, using 2.5 pg sheared E. coli DNA as carrier, and selecting for Ura+ phenotype. The menus-uracil sorbitol plates were replica-plated onto the ordinary minus-uracil plates 2 days after transformation and scored 3 days later. Ars phenotypes were categorized as follows: (+) 2103 transformantslpg DNA, growth rates comparable to those of transformants obtained with control h12 or k6/M13se102 DNA?,, transformants unstable

Cdl 306

for the Ura+ phenotype; (*)102-l@ transformantslpg DNA, growth rate much slower than those of hl2 or k6 transformants (small colonies, doubling time at least twice that of the controls). transfonants unstable for the Ura+ phenotype; (-) O-l fast-growing transformant/pg DNA, transformants stable for the Ura+ phenotype (integrative transformation). In this cotransformatron assay, efficient recombination between the clone DNA and the URA3 M13se102 DNA rn vivo elrminates the need to rernsert the URA3 gene into each deletion mutant in vitro (Singh et al., 1982). Lack of fastgrowing transformants owing to Ars- clone DNA could be clearly distinguished from failure to transform for some other reason since the Ml 3se102 DNA, although itself Ars-, would produce a background lawn of very slowly growing “abortive” transformants (>lO’/pg M13se102 DNA), which fail to grow afler replica-plating onto selective medium. The formal possibility that this assay is detecting a site necessary for in vivo recombination, separate from a site needed for ARS function, is unlikely since the 14 bp core sequence identified is, by other criteria, largely involved in ARS function. M I3 Clones Containing the URA3 Gene ARSfunction in URAS-containing Ml3 clones was determined by transforming the SX34-4D strain with 0.2 ag cloned single-stranded DNA and carrier DNA only, scoring for Ura+ transformants as before. The functioning of the URA3 gene in mutants where the Ars phenotype was negative and thus did not confer high-frequency transfonation was confined by three criteria: complementation of the pyrF- mutation in E. coli (Bach et al., 1979); production of stable Ura’ transformants at low frequency after transformation of a ura3-52 strarn (ca. I/Kg single-stranded DNA); and production of high-frequency “abortive” transformants in yeast, as in the cotransformation assay. Marker Rescue of the Ars Phenotype Using an 18 Nucleotide Primer In the marker-rescue experiment to show that the single-nucleotrde difference between the 956 and 1048 alleles was responsible for the difference in Ars phenotype, “unrversal” sequencrng primer and the mut-I or mut-2 primer were annealed to single-stranded DNA of the MA3 Ars- clone k9 and treated with Klenow polymerase and T4 DNA ligase as described for primer mutagenesis. The DNA was phenol-extracted and precipitated wrth ethanol in the presence of 2.5 pg carrier DNA. This DNA was used to transform the yeast strain SX344D to Ura+. Transformants unstable for their acquired Ura’ phenotype were only obtained from the mut-2 plus k9 DNA mix, and Ml3 DNA was recovered from a number of such transformants as described in Kearsey (1983). Sequencing showed the presence of the 956 allele rn all of these clones.

I thank Ron Laskey for encouragement and for laboratory facilities, and Marcel Mechali and Kim Nasmyth for helpful discussions. I also thank Marvrn Wickens for advice concernrng phage Ml3 mutagenesis. I am especially grateful to Brian Sproat for syntheses of the oligonucleotrde prrmers. S. K. is a Beit Memorial Research Fellow. The costs of publication of thus article were defrayed in pan by the payment of page charges. Thus article must therefore be hereby marked “advertisement” in accordance with 18 USC. Sectron 1734 solely to indicate this fact. January

recombinant

plasmrd DNA. Nucl. Acids Res. 7, 1513-1523.

Broach, J. R., LI. Y.-Y., Feldman, J., Jayaram, M., Abraham, J.. Nasmyth, K. A.. and Hicks, J. B. (1983). Localization and sequence analysis of yeast origins of DNA replcatron. Cold Spring Harbor Symp. Quant. Biol. 47, 1165 1173. Coulondre, C., and Miller, J. H. (1977). Genetic studies of the lac repressor IV. Mutagenic specificity in the /ac/ gene of Escherichia coli. J. Mol. Biol. 117, 577-606. Duckworth. M. L., Gait, M. J., Goelet, P.. Hong, G. F., Singh, M., and Trtmas, R. C. (1981). Rapid synthesis of oligodeoxyribonucleotides VI. Efficrent mechanized synthesis of heptadecadeoxynbonucleotides by an improved solid-phase phosphotriester route. Nucl. Acids Res. 9, 16911706. Fuller, C. W., Beauchamp, B. B., Engler, M. J., Lechner, R. L.. Matson, S. W., Tabor, S., White, J. H.. and Richardson, C. C. (1983). Mechanisms for the initiation of bacteriophage T7 DNA replication. Cold Spring Harbor Symp. Quant. Biol. 47, 669-679. Hsiao, C.-L., and Carbon, J. (1979). High-frequency transformatron of yeast by plasmrds containing the cloned yeast ARG4 gene. Proc. Nat. Acad. Sci. USA 76, 3829-3833. Hutchrson fragments 189.

C. A., Ill, and Edgell. M. H. (1971). Genetic assay for small of bacteriophage $X1 74 deoxyribonucleic acid. J. Virol. 8, 181-

Kafatos, F. C., Jones, C. W., and Efstratiadis, A. (1979). Determination of nuclerc acid sequence homologies and relative concentrations by a dot hybrrdizatron procedure. Nucl. Acrds Res. 7, 1541-l 552. Kearsey, S. E. (1983). Analysis of sequences conferring replrcation rn baker’s yeast. EMBO J. 2, 1571-1575.

autonomous

Maniatrs, T., Fritsch, E. F., and Sambrook. J. (1982). Molecular (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory). Messing, J. (1983). New Ml3 vectors 78.

for cloning. Meth. Enzymol.

cloning. 701, 20-

Miller, J. H. (1972). Experiments in molecular genetics. New York: Cold Spring Harbor Laboratory).

(Cold Spring Harbor,

Murray, A. W., and Szostak. J. W. (1983). segregation in yeast. Cell 34, 961-970.

analysis

Pedrgree

of plasmid

Noms, K., Norris, F., Chnstransen, L., and Fill, N. (1983). Efficient sitedrrected mutagenesis by simultaneous use of two primers. Nucl. Acids Res. 77, 5103-5112. Sanger, F.. Nicklen, S., and Coulson, A. R. (1977). DNA sequencing chain-termrnatrng rnhibrtors. Proc. Nat. Acad. Sci. USA 74, 5463-5467.

Acknowledgments

Received

for screening

3, 1984; revrsed February

6, 1984

References Bach, M.-L., Lacroute, F., and Botstein, D. (1979). Evidence for transcriptronal regulatron of orotidine-5’.phosphate decarboxylase in yeast by hybridization of mRNA to the yeast structural gene cloned in Eschenchia colr. Proc. Nat. Acad. Sci. USA 76, 386-390. Beggs, J. D. (1978). Transformation Nature 275, 104-109.

of yeast by a replicating

hybrid plasmid.

Bergsma, D. J.. Oliver, D. M., Hartzell. S. W., and Subramanian, K. N. (1982). Territorial lrmits and functional anatomy of the simian virus 40 replication origin. Proc. Nat. Acad. Sci. USA 79, 381-385. Brrnborm. H. C., and Doly, J. (1979). A rapid alkaline extraction procedure

with

Sanger, F.. Coulson, A. R., Barrell, B. G., Smith, A. J. H., and Roe, B. A. (1980). Cloning rn single-stranded bacteriophage as an aid to rapid DNA sequencrng. J. Mol. Biol. 143, 161-l 78. Sherman, F., Funk, G.. and Hrcks, J. B. (1982). Methods in Yeast Genetics. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory). Shonle, D. R., Margolskee, R. F., and Nathans, D. (1979). Mutational analysrs of the srmian virus 40 replicon. pseudorevertants of mutants with a defective replication origin. Proc. Nat. Acad. Sci. USA 76, 6128-6131. Srngh. H., Breker, J. J., and Dumas, L. B. (1982). Genetic transformation of Saccharomyces cerevisrae wrth single-stranded crrcular DNA vectors. Gene 20.441-449. Soeda, E., Arrand, J. R., Smolar, N., and Griffin, B. E. (1979). Sequence from early regron of polyoma virus DNA containing viral replication origin and encoding small, middle and (pan of) large T antigens. Cell 77, 357370. Sproat, B. S., and Bannwarth, W. (1984). Improved synthesis of oligodeoxyribonucleotides on controlled-pore glass using phosphotnester chemrstry and a flow system. Tetrahedron Lett 51, 5771-5774. Stinchcomb, D. T., Struhl, K., and Davis, R. W. (1979). Isolation and characterization of a yeast chromosomal replicator. Nature 282, 39-43. Stinchcomb, D. T., Mann, C, Selker, E., and Davis, R. W. (1981). DNA sequences that allow the replrcation and segregation of yeast chromsomes. ICN-UCLA Symp. Mol. Cell. Biol. 22, 473-488. Struhl. K. (1983) The new yeast genetics.

Nature 305, 391-397.

StrFtural

Requirements

for Autonomous

Replication

Tamanoi. F., and Strllman, B. W. (1983). Initiation of adenovirus DNA replicatron in vitro requires a specific DNA sequence. Proc. Nat. Acad. Sci. USA 80, 6446-6450. Traboni. C.. Ciliberto, G.. and Cortese, R. (1982). A novel method for sitedirected mutagenesis: its appkcation to a eukaryotic tRNARogene promoter, EMBO J. 7. 415420. Tschumper, G., and Carbon, J. (1980). Sequence of a yeast DNA fragment containing a chromosomal replicator and the TRP 7 gene. Gene 10, 157166. Tschumper. G., and Carbon, J. (1982). Delta sequences and double symmetry in a yeast chromosomal replicator region. J. Mol. Biol. 156. 293307. Tsurimoto. T., and Matsubara, K. (1983). Replication of bacteriophage DNA. Cold Spring Harbor Symp. Quant. Biol. 47, 681-691.

A

Zoller, M. J.. and Smith, M. (1983). Oligonucleotide-directed mutagenesis of DNA fragments cloned into Ml3 derived vectors. Meth. Enzymol. 100, 468~SOO.