- Email: [email protected]
Structure and expression of chicken protein kinase PITSLRE-encoding genes
Gene, 153 (1995) 237-242 © 1995 Elsevier Science B.V. All rights reserved. 0378-1119/95/$09.50
237
GENE 08590
Structure and expression of chicken protein kinase PITSLRE-encoding genes (Cell cycle; tumor suppressor; protein kinase; apoptosis)
H a i m i n Li a, Jose Grenet a, Marcus Valentine b, Jill M. Lahti a and Vincent J. K i d d ~ Departments ofaTumor Cell Biology, and bExperimental Oncology, St. Jude Children's Research Hospital, Memphis, TN 38105, USA Received by J.A. Engler: 13 September 1994; Accepted: 11 October 1994; Received at publishers: 7 November 1994
SUMMARY
The human PITSLRE protein kinases (PK), members of the p34 cdc2 kinase family named according to the single amino acid (aa) code of an important (PSTAIRE) regulatory region [-Meyerson et al., EMBO J. 11 (1992) 2909-2917], are candidate tumor suppressor gene(s) localized to human chromosome lp36.2 and a syntenic region of mouse chromosome 4 [Lahti et al., Nature Genet. 7 (1994) 370-375; Mock et al., Mammal. Genome 5 (1994) 191-192]. At least ten isoforms of this PK family are expressed from three duplicated and tandemly linked genes in humans [Xiang et al., J. Biol. Chem. 269 (1994) 15786-15794]. We have now isolated two different species of PITSLRE P K cDNAs from chicken that encode identical polypeptides, but are clearly expressed from different genes, based on nucleotide (nt) differences. Isolation of one of the corresponding chicken PITSLRE P K genes confirms that only one of the two species of PITSLRE mRNA is expressed from this gene. Comparison of the predicted avian PITSLRE PK aa sequence to human and mouse sequences shows a high degree of sequence identity (>91%). Like humans, the PITSLRE P K genes in chickens must be closely linked, based on fluorescent in situ hybridization (FISH) localization of these genes to a single chicken microchromosome. PITSLRE P K mRNAs are expressed in two avian B- and T-cell lines. These results suggest that the PITSLRE P K gene family has been well conserved evolutionarily, that the gene duplication observed in humans is noL a recent event, and that expression of redundant PITSLRE mRNAs is observed in different vertebrate species.
INTRODUCTION
A large family of human p34¢d¢2-related protein kinases (PKs) has been described in humans (Meyerson et al., 1992; Bunnell et al., 1990; Xiang et al., 1994). A number of these cdc2-related PKs have been shown to have diverse functions, many of which are prominently linked Correspondence to: Dr. V.J. Kidd, Department of Tumor Cell Biology, St. Jude Children's Research Hospital, 332 N. Lauderdale, Memphis, TN 38105, USA. Tel. (1-901) 5212-0597; Fax (1-901) 531-2381; e-mail: [email protected] Abbreviations: aa, amino acid(s); bp, base pair(s); CAK, cdk activating PK; cdk, cyclin-dependent PK; cdc2, cell division control gene; cDNA, DNA complementary to RNA; CHO, Chinese hamster ovary; FISH, SSDI 0378-1119(94)00801-9
to the control of cell division (Elledge and Spottswood, 1991; Fang and Newport, 1991; Desai et al., 1992; Dutta and Stillman, 1992; Elledge et al., 1992; Gabrielli et al., 1992; Koff et al., 1992; Rosenblatt et al., 1992; Fesquet et al., 1993; Van den Heuvel and Harlow, 1993). Minimal ectopic expression of one member of this cdc2-related P K gene family, p58 (PITSLRE[31), in eukaryotic cells results fluorescent in situ hybridization; kb, kilobase(s) or 1000 bp; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ORF, open reading frame; p, plasmid; PCR, polymerase chain reaction; PITSLRE, gene (DNA, RNA) encoding PITSLRE kinase; PK, protein kinase(s); PK, gene encoding PK; RACE, rapid amplification of cDNA ends; SSC, 0.15 M NaCI/0.015 M Na3.citrate pH 7.6; tsp, transcription start point(s); UTR, untranslated region(s).
238 in the failure of these cells to undergo normal cytokinesis (Bunnell et al., 1990). The rate of cell growth in these cultures is greatly diminished due to apoptosis (Lahti et al., 1995). These results suggest that PITSLRE P K function may be linked to normal regulation of the cell cycle, or cell death, possibly as a checkpoint control regulator. The human P I T S L R E gene family contains at least ten isoforms generated by alternative splicing and promoter utilization from three linked genes (Xiang et al., 1994; Lahti et al., 1994). In a study of human neuroblastoma cell lines, we found that deletion and/or translocation of one allele of the P I T S L R E gene locus occurred in all cell lines with lp36 alterations and N-myc gene amplification (Lahti et al., 1994). Abnormalities in the expression of PITSLRE polypeptides from the remaining allele were apparent in several of these cell lines as well. These data suggest that the PITSLRE PKs are candidate tumor suppressor genes involved in the acquisition of enhanced metastatic growth potential. Here two distinct species of P I T S L R E cDNA have been isolated from chicken T cells. Both forms of cDNA code for identical polypeptides that are very homologous (>90% identity) to the human protein, indicating that two distinct avian genes encode and express functionally redundant protein species. P I T S L R E mRNAs are expressed in chicken B- and T-cells, with multiple PI T S L RE transcripts observed in the B cell line. A chicken P I T S L R E PK gene was isolated from a cosmid library and the mosaic structure of the gene determined. The coding and untranslated regions of this gene are identical to one of the P I T S L R E cDNAs, but not the other, and the locations of introns within the ORF are identical to the corresponding human genes. Additionally, this cosmid was used to localize the avian P I T S L R E genes to a single microchromosome, further supporting the linkage of the chicken P I T S L R E genes expressing the two different mRNAs.
EXPERIMENTALAND DISCUSSION
(a) Chicken PITSLRE cDNAs and their predicted ORF One chicken P I T S L R E cDNA clone, cPITSLRE-1, contained the entire ORF of the ll0-kDa PITSLRE~2 isoform (Fig. 1A). Three additional clones (cPITSLRE-4, 5 and 7) contained overlapping P I T S L R E ~ 2 0 R F s , but were shorter at the 5' end and did not encode the entire PITSLRE~ isoform. The remaining three cDNA clones (cPITSLRE-2, 3 and 6) also had overlapping ORF's with the cPITSLRE-1 sequence, but all had identical nt differences scattered throughout the cDNA (four located in the ORF, and nine located in the 3' UTR; see Fig. 1).
The presence of 13 nt differences scattered throughout the cDNA clones indicate that these products are most likely produced by two different genes and not by alternative splicing. These nt differences are also reminiscent of differences found in the duplicated human P I T S L R E genes, which also express redundant mRNA products (Xiang et al., 1994). None of these differences give rise to significant changes in the amino-acid sequence of the encoded PITSLRE protein (Fig. 2 and Xiang et al., 1994). No evidence for shorter PITSLRE isoforms was obtained from the seven cDNA clones isolated. However, Northern blot analysis suggests that multiple isoforms most likely exist and that they may be tissue-specific (see section h below). Many features of the human aa sequence, including putative phosphorylation sites and nuclear localization signals, are conserved in the chicken sequence. The Thr and Tyr residues which negatively regulate p34 ~c2 PK activity are found in the ATP-binding region of all of the human, mouse, and chicken PITSLRE isoforms (Kidd et al., 1991; Xiang et al., 1994). In addition, a Thr residue equivalent to Thr 16a of p34 cdc2, Thr 16° of p33 cdk2 and Thr 172 of p35 cdk4, as well as some other members of the p34 °~¢2 supergene family, is also found in the human, mouse and chicken PITSLRE aa sequences (Kidd et al., 1991; Xiang et al., 1994). This site has been shown to be phosphorylated by the p40 m°15 cdk-activating P K (CAK), and this phosphorylation is responsible for the activation of these enzymes (Solomon et al., 1993; Poon et al., 1993; Fesquet et al., 1993; Kato et al., 1994).
(b) Structure and expression of the chicken PITSLRE gene A chicken genomic cosmid library was screened with the cPITSLRE-1 cDNA clone and 12 positives (cPIT-1 through cPIT-12) were obtained from 500000 colonies. Analysis of these cosmids revealed that they encoded two separate regions of genomic DNA that overlapped and spanned approx. 45 kb. However, both sets of cosmids contained only one complete P ITSLR E gene, while the partial sequence of a divergent 3' UTR was contained in only one cosmid (data not shown). Two contiguous EcoRI fragments, 14 and 5 kb in size, containing the entire locus of a chicken P I T S L R E gene were cloned into pKS for further analysis (Fig. 1B). Hybridization analysis indicated that the ORF corresponding to the unique aminoterminal region of the PITSLREet2 isoform, as well as a portion of the P K catalytic domain, were located in the 14-kb EcoRI fragment, while the remaining portion of the PK catalytic domain and the unique C-terminal region were located in the adjacent 5-kb EcoRI fragment (Fig. 1B). Analysis of this P I T S L R E gene revealed that the entire chicken PITSLREct2 isoform is encoded by 20
239
A.
p58
ATG
cPITSLRE-1
TAA
G
T
I
I
.C"ACGGGGGTZAAGTCAAATGTCATCCC-*AG.. / i~ A
ePITSLRE-2 B,
A
C
I
I
.C,~,ACGGG(~GT,'~A AGICAA ATGICATCCC(~AG...
I
- 200 bp
5'
X
• ,,
C
I
,,il
I
I I
H
..,TGGGTGTGGAGTATAA...
G
~
...TGGGGGGATAA...
I -1 kb
,i,
"l
,f" ~
x X
I
I
I
ol . . . . .
H
I
H
i
I
illali
. . . . . H
I
3'
X
"--'oil H H
p58
I
p110 I
I
Fig. 1. (A) Schematic diagram of the chicken PITSLRE cDNAs. The various domains of the PITSLRE PK protein are shown in the top line. The start codon for the PITSLRE-2 protein is indicated by the ATG, a putative start codon for a smaller p58 (PITSLRE-1) isoform is indicated by p58, and the common stop codon for both proteins is indicated by the TAA. The poly(Glu)-rich regions of the protein are indicated by the hatched bars; the conserved p34~a¢2-related domain by the black bar; and the unique N-terminal and C-terminal regions by open bars. Shown below this representation of the PITSLRE protein are lines that correspond to the chicken PITSLRE-I and PITSLRE-2 cDNAs. The location and nature of nt differences between the two mRNAs is shown above and below these lines. Inserted or deleted nt in the 3' UTR are denoted by an asterisk. (B) Schematic representation of the chicken PITSLRE gene. The mosaic structure of the chicken PITSLRE gene found in the adjacent 14-kb and 5-kb EcoRI fragments from the isolated cosmids is shown. ATG is the start codon of the PITSLRE~t2 PK. Similarly, the stop codon for the protein is shown by the TAA. H, HindlII; R, EcoRI; X, XbaI. Transcriptional orientation, 5' and 3'. Regions corresponding to the human p58 (PITSLRE~I) encoding exons and the p l l 0 (PITSLREct2) encoding exons are indicated by brackets below the schematic. Chicken PITSLRE cDNAs were isolated from a chicken UG9 T-cell eDNA library (Lahti et al., 1991) by low-stringency hybridization with a murine PITSLRE eDNA (Kidd et al, 1991). The nt sequence was determined as described (Bunnell et al., 1990; Kiddet al., 1991; Xiang et al., 1994). Oligos were spaced approx. 80-100 bp apart spanning the entire eDNA. The chicken PITSLRE gene(s) were isolated by screening a Cornish White Rock chicken eosmid library (Stratagene) with the fulllength chicken PITSLRE-1 eDNA as previously described (Eipers et al., 1992). EcoRI fragments containing the gene were subcloned into pKS and its DNA used for double-strand DNA sequence analysis. Using the eDNA oligo primers, all ex0ns and intron/exon boundaries were sequenced in both directions (Xiang et al., 1994). All DNA sequence data were analyzed using the IntelliGenetics program.
cPITSLRE u2 hPITSLRE a:!-2
MGDEK DSWKVKTLDE ILQEKK~ QEEEAEIKRM KNSDDRDSKR DSLEEGELRD .... L K ............................ L .....................
]~pPQQM~]~E KTHHP, KDEKR .......... - --T ....... I~LEQLERERE ........ K--
KEKRRHRSHS AEG.KHARVK A--. ......... G ......
I~EMGNHIPV. ---E--FL-V
EKEREHERP.K RHREEQDKAR RE~RQK~ K ....................................
RK, .IREQQK EQREQKERER P~ERRKERE ARREVSAHHR -ERKM ....................................
IPEERDPLSDL QDI$.~.~KT SSAESSSAES ]~. . . . L . . . . . . . . . . . . . . . . . . . . . . . . .
GSGSEEEEEE G ........
.... S S S E G S EEEEEEEGST
.ESRFDRDSA GSEVEEEEV~ EGSPQSNAM~ EGDYVPDSPA P ........ G E--EA ....... T---S-L ..........
~RAKDKKTDE IVALKP.LKME KEKEGFPITS LREINTILKA .......................................... ~IQLLRGVKH LHDNWILHP.D LKTSNLLLSH ..............................
........................................
HRMEITIRNS PyRREDSMED RGEEDDSLA~ T ............................
QHLNIVT~ p .......
SGILKVGDFG LAREYGSPLK A ...................
MAREHSKKER R--
......... ~ GNDGVCLFR-
174 165
T~_~.~EYG_.~'V K M R P W S ~ M--D-S .... ASH--2-~'?
RQ~KPEQA -PP-ERF-LG
DSRKPVKEEK -G ........
262 255
EEEGEEEEEE EEEETGSNSE S--S .................
EVSEQ~V SEEEMSEEEE A ............... D--
346 345
SSPIELKQEL PKYLPALQGC RSVEEFQCLN RIEEG~W L ........... ~ ...................... -£---
434 435
IWGSNHDKI YIVMNyVEHD LKS_.~.~Q PFLPGEVKTL ........................................
524 525
PY~V~PJTLW YRAPELLLGA A--~--L-Q ............
614 615
'---GS-H ......................
FRETPLPIDP SMFPTWpAXS EQ~RVERGT_S PRPpEC, G L G ¥ SQLGDDDLKE .........................................................
85 85
TGFHLTTTNQ GASAAGPGFS - ............
KEYSTAIDMW SVGCIFGELL - .... V .............
K
.... r-G---
705
~ L--
770 777
Fig. 2. The deduced aa sequence from the chicken PITSLRE-1 eDNA ORF is shown in comparison to the corresponding human aa sequence. Identity is denoted by a hyphen (-) and gaps are denoted by dots (.). The location of putative nuclear localization sequences are indicated by overlines. Potential phosphorylation sites are indicated as follows: casein kinase II (double underline); p34~d°2 (shadowed box); PK C (underline). In addition, the conserved negative and positive regulatory phosphorylation sites of p34 ede2 and p33edk2 are shown by boldface in shadowed boxes. For information regarding the corresponding DNA sequence, see the legend to Fig. 3.
240 5"
tgc gggc]tggggcggggagaggc cggggcgggc ggcggtgcgg ggtgggcggg gctgcgggcg
tcgggctgag gcggggccgg acggggtgct gggggggagggggtccgtgt gcggggaaggaatcggogcg c~rctgattaa agccggaagc gceggG%~rTC EXON 1
A~ CGTAACGTCT
CTTTCTTTTT
TTCTTTTTTT
M
G
CTTTTTTTTT
D
E
K
TTCCCTTTCT
D
S
W
TTCTTTCTTT
K
V
AGG AAG GAG CAA GAG GAG AAA GCA GAG ATA AAG CGC ATG AAA AAC wtg R K E Q E E K A E I K R M L N
CTTTTTTTTT
K
T
L
agtgcccgtc
TTTCCAGAGT
TCGTTTTTTT
D
L
E
I
tggggcggcg
Q
E
ctgctcagtg
TTTTTTTTAA
K
K
R
ctgctgtgcc
Fig. 3. Complete DNA sequence of the 5' region, including exon 1, of the chicken PITSLRE gene corresponding to cPITSLRE-2. Exonic sequences are indicated by capitals and intronic sequences by lower case. The location of putative tsp are indicated by the triangles above the nt sequence. The tsp for the chicken PITSLRE-2 mRNA was determined by RACE using 20 gg of total UG9 RNA as previously described (Eipers et al., 1992). The following oligos were used for this analysis: cPIT2-5, 5' CTCCATGGAGTCCTCCCT and cPIT2-4, 5' GTTTTTCATGCGCTTTAT. The complete nt sequence of the gene and its corresponding mRNA can be found in GenBank under accession Nos. U16344, U16345, U16346, U16347, U16348, U16349, U16350, U16351, U16352, U16353, U16354, U16355, U16356, U16357 and U16656.
exons spanning 18 kb (Fig. 1), and that the intron positions within the chicken gene are syntenic with those in the h u m a n gene (Fig. 1) (Eipers et al., 1992). Additionally, the intron/exon junctions were all consistent with G T / A G splice d o n o r and acceptor sequences found in most vertebrate genes (Mount, 1982; 1983). A putative tsp corresponding to the chicken P I T S L R E 2 m R N A was determined by RACE. D u e to the tremendous conservation between the two chicken P I T S L R E m R N A s , it is impossible to unequivocally state whether these R A C E products correspond to both genes or only one of the genes. F r o m a total of 14 R A C E products analyzed, three different tsp were determined (Fig. 3). All three tsp m a p within four nt of one another, and all are expressed at roughly equivalent levels. Multiple tsp are often associated with G + C-rich promoters, which is consistent with the nature of this chicken P I T S L R E gene p r o m o t e r (Fig. 3) (Heintz, 1991).
The sequence of this chicken P I T S L R E gene also corresponds to only one of the two distinct chicken P I T S L R E c D N A groups, supporting the notion that two separate chicken P I T S L R E genes encode these products (Figs. 1 and 3). This suggests that the duplication of the h u m a n P I T S L R E genes was not a recent event, and that it occurred before the divergence of avians and mammals. The almost complete identity of these duplicated genes in both the h u m a n and chicken genomes, as well as their tight physical linkage, suggest that their sequences m a y be maintained by gene conversion and that the expression of functional, but redundant, products from both genes is important for cell function. N o r t h e r n blot analysis of total R N A from two chicken cell lines, D T 4 0 B-cells and U G 9 T-cells, indicate that the P I T S L R E P K are expressed in both (Fig. 4). However, an additional, smaller P I T S L R E m R N A is present only in the D T 4 0 cells (Fig. 4). W h e t h e r this m R N A is expressed by alternative splicing or differential promoter utilization, like the h u m a n genes, is not known.
(c) FISH localization of the chicken PITSLRE genes
f~-Actin (~1.8 kb)
PITSLRE (2.5-2.7 kb)
g
o 0
g 0
Fig. 4. Northern blot analysis of PITSLRE gene expression in chicken cell lines. RNA isolated from two chicken cell lines, UG9 (T cell) and DT40 (B cell), was transfered to a membrane and hybridized with either the cPITSLRE-I cDNA (left panel) or a human fl-actin cDNA control (right panel). The location of the two distinct PITSLRE transcripts (2.5 and 2.7 kb) in the DT40 cells is shown by the arrows. Total RNA from chicken UG9 T-cells and DT40 B-cells was isolated by hot phenol extraction as described (Bunnell et al., 1990; Xiang et al., 1994). RNA (40 gg) was analyzed from both cell lines by Northern blotting after transfer to a Duralose (Stratagene) membrane. Equal loading of RNA was demonstrated by hybridization of the same blot with a human fl-actin cDNA probe. Northern blots were visualized by using a Molecular Dynamics 400A Phosphorlmager. Exposure times were 6 h for the cPITSLRE-! cDNA and 30 min for the fl-actin cDNA.
To determine the location of the chicken P I T S L R E gene(s), F I S H analysis with the chicken P I T S L R E cosmid clone was performed. This localization revealed that the P I T S L R E genes are located on a single chicken m i c r o c h r o m o s o m e (Fig. 5). Thus, m u c h like the h u m a n P I T S L R E gene locus, the chicken locus is located on a single chromosome, indicating that the chicken genes are tightly linked (Lahti et al., 1994). These data also support a model in which linkage of the duplicated P I T S L R E genes is important for sequence conservation by gene conversion. It also suggests that redundant expression of certain P I T S L R E P K isoforms has evolved to maintain expression of these products even if one of the genes is physically altered. W h e t h e r this is relevant to the possible role of certain P I T S L R E P K s as t u m o r suppressors is not k n o w n at this time, but further studies are n o w u n d e r w a y to determine h o w P I T S L R E P K activity might
241
Fig. 5. FISH analysis of the chicken PITSLRE cosmid to a metaphase spread of chicken chromosomes. The location of the PITSLRE gene signal on paired alleles of a chicken microchromosome is indicated by the white arrowheads. Metaphase cells were prepared from chick embryo fibroblasts by usual cytogenetic means. Purified cPIT-2 cosmid DNA was labeled with digoxigenin dUTP by nick translation and hybridized to metaphase chromosomes in a solution containing 50% formamide/10% dextran sulfate/2xSSC (Lahti et al., 1994). Hybridization signals were detected by incubating the hybridized slides in fluorescein conjugated antidigoxigenin antibodies (BoehringerMannheim). The slides were then counterstained with propidium iodide and mounted with Vectashield (Vector Laboratories, Burlingame, CA, USA).
regulate apoptosis, and if the loss of PITSLRE PK activity, and subsequent inactivation of apoptotic pathway(s), contributes to tumorigenesis. One means of achieving this goal is to 'knockout' the P I T S L R E genes. The chicken DT40 cell line provides a convenient and efficient system for gene ablation (Buerstedde and Takeda, 1991). The availability of a cell line that does not express P I T S L R E P K would facilitate analysis of their involvement in apoptosis, since B-cell apoptosis can be triggered by cross-linking of surface IgM. The cloning of a chicken P I T S L R E gene will now make these experiments feasible.
ACKNOWLEDGEMENTS
This research was supported by grants from the NIH (GM 44088) and American Cancer Society (CB-27E) to V.J.K., by a CORE grant from the NIH to the St. Jude Children's Research Hospital (CA 21765) and by support from the American Lebanese Syrian Associated Charities of St. Jude Children's Research Hospital.
REFERENCES Buerstedde, J.M. and Takeda, S.: Increased ratio of targeted to random integration after transfection of chicken B cell lines. Cell 67 (1991) 179-188. Bunnell, B.A., Heath, L.S., Adams, D.E., Lahti, J.M. and Kidd, V.J.:
Increased expression of a 58-kDa protein kinase leads to changes in the CHO cell cycle. Proc. Natl. Acad. Sci. USA 87 (1990) 7467-7471. Desai, D., Gu, Y. and Morgan, D.O.: Activation of human cyclindependent kinases in vitro. Mol. Biol. Cell 3 (1992) 571 582. Dutta, A. and Stillman, B.: cdc2 family kinases phosphorylate a human cell DNA replication factor, RPA, and activate DNA replication. EMBO J. 11 (1992) 2189-2199. Eipers, P.G., Lahti, J.M. and Kidd, V.J.: Structure and expression of the human p58clk-1 protein kinase chromosomal gene. Genomics 13 (1992) 613-621. Elledge, S.J., Richman, R., Hall, F.L., Williams, R.T., Lodgson, N. and Harper, J.W.: CDK2 encodes a 33-kDa cyclin A-associated protein kinase and is expressed before CDC2 in the cell cycle. Proc. Natl. Acad. Sci. USA 89 (1992) 2907-2911. Elledge, S.J. and Spottswood, M.R.: A new human p34 protein kinase, CDK2, identified by complementation of a cdc28 mutation in Saccharomyces cerevisiae, is a homolog of Xenopus Egl. EMBO J. 10 (1991) 2653-2659. Facchini, L.M., Chert, S. and Penn, L.J.Z.: Dysfunction of the Mycinduced apoptosis mechanism accompanies c-myc activation in the tumorigenic L929 cell line. Cell Growth Diff. 5 (1994) 637-646. Fang, F. and Newport, J.W.: Evidence that the G1-S and G2-M transitions are controlled by different cdc2 proteins in higher eukaryotes. Cell 66 (1991) 731 742. Fesquet, D., Labbe, J.-C., Derancourt, J., Capony, J.-P., Galas, S., Girard, F., Lorca, T., Shuttleworth, J., Doree, M. and Cavadore, J-C.: The MO15 gene encodes the catalytic subunit of a protein kinase that activates cdc2 and other cyclin-dependent kinases (CDK's) through phosphorylation of Thrl61 and its homologues. EMBO J. 12 (1993) 3111-3121. GabrieUi, B.G., Roy, L.M., Gautier, J., Philippe, M. and Mailer, J.L.: A cdc2-related kinase oscillates in the cell cycle independently of cyclins G2/M and cdc2. J. Biol. Chem. 267 (1992) 1969 1975. Heintz, N.: The regulation of histone gene expression during the cell cycle. Biochim. Biophys. Acta 1088 (1991) 327-339. Kato, J.-Y., Matsuoka, M., Strom, D.K. and Sherr, CJ.: Regulation of cyclin D-dependent kinase 4 (cdk4) by cdk4-activating kinase. Mol. Cell. Biol. 14 (1994) 2713 2721. Kidd, V.J., Luo, W., Xiang, J., Tu, F., Easton, J., McCune, S. and Snead, M.L.: Regulated expression of a cell division control-related protein kinase during development. Cell Growth Diff. 2 (1991) 85-93. Koff, A., Giordano, A., Desai, D., Yamashita, K., Harper, J.W., Elledge, S., Nishimoto, T., Morgan, D.O., Franza, B.R. and Roberts, J.M.: Formation and activation of a cyclin E-cdk2 complex during the G1 phase of the human cell cycle. Science 257 (1992) 1689-1694. Lahti, J.M., Chen, C.-1.H., Tjoelker, L.W., Pickel, J.M., Schat, K.A., Calnek, B.W., Thompson, C.B. and Cooper, M.D.: Two distinct ab T-cell lineages can be distinguished by the differential usage of T-ceU receptor Vb gene segments. Proc. Natl. Acad. Sci. USA 88 (1991) 10595-10960. Lahti, J.M., Valentine, M., Xiang, J., Jones, B., Amann, J., Grenet, J., Richmond, G., Look, A.T. and Kidd, V.J.: Alterations in the PITSLRE protein kinase gene complex on chromosome lp36 in childhood neuroblastoma. Nature Genet. 7 (1994) 370-375. Lahti, J.M., Xiang, J., Heath, L.S., Campana, D. and Kidd, V.J.: PITSLRE protein kinase activity is associated with apoptosis. Mol. Cell. Biol. 15 (1995) in press. Meyerson, M., Enders, G.H., Wu, C.-L., Su, L.-K., Gorka, C., Nelson, C., Harlow, E. and Tsai, L.-H.: A family of human cdc2-related protein kinases. EMBO J. 11 (1992) 2909 2917. Mount, S.M.: A catalogue of splice junction sequences. Nucleic Acids Res. 10 (1982) 459-472. Mount, S.M.: RNA processing. Sequences that signal where to splice. Nature 304 (1983) 309 310.
242 Poon, R.Y.C., Yamashita, K., Adamczewski, J.P., Hunt, T. and Shuttleworth, J.: The cdc2-related protein p40 re°Is is the catalytic subunit of a protein kinase that can activate p33 Cdk2 and p34 cdc2. EMBO J. 12 (1993) 3123-3132. Rosenblatt, J., Gu, Y. and Morgan, D.O.: Human cylin-dependent kinase 2 is activated during the S and G2 phases of the cell cycle and associates with cyclin A. Proc. Natl. Acad. Sci. USA 89 (1992) 2824-2828.
Solomon, M.J., Harper, J.W. and Shuttleworth, J.: CAK, the p34-cdc2 activating kinase, contains a protein identical or closely related to p40-mo15. EMBO J. 12 (1993) 3133-3142. Van den Heuvel, S. and Harlow, E.: Distinct roles for cyclin-dependent kinases in cell cycle control. Science 262 (1993) 2050-2054. Xiang, J., Lahti, J.M., Grenet, J., Easton, J. and Kidd, V.J.: Molecular cloning and expression of alternatively spliced PITSLRE protein kinase isoforms. J. Biol. Chem. 269 (1994) 15786-15794.
237
GENE 08590
Structure and expression of chicken protein kinase PITSLRE-encoding genes (Cell cycle; tumor suppressor; protein kinase; apoptosis)
H a i m i n Li a, Jose Grenet a, Marcus Valentine b, Jill M. Lahti a and Vincent J. K i d d ~ Departments ofaTumor Cell Biology, and bExperimental Oncology, St. Jude Children's Research Hospital, Memphis, TN 38105, USA Received by J.A. Engler: 13 September 1994; Accepted: 11 October 1994; Received at publishers: 7 November 1994
SUMMARY
The human PITSLRE protein kinases (PK), members of the p34 cdc2 kinase family named according to the single amino acid (aa) code of an important (PSTAIRE) regulatory region [-Meyerson et al., EMBO J. 11 (1992) 2909-2917], are candidate tumor suppressor gene(s) localized to human chromosome lp36.2 and a syntenic region of mouse chromosome 4 [Lahti et al., Nature Genet. 7 (1994) 370-375; Mock et al., Mammal. Genome 5 (1994) 191-192]. At least ten isoforms of this PK family are expressed from three duplicated and tandemly linked genes in humans [Xiang et al., J. Biol. Chem. 269 (1994) 15786-15794]. We have now isolated two different species of PITSLRE P K cDNAs from chicken that encode identical polypeptides, but are clearly expressed from different genes, based on nucleotide (nt) differences. Isolation of one of the corresponding chicken PITSLRE P K genes confirms that only one of the two species of PITSLRE mRNA is expressed from this gene. Comparison of the predicted avian PITSLRE PK aa sequence to human and mouse sequences shows a high degree of sequence identity (>91%). Like humans, the PITSLRE P K genes in chickens must be closely linked, based on fluorescent in situ hybridization (FISH) localization of these genes to a single chicken microchromosome. PITSLRE P K mRNAs are expressed in two avian B- and T-cell lines. These results suggest that the PITSLRE P K gene family has been well conserved evolutionarily, that the gene duplication observed in humans is noL a recent event, and that expression of redundant PITSLRE mRNAs is observed in different vertebrate species.
INTRODUCTION
A large family of human p34¢d¢2-related protein kinases (PKs) has been described in humans (Meyerson et al., 1992; Bunnell et al., 1990; Xiang et al., 1994). A number of these cdc2-related PKs have been shown to have diverse functions, many of which are prominently linked Correspondence to: Dr. V.J. Kidd, Department of Tumor Cell Biology, St. Jude Children's Research Hospital, 332 N. Lauderdale, Memphis, TN 38105, USA. Tel. (1-901) 5212-0597; Fax (1-901) 531-2381; e-mail: [email protected] Abbreviations: aa, amino acid(s); bp, base pair(s); CAK, cdk activating PK; cdk, cyclin-dependent PK; cdc2, cell division control gene; cDNA, DNA complementary to RNA; CHO, Chinese hamster ovary; FISH, SSDI 0378-1119(94)00801-9
to the control of cell division (Elledge and Spottswood, 1991; Fang and Newport, 1991; Desai et al., 1992; Dutta and Stillman, 1992; Elledge et al., 1992; Gabrielli et al., 1992; Koff et al., 1992; Rosenblatt et al., 1992; Fesquet et al., 1993; Van den Heuvel and Harlow, 1993). Minimal ectopic expression of one member of this cdc2-related P K gene family, p58 (PITSLRE[31), in eukaryotic cells results fluorescent in situ hybridization; kb, kilobase(s) or 1000 bp; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ORF, open reading frame; p, plasmid; PCR, polymerase chain reaction; PITSLRE, gene (DNA, RNA) encoding PITSLRE kinase; PK, protein kinase(s); PK, gene encoding PK; RACE, rapid amplification of cDNA ends; SSC, 0.15 M NaCI/0.015 M Na3.citrate pH 7.6; tsp, transcription start point(s); UTR, untranslated region(s).
238 in the failure of these cells to undergo normal cytokinesis (Bunnell et al., 1990). The rate of cell growth in these cultures is greatly diminished due to apoptosis (Lahti et al., 1995). These results suggest that PITSLRE P K function may be linked to normal regulation of the cell cycle, or cell death, possibly as a checkpoint control regulator. The human P I T S L R E gene family contains at least ten isoforms generated by alternative splicing and promoter utilization from three linked genes (Xiang et al., 1994; Lahti et al., 1994). In a study of human neuroblastoma cell lines, we found that deletion and/or translocation of one allele of the P I T S L R E gene locus occurred in all cell lines with lp36 alterations and N-myc gene amplification (Lahti et al., 1994). Abnormalities in the expression of PITSLRE polypeptides from the remaining allele were apparent in several of these cell lines as well. These data suggest that the PITSLRE PKs are candidate tumor suppressor genes involved in the acquisition of enhanced metastatic growth potential. Here two distinct species of P I T S L R E cDNA have been isolated from chicken T cells. Both forms of cDNA code for identical polypeptides that are very homologous (>90% identity) to the human protein, indicating that two distinct avian genes encode and express functionally redundant protein species. P I T S L R E mRNAs are expressed in chicken B- and T-cells, with multiple PI T S L RE transcripts observed in the B cell line. A chicken P I T S L R E PK gene was isolated from a cosmid library and the mosaic structure of the gene determined. The coding and untranslated regions of this gene are identical to one of the P I T S L R E cDNAs, but not the other, and the locations of introns within the ORF are identical to the corresponding human genes. Additionally, this cosmid was used to localize the avian P I T S L R E genes to a single microchromosome, further supporting the linkage of the chicken P I T S L R E genes expressing the two different mRNAs.
EXPERIMENTALAND DISCUSSION
(a) Chicken PITSLRE cDNAs and their predicted ORF One chicken P I T S L R E cDNA clone, cPITSLRE-1, contained the entire ORF of the ll0-kDa PITSLRE~2 isoform (Fig. 1A). Three additional clones (cPITSLRE-4, 5 and 7) contained overlapping P I T S L R E ~ 2 0 R F s , but were shorter at the 5' end and did not encode the entire PITSLRE~ isoform. The remaining three cDNA clones (cPITSLRE-2, 3 and 6) also had overlapping ORF's with the cPITSLRE-1 sequence, but all had identical nt differences scattered throughout the cDNA (four located in the ORF, and nine located in the 3' UTR; see Fig. 1).
The presence of 13 nt differences scattered throughout the cDNA clones indicate that these products are most likely produced by two different genes and not by alternative splicing. These nt differences are also reminiscent of differences found in the duplicated human P I T S L R E genes, which also express redundant mRNA products (Xiang et al., 1994). None of these differences give rise to significant changes in the amino-acid sequence of the encoded PITSLRE protein (Fig. 2 and Xiang et al., 1994). No evidence for shorter PITSLRE isoforms was obtained from the seven cDNA clones isolated. However, Northern blot analysis suggests that multiple isoforms most likely exist and that they may be tissue-specific (see section h below). Many features of the human aa sequence, including putative phosphorylation sites and nuclear localization signals, are conserved in the chicken sequence. The Thr and Tyr residues which negatively regulate p34 ~c2 PK activity are found in the ATP-binding region of all of the human, mouse, and chicken PITSLRE isoforms (Kidd et al., 1991; Xiang et al., 1994). In addition, a Thr residue equivalent to Thr 16a of p34 cdc2, Thr 16° of p33 cdk2 and Thr 172 of p35 cdk4, as well as some other members of the p34 °~¢2 supergene family, is also found in the human, mouse and chicken PITSLRE aa sequences (Kidd et al., 1991; Xiang et al., 1994). This site has been shown to be phosphorylated by the p40 m°15 cdk-activating P K (CAK), and this phosphorylation is responsible for the activation of these enzymes (Solomon et al., 1993; Poon et al., 1993; Fesquet et al., 1993; Kato et al., 1994).
(b) Structure and expression of the chicken PITSLRE gene A chicken genomic cosmid library was screened with the cPITSLRE-1 cDNA clone and 12 positives (cPIT-1 through cPIT-12) were obtained from 500000 colonies. Analysis of these cosmids revealed that they encoded two separate regions of genomic DNA that overlapped and spanned approx. 45 kb. However, both sets of cosmids contained only one complete P ITSLR E gene, while the partial sequence of a divergent 3' UTR was contained in only one cosmid (data not shown). Two contiguous EcoRI fragments, 14 and 5 kb in size, containing the entire locus of a chicken P I T S L R E gene were cloned into pKS for further analysis (Fig. 1B). Hybridization analysis indicated that the ORF corresponding to the unique aminoterminal region of the PITSLREet2 isoform, as well as a portion of the P K catalytic domain, were located in the 14-kb EcoRI fragment, while the remaining portion of the PK catalytic domain and the unique C-terminal region were located in the adjacent 5-kb EcoRI fragment (Fig. 1B). Analysis of this P I T S L R E gene revealed that the entire chicken PITSLREct2 isoform is encoded by 20
239
A.
p58
ATG
cPITSLRE-1
TAA
G
T
I
I
.C"ACGGGGGTZAAGTCAAATGTCATCCC-*AG.. / i~ A
ePITSLRE-2 B,
A
C
I
I
.C,~,ACGGG(~GT,'~A AGICAA ATGICATCCC(~AG...
I
- 200 bp
5'
X
• ,,
C
I
,,il
I
I I
H
..,TGGGTGTGGAGTATAA...
G
~
...TGGGGGGATAA...
I -1 kb
,i,
"l
,f" ~
x X
I
I
I
ol . . . . .
H
I
H
i
I
illali
. . . . . H
I
3'
X
"--'oil H H
p58
I
p110 I
I
Fig. 1. (A) Schematic diagram of the chicken PITSLRE cDNAs. The various domains of the PITSLRE PK protein are shown in the top line. The start codon for the PITSLRE-2 protein is indicated by the ATG, a putative start codon for a smaller p58 (PITSLRE-1) isoform is indicated by p58, and the common stop codon for both proteins is indicated by the TAA. The poly(Glu)-rich regions of the protein are indicated by the hatched bars; the conserved p34~a¢2-related domain by the black bar; and the unique N-terminal and C-terminal regions by open bars. Shown below this representation of the PITSLRE protein are lines that correspond to the chicken PITSLRE-I and PITSLRE-2 cDNAs. The location and nature of nt differences between the two mRNAs is shown above and below these lines. Inserted or deleted nt in the 3' UTR are denoted by an asterisk. (B) Schematic representation of the chicken PITSLRE gene. The mosaic structure of the chicken PITSLRE gene found in the adjacent 14-kb and 5-kb EcoRI fragments from the isolated cosmids is shown. ATG is the start codon of the PITSLRE~t2 PK. Similarly, the stop codon for the protein is shown by the TAA. H, HindlII; R, EcoRI; X, XbaI. Transcriptional orientation, 5' and 3'. Regions corresponding to the human p58 (PITSLRE~I) encoding exons and the p l l 0 (PITSLREct2) encoding exons are indicated by brackets below the schematic. Chicken PITSLRE cDNAs were isolated from a chicken UG9 T-cell eDNA library (Lahti et al., 1991) by low-stringency hybridization with a murine PITSLRE eDNA (Kidd et al, 1991). The nt sequence was determined as described (Bunnell et al., 1990; Kiddet al., 1991; Xiang et al., 1994). Oligos were spaced approx. 80-100 bp apart spanning the entire eDNA. The chicken PITSLRE gene(s) were isolated by screening a Cornish White Rock chicken eosmid library (Stratagene) with the fulllength chicken PITSLRE-1 eDNA as previously described (Eipers et al., 1992). EcoRI fragments containing the gene were subcloned into pKS and its DNA used for double-strand DNA sequence analysis. Using the eDNA oligo primers, all ex0ns and intron/exon boundaries were sequenced in both directions (Xiang et al., 1994). All DNA sequence data were analyzed using the IntelliGenetics program.
cPITSLRE u2 hPITSLRE a:!-2
MGDEK DSWKVKTLDE ILQEKK~ QEEEAEIKRM KNSDDRDSKR DSLEEGELRD .... L K ............................ L .....................
]~pPQQM~]~E KTHHP, KDEKR .......... - --T ....... I~LEQLERERE ........ K--
KEKRRHRSHS AEG.KHARVK A--. ......... G ......
I~EMGNHIPV. ---E--FL-V
EKEREHERP.K RHREEQDKAR RE~RQK~ K ....................................
RK, .IREQQK EQREQKERER P~ERRKERE ARREVSAHHR -ERKM ....................................
IPEERDPLSDL QDI$.~.~KT SSAESSSAES ]~. . . . L . . . . . . . . . . . . . . . . . . . . . . . . .
GSGSEEEEEE G ........
.... S S S E G S EEEEEEEGST
.ESRFDRDSA GSEVEEEEV~ EGSPQSNAM~ EGDYVPDSPA P ........ G E--EA ....... T---S-L ..........
~RAKDKKTDE IVALKP.LKME KEKEGFPITS LREINTILKA .......................................... ~IQLLRGVKH LHDNWILHP.D LKTSNLLLSH ..............................
........................................
HRMEITIRNS PyRREDSMED RGEEDDSLA~ T ............................
QHLNIVT~ p .......
SGILKVGDFG LAREYGSPLK A ...................
MAREHSKKER R--
......... ~ GNDGVCLFR-
174 165
T~_~.~EYG_.~'V K M R P W S ~ M--D-S .... ASH--2-~'?
RQ~KPEQA -PP-ERF-LG
DSRKPVKEEK -G ........
262 255
EEEGEEEEEE EEEETGSNSE S--S .................
EVSEQ~V SEEEMSEEEE A ............... D--
346 345
SSPIELKQEL PKYLPALQGC RSVEEFQCLN RIEEG~W L ........... ~ ...................... -£---
434 435
IWGSNHDKI YIVMNyVEHD LKS_.~.~Q PFLPGEVKTL ........................................
524 525
PY~V~PJTLW YRAPELLLGA A--~--L-Q ............
614 615
'---GS-H ......................
FRETPLPIDP SMFPTWpAXS EQ~RVERGT_S PRPpEC, G L G ¥ SQLGDDDLKE .........................................................
85 85
TGFHLTTTNQ GASAAGPGFS - ............
KEYSTAIDMW SVGCIFGELL - .... V .............
K
.... r-G---
705
~ L--
770 777
Fig. 2. The deduced aa sequence from the chicken PITSLRE-1 eDNA ORF is shown in comparison to the corresponding human aa sequence. Identity is denoted by a hyphen (-) and gaps are denoted by dots (.). The location of putative nuclear localization sequences are indicated by overlines. Potential phosphorylation sites are indicated as follows: casein kinase II (double underline); p34~d°2 (shadowed box); PK C (underline). In addition, the conserved negative and positive regulatory phosphorylation sites of p34 ede2 and p33edk2 are shown by boldface in shadowed boxes. For information regarding the corresponding DNA sequence, see the legend to Fig. 3.
240 5"
tgc gggc]tggggcggggagaggc cggggcgggc ggcggtgcgg ggtgggcggg gctgcgggcg
tcgggctgag gcggggccgg acggggtgct gggggggagggggtccgtgt gcggggaaggaatcggogcg c~rctgattaa agccggaagc gceggG%~rTC EXON 1
A~ CGTAACGTCT
CTTTCTTTTT
TTCTTTTTTT
M
G
CTTTTTTTTT
D
E
K
TTCCCTTTCT
D
S
W
TTCTTTCTTT
K
V
AGG AAG GAG CAA GAG GAG AAA GCA GAG ATA AAG CGC ATG AAA AAC wtg R K E Q E E K A E I K R M L N
CTTTTTTTTT
K
T
L
agtgcccgtc
TTTCCAGAGT
TCGTTTTTTT
D
L
E
I
tggggcggcg
Q
E
ctgctcagtg
TTTTTTTTAA
K
K
R
ctgctgtgcc
Fig. 3. Complete DNA sequence of the 5' region, including exon 1, of the chicken PITSLRE gene corresponding to cPITSLRE-2. Exonic sequences are indicated by capitals and intronic sequences by lower case. The location of putative tsp are indicated by the triangles above the nt sequence. The tsp for the chicken PITSLRE-2 mRNA was determined by RACE using 20 gg of total UG9 RNA as previously described (Eipers et al., 1992). The following oligos were used for this analysis: cPIT2-5, 5' CTCCATGGAGTCCTCCCT and cPIT2-4, 5' GTTTTTCATGCGCTTTAT. The complete nt sequence of the gene and its corresponding mRNA can be found in GenBank under accession Nos. U16344, U16345, U16346, U16347, U16348, U16349, U16350, U16351, U16352, U16353, U16354, U16355, U16356, U16357 and U16656.
exons spanning 18 kb (Fig. 1), and that the intron positions within the chicken gene are syntenic with those in the h u m a n gene (Fig. 1) (Eipers et al., 1992). Additionally, the intron/exon junctions were all consistent with G T / A G splice d o n o r and acceptor sequences found in most vertebrate genes (Mount, 1982; 1983). A putative tsp corresponding to the chicken P I T S L R E 2 m R N A was determined by RACE. D u e to the tremendous conservation between the two chicken P I T S L R E m R N A s , it is impossible to unequivocally state whether these R A C E products correspond to both genes or only one of the genes. F r o m a total of 14 R A C E products analyzed, three different tsp were determined (Fig. 3). All three tsp m a p within four nt of one another, and all are expressed at roughly equivalent levels. Multiple tsp are often associated with G + C-rich promoters, which is consistent with the nature of this chicken P I T S L R E gene p r o m o t e r (Fig. 3) (Heintz, 1991).
The sequence of this chicken P I T S L R E gene also corresponds to only one of the two distinct chicken P I T S L R E c D N A groups, supporting the notion that two separate chicken P I T S L R E genes encode these products (Figs. 1 and 3). This suggests that the duplication of the h u m a n P I T S L R E genes was not a recent event, and that it occurred before the divergence of avians and mammals. The almost complete identity of these duplicated genes in both the h u m a n and chicken genomes, as well as their tight physical linkage, suggest that their sequences m a y be maintained by gene conversion and that the expression of functional, but redundant, products from both genes is important for cell function. N o r t h e r n blot analysis of total R N A from two chicken cell lines, D T 4 0 B-cells and U G 9 T-cells, indicate that the P I T S L R E P K are expressed in both (Fig. 4). However, an additional, smaller P I T S L R E m R N A is present only in the D T 4 0 cells (Fig. 4). W h e t h e r this m R N A is expressed by alternative splicing or differential promoter utilization, like the h u m a n genes, is not known.
(c) FISH localization of the chicken PITSLRE genes
f~-Actin (~1.8 kb)
PITSLRE (2.5-2.7 kb)
g
o 0
g 0
Fig. 4. Northern blot analysis of PITSLRE gene expression in chicken cell lines. RNA isolated from two chicken cell lines, UG9 (T cell) and DT40 (B cell), was transfered to a membrane and hybridized with either the cPITSLRE-I cDNA (left panel) or a human fl-actin cDNA control (right panel). The location of the two distinct PITSLRE transcripts (2.5 and 2.7 kb) in the DT40 cells is shown by the arrows. Total RNA from chicken UG9 T-cells and DT40 B-cells was isolated by hot phenol extraction as described (Bunnell et al., 1990; Xiang et al., 1994). RNA (40 gg) was analyzed from both cell lines by Northern blotting after transfer to a Duralose (Stratagene) membrane. Equal loading of RNA was demonstrated by hybridization of the same blot with a human fl-actin cDNA probe. Northern blots were visualized by using a Molecular Dynamics 400A Phosphorlmager. Exposure times were 6 h for the cPITSLRE-! cDNA and 30 min for the fl-actin cDNA.
To determine the location of the chicken P I T S L R E gene(s), F I S H analysis with the chicken P I T S L R E cosmid clone was performed. This localization revealed that the P I T S L R E genes are located on a single chicken m i c r o c h r o m o s o m e (Fig. 5). Thus, m u c h like the h u m a n P I T S L R E gene locus, the chicken locus is located on a single chromosome, indicating that the chicken genes are tightly linked (Lahti et al., 1994). These data also support a model in which linkage of the duplicated P I T S L R E genes is important for sequence conservation by gene conversion. It also suggests that redundant expression of certain P I T S L R E P K isoforms has evolved to maintain expression of these products even if one of the genes is physically altered. W h e t h e r this is relevant to the possible role of certain P I T S L R E P K s as t u m o r suppressors is not k n o w n at this time, but further studies are n o w u n d e r w a y to determine h o w P I T S L R E P K activity might
241
Fig. 5. FISH analysis of the chicken PITSLRE cosmid to a metaphase spread of chicken chromosomes. The location of the PITSLRE gene signal on paired alleles of a chicken microchromosome is indicated by the white arrowheads. Metaphase cells were prepared from chick embryo fibroblasts by usual cytogenetic means. Purified cPIT-2 cosmid DNA was labeled with digoxigenin dUTP by nick translation and hybridized to metaphase chromosomes in a solution containing 50% formamide/10% dextran sulfate/2xSSC (Lahti et al., 1994). Hybridization signals were detected by incubating the hybridized slides in fluorescein conjugated antidigoxigenin antibodies (BoehringerMannheim). The slides were then counterstained with propidium iodide and mounted with Vectashield (Vector Laboratories, Burlingame, CA, USA).
regulate apoptosis, and if the loss of PITSLRE PK activity, and subsequent inactivation of apoptotic pathway(s), contributes to tumorigenesis. One means of achieving this goal is to 'knockout' the P I T S L R E genes. The chicken DT40 cell line provides a convenient and efficient system for gene ablation (Buerstedde and Takeda, 1991). The availability of a cell line that does not express P I T S L R E P K would facilitate analysis of their involvement in apoptosis, since B-cell apoptosis can be triggered by cross-linking of surface IgM. The cloning of a chicken P I T S L R E gene will now make these experiments feasible.
ACKNOWLEDGEMENTS
This research was supported by grants from the NIH (GM 44088) and American Cancer Society (CB-27E) to V.J.K., by a CORE grant from the NIH to the St. Jude Children's Research Hospital (CA 21765) and by support from the American Lebanese Syrian Associated Charities of St. Jude Children's Research Hospital.
REFERENCES Buerstedde, J.M. and Takeda, S.: Increased ratio of targeted to random integration after transfection of chicken B cell lines. Cell 67 (1991) 179-188. Bunnell, B.A., Heath, L.S., Adams, D.E., Lahti, J.M. and Kidd, V.J.:
Increased expression of a 58-kDa protein kinase leads to changes in the CHO cell cycle. Proc. Natl. Acad. Sci. USA 87 (1990) 7467-7471. Desai, D., Gu, Y. and Morgan, D.O.: Activation of human cyclindependent kinases in vitro. Mol. Biol. Cell 3 (1992) 571 582. Dutta, A. and Stillman, B.: cdc2 family kinases phosphorylate a human cell DNA replication factor, RPA, and activate DNA replication. EMBO J. 11 (1992) 2189-2199. Eipers, P.G., Lahti, J.M. and Kidd, V.J.: Structure and expression of the human p58clk-1 protein kinase chromosomal gene. Genomics 13 (1992) 613-621. Elledge, S.J., Richman, R., Hall, F.L., Williams, R.T., Lodgson, N. and Harper, J.W.: CDK2 encodes a 33-kDa cyclin A-associated protein kinase and is expressed before CDC2 in the cell cycle. Proc. Natl. Acad. Sci. USA 89 (1992) 2907-2911. Elledge, S.J. and Spottswood, M.R.: A new human p34 protein kinase, CDK2, identified by complementation of a cdc28 mutation in Saccharomyces cerevisiae, is a homolog of Xenopus Egl. EMBO J. 10 (1991) 2653-2659. Facchini, L.M., Chert, S. and Penn, L.J.Z.: Dysfunction of the Mycinduced apoptosis mechanism accompanies c-myc activation in the tumorigenic L929 cell line. Cell Growth Diff. 5 (1994) 637-646. Fang, F. and Newport, J.W.: Evidence that the G1-S and G2-M transitions are controlled by different cdc2 proteins in higher eukaryotes. Cell 66 (1991) 731 742. Fesquet, D., Labbe, J.-C., Derancourt, J., Capony, J.-P., Galas, S., Girard, F., Lorca, T., Shuttleworth, J., Doree, M. and Cavadore, J-C.: The MO15 gene encodes the catalytic subunit of a protein kinase that activates cdc2 and other cyclin-dependent kinases (CDK's) through phosphorylation of Thrl61 and its homologues. EMBO J. 12 (1993) 3111-3121. GabrieUi, B.G., Roy, L.M., Gautier, J., Philippe, M. and Mailer, J.L.: A cdc2-related kinase oscillates in the cell cycle independently of cyclins G2/M and cdc2. J. Biol. Chem. 267 (1992) 1969 1975. Heintz, N.: The regulation of histone gene expression during the cell cycle. Biochim. Biophys. Acta 1088 (1991) 327-339. Kato, J.-Y., Matsuoka, M., Strom, D.K. and Sherr, CJ.: Regulation of cyclin D-dependent kinase 4 (cdk4) by cdk4-activating kinase. Mol. Cell. Biol. 14 (1994) 2713 2721. Kidd, V.J., Luo, W., Xiang, J., Tu, F., Easton, J., McCune, S. and Snead, M.L.: Regulated expression of a cell division control-related protein kinase during development. Cell Growth Diff. 2 (1991) 85-93. Koff, A., Giordano, A., Desai, D., Yamashita, K., Harper, J.W., Elledge, S., Nishimoto, T., Morgan, D.O., Franza, B.R. and Roberts, J.M.: Formation and activation of a cyclin E-cdk2 complex during the G1 phase of the human cell cycle. Science 257 (1992) 1689-1694. Lahti, J.M., Chen, C.-1.H., Tjoelker, L.W., Pickel, J.M., Schat, K.A., Calnek, B.W., Thompson, C.B. and Cooper, M.D.: Two distinct ab T-cell lineages can be distinguished by the differential usage of T-ceU receptor Vb gene segments. Proc. Natl. Acad. Sci. USA 88 (1991) 10595-10960. Lahti, J.M., Valentine, M., Xiang, J., Jones, B., Amann, J., Grenet, J., Richmond, G., Look, A.T. and Kidd, V.J.: Alterations in the PITSLRE protein kinase gene complex on chromosome lp36 in childhood neuroblastoma. Nature Genet. 7 (1994) 370-375. Lahti, J.M., Xiang, J., Heath, L.S., Campana, D. and Kidd, V.J.: PITSLRE protein kinase activity is associated with apoptosis. Mol. Cell. Biol. 15 (1995) in press. Meyerson, M., Enders, G.H., Wu, C.-L., Su, L.-K., Gorka, C., Nelson, C., Harlow, E. and Tsai, L.-H.: A family of human cdc2-related protein kinases. EMBO J. 11 (1992) 2909 2917. Mount, S.M.: A catalogue of splice junction sequences. Nucleic Acids Res. 10 (1982) 459-472. Mount, S.M.: RNA processing. Sequences that signal where to splice. Nature 304 (1983) 309 310.
242 Poon, R.Y.C., Yamashita, K., Adamczewski, J.P., Hunt, T. and Shuttleworth, J.: The cdc2-related protein p40 re°Is is the catalytic subunit of a protein kinase that can activate p33 Cdk2 and p34 cdc2. EMBO J. 12 (1993) 3123-3132. Rosenblatt, J., Gu, Y. and Morgan, D.O.: Human cylin-dependent kinase 2 is activated during the S and G2 phases of the cell cycle and associates with cyclin A. Proc. Natl. Acad. Sci. USA 89 (1992) 2824-2828.
Solomon, M.J., Harper, J.W. and Shuttleworth, J.: CAK, the p34-cdc2 activating kinase, contains a protein identical or closely related to p40-mo15. EMBO J. 12 (1993) 3133-3142. Van den Heuvel, S. and Harlow, E.: Distinct roles for cyclin-dependent kinases in cell cycle control. Science 262 (1993) 2050-2054. Xiang, J., Lahti, J.M., Grenet, J., Easton, J. and Kidd, V.J.: Molecular cloning and expression of alternatively spliced PITSLRE protein kinase isoforms. J. Biol. Chem. 269 (1994) 15786-15794.