Structure and function of Hsp78, the mitochondrial ClpB homolog

Journal of Structural Biology 156 (2006) 149–164 www.elsevier.com/locate/yjsbi

Structure and function of Hsp78, the mitochondrial ClpB homolog Claudia Leidhold a,b,1, Birgit von Janowsky a,1,2, Dorothea Becker a,b, Tom Bender a, Wolfgang Voos a,¤ a

Institut für Biochemie und Molekularbiologie, Universität Freiburg, D-79104 Freiburg, Germany b Fakultät für Biologie, Universität Freiburg, Germany Received 8 December 2005; received in revised form 15 March 2006; accepted 6 April 2006 Available online 4 May 2006

Abstract The cellular role of Hsp100/Clp chaperones in maintaining protein stability is based on two functional aspects. Under normal growth conditions they represent components of cellular protein quality control machineries that selectively remove damaged or misfolded polypeptides in cooperation with speciWc proteases. After thermal stress, proteins of the ClpB subfamily have the unique ability to directly resolubilize aggregated polypeptides in concert with Hsp70-type chaperones, leading to the recovery of enzymatic activity. Hsp78, the homolog of the bacterial chaperone ClpB in mitochondria of eukaryotic organisms, participates in both protective activities. Hsp78 is involved in conferring thermotolerance to the mitochondrial compartment but also participates in protein degradation by the matrix protease Pim1. Despite the high sequence conservation between Hsp78 and ClpB, an analysis of the structural properties revealed signiWcant diVerences. The identiWed mitochondrial Hsp78s do not contain N-terminal substrate-binding domains. In addition, formation of the oligomeric chaperone complex was more variable as anticipated from the studies with bacterial ClpB. Hsp78 predominantly formed a trimeric complex under in vivo conditions. Hence, mitochondrial Hsp78s form a distinct subgroup of the ClpB chaperone family, exhibiting speciWc structural and functional properties. © 2006 Elsevier Inc. All rights reserved. Keywords: Chaperone; AAA protein family; ClpB; Yeast; Mitochondria; Hsp78

1. Introduction The mitochondrial heat shock protein of 78 kDa (Hsp78) belongs to a group of molecular chaperones that are primarily responsible for the maintenance of cellular protein function. In general, molecular chaperones are indispensable components of many reactions of cellular protein biogenesis. They interact with nascent polypeptide chains emerging from the ribosome and catalyze the folding of newly synthesized proteins to their active conformation (Hartl and Hayer-Hartl, 2002). In addition, intra*

Corresponding author. Fax: +49 761 203 5261. E-mail address: [email protected] (W. Voos). 1 Both authors contributed equally to this work. 2 Present address: Trilogy Writing and Consulting GmbH, Frankfurt/ Main, Germany. 1047-8477/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.jsb.2006.04.007

cellular protein transport processes require the activity of chaperones to drive membrane translocation of polypeptide chains and to coordinate the connected folding activities (Voos and Röttgers, 2002). Last but not least, molecular chaperones, or heat shock proteins as they have been initially described, are required for the maintenance of protein stability and function under various environmental stress situations, most prominently at elevated temperatures (Parsell and Lindquist, 1993). Due to this plethora of cellular functions, multiple types of molecular chaperones have evolved that can be grouped in distinct protein families. Chaperones that deal with the eVects of stress conditions mainly belong to the Hsp100 and Hsp70 protein families. While Hsp70 chaperones are involved in many diVerent cellular activities, Hsp100 family members have a more stress-speciWc function. Hsp100s generally contribute to the protection of proteins against aggregation and/or to

150

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

the speciWc removal of damaged or misfolded polypeptides. Chaperones of this class are therefore major components of cellular protein quality control systems (Sauer et al., 2004). Based on their involvement in proteolytic reactions in bacteria, Hsp100 proteins have also been classiWed as members of the Clp (caseinolytic protease) protein family (Schirmer et al., 1996; Wawrzynow et al., 1996). Chaperones of the types ClpA and ClpX associate tightly with the protease component ClpP to form an ATP-dependent oligomeric protease complex. In contrast, chaperones of the ClpB-type are mainly implicated in the protection of cells against the toxic eVects of protein aggregation and do not permanently associate with a protease. All members of the Hsp100/Clp chaperone family are ATP-hydrolyzing enzymes. Their structural hallmark is the presence of one or two highly conserved protein domains that share homology with the diverse AAA (ATPases associated with various cellular activities) protein family (Lupas and Martin, 2002). Typically, AAA proteins form large ring-shaped protein complexes and are involved in the catalysis of macromolecular rearrangements driven by the hydrolysis of ATP. The AAA domains are crucial elements controlling the enzymatic activity and the structural composition of the complexes. 1.1. Functional and structural properties of the ClpB chaperone subfamily ClpB-type chaperones have a remarkable biochemical activity, as they are capable to resolubilize protein aggregates (Glover and Lindquist, 1998; GoloubinoV et al., 1999; Mogk et al., 1999). Together with Hsp70-type proteins, ClpB forms a multi-chaperone machinery that can reactivate aggregated proteins to their native functional state and thereby repair the cellular damage caused by environmental stress like elevated temperatures. Although the details of this disaggregation mechanism are still enigmatic, a close cooperation of Hsp70 and ClpB chaperones is essential for the reactivation process. Recent experiments indicate that the aggregated polypeptides may be unraveled by a threading mechanism through the central pore of the hexameric ClpB complex (Weibezahn et al., 2004). An analysis of the primary structure of the chaperone ClpB revealed that the protein is composed of several functionally and structurally distinct modules: an N-terminal domain and two AAA domains, separated by an intermediate region, also termed middle or M-domain. The three-dimensional structure of the ClpB monomer from Thermus thermophilus has been solved recently (Lee et al., 2003). While the N-terminal domain forms a distinct entity that is only loosely connected with the rest of the protein, two highly conserved AAA modules form the structural core of the molecule. The AAA domains provide two separated nucleotide-binding pockets. Structurally a component of the Wrst AAA-module, the M-domain has the shape of an elongated alpha-helical coiled-coil domain. This linker is usually absent in other types of Hsp100/Clp chaperones

like ClpA (Fig. 2). Similar to the M-domain, the N-terminal domain shows only relatively low sequence conservation among other ClpB homologs or AAA proteins. Interestingly, ClpB from Escherichia coli has been shown to have two translational start sites that are used alternatively in vivo. Translation from the second ATG yields a shortened protein that lacks the N-terminal domain (ClpBN). The functional role of the N-terminal domain has been discussed controversially since it is not essential for the functions of ClpB (Beinker et al., 2002). ClpBN retains the ability to protect cells during heat shock and has chaperone activity at least on certain substrate proteins. However, recent experiments demonstrated that the N-terminal domain mediates the interaction with aggregated polypeptides and is required for the full disaggregation eYciency (Barnett et al., 2005; Chow et al., 2005). Similar to other members of the Hsp100/Clp family, ClpB forms a homo-oligomeric barrel-shaped protein complex (Zolkiewski et al., 1999; Mogk et al., 2003; Lee et al., 2004). However, the protein complex exhibits a high structural variability. While the most prominent form is composed of six subunits, also heptameric structures have been reported (Akoev et al., 2004). The formation of the oligomeric complex has been shown to be strongly dependent on the bound nucleotide (Barnett et al., 2000). The presence of ATP or non-hydrolyzable nucleotide analogs strongly favors the formation of the hexameric complex. Additionally, under in vitro conditions the high-molecular weight complex seems to be in equilibrium with smaller subcomplexes dependent on the monomer concentration (Akoev et al., 2004). The possibility of a switch between diVerent oligomeric states of ClpB and the biological relevance of the diVerent complex compositions remain unresolved. In combination with high-resolution electron microscope images, the structure of the ClpB monomer could be modeled into a hexameric protein complex similar to other related proteins of the AAA family (Lee et al., 2003). The two AAA modules form a double-ring structure that represents the core structure of the protein complex. The most distinct feature of the hexameric ClpB complex are six long -helical extensions, pointing outward of the double-ring that are formed by the large M-domains, found only in ClpB-type chaperones. It has been speculated that these extensions are involved in the disaggregation mechanism, acting as crowbars that pry the insoluble aggregates apart (GoloubinoV et al., 1999; Ben-Zvi and GoloubinoV, 2001; Lee et al., 2004). However, recent experiments demonstrated that the disaggregation activity of ClpB is correlated with a translocation process through the ClpB oligomer (Weibezahn et al., 2004). Access to the interior of the barrel-like hexamer structure is possible through a central pore. Amino acids located in the immediate vicinity of the pore have been implicated in substrate interaction and disaggregation activity, supporting the threading mechanism for recovery of aggregated polypeptides (Schlieker et al., 2004).

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

1.2. The mitochondrial ClpB homolog Hsp78 While bacteria usually harbor only one gene for a ClpB-type chaperone, eukaryotic cells may possess both a cytosolic and a mitochondrial form. In the yeast Saccharomyces cerevisiae the cytosolic ClpB homolog has been named Hsp104 and the mitochondrial homolog Hsp78. Hsp78 was initially identiWed by an antibody screen, which demonstrated the existence of a novel heat shock protein with a size of 78 kDa in mitochondria (Leonhardt et al., 1993). Subsequent cloning and sequencing revealed a high amino acid sequence homology with members of the bacterial ClpB subfamily. Hsp78 turned out to be a soluble protein localized in the mitochondrial matrix, the compartment corresponding to the bacterial cytosol. A functional analysis of this mitochondria-speciWc chaperone was hampered by the initial lack of a discernible phenotype of yeast cells lacking Hsp78. Unlike bacteria, yeast cells with a deletion of the HSP78 gene (hsp78) did not exhibit growth defects at normal or elevated temperatures (Leonhardt et al., 1993). A Wrst hint of the speciWc function of the mitochondrial ClpB homolog came from the observation of a synthetic growth defect of a yeast strain that contained a conditional lethal mutation in the major mitochondrial Hsp70 (mtHsp70), ssc1-3, combined with a deletion of Hsp78 (Schmitt et al., 1995). Mitochondria isolated from the ssc1-3 mutant strain behaved normal at low temperatures but became unable to import precursor protein after a heat shock at non-permissive conditions. The ssc1-3/hsp78 cells showed a strong growth retardation already at permissive conditions that was caused by a strong defect in the mitochondrial preprotein import eYciency. On the other hand, the preprotein translocation defect of the ssc1-3 mutant at non-permissive temperatures could be partially repaired by an overexpression of Hsp78. Based on the observation of a direct interaction of Hsp78 with imported preproteins, it was suggested that Hsp78 could directly take over the translocation function of mtHsp70 (Schmitt et al., 1995). However, another report showed that the synthetic import defect of the ssc1-3/hsp78 mitochondria was most likely caused by a depletion of the mitochondrial membrane potential and that overexpression of Hsp78 contributed to an increased solubility of mutated mtHsp70 proteins, resulting in the restoration of mitochondrial function after heat stress (Moczko et al., 1995). This involvement of Hsp78 in the general maintenance of mitochondrial functions has been corroborated by studies assessing the tolerance of hsp78 cells against thermal stress (Schmitt et al., 1996). Interestingly, although no signiWcant eVect on cell survival was observed as such, the amount of respiratory deWcient cells was strongly increased in hsp78 cells, indicating a mitochondria-speciWc role in thermoprotection. Indeed, it was shown that Hsp78 is required for the reactivation of mitochondrial protein synthesis after heat stress, maintaining the functional state of the respiratory chain. Apart from mitochondrial protein synthesis also rep-

151

lication of the mitochondrial DNA has been shown to be stabilized by the presence of Hsp78. The mitochondrial DNA polymerase Mip1 was strongly heat sensitive and Hsp78 was shown to be required for its reactivation after heat stress in cooperation with the mtHsp70 system (Germaniuk et al., 2002). The importance of Hsp78 for the protection of mitochondrial protein function under thermal stress is highly reminiscent of the disaggregation function of the bacterial ClpB. PuriWed Hsp78 was shown to be able to resolubilize the aggregated model protein luciferase under in vitro conditions (Krzewska et al., 2001b). Similar to ClpB, the disaggregation reaction was strongly dependent on the presence of the respective Hsp70 chaperones. Interestingly, this chaperone cooperation in disaggregation turned out to be highly speciWc, since it was not possible to substitute the mtHsp70 with its bacterial or cytosolic homologs (Krzewska et al., 2001b). Based on the accumulated in vitro data it is very likely that the ability of Hsp78 to perform disaggregation reactions contributes mainly to its stress protective eVect on mitochondrial function. Recently, we could show that protein disaggregation occurs in intact organelles under in vivo conditions based on a close functional collaboration between Hsp78 and the mtHsp70 system (von Janowsky et al., 2006). Interestingly, under heat stress conditions, mtHsp70 itself seemed to be one of the major substrates of the disaggregation activity of Hsp78. Thereby the function of mtHsp70 as a crucial chaperone of mitochondrial biogenesis was maintained. The intricate combination of both chaperone activities therefore is a major aspect of the stabilization of mitochondrial functions under stress conditions. However, future experiments need to address the range of native mitochondrial substrate proteins aVected by Hsp78 in greater detail. Based on the functional similarities, the evidence available so far suggests a structural composition of the enzymatically active Hsp78 that is comparable to the bacterial ClpB protein. Experiments using puriWed Hsp78 showed its ability to form an ATP-dependent hexameric protein complex, provided that the concentration of the monomer is high enough (Krzewska et al., 2001a). The formation of the oligomer seemed to be required for full chaperone activity. Again similar to the bacterial homolog, the two AAA domains have been shown in site-directed mutagenesis experiments to exhibit diVerent functional properties. The Wrst nucleotide-binding domain seems to be mainly responsible for ATPase activity while the second AAA domain is required for the oligomerization (Krzewska et al., 2001a). The data obtained so far point to a prominent involvement of Hsp78 in the repair of damaged and aggregated polypeptides. However, recent experiments revealed a functional role that had not been anticipated from the studies with the bacterial ClpB. It turned out that the degradation of soluble reporter proteins imported into intact mitochondria under in vivo conditions was strongly

152

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

dependent on the presence of Hsp78 (Röttgers et al., 2002). The major protease of the mitochondrial matrix in yeast is the protein Pim1, a homolog of the bacterial Lon protease (Suzuki et al., 1994). It degrades soluble, damaged or foreign proteins in an ATP-dependent reaction. Pim1 also belongs to the class of AAA proteins but in contrast to the bacterial Clp system both ATPase and protease activities are encoded on the same polypeptide chain. In hsp78 mitochondria, degradation of imported soluble substrate proteins was not entirely abolished but the eYciency of proteolysis was signiWcantly reduced. The requirement for Hsp78 was independent of the conformational stability of the model substrate and also of their tendency to form protein aggregates. Hence, the role of Hsp78 in protein degradation seemed to be a novel function in addition to its potential role in disaggregation. This novel role of Hsp78 was corroborated by the observation that a mutated form of the mitochondrial enzyme Ilv5, involved in amino acid biosynthesis and mitochondrial DNA maintenance, was degraded by Pim1 in an Hsp78-dependent reaction (Bateman et al., 2002). One possible reason for the requirement for an additional chaperone component in the proteolysis process may lie in the speciWc properties of the mitochondrial protease. Experiments with imported reporter proteins showed that Pim1 was unable to actively unfold protein domains for proteolysis despite its intrinsic ATPase activity (von Janowsky et al., 2005). The lack of a signiWcant unfolding capability restricted the proteolytic activity to damaged or destabilized substrate proteins (Major et al., 2006). In this context, it is conceivable that, although not absolutely required, the activity of Hsp78 can support the degradation of substrate proteins that are only partially denatured. However, the molecular mechanism underlying this unique cooperation of a Lon-type protease with a ClpBtype chaperone remains to be established. Taken together, the mitochondrial chaperone Hsp78 has been shown to participate in two important cellular functions, protection of enzymatic activity under thermal stress conditions and removal of damaged polypeptides. We have now analyzed structural properties of Hsp78 and compared them to those of the bacterial ClpB protein family. We determined the native N-terminus of Hsp78 and characterized the oligomeric state of the Hsp78 protein complex in intact mitochondria. We performed an extensive database sequence comparison to identify other mitochondrial Hsp78s. We found that mitochondrial Hsp78 represents a ClpB subclass that does not contain an N-terminal substrate-binding domain. A characterization of the oligomeric state of mitochondrial Hsp78 under in vivo conditions revealed a trimeric protein complex as the predominant form. Mitochondrial Hsp78 therefore exhibits diVerent functional and structural properties compared to the bacterial ClpB family. The reasons for this divergence will be an important topic in the future experimental analysis of eukaryotic Hsp100/Clp chaperones.

2. Material and methods 2.1. Synthesis of Hsp78 precursor and protein import Amino-terminally shortened Hsp78 constructs were made by PCR with wild-type genomic DNA as template using forward primers containing the recognition sequence for the SP6 polymerase, the Kozak sequence and 17–23 bases homolog to the Hsp78 sequence starting from amino acid 28 (CGGGGTACCCCGATTTAGGTGACACTAT AG AA TACAGCCACCATGGACGTCCAAA TGAGG ATGGATCCC), amino acid 82 (CGGGGTACCCCGAT TTA GGTG ACACTATAGAATACAGCCACCATGGA CGTCCAAATGAGGATGGATCCC), amino acid 88 (CGG GGTACCCCGATTTAGGTGACACTATAGAA TACAGCCACCATGGATCCCAATCAGCAACCG) or amino acid 112 (CGGGGTACCCCGATTTAGGTGAC ACTATAGAATACAGCCACCATGGGTAAATTAGA CCCTGTC) of the Hsp78 open-reading frame. The constructs were then synthesized by in vitro transcription and translation using rabbit reticulocyte lysate (GE Healthcare) as previously described (Ryan et al., 2001). Import of the radiolabeled Hsp78 precursor into isolated yeast mitochondria was performed as described (Ryan et al., 2001). 2.2. Protein sequence alignment and structure modeling Protein sequence alignments were carried out using the ClustalW algorithm of the program MegAlign (DNA-Star). Models of the three-dimensional structure of Hsp78 from S. cerevisiae and ClpB from E. coli were generated by homology modeling via the SWISS-MODEL web server. The published structures of the AAA-1 module of E. coli ClpB (PDB entry 1JBK) (Li and Sha, 2002) and the fulllength structure of ClpB from T. thermophilus (PDB entry 1QVR) (Lee et al., 2003) were used as templates. The model of the hypothetical hexameric complex of Hsp78 was obtained by Wtting the monomer of Hsp78 on the hexamer structure of mouse p97 (PDB entry 1QVR) (Huyton et al., 2003) with the help of the Deep View Swiss PDB viewer software. 2.3. Blue-native gel electrophoresis (BN–PAGE) Isolated mitochondria (50–60 g) were solubilized in 50 l lysis buVer (50 mM NaCl, 20 mM Tris/HCl, pH 7.4, 200 M EDTA, 10% glycerol and 1 mM PMSF) containing 1% digitonin. Non-solubilized material was removed by centrifugation for 15 min at 21 000g at 4 °C. After addition of 5 l loading buVer (5% [w/v] Coomassie brilliant blue G250, 0.5 M ⑀-amino-n-caproic acid, 0.1 M Bis-Tris, pH 7.0) to the supernatants, samples were analyzed on a 6–16.5% gradient gel according to published procedures (Schägger and von Jagow, 1991). The gradient gel in 66 mM ⑀-aminon-caproic acid and 50 mM Bis-Tris, pH 7.0 was run in anode buVer (0,5 M Bis-Tris, pH 7.0) for about 6 h at 15 mA in a cooled gel chamber (Hoefer, SE600). Cathode buVer

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

contained 0.5 M Tricine, 0.15 M Bis-Tris, pH 7.0 and 0.02% Coomassie brilliant blue G250. After 1.5 h the cathode buVer was changed to the same buVer without Coomassie and the gel run was Wnished at 600 V. As reference HMW Native marker (GE Healthcare) was used. Before blotting on a PVDF membrane (Millipore) the gel was incubated for 5 min in SDS buVer (25 mM Tris, 0.19 M glycine and 1% SDS). After Western blotting immunodecoration was performed according to standard procedure using a monoclonal antibody against Hsp78. Protein bands were visualized by using Lumi-LightPlus (Roche) Western blotting substrate. Protein complexes containing radiolabeled subunits were detected by autoradiography using the PhosphorImager technology (GE Healthcare). 2.4. Sucrose gradient analysis Linear sucrose gradients were prepared with a gradient mixer from two buVer solutions (0.4% [w/v] digitonin, 20 mM Tris/HCl, pH 7.4, 300 mM NaCl, 1 mM PMSF and protease inhibitors [Roche]) containing 25% (w/v) or 0% (w/v) sucrose, respectively. Five hundred micrograms of mitochondria were solubilized in 300 l lysis buVer (1% [w/v] digitonin, 20 mM Tris/HCl, pH 7.4, 50 mM NaCl, 10% [v/v] glycerol and 1 mM PMSF) containing 3 mM ATP and 5 mM MgCl2. Non-solubilized material was removed by 15 min centrifugation at 21 000g. Supernatants were loaded on the sucrose gradients, followed by 20 h centrifugation at 210 000g. Collected fractions were precipitated using Strata Clean Resin (Stratagene) and analyzed by SDS–PAGE and Western blotting. SpeciWc antibodies against Hsp78, Tom40, Tim23 and Tim11 were used for immunodetection. Signals were visualized with chemiluminescence detection reagent (ECL, GE Biosciences). 2.5. PuriWcation of Hsp78 The yeast strain KRY04 (MATa, ade2-101, his3-200, leu2-1, ura3-52, trp1-63, lys2-801, HSP78-6£HIS ::KanMX) expressing Hsp78 with a hexahistidine tag from its authentic chromosomal location, was generated by a genomic insertion of a PCR-generated DNA fragment (Knop et al., 1999) containing a part of the HSP78 gene with a C-terminal hexahistidine extension into the wildtype strain YPH499. For overexpression, the HSP786£HIS gene from the yeast strain KRY04 was cloned by a PCR-based method into the yeast 2  vector pRS426, generating plasmid pKR08. Plasmid pKR08 was then transformed into KRY04, resulting in a strain containing multiple copies of HSP78-6£HIS. Ten milligrams of mitochondria isolated from strain KRY04 were resuspended in 4 ml lysis buVer (0.3% Triton X-100, 30 mM Tris/HCl, pH 7.4, 100 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol [DTT], 5% glycerol, 20 mM imidazole and protease inhibitors) and lysed by vigorous shaking for 10 min at 4 °C. After centrifugation for 5 min at 21 000g, the soluble fraction was incubated with 300 l

153

Ni–NTA beads (Qiagen) for 30 min at 4 °C. The beads were applied to a small gravity Xow column. Unbound material was removed by addition of 3 ml wash buVer (30 mM Tris/ HCl, pH 7.4, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, 5% glycerol, 20 mM imidazole and protease inhibitors). Bound proteins were eluted with elution buVer (30 mM Tris/HCl, pH 7.4, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, 5% glycerol, 250 mM imidazole, protease inhibitors) in 500 l fractions. Elution fractions were combined and concentrated using a microconcentrator (Millipore) and stored at ¡80 °C. 2.6. Chemical crosslinking Thirty micrograms of isolated yeast mitochondria were suspended in 200 l SM buVer (250 mM sucrose, 10 mM MOPS/KOH, pH 7.4) supplied with either 1 mM EDTA or 25 mM MgCl2 and 3 mM ATP as indicated and incubated for 15–20 min at 4 °C (Fig. 7A) or for 5 min at 30 °C. Crosslinking was performed by an incubation with 250 M disuccinimidyl suberate (DSS) or 1 mM disuccinimidyl glutarate (DSG) for 30 min at 4 °C. Both crosslinking reagents were dissolved in dimethylsulfoxid (DMSO) as 25 mM stock solutions. In the control DMSO without crosslinker was added. 25 mM Tris/HCl, pH 7.4 was added for quenching, followed by 15 min incubation on ice. For crosslinking experiments in E. coli (strain: BE21DE3) 0.1 OD/ml cells were resuspended in 200 l SEM buVer and incubated 5 min at 30 °C before adding the crosslinker as described above. Samples were analyzed by SDS–PAGE using a 4–10% gradient gel followed by Western blot using antibodies directed against Hsp78 or ClpB. For crosslinking of puriWed proteins in vitro, 10 g of puriWed Hsp78 were incubated for 5 min at 30 °C in 100 l SEM buVer (250 mM sucrose, 1 mM EDTA and 1 mM MOPS/KOH, pH 7.4). Crosslinking was started by addition of either 1 mM DSG or 1% glutaraldehyde and incubated for 30 min on ice. The reaction was stopped by addition of 25 mM Tris/HCl, pH 7.4 and incubation for another 15 min. Samples were then precipitated with 10% trichloroacetic acid and analyzed by SDS–PAGE on a 4–10% gradient gel followed by Western blot and immunodecoration with antibodies directed against Hsp78. Crosslinking experiments with puriWed ClpB using glutaraldehyde were done as previously described (Mogk et al., 2003). For DSS- and DSG-crosslinking, 1 g of puriWed ClpB was incubated for 5 min at 30 °C in 100 l of 2 mM MOPS/KOH pH 7.4 as described above for Hsp78. The Western blot was decorated with antibodies against ClpB. 3. Results and discussion 3.1. Determination of the native N-terminus of mitochondrial Hsp78 The chaperone Hsp78 of the yeast S. cerevisiae is encoded by a nuclear gene. It is synthesized as a cytosolic

154

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

precursor protein with an N-terminal extension serving as targeting signal for the post-translational import into the mitochondrial matrix. To compare the primary structure of Hsp78 to other ClpB-like chaperones it was necessary to determine the processing site where the mitochondrial processing peptidase (MPP) removes the N-terminal targeting sequence and the mature enzyme is formed. We generated the native precursor form of Hsp78 by in vitro transcription/translation and imported the radiolabeled preprotein into isolated mitochondria (Fig. 1A). Import of the Hsp78 precursor into isolated mitochondria was eYcient and dependent on the presence of an inner membrane potential  as expected for a matrix-localized enzyme. We observed a decrease in molecular weight, corresponding to the removal of the targeting signal, resulting in the mature form of Hsp78 (Fig. 1A, lanes 1–4). The SDS–PAGE migration behavior of the imported radiolabeled mature form was identical to the endogenous protein as assayed by Western blot (data not shown).

However, the exact N-terminus generated by the mitochondrial processing reaction had not been established so far. We performed N-terminal sequencing reactions with Hsp78 puriWed from yeast mitochondria but repeatedly failed to obtain sequence information. Although no general consensus sequence for mitochondrial targeting sequences exists, we used published criteria to search the amino acid sequence of Hsp78 for potential MPP processing sites (Gakh et al., 2002). We selected four candidate sites where an arginine residue is followed by a bulky hydrophobic residue. To determine the native processing site we performed a direct comparison of the SDS–PAGE migration behavior of the mature form after import with that of artiWcially generated protein fragments (Fig. 1A, lanes 5–8). The size of these fragments corresponded to polypeptides that would be generated by an MPP-mediated cleavage at the candidate processing sites. The SDS–PAGE migration of the mature form after import was most similar to the fragment starting at amino acid (aa) 88 (f88) of the Hsp78 precursor (Fig. 1A).

A

B

Fig. 1. Determination of the N-terminus of mature Hsp78. (A) Size comparison of imported Hsp78 and shortened Hsp78 constructs by SDS–PAGE. The radiolabeled precursor form of yeast Hsp78 was imported into isolated mitochondria in the presence or absence of a mitochondrial inner membrane potential (). After import, mitochondria were treated with proteinase K (PK) to remove non-imported precursor proteins. Indicated are the precursor (p) and the processed mature (m) form of Hsp78 (left panel). Radiolabeled shortened protein fragments lacking the Wrst 27 (f28), 81 (f82), 87 (f88) or 111 (f112) amino acids of the Hsp78 precursor sequence were analyzed on the same SDS–PAGE gel together with the full-length protein (right panel). (B) Sequence alignment showing the N-termini of bacterial ClpB, ClpBN, the Hsp78 precursor (Hsp78 (p)) and the shortened Hsp78 constructs f28, f82, f88 and f112. The Wrst amino acids of ClpBN and the construct f88 are indicated by a box.

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

155

In summary, with about 51% identity, the overall amino acid sequence conservation between the short form of ClpB and Hsp78 (excluding the targeting sequence) is very high. In contrast to the situation in E. coli, where a mixture of long and short form of ClpB is expressed, mitochondria contain only one type of a ClpB-type chaperone that does not contain an N-terminal domain. All other subdomains of Hsp78, including the two nucleotide-binding AAA domains and the linker domain, are arranged in the identical fashion to the bacterial ClpB (Fig. 2).

Due to the resolution limit of the procedure, an alternative processing site at the neighboring aa 82 (f82) cannot be completely excluded. Interestingly, in both cases the start of the mature part of the mitochondrial Hsp78 would almost exactly correspond to the smaller form of the bacterial ClpB (ClpBN) that is produced in E. coli from an alternative translation start site and lacks the N-terminal substratebinding domain (Fig. 1B). Besides the full-length protein, the in vitro transcription/translation of Hsp78 usually yielded an additional translation product that was generated by initiation at the second in-frame ATG corresponding to aa87 (Fig. 1A, lane 9). This fragment cannot be imported due to the absence of a targeting signal. The analysis of the mitochondrial processing site in combination with the sequence comparison with Hsp78s from other species (see below) strongly indicated that mitochondrial ClpBs generally do not contain an N-terminal substrate-binding domain. In that respect, they exclusively resemble the shortened form of the bacterial ClpB (ClpBN). Interestingly, the functional relationship of the two forms in bacteria and the importance of the N-terminal domain in the resolubilization of aggregated proteins are not yet entirely clear. Concerning the mechanistic role of the N-terminal domain, the existence of ClpB subtypes in mitochondria that constitutively lack the N-terminal domain while retaining the ability to confer thermoprotection needs to be considered. A recent report proposed that the requirement for the presence of an N-terminal domain during disaggregation is related to the aggregate size of the used substrate proteins (Barnett et al., 2005). Another possibility is that the requirement for the presence of an N-terminal domain is related to diVerent types of protein substrates. Most of the studies concerning the disaggregation activity of ClpB have been so far performed in vitro with a limited set of standard substrate proteins. A determination of the endogenous substrate range of the mitochondrial Hsp78 would certainly contribute to the deWnition of the functional signiWcance of the N-terminal domain of ClpB proteins under in vivo conditions.

3.2. IdentiWcation of other eukaryotic Hsp78 homologs Although homologs of the ClpB-type chaperones are widespread in the bacterial kingdom, mitochondrial homologs have only been identiWed unequivocally in fungal species. We performed an extensive sequence comparison to identify potential mitochondrial ClpB chaperones in other eukaryotic organisms and to compare their primary structure to the yeast Hsp78 (Fig. 3). Several species of unicellular lower eukaryotes like Trypanosoma brucei or Dictyostelium discoideum contain two types of ClpB homologs. One protein in each of these species shows a very high sequence similarity to the fungal Hsp78 and most likely represents the mitochondrial ClpB homolog. Their accession numbers according to the UniProt database (www.pir.uniprot.org) are Q7YVC9 in T. brucei and Q54I27 in D. discoideum. A high sequence variability at the N-terminus indicates the presence of a mitochondrial targeting sequence. The ClpB homologs from these species do not contain an N-terminal domain similar to the fungal Hsp78s. Mammalian mitochondria as well as mitochondria from any multicellular species, as far as genome information is available, do not seem to contain an Hsp78 homolog with the potential exception of plants. The genome of the model plant species Arabidopsis thaliana contains multiple copies of ClpB-related proteins. While a cytosolic member called Hsp101, a homolog of the yeast Hsp104 protein, could be readily identiWed (P42730), the

Hsp78 S. cerevisiae Presequence

AAA-1

M-domain

N

AAA-2

C

linker 1

97

A

B

267

344

465 482

A

B

706

811

ClpB E. coli N-term. domain

M-domain

AAA-1

N

AAA-2

C

linker 1

159

A

B

341

409

528 546

A

B

766

857

ClpA E. coli AAA-2

AAA-1

C

N 1

165

A

B

351

409

528 444

A

B

653

758

Fig. 2. Structural composition of the mitochondrial ClpB homolog Hsp78 and related chaperones. Schematic drawing of the primary structures of yeast Hsp78, as well as of the chaperones ClpB and ClpA from Escherichia coli. The conserved protein domains are indicated in diVerent shades of grey. The letters A and B depict the localization of the Walker A and B motifs. The numbers of the amino acid residues corresponding to the domains as deWned by the 3D-structure of ClpB from Thermus thermophilus (Lee et al., 2003) are given.

156

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

Fig. 3. Amino acid sequence alignment of potential eukaryotic Hsp78 homologs. Amino acid sequences of the Hsp78 proteins from Saccharomyces cerevisiae (P33416) and Schizosaccharomyces pombe (O74402) were aligned with the candidate mitochondrial proteins Q7YVC9 (Trypanosoma brucei), Q54I27 (Dictyostelium discoideum), P42762 (Arabidopsis thaliana) and Q6H795 (Oryza sativa) using the ClustalW algorithm. For comparison, the bacterial sequences of ClpB homologs from Escherichia coli (P63284), Bacillus subtilis (ClpC; P37571) are shown. Chloroplast homologs of ClpB are represented by the sequence of a chloroplast Hsp100 from Phaseolus lunatus (Q9LLI0) and by ClpB2 (P74361) from the cyanobacterium Synechocystis sp. (strain PCC 6803). Amino acids matching the consensus sequence by two distance units were shaded black. The conserved domain structure of Hsp100/Clp chaperones is indicated in the same shades of gray as shown in Fig. 2 except for the N-terminal substrate-binding domain that overlaps in the alignment with the presequence of the mitochondrial Hsp78s.

assignment of organellar members in plants is problematic. A subset of the Clp homologs in plants can be clearly assigned as chloroplast proteins based on the prediction of

N-terminal signal sequences using the program PSort (wolfpsort.seq.cbrc.jp). This intracellular localization is substantiated by the high sequence conservation with a

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

conWrmed chloroplast Hsp100 from the lima bean Phaseolus lunatus (Q9LLI0) and with cyanobacterial homologs of ClpB (P74361). The chloroplast ClpBs exhibit a long N-terminal extension with a low amino acid conservation that is missing in ClpBs from both E. coli and cyanobacteria and most likely serves as a targeting signal. They show a high overall sequence conservation with bacterial family members but contain a clear N-terminal substrate-binding domain in contrast to the fungal mitochondrial Hsp78. One member of the plant ClpB-like proteins in Arabidopsis (P42762) and the related protein from rice (Oryza sativa, Q6H795) were predicted by PSort to have a weak mitochondrial targeting signal or to possibly exhibit a dual localization in mitochondria and chloroplast. A sequence comparison with the fungal Hsp78s showed that the sequences are related and may represent the plant orthologs of Hsp78. However, the comparison of the primary sequences revealed considerable structural diVerences to both fungal and bacterial ClpBs (Fig. 3). Although they contain a quite well conserved N-terminal domain, a large linker is inserted between this domain and the AAA-1 domain. In addition, they show a high sequence divergence in the M-domain connecting both AAA modules. In general, the M-domain is much shorter compared to other ClpBs but not absent like in ClpA (Fig. 2). These properties are reminiscent of the protein ClpC that represents the ClpB homolog of Bacillus subtilis. Based on these structural diVerences to the genuine mitochondrial Hsp78s combined with the low prediction score for the targeting signals, an assignment as plant mitochondrial Hsp78s remains problematic in the absence of direct biochemical evidences. Irrespectively of their subcellular localization, the two proteins from Arabidopsis and rice together with the ClpC from B. subtilis may represent a novel subclass of ClpB-type chaperones. 3.3. Structural comparison of Hsp78 with the bacterial ClpB Based on the high conservation of the primary structure we were able to model the three-dimensional structure of the Hsp78 complex from the published structure of ClpB from T. thermophilus (Schwede et al., 2003). We generated a surface representation of the Hsp78 model structure and determined the amino acid conservation in comparison with the bacterial ClpB from E. coli (Fig. 4). In particular the amino acids forming the nucleotide-binding pockets and those involved in forming the subunit interface of a putative hexameric complex show a very high degree of similarity (blue). Also two tyrosine residues, Tyr188 and Tyr589, proposed to be involved in substrate interaction in ClpB (Schlieker et al., 2004), are well conserved (Fig. 4A, shown in pink). A lower overall degree of conservation has been observed in the extended helical coiled-coil domain that is formed by the M-domain. Especially the amino acids on the surface that are facing the solvent environment show a lower degree of conservation (Fig. 4B). Due to the exposure of the M-domain to the environment of the chaperone complex, the requirements for a structural conservation are

157

probably less stringent. In addition, the M-domain may provide interaction sites with substrate proteins that may be diVerent between bacteria and mitochondria. Since the N-terminal domain is missing in Hsp78, the amino acids at the ClpB domain interface are not well conserved in Hsp78. A similar low degree of conserved amino acids exposed at the surface can be observed in the part of the molecule that is formed by the very C-terminal segment (Fig. 4C). Since a pronounced species speciWcity has been noted for the interaction behavior of ClpB-type proteins with their corresponding Hsp70 chaperones (Krzewska et al., 2001b), it is tempting to speculate that the C-terminal domain may provide the site for Hsp70 interaction. We also generated a map of the electrostatic surface potential of Hsp78 and compared it to ClpB from E. coli (Fig. 5). In general, the surface potential of Hsp78 (Fig. 5A) is slightly negative, especially in the M-domain. Two structural diVerences to the ClpB surface potential (Fig. 5B) have to be noted. First, a region near the proposed central pore of the ClpB hexamer that is potentially involved in substrate binding is neutral or slightly acidic in ClpB but has a pronounced negative charge in Hsp78 (see below). Second, the base of the Hsp78 monomer, near the C-terminal end of the polypeptide, is signiWcantly more positive than in ClpB. This is correlated to the lower sequence conservation in this domain. Electron microscope images of puriWed Hsp78 revealed a hexameric barrel-shaped protein complex similar to the structure of the oligomeric ClpB complex (Krzewska et al., 2001a). We therefore modeled a hypothetical hexameric complex of Hsp78 and compared it to the ClpB structure (Fig. 5C). In principle, the Hsp78 monomer can be readily assembled into a hexameric complex that is very similar to the corresponding ClpB structure. The monomer interface sites in Hsp78 show a complementary electrostatic potential, indicating that the complex formation is governed by interactions of charged amino acids. Interestingly, the central pore of the hexameric complex (Fig. 4A) shows a more pronounced negative potential, a feature that is not so evident in ClpB. However, especially at this putative substrate interaction site the modeling approach must be regarded with caution since the amino acids of the AAA-1 domain facing the pore have not been resolved in the published ClpB structure (1QVR) (Lee et al., 2003). Indeed, the modeling procedure of Hsp78 yielded a quite diVerent arrangement of amino acid side chains at the pore site compared to the ClpB models. In the Hsp78 model the pore is almost completely obstructed by the side chain of Arg189. This apparent discrepancy may indicate a certain structural variability or Xexibility at the pore site of the hexamer complex. The interpretation of the mechanistic role of the amino acids forming the pore site requires the future solution of the three-dimensional structure of the full oligomeric complex. 3.4. Analysis of Hsp78 complex formation in vivo A biochemical analysis of the quaternary structure of Hsp78 has been exclusively performed so far using the

158

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

Fig. 4. Model of the Hsp78 monomer structure in comparison with ClpB from E. coli. The three-dimensional structure of yeast mitochondrial Hsp78 was generated by homology-modeling as described in Section 2. The molecular surface structure of Hsp78 was generated with the Deep View Swiss PDB viewer software. A structural alignment with the modeled structure of Escherichia coli ClpB was generated. The Hsp78 structure is shown from the following orientations: front (A), representing the view from the inside of a hypothetical hexamer; back (B); bottom (C) and top (D). Surface residues were colored from blue to red according to the amino acid sequence conservation with ClpB from E. coli. The two nucleotides bound to the AAA modules are shown as space-Wlled models. The structure and localization of the N-terminal domain of ClpB that is missing in Hsp78 is shown in red. The conserved residues Tyr188 and Tyr589 that have been implicated in substrate interaction in ClpB are indicated in pink.

puriWed proteins under in vitro conditions. Here, Hsp78 behaved very similar to its bacterial homolog, forming a hexameric complex at high protein concentrations in the presence of ATP (Krzewska et al., 2001a). However, it showed considerable variability of subunit composition under other conditions. We were interested which type of complex is present under in vivo conditions in intact yeast mitochondria. We imported radiolabeled Hsp78 precursor proteins into intact mitochondria and analyzed its complex formation by blue-native gel electrophoresis (BN–PAGE). Mitochondria were lysed under native buVer conditions using the weak detergent digitonin. In the BN–PAGE procedure, protein complexes are separated according to their molecular weight under non-denaturing conditions (Fig. 6A). Surprisingly, we observed a signal for the radiolabeled Hsp78 in the

BN–PAGE at an apparent molecular weight of about 220 kDa that would correspond at most to a trimeric complex. Protein import and solubilization of the mitochondria were performed in the presence of ATP to stabilize a potential hexameric complex. The formation of the trimeric protein complex from newly imported Hsp78 precursors was very fast and independent of the presence of already preassembled Hsp78 complexes since no diVerence was observed in hsp78 mitochondria (Fig. 6A, upper panel). We also assayed the complex size of endogenous Hsp78 under the identical conditions by Western blot. The size of the endogenous Hsp78 complex corresponded exactly to that assembled from the imported radiolabeled proteins, demonstrating that the observation of a small complex size is not an artifact of the import reaction (Fig. 6A, lower panel).

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

159

Fig. 5. Electrostatic surface potential and hypothetical hexameric structure of Hsp78. Surface representations of the monomer model structures of yeast Hsp78 (A) and E. coli ClpB (B) were generated as described in the legend of Fig. 3 and colored according to the electrostatic surface potential calculated with the help of the Deep View Swiss PDB viewer software. The arrow indicates the region of the molecule that is near the entrance pore to the hexameric ClpB complex. (C) A hypothetical model of an Hsp78 hexamer was generated as described in Section 2. One monomer has been omitted to allow a view of the inner surface of the putative substrate-binding channel. The structure is colored according to the electrostatic surface potential (red: acidic, blue: basic).

Still, the possibility cannot be excluded that a relatively instable hexameric complex of Hsp78 in mitochondria dissociated during the used electrophoresis procedure. We therefore employed a more gentle separation method, sucrose density gradient centrifugation, for assessing the size of the mitochondrial Hsp78 complex. We solubilized mitochondria under native conditions in the presence of ATP using digitonin and immediately separated the material on a 0–25% sucrose gradient by ultracentrifugation. After the centrifugation, the gradient was fractionated and the presence of Hsp78 and control proteins was assessed by SDS–PAGE and Western blot (Fig. 6B). We found the protein signal for Hsp78 in fractions near the top of the gradient representing low molecular weight protein

complexes. For comparison, we tested the mitochondrial outer membrane protein Tom40 that is present in a 400 kDa protein complex, the inner mitochondrial membrane protein Tim23 with a complex size between 250 and 300 kDa, and Tim11, which is a subunit of the F1Fo-ATPase, having a complex size of more than 600 kDa (Chacinska et al., 2003). The apparent size of the Hsp78 complex is smaller than the Tim23 protein complex and corresponds therefore almost exactly to the size of 220 kDa that was determined by the BN–PAGE experiments. Finally, to exclude that a potential dissociation of the Hsp78 complex is caused by the detergent solubilization of the mitochondria, we used a chemical crosslinking approach to characterize the oligomerization of Hsp78 in

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

WT 60

30 60

60

+ PK 0

– PK 30 60

+ PK 60 0

30 60

import (min)

0

– PK

60 0

A

30 60

160

+ + + –+ + + – + + + – + + + –

MW (kDa) 669 440 232

Autoradiography

140

66 669 440 Immunodecoration with anti-Hsp78

232

140

66

B approx. MW (kDa)

250-300

400

> 600

Hsp78 Tom40 Tim23 Tim11 top

bottom

Fig. 6. Assembly of Hsp78 oligomers in intact mitochondria. (A) Analysis of Hsp78 complex formation by blue-native gel electrophoresis (BN–PAGE). Radiolabeled Hsp78 precursor was imported into wild-type (left panel) and hsp78 (right panel) mitochondria for the indicated time periods in the presence or absence of a membrane potential (). After import and proteinase K (PK) treatment mitochondria were further analyzed by BN–PAGE and autoradiography (upper panel). Western blot and immunodecoration of the experiment with antibodies against Hsp78 are shown in the lower panel. (B) Sucrose density gradient analysis of mitochondrial protein complexes. Solubilized mitochondria were separated in the presence of ATP by centrifugation through a 0–25% sucrose gradient, fractionated and analyzed by SDS–PAGE and Western blot. Shown are immunodecorations with antisera against Hsp78, Tom40, Tim23 and Tim11. Approximate molecular weights are indicated.

intact mitochondria. Isolated mitochondria were incubated under diVerent conditions with a membrane permeable crosslinker, disuccinimidyl suberate (DSS). After the incubation, the mitochondria were reisolated and their proteins separated by SDS–PAGE. Hsp78 and any higher molecular weight complexes represented by its crosslinking products were detected by Western blot and immunodecoration with speciWc anti-Hsp78 antibodies (Fig. 7A). Apart from the monomer band running at about 80 kDa we observed several bands with higher molecular weights corresponding to protein complexes of

Hsp78. A band of about 150–160 kDa would correspond to the size of an Hsp78 dimer, while the band at 220 kDa most likely represented the trimeric form of the Hsp78 protein complex. The observation of a putative Hsp78 trimer was in very good agreement with both the BN–PAGE and the sucrose density gradient experiments that showed protein complexes of similar sizes. We observed an additional crosslinking product at about 180 kDa that did not correspond to the size of a homo-oligomeric complex but possibly represented the interaction of Hsp78 with an unidentiWed protein in mitochondria. The eYciency of

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164 1

A

2

3

161

4 MW (kDa)

Trimer

205

Dimer 116 97

Monomer

– S – – – + +

S B

1 2

3

CL ATP

C

4 5 6

1 2

3

4 5 6

MW (kDa)

MW (kDa)

500

500

290 240

290 240

Trimer

Trimer Dimer

160

Dimer

116

*

160 116

*

97

97

Monomer

Monomer

66

66

short exp.

Hsp78

– S G – S G CL

– – – + + +

hs

short exp.

Hsp78

– S G – S G CL WT

OE

Fig. 7. Oligomerization of endogenous mitochondrial Hsp78 analyzed by chemical crosslinking. (A) Crosslinking of Hsp78 protein complexes in intact wild-type mitochondria. Mitochondria were incubated in buVer containing 25 mM MgCl2 in the presence (+) or absence (¡) of ATP and/or the crosslinking (CL) agent DSS (S). (B and C) Mitochondria were resuspended in SM buVer containing ATP-regenerating system (3 mM ATP, 20 mM creatine phosphate, 100 g/ml creatine kinase) and 25 mM MgCl2. Crosslinking was performed with DSS (S) or DSG (G) as described in Section 2. (B) Crosslinks of Hsp78 in mitochondria isolated from yeast cells with or without a 4 h heat treatment (hs) at 42 °C. Up-regulation of Hsp78 due to heat stress can be seen in the lower panel (short exp.). (C) Crosslinking in mitochondria containing a genomic copy of Hsp78-6£His (WT) and mitochondria overexpressing Hsp78-6£His (OE). Proteins were separated by SDS–PAGE and Hsp78-containing protein bands were detected by Western blot and immunodecoration using antibodies against Hsp78. Approximate molecular weights and proposed oligomeric states of the Hsp78-speciWc signals are indicated. An unspeciWc cross-reactivity of the Hsp78 serum is marked with an asterisk (¤).

oligomer formation was inXuenced by the nucleotide present in the incubation buVer. While only small amounts of dimer or trimer forms were detected in the absence of ATP, the amounts of both dimeric and trimeric complexes increased in the presence of MgATP. However, the general pattern of crosslinking bands did not change. It should be noted that the presence of nucleotides in the incubation buVer can only indirectly inXuence their concentrations in the matrix compartment of intact mitochondria. Even in the absence of nucleotide in the buVer residual amounts of endogenous ATP remain. The crosslinking experiments in intact mitochondria again failed to detect the presence of a hexameric complex of Hsp78.

Since formation of the ClpB hexamer has been shown to be dependent on the concentration of the protein in solution we asked if an increase in the mitochondrial Hsp78 concentration would yield a hexamer signal. We used two approaches to elevate the amount of Hsp78. Since Hsp78 is a heat shock protein we Wrst pre-incubated the yeast cells for 4 h at 42 °C and isolated mitochondria from these heat-shocked cells (Fig. 7B). Second, we used a strain containing a multicopy (2) plasmid encoding a hexahistidine-tagged version of Hsp78 (Fig. 7C). Although the mitochondria contained signiWcantly increased amounts of Hsp78 in both cases (Fig. 7B and C, short exposures), again no high molecular weight signals

162

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

A

1

2

3

4

5 MW (kDa)

Hexamer

500

Trimers

290 240

Dimers 160 116 97

ClpB

– S G – A ClpB B

1

2

3

4

5

Hexamer

MW (kDa) 500

CL

6

7

Hexamer

290 240

Trimers

Trimer Dimers Dimer 160 116

*

97

ClpB

Monomer 66

– G A Hsp78

– G mito.

– G CL bac.

Fig. 8. Crosslink of puriWed Hsp78 and its bacterial homolog ClpB in vitro and under in vivo conditions. PuriWed proteins, cells or organelles were suspended in SM buVer containing 1 mM EDTA and incubated 5 min at 30 °C before the crosslinking was started as described in Section 2. Crosslinking reagents (CL) were used as indicated: DSS (S), DSG (G) or glutaraldehyde (A). Approximate molecular weights and putative oligomeric states are indicated. (A) Crosslinking of puriWed ClpB. (B) Crosslinking of puriWed Hsp78 (lanes 1–3) compared with isolated yeast mitochondria (mito., lanes 4 and 5) and intact E. coli cells (bac., lanes 6 and 7).

corresponding to a hexamer could be detected. In contrast, the amounts of the dimeric and trimeric complexes increased signiWcantly in the Hsp78 overproduction mitochondria. Additionally, we tested a diVerent crosslinking agent, disuccinimidyl glutarate (DSG), which has the same reactive groups as DSS but a smaller linker length. DSG crosslinking gave the identical pattern but was signiWcantly more eYcient than DSS. In some crosslinking experiments a broad signal in the range between 300 and 380 kDa was observed with variable intensities (e.g., Fig. 7C, lane 3). Similar signals were also observed with ClpB in E. coli cells (Fig. 8B, lane 7). Although this signal is too small for a hexameric complex, it may represent a larger oligomeric state of unknown functional signiWcance.

The absence of a hexameric form of Hsp78 in intact mitochondria was surprising since biochemical studies using the puriWed chaperones indicated that the hexameric complex was the major form present under in vitro conditions, both for bacterial ClpB and mitochondrial Hsp78. We therefore asked if our crosslinking procedure was capable to identify a hexamer complex at all. We used puriWed ClpB from E. coli and performed crosslinking assays under the same conditions and compared the results with published procedures (Mogk et al., 2003). Unexpectedly, the crosslinking assays with puriWed ClpB yielded many higher molecular weight signals in the range between 160 and 290 kDa that could not be assigned unequivocally to speciWc dimeric or trimeric forms. However, especially in comparison with the standard procedure using glutaraldehyde

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

as crosslinking agent, a signal for the hexameric complex at about 500 kDa could be clearly identiWed (Fig. 8A). We repeated the crosslinking test with Hsp78 that was puriWed from mitochondria with the help of a hexahistidine tag. Previous experiments using intact mitochondria demonstrated that the tagged version of Hsp78 behaves identical to the wild-type protein in disaggregation and degradation assays (B.J. and W.V., unpublished). Similar to ClpB, crosslinking of the puriWed Hsp78 with DSG or glutaraldehyde in vitro resulted in the identiWcation of a signal at 500 kDa, corresponding to a hexameric complex (Fig. 8B, lanes 1–3). Although our crosslinking procedure is principally able to detect an Hsp78 hexamer, no signal at 500 kDa could be detected in mitochondria even after a prolonged exposure (Fig. 8B, lanes 4 and 5). As a further control, we asked if the ClpB hexamer could be detected by crosslinking in intact E. coli cells. Interestingly, the pattern of crosslinking products in E. coli cells was very similar to that of the puriWed ClpB. The complexity of the band pattern in the intermediate molecular weight range was even higher due to the additional presence of the short form ClpBN. Still, a signal above 500 kDa indicated the presence of the hexamer complex, although with a reduced eYciency compared to the puriWed protein (Fig. 8B, lane 7). Two conclusions can be drawn from this observation. First, under normal conditions the trimeric complex seemed to represent the major state of the Hsp78 chaperone in the mitochondrial matrix. Second, the behavior of ClpBtype chaperones concerning the formation of oligomeric protein complexes might be even more variable in vivo than was inferred from the experiments using puriWed ClpB. Although the used experimental approaches converge on a trimeric complex for the mitochondrial Hsp78, the possibility of a hexameric complex cannot be excluded completely. The hexamer could be formed only transiently or the complex may not be abundant enough to be detected with the methods used. The relatively minor signal for the ClpB hexamer in our crosslinking experiments of intact E. coli cells indicated that even the bacterial ClpBs might not exclusively exist in the hexamer form in vivo. Recent mechanistic studies performed in vitro clearly demonstrated that the disaggregation activity of ClpB was closely correlated with a hexameric organization of the subunits (Weibezahn et al., 2004). This indicated that the hexamer is probably also the active form of the chaperone in vivo. It is tempting to speculate that in the cellular environment the formation of an active hexameric chaperone complex may be an intrinsic aspect of the disaggregation mechanism. The functional signiWcance of the diVerent oligomeric complexes in vivo need to be addressed in future experiments. Acknowledgments We thank Dr. T. L. Mason for providing a monoclonal antiserum against mitochondrial Hsp78. Dr. A. Mogk generously provided puriWed ClpB from E. coli and an antiserum against bacterial ClpB. This work was supported by a

163

grant from the Deutsche Forschungsgemeinschaft (DFG) for W.V. (Schwerpunktprogramm 1132, Vo 657/4-2). References Akoev, V., Gogol, E.P., Barnett, M.E., Zolkiewski, M., 2004. Nucleotideinduced switch in oligomerization of the AAA+ ATPase ClpB. Protein Sci. 13, 567–574. Barnett, M.E., Nagy, M., Kedzierska, S., Zolkiewski, M., 2005. The aminoterminal domain of ClpB supports binding to strongly aggregated proteins. J. Biol. Chem. 280, 34940–34945. Barnett, M.E., Zolkiewska, A., Zolkiewski, M., 2000. Structure and activity of ClpB from Escherichia coli. Role of the amino- and -carboxyl-terminal domains. J. Biol. Chem. 275, 37565–37571. Bateman, J.M., Iacovino, M., Perlman, P.S., Butow, R.A., 2002. Mitochondrial DNA instability mutants of the bifunctional protein Ilv5p have altered organization in mitochondria and are targeted for degradation by Hsp78 and the Pim1p protease. J. Biol. Chem. 277, 47946–47953. Beinker, P., Schlee, S., Groemping, Y., Seidel, R., Reinstein, J., 2002. The N terminus of ClpB from Thermus thermophilus is not essential for the chaperone activity. J. Biol. Chem. 277, 47160–47166. Ben-Zvi, A.P., GoloubinoV, P., 2001. Mechanisms of disaggregation and refolding of stable protein aggregates by molecular chaperones. J. Struct. Biol. 135, 84–93. Chacinska, A., Rehling, P., Guiard, B., Frazier, A.E., Schulze-Specking, A., Pfanner, N., Voos, W., Meisinger, C., 2003. Mitochondrial translocation contact sites: separation of dynamic and stabilizing elements in formation of a TOM-TIM-preprotein supercomplex. EMBO J. 22, 5370–5381. Chow, I.T., Barnett, M.E., Zolkiewski, M., Baneyx, F., 2005. The N-terminal domain of Escherichia coli ClpB enhances chaperone function. FEBS Lett. 579, 4242–4248. Gakh, O., Cavadini, P., Isaya, G., 2002. Mitochondrial processing peptidases. Biochim. Biophys. Acta 1592, 63–77. Germaniuk, A., Liberek, K., Marszalek, J., 2002. A bichaperone (Hsp70– Hsp78) system restores mitochondrial DNA synthesis following thermal inactivation of Mip1p polymerase. J. Biol. Chem. 277, 27801–27808. Glover, J.R., Lindquist, S., 1998. Hsp104, Hsp70, and Hsp40: a novel chaperone system that rescues previously aggregated proteins. Cell 94, 73–82. GoloubinoV, P., Mogk, A., Zvi, A.P., Tomoyasu, T., Bukau, B., 1999. Sequential mechanism of solubilization and refolding of stable protein aggregates by a bichaperone network. Proc. Natl. Acad. Sci. USA 96, 13732–13737. Hartl, F.U., Hayer-Hartl, M., 2002. Molecular chaperones in the cytosol: from nascent chain to folded protein. Science 295, 1852–1858. Huyton, T., Pye, V.E., Briggs, L.C., Flynn, T.C., Beuron, F., Kondo, H., Ma, J., Zhang, X., Freemont, P.S., 2003. The crystal structure of murine p97/VCP at 3.6 A. J. Struct. Biol. 144, 337–348. Knop, M., Siegers, K., Pereira, G., Zachariae, W., Winsor, B., Nasmyth, K., Schiebel, E., 1999. Epitope tagging of yeast genes using a PCR-based strategy: more tags and improved practical routines. Yeast 15, 963–972. Krzewska, J., Konopa, G., Liberek, K., 2001a. Importance of two ATPbinding sites for oligomerization, ATPase activity and chaperone function of mitochondrial Hsp78 protein. J. Mol. Biol. 314, 901–910. Krzewska, J., Langer, T., Liberek, K., 2001b. Mitochondrial Hsp78, a member of the Clp/Hsp100 family in Saccharomyces cerevisiae, cooperates with Hsp70 in protein refolding. FEBS Lett. 489, 92–96. Lee, S., Sowa, M.E., Choi, J.M., Tsai, F.T., 2004. The ClpB/Hsp104 molecular chaperone—a protein disaggregating machine. J. Struct. Biol. 146, 99–105. Lee, S., Sowa, M.E., Watanabe, Y., Sigler, P.B., Chiu, W., Yoshida, M., Tsai, F.T., 2003. The structure of ClpB. A molecular chaperone that rescues proteins from an aggregated state. Cell 115, 229–240. Leonhardt, S.A., Fearon, K., Danese, P.N., Mason, T.L., 1993. HSP78 encodes a yeast mitochondrial heat shock protein in the Clp family of ATP-dependent proteases. Mol. Cell. Biol. 13, 6304–6313. Li, J., Sha, B., 2002. Crystal structure of E. coli Hsp100 ClpB nucleotidebinding domain 1 (NBD1) and mechanistic studies on ClpB ATPase activity. J. Mol. Biol. 318, 1127–1137.

164

C. Leidhold et al. / Journal of Structural Biology 156 (2006) 149–164

Lupas, A.N., Martin, J., 2002. AAA proteins. Curr. Opin. Struct. Biol. 12, 746–753. Major, T., von Janowsky, B., Ruppert, T., Mogk, A., Voos, W., 2006. Proteomic analysis of mitochondrial protein turnover: identiWcation of novel substrate proteins of the matrix protease Pim1. Mol. Cell. Biol. 26, 762–776. Moczko, M., SchönWsch, B., Voos, W., Pfanner, N., Rassow, J., 1995. The mitochondrial ClpB homolog Hsp78 cooperates with matrix Hsp70 in maintenance of mitochondrial function. J. Mol. Biol. 254, 538–543. Mogk, A., Schlieker, C., Strub, C., Rist, W., Weibezahn, J., Bukau, B., 2003. Roles of individual domains and conserved motifs of the AAA+ chaperone ClpB in oligomerization, ATP hydrolysis, and chaperone activity. J. Biol. Chem. 278, 17615–17624. Mogk, A., Tomoyasu, T., GoloubinoV, P., Rüdiger, S., Roder, D., Langen, H., Bukau, B., 1999. IdentiWcation of thermolabile Escherichia coli proteins: prevention and reversion of aggregation by DNAK and ClpB. EMBO J. 18, 6934–6949. Parsell, D.A., Lindquist, S., 1993. The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annu. Rev. Genet. 27, 437–496. Röttgers, K., Zufall, N., Guiard, B., Voos, W., 2002. The ClpB homolog Hsp78 is required for the eYcient degradation of proteins in the mitochondrial matrix. J. Biol. Chem. 277, 45829–45837. Ryan, M.T., Voos, W., Pfanner, N., 2001. Assaying protein import into mitochondria. Methods Cell Biol. 65, 189–215. Sauer, R.T., Bolon, D.N., Burton, B.M., Burton, R.E., Flynn, J.M., Grant, R.A., Hersch, G.L., Joshi, S.A., Kenniston, J.A., Levchenko, I., Neher, S.B., Oakes, E.S., Siddiqui, S.M., Wah, D.A., Baker, T.A., 2004. Sculpting the proteome with AAA(+) proteases and disassembly machines. Cell 119, 9–18. Schägger, H., von Jagow, G., 1991. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, 223–231. Schirmer, E.C., Glover, J.R., Singer, M.A., Lindquist, S., 1996. HSP100/Clp proteins: a common mechanism explains diverse functions. Trends Biochem. Sci. 21, 289–296.

Schlieker, C., Weibezahn, J., Patzelt, H., Tessarz, P., Strub, C., Zeth, K., Erbse, A., Schneider-Mergener, J., Chin, J.W., Schultz, P.G., Bukau, B., Mogk, A., 2004. Substrate recognition by the AAA+ chaperone ClpB. Nat. Struct. Mol. Biol. 11, 607–615. Schmitt, M., Neupert, W., Langer, T., 1995. Hsp78, a Clp homologue within mitochondria, can substitute for chaperone functions of mthsp70. EMBO J. 14, 3434–3444. Schmitt, M., Neupert, W., Langer, T., 1996. The molecular chaperone Hsp78 confers compartment-speciWc thermotolerance to mitochondria. J. Cell Biol. 134, 1375–1386. Schwede, T., Kopp, J., Guex, N., Peitsch, M.C., 2003. SWISS-MODEL: an automated protein homology-modeling server. Nucleic Acids Res. 31, 3381–3385. Suzuki, C.K., Suda, K., Wang, N., Schatz, G., 1994. Requirement for the yeast gene LON in intramitochondrial proteolysis and maintenance of respiration. Science 264, 273–276. von Janowsky, B., Knapp, K., Major, T., Krayl, M., Guiard, B., Voos, W., 2005. Structural properties of substrate proteins determine their proteolysis by the mitochondrial AAA+ protease Pim1. Biol. Chem. 386, 1307–1317. von Janowsky, B., Major, T., Knapp, K., Voos, W., 2006. The disaggregation activity of the mitochondrial ClpB homolog Hsp78 maintains Hsp70 function during heat stress. J. Mol. Biol. 357, 793–807. Voos, W., Röttgers, K., 2002. Molecular chaperones as essential mediators of mitochondrial biogenesis. Biochim. Biophys. Acta 1592, 51–62. Wawrzynow, A., Banecki, B., Zylicz, M., 1996. The Clp ATPases deWne a novel class of molecular chaperones. Mol. Microbiol. 21, 859–895. Weibezahn, J., Tessarz, P., Schlieker, C., Zahn, R., Maglica, Z., Lee, S., Zentgraf, H., Weber-Ban, E.U., Dougan, D.A., Tsai, F.T., Mogk, A., Bukau, B., 2004. Thermotolerance requires refolding of aggregated proteins by substrate translocation through the central pore of ClpB. Cell 119, 653–665. Zolkiewski, M., Kessel, M., Ginsburg, A., Maurizi, M.R., 1999. Nucleotidedependent oligomerization of ClpB from Escherichia coli. Protein Sci. 8, 1899–1903.